1. Field of the Invention
The invention relates generally to melanoma and more specifically to diagnosis and treatment of melanoma through microphthalmia-associated transcription factor (MITF) and activating transcription factor 2 (ATF2).
2. Background Information
Malignant melanoma is one of the most highly invasive and metastatic tumors and its incidence has been increasing at a higher rate than other cancers in recent years. Significant advances in understanding melanoma biology have been made over the past few years as a result of the identification of genetic changes along the MAPK signaling pathway. Those include mutations in BRAF, NRAS, KIT and GNAQ, all of which result in a constitutively active MAPK pathway. Consequently, corresponding transcription factor targets such as microphthalmia-associated transcription factor (MITF), AP2, and C-JUN and its heterodimeric partner ATF2 are activated and induce changes in cellular growth, motility and resistance to external stress. In addition, constitutively active MAPK/ERK causes rewiring of other signaling pathways. Among examples of rewired signaling is up-regulation of C-JUN expression and activity, which potentiates other pathways, including PDK1, AKT and PKC, and plays a critical role in melanoma development.
Activating transcription factor 2 (ATF2), a member of the bZIP family, is activated by stress kinases including JNK and p38 and is implicated in transcriptional regulation of immediate early genes regulating stress and DNA damage responses and expression of cell cycle control proteins. To activate transcription, ATF2 heterodimerizes with bZIP proteins, including C-JUN and CREB, both of which are constitutively up-regulated in melanomas. ATF2 is also implicated in the DNA damage response through phosphorylation by ATM/ATR. Knock-in mice expressing a form of ATF2 that cannot be phosphorylated by ATM are more susceptible to tumor development.
The transcription factor MITF, a master regulator of melanocyte development and biogenesis, has been shown to play a central role in melanocyte biology and in melanoma progression. Factors controlling MITF transcription have been well documented and include transcriptional activators, such as SOX10, CREB, PAX3, lymphoid enhancer-binding factor 1 (LEF1, also known as TCF), onecut domain 2 (ONECUT-2) and MITF itself, as well as factors that repress MITF transcription, including BRN2 and FOXD3. In addition, MITF is subject to several post translational modifications affecting its availability and activity, including acetylation, sumoylation and ubiquitination.
While previous studies indicate the presence of mutant BRAF in melanocytic lesions, as well as its effect on pigment gene expression, the role of MITF in early stages of melanoma development remains largely unexplored.
The present invention is based on the seminal discovery of the role of ATF2 in de novo melanoma formation and the mechanism underlying ATF2's contribution to melanoma development. Transcriptionally active ATF2 is important for melanoma development and loss of transcriptionally active ATF2 allows higher expression of MITF. ATF2 negatively regulates MITF expression, and several other important pigmentation genes, in melanocytes. ATF2 regulation of MITF transcription in melanocytes is mediated by discrete promoter elements such as SOX10, JunB, FOXD3, and the like.
In one aspect, provided herein is a method for the diagnosis or prognosis of melanoma in a subject including obtaining a nucleic acid sample from melanocytes of a subject suspected of having melanoma or at risk of having melanoma; detecting expression of activating transcription factor 2 (ATF2) and microphthalmia-associated transcription factor (MITF) in melanocytes; and determining a ratio of ATF2:MITF expression, thereby allowing diagnosis or prognosis of melanoma in the subject. In one aspect, detection of expression is a comparison of nuclear and cytoplasmic localization of ATF2 expression in melanocytes. In another aspect, an increased ratio of nuclear localization of ATF2:MITF expression in melanocytes is associated with metastatic melanoma, is provided.
In another aspect, a method of treating a melanocyte proliferative disorder in a subject including administering to the subject an effective amount of an agent that modulates the transcriptional activity of ATF2, thereby treating the disorder, is provided. In certain aspects, the agent inhibits the transcriptional activity of ATF2. In one embodiment, the agent that modulates the transcriptional activity of ATF2 increases the expression of MITF. In another embodiment, the agent that modulates the transcriptional activity of ATF2 further modulates the transcriptional activity of SOX10 or further modulates the activity of melanocyte pigmentation genes. The pigmentation genes provided herein include, but are not limited to, Cyclin D1, ESAM1, Angiopoietin 2, Klflc, PCDH7, Silver, DCT, Tyrp1, and Tgfbi.
In one aspect, a method of treating a melanocyte proliferative disorder in a subject including administering to the subject an effective amount of an agent that modulates the transcriptional activity of ATF2 in combination with an anticancer drug, is provided. In one embodiment, the anticancer drug used for the treatment of melanoma, includes but is not limited to, vemurafenib (Zelboraf™).
The melanocyte proliferative disorder as provided herein includes melanoma, primary melanoma or metastatic melanoma.
The present invention is based on the association between ATF2 and melanoma development and the diagnosis and prognosis of patients relating to melanocyte transformation and melanoma, including metastasis development.
To directly assess the importance of ATF2 in melanoma development, a mouse melanoma model in which ATF2 is selectively inactivated in melanocytes was employed. Melanoma development was demonstrated to be markedly attenuated in mice expressing a transcriptionally inactive form of ATF2 in melanocytes. Surprisingly, ATF2 control of melanoma development was mediated, in part, through its negative regulation of SOX 10 and consequently of MITF transcription. Inhibition of ATF2 abolished mutant BRAF-expressing melanocytes' ability to form foci on soft agar, which was partially rescued when expression of MITF was attenuated. The significance of these findings is underscored by the observation that human melanoma tumors having a high ratio of nuclear ATF2 to MITF expression were associated with poor prognosis. Thus, a novel mechanism underlying melanocyte transformation and melanoma development has been identified.
The transcription factor ATF2 has been shown to attenuate melanoma susceptibility to apoptosis and to promote its ability to form tumors in xenograft models. The role of ATF2 in melanoma development has been demonstrated by analysis of a mouse melanoma model crossed (NrasQ61K::lnk4a−/−) with mice expressing a transcriptionally inactive form of ATF2 in melanocytes.
