Methods of producing doxorubicin

BACKGROUND OF THE INVENTION
Daunomycin and doxorubicin are clinically important chemotherapeutic agents. Daunomycin is used primarily to treat adult myelogenous leukemia. Doxorubicin is widely used to treat a variety of neoplasias, making it the more valuable of the two anticancer drugs. The world wide market for doxorubicin is estimated to exceed $156 million. As of 1984, the wholesale price for doxorubicin was estimated to be $1,370,000 per kilogram.
While daunomycin is synthesized by several species of Streptomyces, doxorubicin is biologically synthesized by only one strain, a mutant strain of Streptomyces peucetius, called S. peucetius subsp. caesius which is available from the American Type Culture Collection under Accession number 27952.
The alternative in vitro laboratory synthesis of doxorubicin is difficult. The in vitro synthesis of doxorubicin is a process involving multiple steps and resulting in a poor yield, with a lack of stereospecificity in several of the synthetic steps, producing forms which are difficult to separate.
Chemical synthetic procedures are known for converting daunomycin to doxorubicin; however they require the use of halogens in the synthetic process.
It would be desirable to have an efficient, cost-effective method for producing doxorubicin that does not require the use of halogens in the synthetic process.
SUMMARY OF THE INVENTION
The present invention provides novel methods for producing doxorubicin using daunomycin as a substrate. One method employs a genetically engineered host microorganism which is transformed with a vector, preferably a plasmid, which contains the doxA gene. Preferably, the doxA gene, also referred to herein as "doxA", is cloned into a plasmid which is then introduced into the host microorganism, preferably a bacterial host, more preferably Streptomyces, to provide a transformed host microorganism. The doxA gene, when present on a plasmid, confers on the transformed host the ability to convert daunomycin and 13-dihydrodaunomycin, to doxorubicin. The doxA gene encodes a cytochrome P450-type enzyme which catalyzes the hydroxylation of daunomycin and 13-dihydrodaunomycin at C-14 to form doxorubicin; such enzyme is designated "daunomycin C-14 hydroxylase". Thus, the expression of doxA in the transformed host using a plasmid which contains doxA enables the transformed host to convert daunomycin to doxorubicin. The doxorubicin is then extracted from host microorganism cultures.
Another method for producing doxorubicin involves incubating the daunomycin C-14 hydroxylase with daunomycin, then extracting the doxorubicin from the solution.
Another method involves adding daunomycin to cultures of Streptomyces sp. strain C5 and extracting doxorubicin from the culture fluid and the host cells.
The invention also relates to daunomycin C-14 hydroxylase, novel plasmids, novel polylinkers and novel transformed host microorganisms employed in such method for producing doxorubicin. The invention also relates to methods for producing anthracyclines, such as 13-deoxycarminomycin and 13-deoxydaunomycin, 13-dihydrocarminomycin and 13-dihydrodaunomycin, carmninomycin and daunomycin.

BRIEF DESCRIPTION OF FIGURES
FIG. 1 is a restriction map of the Streptomyces sp. strain C5 daunomycin biosynthesis gene cluster which shows the position of doxA within the cluster. Abbreviations for restriction endonuclease sites are as follows: "B" represents BamHI; "Bg" represents BglII; "C"represents ClaI; "E" represents EcoRI; "K" represents KpnI; "P" represents PstI; "S" represents SstI; and "X" represents XhoI;
FIG. 2 is a detailed restriction map of part of the daunomycin biosynthesis gene cluster from Streptomyces sp. strain C5. Abbreviations for restriction endonuclease sites are as follows: "B" represents BamHI; "Bg" represents BglII; "E" represents EcoRI; "K" represents KpnI; "P" represents PstI; "S" represents SstI; "Sp" represents SphI;
FIG. 3A and 3B is a nucleotide sequence of the 3196 base pair KpnI- SstI DNA fragment from Streptomyces sp. strain C5 containing the doxA gene. The deduced amino acid sequence of the daunomycin C-14 hydroxylase is given below the nucleotide sequence. Potential ribosome binding sites, designated "rbs" are identified, as are significant restriction endonuclease sites. The sequences and deduced products of the 3' end of orfl, all of orfA, and the 5' end of dauI are also shown;
FIG. 4 shows the plasmid maps of plasmid pANT849 and the plasmids pANT42 and pANT842 which were used to construct pANT849;
FIG. 5 shows the plasmid maps of pANT195 and plasmids pANT849, pANT186, pANT185, pANT235 and pUC19 all of which were used to construct pANT195;
FIG. 6 shows the sequence of snpR, doxA, and the intervening sequences within plasmid pANT195;
FIG. 7 shows plasmid maps of pANT192 and pANT193;
FIG. 8 shows plasmid maps of pANT194 and pANT196;
FIG. 9 shows the N-terminal, modified region of the doxA fusion protein;
FIG. 10 shows plasmid maps of pANT198 and pANT199; and
FIG. 11 shows sequence of the doxA gene and upstream melC1 promoter regeion in pANT196; and
FIG. 12 shows a plasmid map of pANT144.

