Patent Application
20240271145
The present invention relates to the engineering of transgene cDNA sequences to increase expression in eukaryotic cells.
The knowledge of the cis-acting elements required for gene expression has been built up over many decades starting from an initial understanding of bacteriophage and bacteria systems and extending these to eukaryotic viruses and ultimately eukaryotic genomes. Knowledge has been progressively enhanced and refined by transferring ectopic transcription units from one genome to another. Initially cultured mammalian cell lines have been used for this purpose but beginning in the 1980s transgenic animals have provided a convenient assay system for exploring the regulatory aspects of transgene expression. Transgenic mice have been used to define cis-acting regulatory elements in terms of their ability to direct appropriate levels of expression in the correct tissues and time. Most conveniently this investigation has used transgenes obtained from other species (such as LacZ, GFP) which label the cells in which expression occurs (Chalfie et al. 1994, Schmidt et al. 1998). Through such methods the promoters and enhancers which respond to the endogenous regulatory circuits have been determined for many genes. Moreover, other important elements have been recognized such as locus control regions, often found at substantial distances from genes, which enable copy number dependent gene expression for transgenes integrated in ectopic locations. At the nucleotide level, enhancements have been achieved by optimizing translation—for instance a “Kozak” consensus start site (Kozak 1984) is almost universally used.
Mammalian genes are typically large, their coding sequences are distributed over tens to hundreds kilobases of genomic DNA and regulatory elements required to maximize transgene expression can often lie at substantial distances from the transcription unit. Consequently, transgenes designed to express such sequences are typically reduced to their bare minimum size by removal of sequences with indeterminate or poorly understood contributions to gene expression, such as introns and 5′ and 3′ untranslated sequences, even though these are features of virtually every mammalian gene. Such transgene “trimming” has the advantage that the transgene can be squeezed into viral vector systems like adeno associated viruses with packaging size limits.
When used as naked DNA smaller size can result in more efficient transfection either as a result of more cells up-taking DNA and/or more copies inserting into the host cell genome. A larger transgene copy number is often considered advantageous as this in principle can result in greater levels of gene expression. Indeed, methods to select for cells with increased copy numbers of the transfected DNA are often used where gene expression levels have a commercial benefit. Examples of this include the use of genes like DHFR and GS which can be used to select for clones with amplified copies of a transgene sited directly upstream of the selection cassette (Urlaub et al. 1980, Cockett et al. 1990).
Other methods of improving gene expression include the use of regulatory sequences that are better matched to the target cell—in other words using promoters from the Chinese hamster genome to drive expression in a CHO cell. Removal of prokaryotic sequences is also considered advantageous in preventing loss of transgene expression (Haruyama et al. 2009). Similarly, the coding sequences may be “optimized” to introduce a balance of codons that are more like those of the species of the destination cell lines/organism, rather than those used by the source species (Gustafsson et al. 2004). By removing rare codons translation speed is in principle enhanced, though this may have other less desirable features—as folding complex molecules may be more rate limiting than translation per se.
Despite these and other innovations, the process of isolating a high-yielding cell line with stable expression over many generations is tedious, slow and expensive, and typically many thousands of clones must be screened to find one with the appropriate features. Such cell lines are invariably empirically derived, although in some cases features of the integration site are also examined—for instance transgene integration in a so called “methylation canyon” is less likely to be susceptible to silencing than integration in more methylated regions.
The importance of intronic sequences in the context of eukaryotic gene expression was recognised over 40 years ago (Hamer et al. 1979) and since then various related processes have been shown to be affected by introns including initial transcription of the gene, rate of transcription, polyadenylation, nuclear export, RNA editing, translational efficiency, and mRNA decay (Le Hir et al. 2003, Shaul 2017). This understanding has also led to the current common practice of including a 5′UTR intron into standard transgene expression systems.
There are numerous examples of intron-mediated expression enhancement, but still the understanding in the field is incomplete with various conflicting results reported. For example, in some cases different introns positioned identically within a single gene would result in opposite effects on protein expression (Bourdon et al. 2001) and sometimes the same intron placed within different positions of the cDNA sequence also yielded opposing results (Buchman et al. 1988, Bourdon et al. 2001). There are examples of introns that directly or indirectly have a negative effect on gene expression (Gromak 2012, Jin et al. 2017) and the magnitude of intron-dependent positive effects have also varied tremendously, from almost nothing to more than a 400-fold increase in mRNA levels (Buchman et al. 1988, Bourdon et al. 2001). In an effort to understand the underlying conflicts, a recent publication concluded that introns only improve expression of AT-rich cDNA sequences, but do not benefit GC-rich sequences (Mordstein et al. 2020).
While most endogenous genes in higher eukaryotes contain many introns (Piovesan et al. 2019), the expression benefits from adding multiple introns into transgenes is controversial and has not been implemented into common practice. A few reports have described expression enhancement using constructs with multiple endogenous introns a.k.a. minigenes (Virts et al. 2001). The use of two heterologous introns in mammalian cells (Lacy-Hulbert et al. 2001) and multiple introns in plants (Marillonnet et al. 2010, Grutzner et al. 2021) has been reported to improve mRNA and protein expression but the basis of effect described by Lacy-Hulbert et al. was not understood, appears to be specific to the reported case and cannot be applied to similar situations. Various reports have detailed that the addition of more introns did not bring added benefit to expression levels (Crane et al. 2019). U.S. Pat. No. 9,708,636B2 (Enenkel 2017) reports insertion of one or more artificial introns to enhance gene expression, and advises to preferably use only one intron, in order to reduce the risk of alternative splicing. Furthermore, their intronization examples are limited to endogenous intronic locations within a cDNA.
It is remarkable that 20 years after the human genome was deciphered and most gene structures were defined at the nucleotide level, the underlying rules that enable transcripts to be correctly spliced are not understood. Even though the intron-exon boundaries are highly or absolutely conserved in species as distant as humans and mice (around 100 million years of evolution), it remains impossible to predict with any certainty where introns lie in a genomic sequence without accessing the mRNA sequence and aligning this to the genome. It has therefore not been possible to design a gene structure de novo that reliably and reproducibly produces a designed spliced product in an experimental setting. The fact that intron/exon junctions are so highly conserved across species teaches that there is very strong evolutionary selection for maintaining the status quo. Moreover, this conservation places a very severe impediment to deciphering the rules that enable a cell to determine what to splice and what to retain in a transcript.