In contrast to 7 of 21 of the NrasQ61K::lnk4a−/− mice, only 1 of 21 mice expressing mutant ATF2 in melanocytes developed melanoma. Gene expression profiling identified higher MITF expression in primary melanocytes expressing transcriptionally inactive ATF2. MITF downregulation by ATF2 was confirmed in the skin of Atf2−/− mice, in primary human melanocytes and in 50% of the human melanoma cell lines. Inhibition of MITF transcription by MITF was shown to be mediated by ATF2-JunB-dependent suppression of SOX10 transcription. Remarkably, oncogenic BRAF (V600E)-dependent focus formation of melanocytes on soft agar was inhibited by ATF2 knockdown and partially rescued upon shMITF co-expression. On melanoma tissue microarrays, a high nuclear ATF2 to MITF ratio in primary specimens was associated with metastatic disease and poor prognosis. These findings establish the importance of transcriptionally active ATF2 in melanoma development through fine-tuning of MITF expression.
Negatively regulation of MITF transcription by the transcription factor ATF2 in melanocytes and in about 50% of melanoma cell lines has been demonstrated herein. Increased MITF expression, which was observed upon inhibition of ATF2, effectively attenuated the ability of BRAFV600E-expressing melanocytes to exhibit a transformed phenotype, an effect partially rescued when MITF expression was also blocked. Significantly, the development of melanoma in mice carrying genetic changes observed in human tumors was inhibited upon inactivation of ATF2 in melanocytes. Melanocytes from mice lacking active ATF2 expressed increased levels of MITF, confirming that ATF2 negatively regulates MITF and implicating this newly discovered regulatory link in melanoma development. Primary melanoma specimens that exhibit a high nuclear ATF2 to MITF ratio were found to be associated with metastatic disease and poor prognosis, further substantiating the significance of MITF control by ATF2. In all, these findings provide genetic evidence for the role of ATF2 in melanoma development and indicate an ATF2 function in fine-tuning MITF expression, which is central to understanding MITF control at the early phases of melanocyte transformation.
The loss of a transcriptionally active form of ATF2 in melanocytes inhibits melanoma development in an Nras/lnk4a model. A critical role for ATF2 regulation of MITF, an important regulator of melanocyte biogenesis and a factor implicated in melanoma progression, has been identified during the course of an analysis of the mechanisms underlying ATF2 activity in this process. Surprisingly, ATF2 has been found to negatively regulate MITF expression in mouse and human melanocytes, suggesting that ATF2 transcriptional activities limit MITF expression. As demonstrated herein, such negative regulation is elicited through downregulation of SOX10 by ATF2, in cooperation with JunB. A putative API response element has been identified in SOX10 promoter sequences and ChIP analysis of this domain showed ATF2 and JunB binding. Over-expression of JunB efficiently suppressed SOX10 expression in an ATF2-dependent manner and inhibition of Jun transcriptional activities phenocopied the effect of shATF2, suggesting that negative regulation of SOX10 by ATF2 is direct, and is mediated in cooperation with JunB.
Importantly, ATF2-dependent negative regulation of Sox 10 and consequently of MITF is seen in melanocytes, but only in about 50% of the 18 melanoma cell lines studied here. Correspondingly, JunB, which is required for ATF2-dependent inhibition of Sox10 transcription, is no longer found on the promoter of SOX10 in melanoma cells (i.e., 501Mel) that exhibit positive regulation by ATF2. Rather, CREB and ATF2 are found on SOX10 and MITF promoters, pointing to a switch in ATF2 heterodimeric partners to enable positive regulation of these genes. Notably, melanoma cell lines that exhibit positive regulation of SOX10 and MITF by ATF2, also show high basal levels of MITF expression, suggesting that additional genetic or epigenetic changes distinguish these lines from melanocytes and the other melanoma lines in which ATF2 elicits negative regulation of MITF.
ATF2 control of MITF expression affected the ability of BRAF600E-expressing melanocytes to exhibit transformed phenotype in culture, monitored by their ability to grow on soft agar. Inhibition of ATF2 abolished soft agar growth of BRAF600E-expressing melanocytes, which was partially rescued upon knock down (KD) of MITF. Interestingly, both the over-expression or the KD of MITF resulted in inhibition of melanocytes ability to grow on soft agar, substantiating the notion that a fine balance of MITF expression must be maintained in order to ensure its contribution to cellular proliferation and transformation. Thus, while excessively low or high MITF levels appear to block melanocyte transformation, intermediate levels allow transformation to occur. Clearly ATF2 plays an important role in fine-tuning MITF levels, which is consistent with the rheostat model proposed for MITF's role in melanoma development and progression.
Of importance, ATF2 and MITF affect the ability of BRAF600E-expressing melanocytes to grow on soft agar via distinct mechanisms. Whereas specific inhibition of ATF2 causes both accumulation of cells in G2 and induction of cell death, specific alteration of MITF protein levels, particularly depletion, significantly affects cell proliferation and inhibit growth on soft agar by non-lethally slowing cell cycle progression at G2/M. These observations are consistent with a report from Wellbrock and Marais, who showed that altered MITF expression inhibits melanocyte proliferation.
Importantly, inhibiting MITF expression in ATF2 KD melanocytes was sufficient to partially rescue melanocyte growth on soft agar. While supportive of findings in the Nras::lnk4a mouse melanoma model, where expression of transcriptionally inactive ATF2 inhibits melanoma formation, these observations provide the foundation for a model in which ATF2 inhibition causes increased MITF levels and concomitant inhibition of melanocyte growth, possible induction of cell death and delayed development. The latter is suggested by IHC analysis of mouse skin from ATF2md mice, which shows notably reduced S100 staining indicative of delayed melanocyte development: ATF2 KO melanocytes appear to represent anagen stage IV, whereas WT represent anagen stage VI. This delay was seen at the 4- but not the 14-day time point, suggesting that an ATF2 effect might be limited to a specific subpopulation or phase of melanocyte development. The early (4 day) time point is within the time frame that allows induction of melanoma development by UV-irradiation of c-Met or H-Ras mutant mice. It is therefore plausible that timely control of MITF expression by ATF2 determines melanocyte susceptibility to transformation.