DETAILED DESCRIPTION OF INVENTION
A novel method for producing doxorubicin from daunomycin has been developed which employs genetically engineered host microorganisms that contain and express the gene doxA. Preferably, doxA is cloned into a plasmid which is then inserted into a host microorganism, preferably a bacterial host, more preferably Streptomyces, most preferably Streptomyces lividans to provide a transformed host. The doxA gene encodes daunomycin C-14 hydroxylase which catalyzes the hydroxylation of daunomycin and 13-dihydrodaunomycin at C-14 to form doxorubicin. Thus, expression of doxA in the transformed host using a plasmid which contains the doxA gene enables the transformed host to convert daunomycin to doxorubicin.
Daunomycin is also known as daunorubicin; doxorubicin is also known as 14-hydroxydaunomycin and adriamycin. The structure of daunomycin is shown below: ##STR1##
The structure of doxorubicin is shown below: ##STR2## Cloning and Analysis of the DoxA Gene
Streptomyces sp. strain C5 synthesizes several compounds in fermentations, that is such compounds are produced from common metabolic intermediates and without the addition of precursor anthracycline molecules to the culture media. Streptomyces sp. strain C5 produces the following anthracyclines: e-rhodomycinone; daunomycin; 13-dihydrodaunomycin; baumycin A1; and baumycin A2. Nevertheless, a gene, the doxA gene, was discovered in the genome of Streptomyces sp. strain C5 which, when expressed, converts daunomycin, particularly exogenous daunomycin, to doxorubicin. Preferably, the conversion of daunomycin to doxorubicin is accomplished by cloning the doxA gene along with a promoter into a plasmid which is then introduced into a host microorganism.
It has also been discovered that Streptomyces sp. strain C5 can convert small amounts, less than 10%, daunomycin to doxorubicin in the absence of plasmid containing the doxA gene.
Preferably, the doxA gene is cloned from Streptomyces, preferably Streptomyces sp. strain C5. Alternatively, the doxA gene is synthesized using conventional oligonucleotide synthesis techniques and equipment.
The doxA gene is located in the daunomycin biosynthesis gene cluster between the daunomycin polyketide biosynthesis genes and dauI, a putative transcriptional activator as shown in FIG. 1. The location of doxA within the Streptomyces sp. strain C5 daunomycin biosynthesis gene cluster is shown in FIG. 2.
The approximately 8 kbp region between daul, a gene encoding an activator regulatory protein for daunomycin biosynthesis, and the daunomycin polyketide synthase biosynthesis genes was sequenced in its entirety.