Recent reports show that endogenous intron and exon definitions in humans and other vertebrates are not uniform and different splicing factors are used within different genomic context (Amit et al. 2012, Lemaire et al. 2019) highlighting the fact that introns are not uniform in the genome and may not perform well within a different genomic context, such as a transgene. Amit et al. observed that genes in low GC % genomic regions tend to have large AT-rich introns with a clear GC % gradient at intron-exon interface (Amit et al. 2012). Wang et al. (2014) arXiv: 1404.2487 [q-bio.GN] reported that grouping exons by the GC content of their flanking introns indicates that the average exon size is positively correlated with GC content.
The present inventors have developed methods for modifying transgenes to increase their expression in eukaryotic cells through the incorporation of multiple heterologous introns to generate exon regions of defined length with defined gradients of GC content across intron/exon boundaries. These methods may be useful in the in vitro and in vivo expression of proteins, for example, in the production of recombinant proteins, gene therapy and nucleic acid or virus-based vaccination. These methods may also be useful in in vitro and in vivo transfection systems, for example to generate transgenic animals or re-program or engineer cells, such as T cells and other immune cells, for example through recombinant expression of a chimeric antigen receptor or other antigen receptor.
A first aspect of the invention provides a method of adapting or modifying a complementary DNA (cDNA) sequence for expression in a eukaryotic cell comprising;
A second aspect of the invention provides a recombinant nucleic acid comprising a cDNA sequence for expression in a eukaryotic cell,
A third aspect of the invention provides an expression vector comprising a recombinant nucleic acid of the second aspect.
A fourth aspect of the invention provides a eukaryotic cell comprising a recombinant nucleic acid of the second aspect or an expression vector of the third aspect.
Other aspects and embodiments of the invention are described in more detail below.
The methods described herein relate to the modification of a transgene for expression in a eukaryotic cell. The transgene may comprise a cDNA sequence. Heterologous introns are inserted into the splicing consensus motifs of the cDNA sequence such that the cDNA sequence is divided into exon regions of a defined length. All or part of each heterologous intron nucleic acid has a sequence that has a GC content that is equal or lower than the GC content of all or part of the immediately downstream exon region. In some embodiments, a gradient of GC content may be generated across the intron/exon boundaries of the modified cDNA sequence.
A modified cDNA sequence that is produced as described herein may display increased expression in a eukaryotic cell relative to the unmodified cDNA sequence. In some embodiments, the amount of cryptic splicing that occurs when the modified cDNA sequence is expressed in a eukaryotic cell may be less than the amount that occurs when the unmodified cDNA sequence is expressed. This reduction in cryptic splicing may lead to increased production of correctly spliced transcripts and increased expression in eukaryotic cells. For example, a modified cDNA sequence may display an increase in expression of at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 100%, at least 200%, or at least 500% relative to the unmodified cDNA sequence.
Expression of a cDNA sequence may be determined by any suitable technique at either the mRNA or protein expression level.
In some embodiments, the expression of a cDNA sequence may be determined by measuring the level or amount of mRNA transcribed from the cDNA. For example, a steady state transcript count of full-length cytoplasmic mRNA transcribed from the cDNA may be compared to a standard or set of standards.
Cytoplasmic full-length mRNAs may be captured by standard techniques, such as RNA sequencing, either without amplification, with low amplification or with controls for amplification bias. In some embodiments, Shashimi plots may be used to visualize read density across exons as well as splicing artefacts.
In other embodiments, the expression of a cDNA sequence may be determined by measuring the level or amount of protein produced from the cDNA sequence. For example, the level or amount of a secreted protein may be determined as a molecules per cell per day compared to a standard or set of standards. The level or amount of protein may be determined using routine techniques, such as ELISA or surface plasmon resonance (SPR), western blots, mass spectrometry, size exclusion chromatography (SEC) and comparisons to a standard curve. In some embodiments, biological activity may be assessed compared to a standard. For example, factor VIII may be quantified in a thrombin generation assay [TGA] and viral proteins, such viral spike proteins, may be quantified in a pseudotyped viral assay. The level or amount of a protein that is retained on the surface of cells may be determined by any suitable technique, such as antibody staining and a shift in mean intensity of a population of transfected cells. Improved expression may also be indicated by a higher transfection efficiency as more cells achieve the threshold by which the transgene product is detectable in an assay.
A cDNA sequence as described herein is the nucleotide sequence of the exons of a gene. The cDNA may correspond sequence of an mRNA that is expressed as DNA bases. A cDNA may be produced by any suitable technique and is not limited to sequences generated by reverse transcription of mRNA.
A cDNA sequence may be expressed to produce a gene product, such as a protein or non-coding RNA molecule, for example a shRNA or long non-coding RNA (lncRNA). A cDNA sequence for a non-coding RNA may consist of a non-coding nucleotide sequence that is transcribed in the eukaryotic cell but are not translated.
In some preferred embodiments, the cDNA sequence may comprise a coding sequence that encodes the amino acid sequence of a protein. The cDNA sequence may be transcribed and translated in a eukaryotic cell following expression of the cDNA to generate the encoded protein. The cDNA sequence may further comprise one or more non-coding sequences that are transcribed in the eukaryotic cell but are not translated. Non-coding sequences may include 5′ and 3′ untranslated regions (UTRs) and a polyA tail. In some embodiments, the cDNA sequence may be devoid of endogenous introns from the gene. For example, the unmodified cDNA sequence may consist of the contiguous nucleotide sequence of the exons of the gene. In other embodiments, the cDNA sequence may further comprise one or more endogenous introns from the gene. Suitable endogenous introns display the GC content and spacing of the heterologous introns described herein. For example, in addition to two or more heterologous introns, a modified cDNA sequence as described herein may further comprise one or more endogenous introns.
The coding sequence of the cDNA sequence may encode a gene product, such as a protein. The cDNA sequence may encode any protein for which increased expression or overexpression is desired. Suitable gene products include therapeutic proteins, such as clotting factors, enzymes, toxins, hormones, antibody molecules, cytokines, receptors, such as PD-1, T cell receptors and chimeric antigen receptors. In other instances, suitable gene products include industrially relevant proteins, for example proteins that have a non-therapeutic application, such as proteins involved in the production of chemicals, fragrances, and food. Modification of the cDNA sequence as described herein may be useful in maximizing yields in manufacturing of the therapeutic or non-therapeutic protein; or increasing the expression of the therapeutic or non-therapeutic protein in vivo. Other suitable gene products include antigenic proteins, such as viral, bacterial and parasite protein antigens, and tumour antigens. Viral protein antigens may include coronavirus proteins, such as coronavirus Spike (S) protein (e.g. SARS-COV-2 S protein). Tumour antigens may include tumour-specific and tumour-associated antigens. Other suitable gene products include research proteins, for example gene editing proteins, such as Cas9 and fluorescent proteins, such as GFP.