An analysis of genes whose expression is altered by ATF2 KD in melanocytes identified a cluster of pigmentation genes, many reportedly regulated by MITF. Therefore, changes in TYRP1, DCT and SILVER expression could be attributed to altered MITF expression. However, an initial analysis points to a more complex mechanism since (i) the degree of changes in expression of these genes was often greater than that seen for MITF; and (ii) expression of some pigmentation genes was found to be independent of MITF in some melanoma and melanocyte cultures. Hence, further studies are required to address mechanisms underlying ATF2 regulation of these pigmentation genes and the significance of such regulation to melanocyte transformation and melanoma development. While present studies focused on the ATF2-MITF axis, it is expected that additional ATF2-regulated genes contribute to melanoma development. In agreement, previous studies using both human and mouse melanoma lines demonstrate that inhibition of ATF2 effectively inhibits tumorigenesis and blocks metastasis.
Important for ATF2 function is its subcellular localization. Nuclear localization of ATF2 in melanoma tumor cells is associated with poor prognosis, likely due to transcriptional activity of constitutively active ATF2. Indeed, expression of transcriptionally inactive ATF2 or peptides that attenuate endogenous ATF2 activity inhibits melanoma development and progression in xenograft models. These studies suggest that ATF2 is required for melanoma development and progression.
While the findings disclosed herein position ATF2 as an oncogene functioning in melanocyte transformation and melanoma development, earlier studies suggest that in keratinocytes and mammary glands, ATF2 elicits a tumor suppressor function. An assessment of the localization of ATF2 in the melanoma cell lines studied here has revealed that all express nuclear ATF2. Interestingly, in most cases the nuclear staining revealed a punctate staining, resembling the localization of ATF2 to DNA repair foci following DNA damage. A possible link between the presence of ATF2 in repair foci in most melanoma cells points to the possible presence of activated DNA damage response which may be associated with genomic instability, aspects that will be explored in detail in future studies. Significantly, the appearance of nuclear ATF2 is correlated with poor prognosis in melanoma, whereas melanomas that exhibit cytosolic ATF2 exhibit a better survival. Cytosolic ATF2 is reported to be primarily seen in non-malignant skin tumors. As demonstrated herein, high nuclear ATF2/MITF ratios are associated with poor prognosis in primary melanomas, but not with metastatic melanomas. The latter finding attests for the important role ATF2 plays to control M1TF expression in the early phase of melanocyte transformation and melanoma development.
Overall, using the mutant Nras/lnk4a melanoma model, genetic evidence for a central role for ATF2 in melanoma development is provided herein. In the absence of transcriptionally active ATF2, melanoma formation is largely inhibited. Furthermore, the data presented herein point to an unexpected role of ATF2 in fine-tuning of MITF transcription through regulation of its positive regulator SOX10. Mouse melanoma models and in vitro transformation studies indicate that this newly identified regulatory pathway is required for early phases of melanocyte transformation. Given that ATF2 affects activity of the oncogenes N-Ras (mouse model) and BRAF (melanocyte growth on soft agar), it is likely that ATF2 plays significant roles in melanomas that carry either of these mutations.
The following examples are intended to illustrate but not limit the invention.
Because global Atf2 knockout in mice leads to early post-natal death, the Cre-loxP system was utilized to disrupt Atf2 in melanocytes. Deletion of its DNA binding domain and a portion of the leucine zipper motif results in a transcriptionally inactive form of ATF2 (
To elucidate the role of ATF2 in melanoma, Atf2f/f mice were crossed with mice harboring a 4-hydroxytamoxifen (OHT)-inducible Cre recombinase-estrogen receptor fusion transgene under the control of the melanocyte-specific tyrosinase promoter, designated Tyr::CreER (T2). It was anticipated that, upon administration of OHT, CRE-mediated recombination would be induced in a spatially and temporally controlled manner in embryonic melanoblasts, melanocytes, and in putative melanocyte stem cells. The resulting Atf2f/f/Tyr-CreER (T2) mice, designated melanocyte-deleted (md) Atf2md, expressed the gene encoding the ATF2 transcriptional mutant in melanocytes as predicted. Immunoblot analysis of ATF2 protein confirmed that melanocytes prepared from wild-type TyrCre+::Atf2+/+Nras+::lnk4a−/− (WT) mice express a 70 kDa band corresponding to full length ATF2, whereas melanocytes of TyrCre+::Atf2md::Nras+::lnk4a−/− mice express only a 55 KDa band, corresponding to the size of ATF2 lacking the DNA binding and leucine zipper domains (
To address the role of ATF2 in de novo melanoma formation, Tyr: :CreER: :NrasQ61K: :lnk4a−/− (KO of exon 2-3 of Cdkn2a locus that encodes for both p16lnk4a and p19Arf) mice, which develop spontaneous melanoma (Lynda Chin, unpublished observations), were crossed with Atf2md mice. Similar to findings reported by Ackermann et al. (Cancer Res., 2005, 65: 4005-4011), mutant N-Ras/lnk4a−/− mice developed melanoma within 8-12 weeks with metastatic lesions often seen in the lymph nodes. However, the incidence of melanoma was lower in Tyr::CreER::NrasQ61K::lnk4a−/− mice used in the present study (50% penetrance, of which 50% of the tumors were confirmed to be melanoma) and this was attributed to expression of mutant NRAS induced only after birth, as opposed to activation of NRAS during embryogenesis, as reported by Ackermann et al. Thus, Atf2md::N-RasQ61K:lnk4a−/− mice were used to assess changes in melanoma incidence in the absence of functional ATF2 over a period of up to 8 months, in all cases, mouse skin was treated with Tamoxifen within 3-5 days after birth to inactivate ATF2 (
To assess the mechanism underlying ATF2′s contribution to melanoma development, gene profiling array analysis of primary melanocytes prepared from Tyr: :Cre+::Atf2+/+::NrasQ61K::lnk4a−/− and Tyr::Cre+::Atf2md::NrasQ61K::lnk4a−/− mice was conducted. Because, as reported above, only one melanoma formed in the ATF2 mutant group, the analysis was limited to melanocytes. In all cases, ATF2 was inactivated and NRAS was induced in culture within 48 hours of plating cells, as monitored by western blots (
qPCR analysis, performed on independently prepared RNA samples from melanocytes expressing WT (Tyr:Cre+::Atf2+/+::NrasQ61K::lnk4a−/−) or mutant ATF2 (Tyr::Cre+::Atf2md::NrasQ61K::lnk4a−/−), confirmed altered expression of pigmentation genes (Table 3). These data provide the initial indication that ATF2 negatively regulates Mitf and several other important pigmentation genes. The pigmentation genes identified in this array are already known to be regulated by MITF thus, regulation of MITF by ATF2 was investigated in further detail.