Plasmids containing inserts to be sequenced were isolated from recombinant E. coli JM83, available from Dr. Mary Berlyn, E. coli Genetic Stock Center, Yale University, P.O. Box 6666, New Haven, Conn. 06511-7444 by the methods disclosed in Carter, M. J., and I. D. Milton, (1993), "An Inexpensive and Simple Method for DNA Purification on Silica Particles," Nucleic Acid Res. Volume 21, p. 1044. The doxA DNA was sequenced in both directions, that is, both strands were sequenced using Sequenase enzyme, Version 2.0 from the United States Biochemical Corp., Cleveland, Ohio, according to the manufacturer's instructions, and as described in Ye, et. al., 1994, "Isolation and Sequence Analysis of Polyketide Synthase Genes from the Daunomycin-producing Streptomyces sp. strain C5 " J Bacteriol. 176:6270-6280. Doubled-stranded DNA templates were employed. The terminated chains were labeled with 3000 Ci/mmol (a- .sup.32 P)dCTP from Dupont -New England Nuclear, Boston, Mass. The terminated labeled chains were separated on a 6% weight-to-volume polyacrylamide gel containing 10% (volume-to-volume) formamide and visualized by autoradiography. Sequencing reactions were carried out using 7-deaza-dGTP nucleotide mixes to reduce compressions. Forward (-40) and reverse universal pUC/m13 17-mer oligonucleotide primers from U.S. Biochemical Corp. were used to obtain the initial sequences in the inserts. Specific primers, 15-mer oligonucleotides, were generated based on sequencing results for extension of the sequences within the inserts.
DNA sequence data were analyzed using Clone Manager from Stateline, Pa., and the Sequence Analysis Software Package of the Genetics Computer Group from Madison, Wis.
The nucleotide sequence between dauI and the ketoreductase just downstream of dauA-orfG is shown in FIG. 3. Two complete open reading frames, orfA and doxA, were found within this sequence; OrfA encodes a protein of M.sub.r 28,808, and 275 amino acid residues, and doxA encodes a protein of M.sub.r 46,096 and 422 amino acid residues.
Plasmids
The doxA gene is inserted into a vector, preferably a plasmid. Optionally, the plasmid contains genes from the daunomycin synthesis cluster in addition to doxA. However, preferred plasmids lack dauA(g) and more preferred plasmids lack dauA(g), orfl and orfA.
The preferred plasmids contain not only the translated portion of doxA but a promoter. Suitable promoters include, Streptomyces promoters for example, melC1-P, ermE-P, wild type, and snpA-P. The snpA-P promoter is the most preferred. Preferably, the promoter is a protein activated promoter, and most preferably, an SnpR-activated promoter. Less preferred plasmids, such as pANT196, contain a melC1 promoter from pIJ702 for expression of doxA. Also less preferred are plasmids which lack a known promoter, such as pANT194.
The most preferred plasmid which contains doxA is designated "pANT195" which is shown in FIG. 5. Host microorganisms, when transformed with plasmid pANT195, convert 100% daunomycin to doxorubicin. Other plasmids which contain doxA are suitable, including, for example pANT192, pANT193, pANT194 and pANT196. Host microorganisms, when transformed with plasmid pANT192, typically convert about 25% daunomycin to doxorubicin at a concentration of 2 mg/ml. Host microorganisms when transformed with pANT193 convert about 80% daunomycin to doxorubicin and about 20% daunomycin to 13-dihydrodaunomycin, at a daunomycin concentration of 2 mg/ml.
Construction of the Plasmids
Digestion of and ligation of DNA was performed using conventional techniques described by Maniatis et al. (1982) in "Molecular Cloning: A Laboratory Manual," Cold Spring Harbor Laboratory, New York.
Construction of pANT195
Plasmid pANT195, shown in FIG. 5, has about 7.04 kbp of DNA. Plasmid pANT195 was constructed by inserting the 1.72 kbp SphI-SacI fragment insert containing intact doxA from plasmid pANT186 into pANT849.
First, plasmid pANT186 was constructed by constructing pANT235. Plasmid pANT235 is described in Ye et. al. 1994 "Isolation and Sequence Analysis of Polyketide Synthase Genes from the Daunomycin-Producing Streptomyces sp. Strain C5 " J Bacteriol. Vol. 176, pp. 6270-6280. Plasmid pANT235 is a 9.2 kbp plasmid which contains a 6.48 kbp BamHI-BglII DNA fragment from the Streptomyces sp. strain C5 daunomycin biosynthesis gene cluster. The doxA gene lies within the insert of pANT235 which is derived from the daunomycin biosynthesis gene cluster. The BamHI-BglII DNA fragment had been cloned into the BamHI site of pUC19 to generate pANT235. Plasmid pUC19 is available from Gibco BRL, Gaithersburg Md.