The cDNA sequence may be any suitable length to encode a gene product of interest. For example, suitable cDNA sequences may be 200 nucleotides or more, 240 nucleotides or more, 300 nucleotides or more, 400 nucleotides or more, 500 nucleotides or more, 1000 nucleotides or more, 1500 nucleotides or more or 2000 or more nucleotides in length. In some embodiments, longer cDNA sequences, such as 1000 nucleotides or more, may be preferred for intronization as described herein.
A cDNA sequence suitable for modification as described herein may be from any source. For example, the cDNA sequence may be an artificial sequence; an archaebacterial sequence; a viral sequence; a bacterial sequence; or a eukaryotic sequence, such as a protozoan or mesozoan sequence, such as a mammalian sequence. In some embodiments, cDNA sequence suitable for modification as described herein may be from a source in which it is not exposed to a cell nucleus, such as a bacterial cDNA sequence or a cytoplasmic viral cDNA sequence.
A suitable cDNA sequence may be codon optimised for expression in a host eukaryotic cell. For example, the codons within the cDNA sequence of the cDNA may be modified to reflect the codon usage bias of the host eukaryotic cell. Techniques for codon optimisation are readily available in the art.
A cDNA sequence as described herein may be operably linked to a suitable regulatory element to form a transgene.
The cDNA sequence is modified as described herein by the incorporation of heterologous introns. The incorporation of heterologous introns as described herein may be referred to as “intronization”. An intronized cDNA sequence may be transcribed in eukaryotic cells to produce a pre-mRNA molecule that comprises heterologous introns. The introns are subsequently removed from the pre-mRNA during splicing in the eukaryotic cells to generate an mRNA molecule that comprises a cDNA sequence for translation, along with a 5′CAP, 5′ and 3′ untranslated regions (UTRs) and a polyA tail.
A heterologous nucleic acid is a nucleic acid that is foreign to a particular gene, or other biological system, and is not naturally present in that system. A heterologous nucleic acid, such as a heterologous intron, may be introduced to the gene or other biological system by artificial means, for example using recombinant techniques. For example, a heterologous intron is inserted into the cDNA sequence of a gene at a position in which it is not naturally present.
A heterologous intron may be artificial or may be naturally occurring. For example, a heterologous intron may occur naturally in a different gene from the cDNA sequence. The different gene may be in the same or different species as the cDNA sequence, for example, the different gene may be the corresponding gene in a different species from the cDNA sequence. In some embodiments, a heterologous intron may occur naturally in the same gene in the same species as the cDNA sequence but inserted in a different location within the cDNA sequence. For example, the order of the introns in a modified cDNA sequence may be changed relative to the gene in which the introns and cDNA sequence naturally occur.
A cDNA sequence modified as described herein may be expressed in a eukaryotic cell. Suitable eukaryotic cells include higher eukaryotic cells, for example higher plant cells or metazoan cells, such as insect cells and mammalian cells.
Suitable eukaryotic cells include isolated cell lines used for the production of recombinant proteins, for example mammalian cells such as Chinese Hamster ovary (CHO) cells, Baby hamster kidney cells (BHK), mouse myeloma cells (NS/O), and Human embryonic kidney (HEK) cells.
Other suitable eukaryotic cells include host cells in vivo, for example cells in a human or non-human individual. Expression of a cDNA sequence modified as described herein in host cells in vivo may be useful for example in gene therapy, immunotherapy, such as vaccination, and the production of transgenic non-human animals.
Other suitable eukaryotic cells include host cells ex vivo, for example cells obtained from a human or non-human individual. Expression of a cDNA sequence modified as described herein in host cells ex vivo may be useful for example in producing cells for cell therapy, such as hematopoietic stem cells and immune cells, such as T-cells and NK-cells.
Suitable eukaryotic cells include isolated cell lines used for the industrial production of recombinant proteins, for example yeast cells, such as S. cerevisiae cells or Pichia pastoris cells and insect cells, such as Trichoplusia ni cells.
The cDNA sequence of a transgene is modified as described herein to correspond more closely to the architecture of endogenous genes in eukaryotic cells. Without being bound by theory, the mimicry of endogenous gene architecture may reduce the amount of cryptic splicing that occurs during expression of the cDNA sequence in a eukaryotic system and increase the amount of gene product produced. A modified cDNA sequence may be of any suitable length for cloning and delivery into a eukaryotic cell.
The heterologous introns divide the cDNA sequence into exon regions, each heterologous intron having an upstream (5′) and a (3′) downstream exon region. Splicing of the heterologous introns during expression in a eukaryotic cell removes the introns and re-connects the exon regions to generate an mRNA molecule comprising the exon regions in a contiguous sequence.
The number of heterologous introns inserted into the cDNA sequence depends on the size of the cDNA sequence and the number of introns required to divide it into exon regions of 50 to 1200 nucleotides. For example, the cDNA sequence may be modified to comprise 2, 3, 4, 5, 6, 7, 8, 9, 10 or more heterologous introns.
A cDNA sequence suitable for modification as described herein may comprises 2, 3, 4, 5, 6, 7, 8, 9, 10 or more splicing consensus motifs. The splicing consensus motifs are the sites into which the heterologous introns are inserted into the cDNA sequence. The heterologous introns may be inserted in splicing consensus motifs within the cDNA sequence or UTRs of the cDNA sequence.
A splicing consensus motif is a nucleotide sequence within the cDNA sequence that comprises the exon element of a donor splice site that occurs at the 5′ end of an intron (5′ exon element) and the exon element of an acceptor splice site that occurs at the 3′ end of an intron (3′ exon element). A heterologous intron may be inserted into a splicing consensus motif between the 5′ and 3′ exon elements to generate an intronized cDNA sequence comprising the heterologous intron with a donor splice site at its 5′ end and an acceptor splice site at its 3′ end. Splicing consensus motifs may be frame independent and may occur in any reading frame of the cDNA sequence. Suitable splicing consensus motifs are known in the art and may comprise the nucleotide sequence (C/A/G)AG↑G(T/N)(T/N), preferably CAG↑GTT (site of insertion of heterologous intron between the 5′ and 3′ exon elements is indicated). Other suitable splicing consensus motifs include ATG↑AAT, CAG↑GTT, GAG↑ATT, CAG↑GCC, CAG↑GAT, GAA↑GCG, GTT↑CAA, CAT↑ATG, and CAG↑GAT. Splicing consensus motifs may be readily identified in a cDNA sequence using standard techniques.
The splicing consensus motifs may divide the cDNA sequence into exon regions of 50 to 1200 nucleotides, more preferably 80 to 380 nucleotides in length. In some preferred embodiments, the exon regions in the modified cDNA sequence may be 50 to 250 or 100 to 150 nucleotides in length.