To confirm that ATF2 negatively regulates Mitf expression, MITF transcription in primary mouse melanocytes harboring WT (Tyr::Cre::Atf2+/+) or mutant (Tyr::Cre+::Atf2md) forms of ATF2 was assessed. RNA prepared from whole skin of these mice (3 mice per group) was subjected qPCR analysis. Significantly, Mitf expression was inversely correlated to the presence of functional ATF2; samples obtained from ATF2 mutant skin exhibited a greater than 2-fold increase in MITF expression compared with those obtained from WT ATF2 mice (
Additionally, melan-lnk4a-Arf1 melanocytes, a line derived from black Ink4a-Arf null mice, and primary human melanocytes were assessed. In both, ATF2 expression was inhibited by viral infection with the corresponding mouse or human shRNA (shATF2). Infection of either primary human (
Given that ATF2 negatively regulates MITF in melanocytes of mouse and human tissues and in related melanocyte cell lines, the role of ATF2 in the regulation of MITF in human melanoma cells was investigated. Initially, changes in MITF expression was assessed in six human melanoma lines harboring oncogenic mutations in BRAF or NRAS in which ATF2 expression was effectively inhibited by corresponding shRNA (shATF2). In all cases, shRNA specificity was confirmed using three independent sequences (data not shown). Surprisingly, the six melanoma lines fell into two classes based on distinct patterns of regulation of MITF by ATF2 (Table 4). The first class comprised four of the six melanoma cultures (1205Lu, WM35, WM793 and WM1361), in which MITF expression was elevated 3-6-fold following inhibition of ATF2 expression (
MITF transcription is regulated by complex positive and negative cues. For instance, while CREB and SOX10 positively regulate MITF, BRN2, and FOXD3 have been shown to down-regulate MITF expression. Hence melanocytes and representative melanoma lines were utilized to assess mechanisms underlying positive or negative regulation of MITF. Infection of the human melanocyte line Hermes 3A with shATF2 effectively inhibited ATF2 expression, up-regulated Mitf transcription, and increased transcription of SOX10 and FOXD3 (from 7- to 10-fold, respectively) and to a lesser extent of Pax3 and Brn2 (from 1.5- to 2-fold, respectively) (
To assess the possible role of FOXD3 in regulation of MITF, FOXD3 expression was inhibited in melanocytes expressing control shRNA and shATF2. Inhibition of FOXD3 expression increased SOX10 transcription and protein expression, albeit to lower levels compared to inhibition of ATF2 expression. Concomitant increase of MITF RNA and protein levels was also lower, compared with that seen upon inhibition of ATF2 expression. Notably, inhibition of both ATF2 and FOXD3 resulted in additive increase of SOX10 and MITF. These data suggest that FOXD3 may also contribute to negative regulation of MITF in melanocytes, independent of ATF2. Because inhibition of FOXD3 elicited a less pronounced effect compared with ATF2, and given that the effect appeared ATF2-independent and did not appear to mediate similar changes in human melanoma cells (data not shown), an assessment of direct mechanisms underlying ATF2 effect on MITF transcription was made.
To this end, MITF promoter sequences for ATF2/CRE elements (Cyclic AMP response element), which can be targeted by ATF2, as well as sequences recognized by BRN2 and SOX10 using a luciferase reporter construct (MITF-Luc) were first analyzed. Using either a wild-type (WT) construct or one in which the BRN2 site was mutated, increased luciferase activity following inhibition of ATF2 transcription in WM1361 melanoma (
A putative response element for AP1 (which can serve as an ATF2 response element through ATF2 heterodimerization with JUN family members) has been identified in upstream regions of the Sox10 promoter. Potential ATF2 binding to this element by ChIP was examined and it was found that endogenous ATF2, but not ATFa, binds to that API sequence (−4797-4791) in both human melanocytes and melanoma cells (
The effect of ATF2 on SOX10 and MITF expression in 12 additional human melanoma cell lines was next assessed. In all cases cells were infected with shATF2 and changes in SOX10 and MITF were monitored at the level of RNA. Notably, about four of twelve melanoma lines revealed increase in both SOX10 and MITF expression upon KD of ATF2 (Table 4). In contrast, six of twelve melanoma lines revealed decrease in MITF expression, of which 5 also shown decrease in SOX10 expression, pointing to positive regulation of SOX10 and MITF in these melanoma cells. In two out of the 12 melanoma lines, ATF2 affected SOX10 but not MITF transcription. Overall, the cohort of 18 melanoma lines revealed that about 50% of the melanomas retained negative regulation of MITF by ATF2, as seen in the melanocytes (primary and cell lines) (Table 4).
To further assess whether ATF2 regulation of MITF is Sox10-dependent in melanocytes and melanoma cells, SOX10 was co-expressed in shATF2-expressing cells. As seen in earlier analyses, inhibition of ATF2 expression caused increase in MITF transcription in the human melanocytes and 4 melanoma cell lines, (WM1361, WM793, LU1205, WM35). Notably, the melanocytes and two of four melanoma cell lines revealed ATF2 effect on MITF expression is Sox10-dependent (WM1361, WM793). Two of the four melanoma cell lines did not reveal increased SOX10 expression, although they retained increased MITF expression, upon inhibition of ATF2 (Lu1205, WM35). These findings confirm that, while in melanocytes expression of SOX10 and M1TF is negatively regulated by ATF2, this mechanism is conserved in approximately half of melanomas surveyed.