Next, pANT235 was digested with SalI and SstI and the digestion products were purified on an agarose gel. The 1.67 kbp SalI-SstI fragment containing the 3.sub.-- end of the doxA gene and the 5.sub.-- end of daul was extracted from the agarose gel and ligated into pUC19 with T4 DNA ligase, from Gibco BRL, Gaithersburg Md., to generate pANT185, as shown in FIG. 5.
Next, pANT235 was used as the template for the polymerase chain reaction amplification of the 5.sub.-- -end of the doxA gene containing an upstream ribosome binding site and SphI restriction site for the 5' end and BspEI restriction site for the 3' end.
The forward primer used in the polymerase chain reaction amplification of the doxA gene had the following nucleotide sequence: 5.sub.-- -GACATGCATGCGGAGGGGTGCCTC-3.sub.-- SEQ ID NO:1 The forward primer which is used for the 5.sub.-- -end, contains an SphI site with five extra nucleotides on the end and the extra ribosome binding site "GGAGG". The reverse primer had the following nucleotide sequence: 5.sub.-- -GACGCAGCTCCGGAACGGGG-3.sub.-- SEQ ID NO:2 The reverse primer which is used for the 3.sub.-- -end, has a BspEI site plus eight extra nucleotides.
The polymerase chain reaction amplification was carried out for 25 cycles using Deep Vent Polymerase from New England Biolabs, Beverly, Mass. The solution for PCR included: 2.0 ml dimethylsulfoxide; 14.5 ml double distilled water; 1.25 mM dNTPs, 16.0 ml of a total stock containing DATP, dCTP, dTTP, dGTP; 5.0 ml 10.times.Deep Vent Buffer, from New England Biolabs; 5 ml forward primer; 5 ml reverse primer; 0.5 ml Deep Vent polymerase; 2.0 ml DNA template, 14.5 ml distilled water, and boiled for 10 minutes. PCR was carried out by incubating the reaction mixture at 94.degree. C. in the absence of Deep Vent Polymerase for 5 minutes, following by 25 cycles of the following regimen: 94.degree. C. for 30 seconds, 55.degree. C. for 30 seconds, 72.degree. C. for 30 seconds. After 25 cycles were completed, the mixture was incubated at 72.degree. C. for 7 minutes and then held at 4.degree. C. until further use.
The products of PCR were separated on a 0.8% agarose gel, and a 298 base pair DNA fragment was eluted from the gel. The 298 base pair DNA fragment was then digested with SphI and BspEI to generate a 285 base pair fragment with "sticky" ends. pANT185 was digested with SphI and BspEI and the 285 base pair fragment ligated into pANT185 to generate pANT186 which was introduced into dam/dcm-minus E. coli strain ET12567. MacNeil, et. al. (1992) "Analysis of Streptomyces avermitilis Genes Required for Avermectin Biosynthesis Utilizing a Novel Integration Vector", Gene, vol. 111, pages 61-68. Plasmid pANT186 contains the complete doxA gene, upstream of which lay the newly constructed ribosome binding site having the nucleotide sequence GGAGG. The nucleotide sequence of the PCR-generated 5.sub.-- end of the gene was confirmed by dideoxy sequencing.
Plasmid pANT849, shown in FIG. 4, was constructed by first constructing pANT842. Plasmid pANT42, described in Lampel, et. al., 1992 "Cloning and Sequencing of a Gene Encoding a Novel Extracellular Neutral Proteinase from Streptomyces sp. Strain C5 and Expression of the Gene in Streptomyces lividans 1326 "J. Bacteriology 174:2797-2808, was digested with KpnI and religated, removing a 1.95 kbp KpnI fragment to yield pANT842.