Exon regions may be artificial exons generated in the cDNA sequence by the insertion of heterologous introns into consensus splice motifs. The cDNA sequence is divided by the heterologous introns into exon regions that together encode the gene product. In some embodiments, the cDNA sequence may comprise one or more endogenous introns that define one or more of the exon regions of the modified cDNA sequence.
In some embodiments, suitable splicing consensus motifs to divide the cDNA sequence into exon regions may be present or pre-existing in the cDNA sequence. A method described herein may comprise identifying splicing consensus motifs in the cDNA sequence. Sequence analysis tools for the identification of splicing consensus motifs is readily available in the art.
In other embodiments, the cDNA sequence may lack one or more of the splicing consensus motifs required to divide the cDNA sequence into exon regions. Splicing consensus motifs may be generated in the cDNA sequence by the introduction of one or more mutations to alter the existing cDNA sequence. Preferably, the one or more mutations generate one or more splicing consensus motifs without altering the sequence of the encoded protein. In some embodiments, the one or more mutations may also optimise the codons in the cDNA sequence for expression in a eukaryotic cell. In other embodiments, the one or more mutations may alter the sequence of the encoded protein, for example to increase or modify its activity.
A heterologous intron may be inserted between the 5′ and 3′ exon elements of a splicing consensus motif of the cDNA sequence.
Suitable heterologous introns may be 30 to 400 nucleotides in length, preferably 60 to 120 nucleotides or 80 to 100 nucleotides. The optimal intron length may be dependent on the eukaryotic host cell and may be optimised for expression in any specific eukaryotic host cell.
A heterologous intron may comprise
The heterologous intron may comprise a splice-donor sequence and a splice-acceptor sequence at the 5′ end and the 3′ end of the intron, respectively. The splice-donor sequence defines the 5′ end of the intron and the splice-acceptor sequence defines the 3′ end of an intron. Suitable splice-donor sequences may for example comprise a GT dinucleotide. Suitable splice-donor sequences may for example comprise an AG dinucleotide. The splice-donor and splice acceptor sequences of the heterologous intron may be optimised for the eukaryotic cell in which the cDNA sequence is expressed
The heterologous intron may further comprise a polypyrimidine tract (PPT). The polypyrimidine tract may be located upstream of the 3′ end of the heterologous intron, for example 5 to 40 nucleotides upstream of the 3′ end. The polypyrimidine tract may comprise a sequence of 15-20 nucleotides that is rich in pyrimidines (C and U). Suitable PPTs include 5′-UUUUUUUCCCUUUUUUUCC-3′ and variants thereof. Other suitable PPTs are known in the art (see for example Wagner et al 2001 Mol Cell Biol 21(10):3281-3288; WO2017171654A1).
The heterologous intron may further comprise a branch point sequence. The branch point sequence may be located upstream of the 3′ end of the intron nucleic acid and may for example be 20 to 50 nucleotides upstream of the 3′ end. The branch point sequence may comprise the sequence YURAC or YNURAC, where R=purine, Y=pyrimidine and N=any nucleotide. Suitable branch point sequences include 5′-UACUAACA-3′ and are known in the art (see for example Gao et al Nucl Acid Res 2008 36(7) 2257-2267; US20060094675).
GC content is the proportion of guanine or cytosine nucleotides in a nucleic acid sequence (i.e. (G+C)/total nucleotides) and is commonly expressed as a percentage (GC %). In some embodiments, insertion of a heterologous intron as described herein may generate a GC content gradient between the heterologous intron and the immediately downstream exon region (i.e. the exon region immediately adjacent the 3′ end of the heterologous intron). For example, a heterologous intron inserted into a splicing consensus motif may create a GC content gradient between the 3′ region of the heterologous intron and the 5′ region of the following exon region. The heterologous intron may comprise a 3′ region with a GC content that is lower than the 5′ region of the immediately downstream exon region. In other embodiments, the heterologous intron may comprise a 3′ region with a GC content that is the same as the 5′ region of the immediately downstream exon region. A gradient of GC content may not be generated between the heterologous intron and the immediately downstream exon region by insertion of the heterologous intron as described herein.
GC content may be measured starting from the interface in 3′ to 5′ direction for the intron and in 5′ to 3′ direction for the exon. Suitable tools for measuring GC content are readily available in the art.
The 3′ region of a heterologous intron inserted into the cDNA sequence may have a GC content that is equal to or at least 1%, at least 2%, at least 4%, at least 6%, at least 8%, at least 10%, at least 15% or at least 20% lower than the 5′ region of the immediately downstream exon region. In some embodiments, the 3′ region of the heterologous intron inserted into the cDNA sequence may have a GC content that is 0% to 46%, 2% to 40% or 5% to 35% lower than 5′ region of the immediately downstream exon region.
The size of the 3′ region of intron and the 5′ region of the downstream exon region (i.e. the window over which GC content is determined) may be 30 nucleotides or more, 40 nucleotides or more, 50 nucleotides or more, 60 nucleotides or more, 70 nucleotides or more, 80 nucleotides or more, 90 nucleotides or more or 100 nucleotides or more. In some embodiments, GC content may be determined across the whole of the intron and downstream exon region (i.e. the 3′ region of intron and the 5′ region of the downstream exon region may consist of the whole of the intron and exon region respectively). The GC content of the 3′ region of the heterologous intron may be equal to or lower than 5′ region of the immediately downstream exon region as described herein for 3′ and 5′ regions of any size.
In some preferred embodiments, the 3′ region of the heterologous intron and the 5′ region of the downstream exon region consist of 30 nucleotides. For example, the 30 nucleotides at the 3′ end of the heterologous intron may have a GC content that is equal to or lower, preferably up to 30%, 40%, 45%, 50% or 60% lower, than the 30 nucleotides at the 5′ end of the downstream exon region.
The sequence of a heterologous intron depends on the position within the cDNA sequence into which it is inserted. The GC content of the 5′ region of an exon region downstream of a splicing consensus motif may be determined. An intron sequence for insertion into the splicing consensus motif may then be designed that comprises a 3′ region with a GC content that is equal to or lower than the 5′ region of the exon region downstream of the splicing consensus motif, as described herein.
In some embodiments, the nucleotide sequence of a heterologous intron may be found in a naturally occurring intron, for example an intron from a different gene or a different position in the same gene.