Along these lines, the two melanoma lines (MeWo and 501Mel) that exhibit positive regulation of MITF by ATF2 also exhibited positive regulation of SOX10 by ATF2. Inhibition of ATF2 expression reduced SOX10 and MITF RNA and protein levels. In order to determine whether JunB lost its ability to elicit negative regulation of SOX10 and MITF in melanoma cells where ATF2 no longer inhibited SOX10 or MITF expression, those cell lines were transfected with TAM67 and JunB alone and in combination. In these cells, whereas TAM67 effectively attenuated Sox10 and MITF expression, JunB did not alter expression of these genes, suggesting that positive regulation of MITF and SOX10 by ATF2 depends on other members of the Jun family of transcription factors. Conversely, TAM67 or JunB had no effect on melanoma cells in which ATF2 inhibits MITF independently of SOX10, suggesting that in these cases, ATF2 likely cooperates with transcription factors other than JunB to elicit negative regulation of SOX10 and MITF. Consistent with this observation, ChIP assay confirmed ATF2 and CREB, but not JunB, binding to the Sox10 promoter in these cells. These findings suggest that changes in ATF2 heterodimeric partner (from JunB to CREB) are likely to cause the switch from negative to positive regulation of SOX10, and in turn, MITF (see below). The possibility that altered expression of JunB may account for ATF2 positive or negative regulation of Sox10 and MITF was excluded, as no clear correlation between JunB expression and the ability of ATF2 to elicit negative regulation of Sox10/MITF was observed.
Among response elements potentially required to up-regulate MITF transcription is the CRE element, which is implicated in CREB-mediated upregulation of MITF transcription. Although transcriptional activity from a CRE mutant MITF promoter was lower compared to the WT promoter (30%), it was no longer responsive to inhibition of ATF2 expression in the MeWo cells. Pull-down assays using biotin-tagged MITF promoter sequences harboring the CRE identified ATF2 and CREB as CRE-bound proteins in MeWo melanoma cells. In agreement, ChIP analysis confirmed occupancy of the CRE site on MITF promoter by ATF2. These findings are consistent with the fact that ATF2 heterodimerizes with CREB and with reports that p38/MAPK14 (which phosphorylates ATF2) plays an important role in MITF transcription dependent on the CRE site. These results establish that ATF2-dependent activation of MITF transcription in these melanoma cells is mediated through the CRE site, likely in cooperation with CREB. Notably, MeWo and 501Mel lines are known to express high MITF levels compared to other melanoma lines, suggesting these cells harbor distinct mechanisms that preclude negative regulation of MITF by ATF2.
To determine whether the contribution of ATF2 to melanocyte transformation and development is MITF-dependent, melanocytes' ability to grow and form colonies in soft agar was assessed as this is indicative of their transformed potential. Expression of mutant BRAFV600E in immortal melanocytes is reportedly sufficient for growth on soft agar. Thus melan-lnk4a-Arfl melanocytes were infected with mutant BRAF (
Significantly, inhibition of MITF expression decreased the number of BRAF-induced foci (from 1000 to about 100 per well). Over-expression of MITF in BRAF-expressing melanocytes also inhibited focus formation, to a degree similar to that seen following inhibition of MITF expression (
Whether inhibition of melanocyte growth on soft agar by altered ATF2 and/or MITF expression can be attributed to decreased proliferation or increased apoptosis was next addressed. Inhibition of ATF2 expression caused notable accumulation of cells in G2 (60%), with significant cell death induction (22%) compared to controls (4%), (
The availability of a melanoma TMA, consisting of over 500 melanoma samples and in which expression of both ATF2 and MITF in the same tumors had been measured, allowed for the assessment of possible associations between ATF2 and MITF and their correlation with survival and other clinical and pathological factors. Previous studies revealed that ATF2 sub-cellular localization in tumors is significantly correlated with prognosis: nuclear localization, reflecting constitutively active ATF2, was associated with metastasizing tumors and poor outcome. Here, immunofluorescent staining of TMAs for MITF and ATF2 was quantified employing an automated, quantitative (AQUA) method. To normalize ATF2 and MITF levels, expression of each of the two proteins in individual patients was divided by the median expression level of the respective protein in all patients, and the nuclear ATF2/MITF ratio was calculated and log-transformed. By ANOVA analysis, the ratio was higher in metastatic than in primary specimens (t value=2.823, P=0.0051), as shown in
Ethics statement. Research involving human participants has been approved by the institutional review board at Yale University (where the TMA was prepared and analyzed). All animal work has been conducted according to relevant national and international guidelines in accordance with recommendations of the Weatherall report and approved by the IACUC committee at SBMRI.
Animal treatment and tumor induction protocols. Mice bearing a conditional allele for mutant ATF2 in which the DNA binding domain and part of the leucine zipper domain were deleted, were generated as previously described Genes Dev., 2007, 21: 2069-2082 and Proc. Natl. Acad. Sci., 2008, 105:1674-1679. The Cre-loxP system for disruption of the ATF2 gene in melanocytes was utilized to study the function of ATF2 in melanocytes. The Tyr::CreER::/Atf2md mice and their littermate controls (WT) were of FVB/129P2/OlaHsd (TyrCreERT mice were FVB, ATF2fl/fl were 129P2/OlaHsd) and N-Ras/lnk4a−/− mice were C57BI/6/129SvJ. For melanoma studies Tyr::CreER::NrasQ61K::Ink4a−/− mice (developed at HMS by LC) were used following their cross with the Tyr::CreER::Atf2md.
Immunohistochemistry—Skin specimens were fixed in neutral buffered formalin solution and processed for paraffin embedding. Skin sections (5 pm in thickness) were prepared and deparaffinized using xylene. For MITF, DCT and S100 immunostaining, tissue sections were incubated in DAKO antigen retrieval solution, for 20 minutes in a boiling bath, followed by treatment with 3% hydrogen peroxide for 20 minutes. Antibodies against MITF (1:100 from Sigma), DCT (1:500, kind gift from Dr. Vincent Hearing) and 5100 (1:100, DAKOCytomation; Carpinteria, Calif.) were allowed to react with tissue sections at 4° C. overnight. Biotinylated anti-rabbit IgG was allowed to react for 30 minutes at ambient temperature and diaminobenzidineor Nova Red were used for the color reaction while hematoxylin was used for counterstaining. The control sections were treated with normal mouse serum or normal rabbit serum instead of each antibody.