A novel polylinker sequence, having 48 nucleotides, was constructed according to conventional techniques using synthesized DNA oligonucleotides by Integrated DNA Technologies, Inc., Coralville, Iowa. The polylinker sequence has the following nucleotide sequence:
SEQ ID NO:3SphI BglIISacI DraI HpaIGCATGCGAATTCAGATCTAGAGCTCAAGCTTTAAACTAGTTAACGCGT EcoRI XbaI HindIII SpeI MluI
Plasmid pANT842 was digested with SphI-MluI to remove a 1.42 kbp SphI-MluI fragment. The polylinker sequence was ligated into SphI-MluI-digested pANT842 to provide plasmid pANT849. Plasmid pANT849, shown in FIG. 4, has 5.34 kbp of DNA and lacks the snpA gene and most of melC2. Plasmid pANT849 does have the SnpR-activated snpA-promoter, which is located immediately upstream of the polylinker sequence as shown in FIG. 4. pANT849 is a high copy number plasmid and contains the thiostrepton resistance gene as the selectable marker.
Next, to construct pANT195, a clone of pANT186 which contains the modified doxA gene, was digested with SphI and SstI, and pANT849 was digested with SphI and SstI. The fragment from pANT186 containing the doxA gene was ligated into the polylinker sequence of pANT849 to make pANT195 as shown in FIG. 5.
The sequence of the region of pANT195 containing the snpR activator gene, the SnpR-activated snpA promoter, and the 5.sub.-- -end-modified doxA gene is shown in FIG. 6, and SEQ ID NO:6.
Construction of pANT192
Plasmid pANT192 shown in FIG. 7 is an 11.84 kbp plasmid which contains DNA encoding the acyl carrier protein and its putative promoter, a ketoreductase (orf1), orf2, a partial orf3, orfA, doxA, dauI, and most of dauJ. Plasmid pANT192 was constructed by removing the 6.52 kbp HindIII-EcoRI fragment from pANT235 which includes the entire BglII-BamHI fragment, by digesting pANT235 with HindIII and EcoRI. Next pANT849 was digested with HindIII and EcoRI and the 6.52 kbp HindIII-EcoRI fragment from pANT235 was ligated into pANT849.
Construction of pANT193
Plasmid pANT193, shown in FIG. 7, has 10.28 kbp of DNA and contains part of orf1, all of orfA, and doxA driven by the snpR-activated snpA-promoter. Plasmid pANT193 was constructed by digesting plasmid pANT235 with KpnI, and the 1582 base pair KpnI fragment removed. The plasmid was re-ligated to itself to form pANT235-k. Plasmid pANT235-k was digested with EcoRI and HindIII to remove the 4.95 kbp EcoRI-HindIII fragment. pANT849 was digested with EcoRI and HindIII and the 4.95 kbp EcoRI-HindIII fragment from pANT235-k was ligated into the digested pANT849.
Construction of pANT194
Plasmid pANT194, shown in FIG. 8, has 8.97 kbp of DNA and contains the part of orf1, all of orfA, daul, dauJ and doxA but lacks any known promoter to drive the expression of doxA. Plasmid pANT194 was constructed by digesting pANT192 with KpnI to remove a 2.87 kbp KpnI fragment and then religating the plasmid to itself.
Construction of pANT196
Plasmid pANT196, shown in FIG. 8, has 7398 bp of DNA and possesses a promoter melC1 which drives the expression of the doxA gene. pANT186 was digested with SphI and SstI and a 1712 nucleotide SphI-SstI fragment from pANT186 containing doxA was isolated and ligated into SphI-SstI digested pIJ702. Plasmid pIJ702 is a 5.686 kbp plasmid which is described in Katz, E., et. al. (1983) "Cloning and Expression of the Tyrosinase Gene from Streptomyces antibioticus in Streptomyces lividans" J. Gen. Microbiol. volume 129, pages 2703-2714.
Construction of pANT198
Plasmid pANT186 was digested with SphI and then incubated with T4 DNA polymerase from Gibco BRL, according to the manufacturer's instructions to yield a blunt end. Plasmid pZero from Invitrogen, San Diego, Calif., was digested with EcoRI and then filled in 5' to 3' using Klenow fragment of DNA polymerase according to the manufacturer's instructions to provide a blunt end. Both fragments were purified according to the methods described in Carter, M. J. and I. D. Milton (1993), Nucleic Acid Res. volume 21, pages 1044. The fragments were precipitated in ethanol for one hour at -70.degree. C. and then digested with SstI overnight. The plasmid and insert, each of which contains a single blunt end and an SstI end, were purified from an agarose gel and then ligated overnight with T4 DNA ligase at room temperature, to provide pANT198.