In other embodiments, the nucleotide sequence of a heterologous intron may be artificial i.e. is not found in a naturally occurring intron. An artificial intron sequence may be designed using any convenient technique. For example, splice donor and splice acceptor sites may be positioned at the 5′ and 3′ ends of a nascent intron sequence. A branch point may be introduced to the middle of the nascent sequence. A random combination of T and C may be added to the nascent sequence to generate a pyrimidine tract of about 20 nucleotides. A random sequence of 50 or more nucleotides may be added between the pyrimidine tract and the branch point. Additional nucleotides may be added between the splice donor site and the branch point of the nascent sequence. The additional nucleotides may be random sequence with the A/T content adjusted to generate a GC % content equal to or lower than the 5′ region of the exon region downstream of the splicing consensus motif into which the intron is to be inserted. Suitable artificial introns may be 80-85 nucleotides in length. Suitable intron sequences for use as described herein are highlighted (lower case) in SEQ ID Nos: 1 to 30.
A suitable heterologous intron for insertion into a splicing consensus motif may be produced using standard synthetic or recombinant techniques. A method described herein may comprise providing heterologous introns for insertion into the two or more splicing consensus motifs in the cDNA sequence.
In addition to the insertion of heterologous introns, one or more further mutations may be introduced into the cDNA sequence, for example to remove cryptic splice sites. Cryptic splice sites may be identified by computational prediction tools that are readily available in the art (see for example Alternative Splice Site Predictor (Wang M. and Marín A. (2006) Gene 366: 219-227). Cryptic splice sites are preferably removed without altering the sequence of the gene product.
In some embodiments, a method described herein may comprise providing a nucleic acid comprising a cDNA sequence and inserting heterologous introns into the cDNA sequence of the nucleic acid as described herein to generate a nucleic acid comprising a modified cDNA sequence. Heterologous introns may be synthesised and inserted using standard techniques.
In other embodiments, a cDNA sequence that is modified to include heterologous introns may be designed and a nucleic acid comprising the modified cDNA sequence synthesised or assembled. For example, a method of adapting a cDNA sequence for expression in a eukaryotic cell comprising;
Steps 1 to 3 may be computer implemented, for example using standard sequence analysis software tools.
Examples of cDNA sequences modified as described herein are shown in SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NOs: 9-15, SEQ ID NOs: 17-21, SEQ ID NO: 25, SEQ ID NO: 27, and SEQ ID NOs: 28-30.
Also provided are cDNA sequences, nucleic acids, and transgenes modified as described herein. A recombinant nucleic acid as described herein may comprise a cDNA sequence for expression in a eukaryotic cell,
The cDNA sequence of the recombinant nucleic acid may be produced by a method described herein. In some embodiments, a recombinant nucleic acid or transgene comprising a modified cDNA sequence as described herein may be directly inserted into the genome of a eukaryotic cell. For example, a modified cDNA sequence may be knocked into an endogenous gene locus. Suitable techniques for the random or targeted insertion into a genome are well-known in the art and include for example CRISPR-, Lox/Cre-, or transposon-based techniques.
In other embodiments, a recombinant nucleic acid or transgene comprising a modified cDNA sequence as described herein may be cloned and/or incorporated into a nucleic acid construct or vector, such as an expression vector. For example, the cDNA sequence may be operably linked to one or more control elements or regulatory sequences capable of directing the expression of the cDNA sequence. Suitable control elements or regulatory sequences to drive the expression of heterologous nucleic acid cDNA sequences in eukaryotic cells, preferably mammalian cells are well-known in the art and include constitutive promoters, for example viral promoters such as CMV or SV40; and tissue specific promoters, for example promoters such as the human thyroxine binding globulin (TBG) promoter or system specific promoters such as hypoxia responsive promoters.
Further provided are constructs in the form of plasmids, vectors (e.g. expression vectors), such as viral vectors e.g. phage, or phagemid vectors, transcription or expression cassettes or other delivery systems which comprise an adapted or intronized cDNA sequence as described herein. For example, the modified or intronized cDNA sequence may be contained in an expression vector. Suitable expression vectors can be chosen or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate. A vector may also comprise sequences, such as origins of replication, promoter regions and selectable markers, which allow for its selection, expression and replication in bacterial hosts, such as E. coli.
Preferred vectors may be tropic for the cell type in which expression is required and may comprise suitable control and regulatory elements to enhance specific expression within that cell type.
Vectors may be plasmids, viral e.g. phage, or phagemid, as appropriate. For example, cosmids, BACs, or YACs may be used to accommodate long modified cDNA sequences. For further details see, for example, Molecular Cloning: a Laboratory Manual: 3rd edition, Russell et al., 2001, Cold Spring Harbor Laboratory Press. Many known techniques and protocols for manipulation of nucleic acid, for example in preparation of nucleic acid constructs, mutagenesis, sequencing, introduction of DNA into cells and gene expression, are described in detail in Current Protocols in Molecular Biology, Ausubel et al. eds. John Wiley & Sons, 1992. In some preferred embodiments, the expression vector may be a viral vector, such as a lentivirus or adeno-associated virus (AAV) vector.
The recombinant nucleic acid, transgene or expression vector may be introduced into a eukaryotic cell. The introduction may employ any available technique. Suitable techniques may depend on the vector and cell type and may include calcium phosphate transfection, DEAE-Dextran, electroporation, liposome-mediated transfection and transduction using retrovirus or other virus, e.g. vaccinia.
Nucleic acid may be introduced into the host eukaryotic cell using a viral or a plasmid-based system. The plasmid system may be maintained episomally or may be incorporated into the host cell or into an artificial chromosome. Incorporation may be either by random or targeted integration of one or more copies at single or multiple loci.
The introduction may be followed by causing or allowing expression of the modified cDNA sequence, e.g. by culturing host cells under conditions for expression of the gene.
Also provided are recombinant eukaryotic cells, for example recombinant mammalian cells, that comprise a recombinant nucleic acid or vector with a modified cDNA sequence as described herein. The cDNA sequence may be expressed in the cells to produce the gene product.
Systems for cloning and expression of nucleic acid in a variety of different host eukaryotic cells are well known. Suitable host cells include mammalian, insect and yeast systems. Mammalian cell lines available in the art for expression of a heterologous protein include Chinese Hamster ovary (CHO) cells, Baby hamster kidney cells (BHK), mouse myeloma cells (NS/O). and Human embryonic kidney (HEK) cells and many others.
Also provided are methods of expressing a cDNA sequence in a eukaryotic cell comprising;
The cDNA sequence may encode a gene product. Following production by expression of a nucleic acid comprising a modified cDNA sequence, the gene product may be isolated and/or purified using any suitable technique, then used as appropriate. For example, a method of production may further comprise formulating the product into a composition including at least one additional component, such as a pharmaceutically acceptable excipient.
Other aspects and embodiments of the invention provide the aspects and embodiments described above with the term “comprising” replaced by the term “consisting of” and the aspects and embodiments described above with the term “comprising” replaced by the term “consisting essentially of”.