Cell culture—Immortalized human melanocytes Hermes 3A, which exhibit hTERT (puro) and CDK4 (neo) expression were grown in RPMI 1640 medium containing Fetal Bovine Serum (FBS, 10%), 12-0-tetradecanoyl-phorboi-13-acetate (TPA, 200 nM, Sigma, St. Louis, Mo.), Cholera toxin (200 pM, Sigma), human stem cell factor (10 ng/ml, R&D systems, Minneapolis, Minn.), and endothelin 1 (10 nM, Bachem Bioscience Inc., Torrance, Calif.). Primary human melanocytes (NEM-LP; Invitrogen) were grown in medium 254 and HMGS (Cascade Biologies). Mouse melanocytes (melan-lnk4a-Arf1) were grown as for immortalized human melanocytes excluding human stem cell factor and endothelin. Melanoma cell lines were grown in DMEM medium supplemented with 10% FBS and penicillin/streptomycin (P/S; Cellgro). Melanoma cell lines used in this study include LU1205, WM793, 501MEL, WM35, WM1361 MeWO (kind gift from Meenhard Herlyn) maintained in DMEM medium supplemented with 10% FBS and Penicillin/Streptomycin. Primary melanocytes cultures were prepared from mice carrying the Atf2 WT or mutant genotypes and N-Ras/lnk4a−/− as follows. Dorsal-lateral skin was removed from one day-old pups, disinfected with 70% ethanol for 1 minute and then wash at least twice with sterile PBS. The skin was submerged in 1× Trypsin/EDTA overnight at 4° C. and next day, the skin was placed in a Petri dish with mouse melanocyte culture medium (described below). The epidermis and sheared tissue was removed and discarded with forceps. The tissue was transferred to 15 ml centrifuge tubes and vortexed vigorously until solution becomes cloudy (1-2 minutes). The cell suspension was transferred to tissue culture flasks. After 3 days, melanocyte growth medium containing 0.8 jig/ml geneticin (Sigma-Aldrich) was added to eliminate contaminating fibroblasts (melanocytes are resistant to such treatment). Geneticin-containing medium was removed and replaced with fresh media after 1 day. Media was changed twice a week. Primary mouse melanocytes were grown in F-12 media (invitrogen) containing 20% L-15 media (Invitrogen), 4% of FBS and Horse serum (Invitrogen), Penicillin (100 units) and streptomycin (50 μg) antibiotics, db-cAMP (40 μM, Sigma-Aldrich), 12-0-tetradecanoyl-phorbol-13-acetate (TPA, 50 ng/ml, Sigma-Aldrich), alpha-Melanocyte stimulating hormone (a-MSH, 80 nM, Sigma-Aldrich), Fungizone (2.5 μg/ml, Sigma-Aldrich) and melanocyte growth supplement (Invitrogen). Primary melanocytes were treated with 4-OHT (10 μM) for 8 h followed by addition of doxycycline (2 μg/ml) for 24 hours to inactivate ATF2 and induce expression of N-Ras.
Constructs—ATF2-specific shRNA clones were obtained from Open Biosystems (catalog number: RHS4533). Five different shRNA were obtained and tested for their efficiency of KD. Clone TRCN0000013714 was more efficient in inhibiting ATF2 in human cell lines while clone TRCN0000013713 was more efficient for knocking down mouse ATF2. For subsequent experiments the respective shATF2 clone was used depending on human or mouse cell lines. Three different clones were also tested for KD of ATF2 to rule out any off-target effect (data not shown). siRNA control (catalog number: 4611) and three Sox10-specific siRNA oligonucleotides were obtained from Ambion (catalog number: 4392420). Four FOXD3 specific siRNA were obtained from Dharmacon (catalog numbers: J-009152-06, -07, -08, and -09). These siRNAs were pooled together in an equimolar ratio for transient transfection. An MITF specific shRNA, and MITF promoter luciferase constructs (WT and mutant CRE-Luc constructs) were obtained from Dr. David Fisher (J. Biol. Chem., 2003, 278: 45224-45230). pGL3 vectors containing wild-type and BRN2-site-mutated MITF promoters were obtained from Dr. Colin Goding (Cancer Res., 2008, 68: 7788-7794). pGL3 vectors containing wild-type and Sox10-site-mutated MITF promoters were obtained from Dr. Michel Goossens (Hum. Mol. Genet., 2000, 9: 1907-1917). Retroviral vectors encoding a fusion protein consisting of full length human BRAF and BRAFV600E linked to the TI form of the human estrogen receptor hormone-binding domain were generously provided by Dr. Martin McMahon (Pigment Cell Melanoma Res., 2008, 21: 534-544). SOX10 expression vector obtained from Dr. Alexey Terskikh, RSV-JunB, RSV-JunD were obtained from Dr. Michael Karin and pBabe-Flag-TAM67 from Dr. Michael Birrer.
Antibodies and Immunoblotting—Antibodies against SOX10 and CREB (sc-1734 and sc-186 respectively) were from Santa Cruz Biotechnologies; antibodies against ATF2, pERK and ERK (catalog numbers: 9226, 4337 and 4695, respectively) were obtained from Ceil Signaling; antibodies against MITF (C5) were purchased from Cell Lab vision. Protein extract (40-60 μg) preparation and western blot analysis were done as described previously in Cancer Cell, 2007, 11: 447-460. Specific bands were detected using fluorescent-labeled secondary antibodies (Invitrogen, Carlsbad, Calif.) and analyzed using an Odyssey Infrared Scanner (Li-COR Biosciences). p-Actin antibody was used for monitoring loading.
Immunofluorescence—Human melanoma and melanocytes were grown in coverslips, fixed (4% paraformaldehyde and 2% sucrose in 1× PBS), and then permeabilized and blocked (0.4% Triton X-100 and 2% BSA in 1× PBS) at ambient temperature. The cells were then washed (0.2% Triton X-100 and 0.2% BSA in 1× PBS) and incubated overnight at 4° C. with monoclonal anti-rabbit antibody against ATF2 (20F 1, 1:100), followed by five washes and then subsequent incubation at ambient temperature for 2 hours with anti-rabbit IgG (Invitrogen, 1:300) and Phalloidin (Molecular Probes, 1:1000). DNA was counterstained with 4,6-diamidino-2-phenylindole (DAPI; Vector Laboratories) containing mounting medium.