Construction of pANT199
Plasmid pANT198 was digested with EcoRI-HindIII, the EcoRI-HindIII fragment removed and ligated into pTrcHisC from Invitrogen to construct pANT199. In pANT199, the doxA gene is translationally fused with a leader sequence encoding six histidine residues, shown in SEQ ID NO:7 so that the fusion protein can be affinity purified on a nickel-agarose gel.
pANT849
Plasmid pANT849 in addition to being useful to construct pANT195 is also useful expression vector for other genes. To construct other such plasmids pANT849 is digested with at least one restriction endonuclease corresponding to the restriction sites in the polylinker, such as, for example, SphI, BglII, SacI, DraI, HpaI, EcoRI, XbaI, HindIII, SpeI, or MluI. The desired gene sequence to be inserted into the plasmid is provided with sticky ends corresponding to the sticky ends of the cut pANT849. The desired gene is then ligated into the plasmid to provide a new plasmid derived from pANT849.
Host Microorganisms
Suitable host microorganisms for the doxA plasmid possess electron donating, cytochrome P450 accessory proteins; suitable accessory proteins include for example, NADPH:ferredoxin oxidoreductase and ferredoxin. The preferred host microorganisms are bacteria, more preferably E. coli or Streptomyces spp., most preferably Streptomyces lividans TK24 and Streptomyces coelicolor CH999. Streptomyces coelicolor CH999 is a mutant of Streptomyces coelicolor A3(2). Streptomyces lividans TK4 is available from Professor David A. Hopwood, Head, Department of Genetics, John Innes Centre, Norwich Research Park, Colney, Norwich NR4 7UH, United Kingdom. Streptomyces coelicolor CH999 is available from C. Khosla, Stanford University, Palo Alto, Calif. and Professor David A. Hopwood. S. peucetius is available from the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Md., U.S.A. under the accession number 29050. Streptomyces sp. strain C5 was obtained from the Frederick Cancer Research Center, Frederick Md. Streptomyces sp. strain C5 is also available from the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Md., U.S.A. under the Accession number ATCC
Transformation of Host Microorganism
The plasmids are introduced into the host microorganism using conventional techniques. For example, Streptomyces spp. are transformed using electroporation as described in Pigac and Schrempf (1995) "A Simple and Rapid Method of Transformation of Streptomyces rimosus R6 and Other Streptomycetes by Electroporation", Appl. Environ. Microbiol. vol. 61, pages 352-356, or by protoplast transformation. Streptomyces are preferably transformed using protoplast transformation as described in Hopwood, et. al. (1985), "Genetic Manipulation of Streptomyces: A Laboratory Manual", The John Innes Foundation, Norwich, UK. E. coli strains are transformed using conventional transformation procedures as described in Maniatis, et al. (1982) "Molecular Cloning: A Laboratory Manual" Cold Spring Harbor Laboratory, New York.
Plasmid pANT195 was introduced into Streptomyces lividans TK24 by protoplast transformation according to the procedures described in Hopwood et. al (1985), "Genetic Manipulation of Streptomyces: A Laboratory Manual", The John Innes Foundation, Norwich, UK. 500 ml of Streptomyces lividans TK24 protoplasts, were transformed with 10 ml of plasmid DNA, about 0.5 mg total, in 500 ml of T buffer for two minutes. The reaction was stopped with 500 ml of P buffer and the protoplasts were pelleted twice in a microcentrifuge for 7 seconds each spin. The pellets were then resuspended in 100 ml of P buffer and plated onto R2YE medium using a soft R2YE agar overlay with 50 mg/ml of thiostrepton added 24 hours later. The transformed microorganisms were tested for their ability to carry out daunomycin C-14 oxidation.
S. peucetius ATCC 29050, Streptomyces coelicolor CH999 and Streptomyces sp. strain C5 were transformed with plasmids pANT195 and pANT849 by protoplast transformation.