The term “downstream” as used herein refers to the 5′ to 3′ direction in a nucleic acid described herein and the term “upstream” as used herein refers to the 3′ to 5′ direction in a nucleic acid described herein
Reference to a nucleotide sequence as set out herein encompasses a DNA molecule with the specified sequence, and encompasses a RNA molecule with the specified sequence in which U is substituted for T, unless context requires otherwise.
It is to be understood that the application discloses all combinations of any of the above aspects and embodiments described above with each other, unless the context demands otherwise. Similarly, the application discloses all combinations of the preferred and/or optional features either singly or together with any of the other aspects, unless the context demands otherwise.
Modifications of the above embodiments, further embodiments and modifications thereof will be apparent to the skilled person on reading this disclosure, and as such, these are within the scope of the present invention.
All documents and sequence database entries mentioned in this specification are incorporated herein by reference in their entirety for all purposes.
“and/or” where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. For example, “A and/or B” is to be taken as specific disclosure of each of (i) A, (ii) B and (iii) A and B, just as if each is set out individually herein.
Table 1 gives an overview of all the transgene constructs with the relevant 5′ and 3′ elements and the used plasmid backbone. Full DNA sequences of these constructs are given below. Wildtype (wt) SARS-COV-2 S protein CDS sequence refers to the S protein cDNA sequence from the Wuhan-Hu-1 isolate (Genbank: MN908947.3) while “18F” refers to the removal of the last 18 amino acids of the S protein C-terminus (ER retention sequence) and the addition of a FLAG tag. The DNA sequence for codon-optimized (c-o) SARS-CoV-2 S protein was obtained from the National Institute for Biological Standards and Control website (nibsc.org, CFAR #100976). mCherry CDS refers to the “synthetic construct monomeric red fluorescent protein gene” (Genbank: AY678264.1), with the stop codon changed from ‘TAA’ to ‘TGA’ while human ACE2 CDS refers to the “Homo sapiens angiotensin converting enzyme 2, mRNA transcript variant 2” (Genbank: NM_021804.3).
All constructs were assembled by Gibson cloning of relevant PCR products and/or custom designed gene blocks (gBlocks Gene Fragments, Integrated DNA Technologies) according to manufacturer's protocol (Gibson Assembly Master Mix, NEB).
Construct GC % was calculated using a sliding window of 30 base pairs (bp) across the sequence, resetting at each element (intron or exon) to highlight their GC % difference. For a given 30 bp window, the frequency of G and C nucleotides was measured (equals total count of G and C nucleotides in sequence divided by sequence length). Then the window would slide by 1 bp, moving in 5′ to 3′ direction. Last measurement for an element would be calculated when the sliding window hits the start of the next element. Then the window would jump 30 bp to start measuring GC % at the beginning of the next element. This gap in GC % measurement is visualized as a dashed line in
The GC % at intron-exon interface was calculated for every intron-exon pair (intron and it's following exon). The GC % was measured as above for various sequence lengths starting from the interface in 3′ to 5′ direction for the intron and in 5′ to 3′ direction for the exon, illustrated for 50 bp segments in
293FT cells were obtained from Dr. Kosuke Yusa's Lab. 293FT.Cas9 cell lines were generated through lentiviral integration of EF1a-Cas9-T2A-BlastR construct at low MOI to achieve single-copy integration. To generate cell lines permissive to Spike-Pseudotyped lentiviral infection, 293FT.Cas9 cells were engineered to stably express SARS-COV-2 receptors ACE2 and TMPRSS2. PiggyBac transposition was used to integrate EF1a-ACE2-T2A-TMPRSS2 constructs followed by single-cell cloning. This resulted in 293FT.Cas9.ACE2/TMPRSS2 clonal cell lines. Clones C10 and D10 were used in this work. 293T cells were obtained from Dr. Ravindra Gupta Lab and used mostly for Spike-Pseudotyped lentivirus production. JM8 mouse embryonic stem cell line was derived from B57BL/6N blastocyst (Pettitt et al. 2009). MC38 cells were purchased from Kerafast (cat. 2388609). All cell lines have tested negative for mycoplasma contamination.
Unless stated otherwise, all lines were maintained at 5% CO2 and 37° C. 293FT, 293T and MC38 cell lines were routinely cultured in M10 media (DMEM, 10% FBS and 2 mM L-glutamine). Cas9 expressing cell lines were maintained in M10 supplemented with 10 μg/mL Blasticidin. JM8 cells were maintained in M15 medium (DMEM, 15% FBS, 100 μM b-mercaptoethanol, and 2 mM L-glutamine), on a layer of irradiated feeder fibroblasts (SNL76/7).
Cell transfection was carried out using Lipofectamine LTX Reagent (Invitrogen) according to the manufacturer's instructions. For 6-well format transfections, Lipofectamine:DNA complexes were formulated using 750 ng DNA, 5 μL Plus reagent and 10 μL Lipofectamine LTX. These were then used to transfect 1.5 million cells per reaction. For analysis of transgene expression, cells were harvested with trypsin generally 48 h post-transfection. Samples were kept as frozen cell pellet for cDNA analysis or used directly for flow cytometry assays. For MC38 cells, transfections were performed using Amaxa Nucleofector (Lonza) using programme H-022 and Nucleofector kit V, according to the manufacturer's instructions. For the transfections, 0.41 pmols of DNA were transfected into one million cells per reaction.
cDNA Analysis
RNA was extracted from the frozen cell pellets using RNeasy Mini Kit (Qiagen) and treated with ezDNase (ThermoFisher) before applying oligo(dT) guided 1st strand cDNA synthesis using SuperScript VI reverse transcriptase (ThermoFisher), all according to manufactures' recommendations. RT-PCR was carried out using GoTaq Green Master Mix (Promega), following recommended protocol. PCR primers used to capture the entire length of investigated transgenes are enlisted in Table 2.
PCR products were both visualized on an agarose gel as well as TA-cloned using TA Cloning Kit with pCR2.1 vector and OneShot TOP10 Chemically Competent E. coli (ThermoFisher) according to kit instructions. After overnight growth on LB plates containing 100 μg/ml ampicillin at 37° C., single colonies were picked into 20 μl of PBS and the respective vector insert was PCR amplified with M13F (GTAAAACGACGGCCAGT) and M13R (CAGGAAACAGCTATGAC) primers, using GoTaq Green Master Mix. These PCR products were purified using AmPure XP magnetic beads (Beckman Coulter) following manufacture's recommendations and submitted to Sanger Sequencing (supplied by Source BioScience Inc) using the above M13F/M13R primers. On average, 24 clones per construct were assessed by PCR and 8 clones further selected for Sanger sequencing. All reads were mapped back to the original construct DNA sequence using SnapGene software to assess individual mRNA splicing events.