Analysis of Skin samples—Skin samples were collected from the backs of mice and immediately fixed with Z-fix, processed, and embedded in paraffin. Paraffin sections were routinely stained by H&E. Dewaxed tissue sections (4.0-5.0 μm) were immunostained using rabbit polyclonal antibodies to MITF (Sigma-Aldrich), S100 (S100B; DAKOCytomation; Carpinteria, Calif.), and DCT (aPEPS, kindly provided by Dr. Vincent Hearing). Application of the primary antibody was followed by incubation with goat anti-rabbit polymer-based EnVision-HRP-enzyme conjugate (DakoCytomation). DAB (DakoCytomation) or SG-Vector (Vector Lab, Inc.; Burlingame, Calif.) chromogens were applied, yielding brown (DAB) and black (SG) colors, respectively.
Quantitative Analysis of Immunostaining—Quantitative analysis was performed as described previously in J. Histochem. Cytochem., 2009, 57: 649-663. Briefly, all slides were scanned at an absolute magnification of 400× [resolution of 0.25 μm/pixel (100,000 pix/in.)] using the Aperio ScanScope CS system (Aperio Technologies; Vista, Calif.). The acquired digital images representing whole tissue sections were analyzed applying the Spectrum Analysis algorithm package and ImageScope analysis software (version 9; Aperio Technologies, Inc.) to quantify IHC and histochemical stainings. These algorithms make use of a color deconvolution method (Anal. Quant. Cytol. Histol., 2001, 23: 291-299) to separate stains. Algorithm parameters were set to achieve concordance with manual scoring on s number of high-power fields, including intensity thresholds for positivity and parameters that control cell segmentation using the nuclear algorithm.
Microarray analysis—Primary melanocytes were treated with 4-OHT and Doxycycline before isolation of total RNA. 500 ng of total RNA was used for synthesis of biotin-labeled cRNA using an RNA amplification kit (Ambion). The biotinylated cRNA is labeled by incubation with streptavidin-Cy3 to generate probe for hybridization with the Mouse-6 Expression BeadChip (Illumina MOUSE-6_V1—1—11234304_A) that represents 46.6 K mouse gene transcripts. BeadChips were analyzed using the manufacturer's BeadArray Reader and collected primary data using the supplied Scanner software. Data analysis was done as follows. First, expression intensities were calculated for each gene probed on the array for all hybridizations using illumina's BeadStudio 3.0 software. Second, intensity values were quality controlled and normalized: quality control was carried out by using the BeadStudio detection P-value set to <0.01 as a cutoff. This removed genes not detected in the arrays. All the arrays were then normalized using the cubic spline routine from the BeadStudio 3.0 software. This procedure accounted for any variation in hybridization intensity between the individual arrays. Finally, these normalized data were analyzed for differentially expressed genes. The groups of 2 biological and 2 technical replicates were described to the BeadStudio 3.0 software and significantly differentially expressed genes were determined on the basis of the difference changes in expression level (Illumina DiffScore>60 or DiffScore<−60) and expression difference p-value<0.01. Microarray data are available under accession number GSE23860.
ShRNA infection and RNA interference—Human embryonic kidney 293T cells were transfected with corresponding retro-or lentiviral shRNA constructs (10 μg), Gag-pol (5 μg) and ENV expression vectors (10 μg) by calcium phosphate transfection into 10 cm plates and supernatant was collected after 48 hours to obtain viral particles. Two million melanocytes and melanoma cells in 10 cm plates were infected with 5 ml of viral supernatant along with 5 ml of medium in the presence of 8 μg/ml polybrene. The virus was replaced with fresh media after 8 hours of infection. After two days, puromycin (1.5 μg/ml} was used to select cells for 3 days. For human and mouse melanocytes the media was changed to DMEM containing 10% FBS 24 hours prior to harvesting cells. 50 nM duplexes of scrambled and SOX10- or FOXD3-specific siRNA were transfected into human melanocytes and WM1361 melanoma cells (2 million cells per transfection) by Nucleofection using Amaxa reagents (NHEM-Neo Nucleofector and Solution R, respectively) for SOX10 or FOXD3 knock down. Over 90% of the cells transduced were able to resist drug selection, indicating efficient infection of the respective genes. GFP was also used to monitor efficiency of infection, confirming >90% GFP expression by fluorescence microscopy.
Real-time quantitative reverse transcription-PCR (RT-PCR)—Quantitative PCR was performed as described above. Total RNA was isolated using an RNeasy mini kit (Sigma, St. Louis, Mo.) and reverse transcribed using a high cDNA capacity reverse transcription kit (Applied Biosystems, Foster City, Calif.) following the manufacturer's instructions.
Specific primers (Valuegene, San Diego, Calif.) used for PCR were as follows:
The reaction mixture was denatured at 95° C. for 10 minutes, followed by 40 cycles of 95° C. for 15 seconds, annealing at 60° C. for 30 seconds and extension at 72° C. for 30 seconds. Reactions were performed using the SYBR® GreenER qPCR reagent (Invitrogen) and run on an MX3000P qPCR machine (Stratagene, La Jolla, Calif.). The specificity of the products was verified by melting curve analysis and agarose gels. The amount of the target transcript was related to that of a reference gene (Cyclophilin A for both human and mouse) by the Ct method. Each sample was assayed at least in triplicate and was reproduced at least three times.
Chromatin Immunoprecipitation—Chromatin immunoprecipitation was performed using the Magna-Chip (Upstate) according to the manufacturer's instructions. Control shRNA and ATF2 knocked down WM1361 cells (one 10 cm plate for each, 80% confluent) were fixed in 37% formaldehyde and sheared chromatin was immunoprecipitated and subjected to PCR for 26 cycles. The following primers corresponding to the MITF promoter, spanning the SOX10 binding site which also includes a CRE site, were used, forward: gcagtcggaagtggcag, reverse: caactcactgtcagatcaa. Antibodies against Sox10 and CREB (se-1734 and sc-186 respectively) were from Santa Cruz Biotechnologies. IgG control, and glyceraldehyde-3-phosphate dehydrogenase oligonucleotides were provided by the kit. Antibody against ATF2 (sc-6233), JunB (sc-8051), JunD (sc-74) were obtained from Santa Cruz. Antibodies against ATFa were provided generated by Nic Jones. For Sox10 promoter, the following primers spanning AP-1 binding site were used; forward: cccagtgctggcctaatagc, reverse: cacccttgatatccccaagtga.