Cells were harvested 48 h post-transfection, using trypsin dissociation. For analysis of mCherry expression, cells were directly assessed by flow cytometry. When surface staining was needed, upon harvesting, cells were washed twice with staining buffer (see Table 3). They were then incubated with the appropriate dilution of primary antibody (in staining buffer) for 30 min at the indicated temperature. Cells were washed twice and incubated with secondary antibody (1:500) for 30 min on ice (for non-conjugated primary antibodies). Following another set of two washes, cells were analysed by flow cytometry using Cytoflex (BD Biosciences). Data analysis was performed using FlowJo software (BD Biosciences). S protein expression data is plotted as % of positively stained cells (
Pseudotyped Lentivirus was produced by transfection of 293T cells using lipofectamine LTX according to the manufacturer's instructions. All S protein constructs were tested using three independent virus productions. Briefly, 1 million 293T cells were seeded into gelatinized 6-well plates one day ahead of transfection. For transfection, 1 μg of lentiviral transfer vector (pCSGW-GFP), were mixed with 0.72 μg of gag-pol expressing plasmid p8.9 and 68.33 fmol of S protein expressing construct in 500 μL of optiMEM media followed by the addition of 2 μL of PLUS reagent and incubation for 5 minutes at room temperature. 6 μL of Lipofectamine LTX reagent were then added to the mix and incubated for 10 minutes. Medium was aspirated from the plates and the Lipofectamine:DNA complexes were added dropwise and topped-up with 1.5 mL of M10. Production was carried out at 5% CO2 and 32° C. Medium was changed the following morning to 2.5 mL of fresh M10 and the supernatant was harvested 56 hours later. Virus-containing supernatant was spun down at 500 g for 5 minutes to remove cell debris and used directly to infect permissive cell lines or aliquoted and frozen at −80° ° C.
Transductions were carried-out in 96-well plates, in duplicates for each independent virus sample. For pseudotyped lentivirus titrations, a dilution series was prepared ranging from 100% virus-containing supernatant to 1:500 dilution in a total volume of 200 μL M10 medium. 293FT.Cas9.ACE2/TMPRSS2 clonal cell lines were harvested by trypsinization and resuspend at a density of 70.000 cells per 30 μL. They were then seeded, 30 μL per well, mixed and incubated at 37° C. Viral infection efficiency was measured 48-72 h later, assessed by the percentage of GFP positive cells on flow cytometry. Data was analysed using FlowJo software (BD Biosciences). Pseudotyped lentivirus infection assay data is displayed either as % cells infected with the full dose of pseudotyped virus (
Addition of multiple introns to SARS-COV-2 Spike protein leads to alternatively spliced mRNA products. Wildtype (wt) SARS-COV-2 Spike (S) protein coding sequence (CDS) has proved difficult to be express as a transgene (Chen Ling 2020), similar to its related species SARS-COV Spike protein (Callendret et al. 2007). To improve its expression, two constructs with additional introns added to the wt S CDS were generated. While various intron insertion sites exist in endogenous genes (as well as in functional transgenes here), there is a slight preference in human canonical splicing consensus motifs for a sequence ‘(C/A)AG’ before intron and ‘G(T/N)(T/N)’ after intron (Sibley et al. 2016). For optimal placement of these introns, we looked for the presence of ‘CAGGTT’ nucleotide sequences in wt S protein, or for an opportunity to achieve that sequence using codon-optimisation. In wt S-protein, amino acid sequence ‘SGW’ in position 256-258 is encoded by ‘TCA-G|-intron-|GT-TGG’, containing the desired sequence (underlined) and hence providing an intron insertion site at the indicated location in G257. An opportunity for codon-optimised insertion site is available at amino acid sequence ‘DRL’ in position 1184-1186, where original nucleotide sequence: ‘GAC-CGC-CTC’ could be codon-optimised into an optimal intron insertion site: ‘GAC-AG|-intron-|G-TTG’ at amino acid R1185. The first generated construct (SEQ ID NO: 1 (P91),
S protein expression was measured 48 h after transfection into Hek293 cells but was not detected on the surface of the cells (data not shown). To investigate the reason, RT-PCR was conducted which detected a few strongly preferred alternatively spliced cDNA products. Sanger sequencing identified these products to consist of correct external exons of the S CDS construct, while the internal coding sequence was not incorporated in the mature transcript. It was removed via alternative splicing using either the canonical or cryptic splice sites within the introduced introns (
As the above-used introns do not exist together within the same gene in a natural setting, consecutive introns from endogenous human genes were tested next. The gene PRR36 (Genbank: NM_001190467) was identified as a potentially good intron donor due to its short introns but similar length CDS in relation to S protein. A vector was generated in which all PRR36 introns were inserted into S CDS, maintaining their endogenous 5′ to 3′ order and their nucleotide sequence setting (3 bp before and after intron, where possible). To some extent the exon length was consistent with the PRR36 structure (SEQ ID NO: 3 (P113),
To assess if the wt S CDS was driving the observed cryptic splicing in SEQ ID NO: 3 (P113), two more constructs were generated. First, 170 point mutations were introduced to wt S CDS to eliminate all cryptic splice sites identified in wt sequence using Alternative Splice Site Predictor (http://wangcomputing.com/assp/index.html) while retaining identical amino acid sequence and maintaining a similar GC % landscape (wt+ss, SEQ ID NO: 4 (P136),
Taking these data together, we confirm the addition of multiple introns, either well-defined ones from the literature and data bases or well used ones that are present in widely used expression systems, does not result in improved transgene expression due an underlying problem of alternative splicing. In other words, the assumption that a mammalian gene architecture that is sufficient for robust gene expression can be assembled merely by inserting numerous introns and removing cryptic sites was shown to be manifestly incorrect.
GC % Landscape that Enables Clear Definition of Exons and Intron
Amit et al. observed that genes in low GC % genomic regions tend to have large AT-rich introns with a clear GC % gradient at intron-exon interface (Amit et al. 2012). Whether this merely reflects the underlying bias between coding exons and non-coding introns in low GC % regions or is functionally significant requires experimental assessment. To test the effect of intron-exon GC % gradient in the context of transgenes with relatively short introns, a local and systematic change was introduced to a non-functional construct SEQ ID NO: 6 (P143). This construct consisted of 13 short introns from human TTN gene inserted into the wt-ss S sequence. Transfection of SEQ ID NO: 6 (P143) resulted in various alternative splicing outcomes (
In order to further characterize what defines a functional intron-exon interface, GC % was calculated for different length segments of DNA (10-80 bp+full length of the element) measured from the interface outwards for 29 neighbouring intron-exon pairs from 3 different correctly splicing constructs (SEQ ID NO: 11 (P171), SEQ ID NO: 14 (P186), SEQ ID NO: 25 (P237), SEQ ID NO: 30 (P243),
After solving the critical landscape requirements for correct intron and exon recognition in transgenes, the number of optimal introns could be addressed. An increasing number of introns were inserted into the SEQ ID NO: 8 (P166) sequence: 3, 7, 13, 14, 15 introns (SEQ ID NO: 9 (P205), SEQ ID NO: 10 (P204), SEQ ID NO: 11 (P171), SEQ ID NO: 12 (P231), SEQ ID NO: 13 (P232),
A similar outcome was observed when intronizing mCherry CDS with 1, 3, 4, 7 or 8 introns (SEQ ID NO: 21 (P233) to SEQ ID NO: 25 (P237),
Similar improvement in expression was seen when intronizing human ACE2 CDS, most prominently with the addition of 6 and 9 introns (SEQ ID NO: 27 (P95), SEQ ID NO: 28 (P223), SEQ ID NO: 29 (P242)-SEQ ID NO: 30 (P243),
Taken together, transgene expression could be improved with internal exons as large as 501 bp-1146 bp, but the optimal expression outcome required internal exon sizes to be between 84 bp-372 bp. These data are consistent with previous findings in human endogenous genes demonstrating the optimal exon length for efficient splicing to be between 50 bp and 250 bp (Movassat et al. 2019).
To explore the type of intronic sequences that enable the formation of the correct intron-exon landscape in a multiple intron setting, a series of constructs were generated with different introns embedded into c-o S CDS (
Next, a number of exogenous introns with similar criteria were introduced into SEQ ID NO: 11 (P171) sequence, substituting the third intron (TTN intron 196). This included an intron from unicellular yeast (S. cerevisiae, CMC2, intron 1, SEQ ID NO: 15 (P226)), a nematode (C. elegans, rcor-1, intron 5, SEQ ID NO: 16 (P227)), a fruit fly (D. melanogaster, eIF4G, intron 5, SEQ ID NO: 17 (P228)) and a mouse (M. musculus, Ttn, intron 125, SEQ ID NO: 18 (P229)) (
Given the above, we next introduced two artificial intronic sequences into the SEQ ID NO: 11 (P171) third intron position (SEQ ID NO: 19 (P230), SEQ ID NO: 20 (P241),
Intronization Leads to Improved Expression Levels within Various Contexts
Above-developed rules for optimal transgene expression using multiple introns was tested in the context of different transgenes and cell lines (
Above three intronized transgenes were first tested against their intronless counterparts in human 293FT cells. Intronized S protein (stained with antibodies), mCherry (direct measurement of fluorescence), and ACE2 (stained with antibodies) showed improvement both in percent of cells expressing the protein as well as in the amount of expression per cell, displayed as fold change difference in population median expression values (
GTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCCCTCGAAGCTTACAT
GTGGTACCGAGCTCGGATCCTGAGAACTTCAGGgtgagtctatgggacccttgatgttttctttccccttcttttctatggttaagt
TGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGCACAGGAGATCTGCCACCATGTTTGTTTTTCTTGTTTTATTGCCACTAGTC
GTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCCCTCGAAGCTTACAT
GTGGTACCGAGCTCGGATCCTGAGAACTTCAGGgtgagtctatgggacccttgatgttttctttccccttcttttctatggttaagt
TGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGCACAGGAGATCTGCCACCATGTTTGTTTTTCTTGTTTTATTGCCACTAGTC
GTCAGATCGCCTAGCCCCCTCCCCTCGCCTCCTCGCCGCTGGCGGCCACCGCGTCGCTCCGGCCCGGGCCCCACCCCAGGCGACTCT
GTGAGGAGCGGCCGGAGGCCGGAGGCGGAGgtgagcgcgacgcgagcaggtggagaggctgggcgcgggccaggcccggctggggga
GTTTTAGACCCCGCCTCCACTGCCCTGGAGCCCCGCTGGGTGGATTAGTCTTAGCTCCCTAGAGCCTGAGCCTTTGGCCTCGGAGGC
TCGGGACCTACCCACAGCTTTGACCTAGGCCCGCCCCTCGAGCTCCGCCCCTTTGGCCTAGGACACGCCCCGTTTCCCCGAGTCCCG
CCCCGTGTGCAGTGTATTGCCCACCCCGCACAGCCTGAGTTTGCAATAAAACTGGGACACTGGGACTTGCA
GTCAGATCGCCTAGCCCCCTCCCCTCGCCTCCTCGCCGCTGGCGGCCACCGCGTCGCTCCGGCCCGGGCCCCACCCCAGGCGACTCT
GTGAGGAGCGGCCGGAGGCCGGAGGCGGAGgtgagcgcgacgcgagcaggtggagaggctgggcgcgggccaggcccggctggggga
GTTTTAGACCCCGCCTCCACTGCCCTGGAGCCCCGCTGGGTGGATTAGTCTTAGCTCCCTAGAGCCTGAGCCTTTGGCCTCGGAGGC
TCGGGACCTACCCACAGCTTTGACCTAGGCCCGCCCCTCGAGCTCCGCCCCTTTGGCCTAGGACACGCCCCGTTTCCCCGAGTCCCG
CCCCGTGTGCAGTGTATTGCCCACCCCGCACAGCCTGAGTTTGCAATAAAACTGGGACACTGGGACTTGCA
GTCAGATCGCCTAGCCCCCTCCCCTCGCCTCCTCGCCGCTGGCGGCCACCGCGTCGCTCCGGCCCGGGCCCCACCCCAGGCGACTCT
GTGAGGAGCGGCCGGAGGCCGGAGGCGGAGgtgagcgcgacgcgagcaggtggagaggctgggcgcgggccaggcccggctggggga
GTTTTAGACCCCGCCTCCACTGCCCTGGAGCCCCGCTGGGTGGATTAGTCTTAGCTCCCTAGAGCCTGAGCCTTTGGCCTCGGAGGC
TCGGGACCTACCCACAGCTTTGACCTAGGCCCGCCCCTCGAGCTCCGCCCCTTTGGCCTAGGACACGCCCCGTTTCCCCGAGTCCCG
CCCCGTGTGCAGTGTATTGCCCACCCCGCACAGCCTGAGTTTGCAATAAAACTGGGACACTGGGACTTGCA
| Number | Date | Country | Kind |
|---|---|---|---|
| 2108855.4 | Jun 2021 | GB | national |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/EP2022/066763 | 6/20/2022 | WO |