Luciferase Assays—MeWo, WM35, WM1361, Lul205 cells in six-well plates were transiently transfected with 0.5 μg of reporter plasmid containing WT or CRE mutant, BRN2 mutant or SOX10 mutant MITF promoter and 0.1 μg of pSV-B-Galactosidase (Promega, San Luis Obispo, Calif.) using Lipofectamine 2000 reagent (InVitrogen). Human melanocytes (2 million) were transfected with 2 μg of reporter plasmid containing WT or SOX10 mutant MITF promoter and 0.3 μg of pSV-(i-Galactosidase using Amaxa reagent (NHEM-Neo nucleofector kit, Lonza) according to the manufacturer's protocol. Cell lysates were prepared from cells after 48 hours. Luciferase activity was measured using the Luciferase assay system (Promega) in a luminometer and normalized to B-galactosidase activity. The data were normalized to B-galactosidase and represent the mean and SD of assays performed in triplicate. All experiments were performed a minimum of 3 times.
Colony formation assay—Melan-lnk4a-Arf1 cells were transduced with a retroviral vector expressing BRAFV600E:ERT1and selected with puromycin for 3 days. These cells were treated with 200 nM of estrogen receptor antagonist ICI 182780 (ICI, Tocris Bioscience) to induce expression of BRAFV600E. After one day, these cells were transduced with a lentiviral vector expressing either shATF2 or shMITF separately, or in combination. Colony formation was carried out as described by Franken et al. (Clonogenic assay of cells in vitro, 2006). Briefly, 5,000 cells were plated into each well of a 6-well plate, and cells were grown in mouse melanocyte media containing ICI and puromycin (1.5 μg/ml) for 3 weeks until colonies became visible. The colonies were stained with P-Iodonitrotetrazolium Violet (1 mg/ml Sigma, St. Louis, Mo.). This experiment was performed in triplicate and reproduced 2 times.
Mouse genotyping—Genomic DNA was isolated from tail tissue was subjected to PCR resulting in amplification of a 549 bp DNA fragment for Atf2 floxed and a 485 bp DNA fragment for wild type mice. PCR conditions included one cycle at 95° C. for 3 minutes; and 30 cycles of 94° C./30 seconds, 55° C./30 seconds and 72° C./1 minute and one cycle at 72° C. for 5 minutes. Primers used for PCR reactions were forward: caatccactgccatggcctt, reverse: tcagataaagccaagtcgaatctgg.
Avidin-Biotin DNA-protein binding assay—MeWo cells were left untreated or treated with 20 mJ/cm2 of UV-B for 1 hour. The cells were lysed using lysis buffer containing 1% Triton-100 and incubated with 4 μg of biotin-labeled MITF promoter spanning the CRE site oligo (5′-gaaaaaaaagcatgacgtcaagccaggggg-3′) in the presence of poly-(dl-dC) (20 μg/ml) for 2 hours at 4° C. The oligo-bound proteins were captured using streptavidin-agarose (Invitrogen) for 1 hour incubation, followed by extensive washes with washing buffer (20 mm HEPES, 150 mm NaCI, 20% glycerol, 0.5 mm EDTA, and 1% Triton-100) and analyzed using SDS-PAGE and western blots.
BrdU, PI Labeling, Annexin V staining—To evaluate the cell cycle index of Melan-lnk4a-Arf1 cells stably over-expressing BRAFV600E:ERT1 alone or in combination with shRNA to the genes described above, cells were plated in media containing ICI and puromycin (1.5 μg/ml) at 2×106 cells per 10 cm plate over night. Cells were labeled with 10 μM of 5-bromo-2-deoxyuridine (BrdU; Sigma Chemical Co.), for an hour. Cells were then washed, fixed, and stained with anti-BrdU mAbs and propidium Iodide (BD Biosciences, San Jose, Calif.) according to the manufacturer's protocol, and analyzed on a BD FACSCanto machine. Cell cycle phase was analyzed using the Mod Fit LT v.2 program (Verity Software, Topsham, Me.). In a separate experiment the cells were stained with Annexin V-APC and 7-AAD (BD Pharmingen™, San Diego, Calif.) according to manufacturer's protocol, to enable analysis of early apoptosis and cell death.
Hypoxia treatment—Cells were treated under hypoxia (1% O2) for indicated time points using a hypoxia chamber (In Vivo 400; Ruskin Technologies Ltd, Bridgend, UK).
UV Irradiation—Mice were treated with 4-hydroxytamoxifen (25 mg/ml in dimethylsulfoxide) by swabbing the entire body (excluding the head) on days 1 through 3 after birth. On day 4, the pups were placed under UVB light source (FL-15E; 320 nm) and exposed to 20 μW/cm2 for 22 seconds. Ninety minutes after UVB treatment mice were sacrificed and entire skin was removed and processed.
TMA and AQUA staining—Tissue microarrays were constructed as previously described in Cancer Res., 2003, 63: 8103-8107. The arrays included a series of 192 sequentially collected primary melanomas and 299 metastatic melanomas. Slides were stained for automated, quantitative analysis (AQUA) for ATF2 and MITF as previously published (Nature, 2005, 436: 117-122 and J. Clin. Oncol., 2009, 27: 5772-5780). The AQUA scores for the two markers were obtained from the AQUAmine database at the world wide web tissuearray.org.
Although the invention has been described with reference to the above example, it will be understood that modifications and variations are encompassed within the spirit and scope of the invention. Accordingly, the invention is limited only by the following claims.
This application claims the benefit of priority under 35 U.S.C. §119(e) of U.S. Ser. No. 60/390,746 filed Oct. 7, 2010 the entire content of which is incorporated herein by reference.
Number | Date | Country | |
---|---|---|---|
61390746 | Oct 2010 | US |