Daunomycin C-14 Hydroxylase
The daunomycin C-14 hydroxylase encoded by doxA is a cytochrome P450-type enzyme having a deduced Mr of 46,096. Daunomycin C-14 hydroxylase is a monooxygenase which inserts a single oxygen at carbon 14 on daunomycin. The daunomycin C-14 hydroxylase also appears to catalyze the two step oxidation at C-13 from methylene to hydroxyl to a keto functional group. Daunomycin C-14 hydroxylase also oxidizes 13-dihydrocarminomycin to carminomycin and 13-dihydrodaunomycin to doxorubicin.
The deduced amino acid sequence of daunomycin C-14 hydroxylase which is encoded by doxA of strain C5 is shown in FIG. 3 and SEQ ID NO:5.
Preparation of Daunomycin C-14 Hydroxylase
EXAMPLE A
The daunomycin C-14 hydroxylase was isolated and partially purified and subjected to spectrophotometric analysis. First, S. lividans TK24 strains containing plasmid pANT195 were grown in YEME medium containing 10 mg/ml thiostrepton for 48 hours at 30.degree. C., harvested and washed by centrifugation and then broken in 100 mM, pH 7.5 sodium phosphate buffer using a French pressure cell at 15,000 lb/in.sup.2. The cell debris and unbroken mycelia were pelleted by centrifugation at 10,000'g for 30 minutes at 4.degree. C., after which the supernatant was analyzed by visible spectrometry. The cytochromes within the supernatant derived from the cultures were reduced by a few grains of sodium dithionite. The supernatant samples were bubbled with carbon monoxide for 1 minute prior to analysis. Spectra were obtained using a Beckman DU-64 single beam spectrophotometer and reduced-plus-CO minus reduced difference spectra were obtained by electronic subtraction.
Reduced-plus-CO minus reduced difference spectra of samples derived from cultures of S. lividans TK24 containing plasmid pANT195 revealed a peak at 450 nm, characteristic of cytochrome P450 enzymes. Such peak was not observed in samples derived from the control culture, which lack the doxA gene.
Proteins derived from both S. lividans TK24 containing plasmid pANT195 and the control culture S. lividans TK24 containing control plasmid pANT849, were visualized by sodium dodecylsulphate polyacrylamide gel electrophoresis. Samples derived from cultures containing plasmid pANT195 revealed a band with M.sub.r of about 42,000, close to the predicted size of daunomycin C-14 hydroxylase. This band was not present in samples derived from the control cultures.
EXAMPLE B
A 50 ml culture of S. lividans TK24 (pANT195) was grown for 48 hours in YEME medium plus 10 mg/ml thiostrepton as in Example 1. This culture was split into 2.times.25ml aliquots, each of which was used to inoculate a 1000 ml flask containing 225 ml of YEME medium plus 10 mg/ml thiostrepton, giving 2 fresh 250 ml cultures, which were grown as described in Example 1 for 48 hours. A 14-liter stirred tank fermentor containing 9.5 liters of YEME medium with 10 mg/ml of thiostrepton was inoculated with both 250 ml cultures, a total inoculum size of 500 ml, and the 10 L culture was incubated for 6 days under the following conditions: temperature, 28.degree. C.; air flow, 1 volume air/volume culture/minute; agitation, 250 rpms. The culture was harvested by continuous centrifugation using a Heraeus 300 MD System, from Heraeus Sepatech, South Plainfield, N.J., at 15,000 rpm and a flow rate of 100 ml/min. The resultant pellet was frozen at -70.degree. C. until further use. A small portion of the frozen pellet of S. lividans TK24 (pANT195) was thawed on ice in ice-cold 0.1 M sodium phosphate (Na.sub.2 HPO.sub.4 :NaH.sub.2 PO.sub.4) buffer having a pH 7.5. The thawed suspension was passed twice through a 4.degree. C. French Pressure cell at 15,000 pounds per square inch to break the cells. The broken cell suspension was centrifuged at 10,000.times.g for 30 minutes at 4.degree. C. and the supernatant from this centrifugation step was kept on ice to provide an isolated partially purified daunomycin C-14 hydroxylase.
P450 Determination
A 100 ml aliquot of the daunomycin C-14 hydroxylase prepared according to Example B, was added to 900 ml of 0.1M sodium phosphate buffer having a pH of 7.5, in a cuvette and approximately 1 mg of sodium dithionite was added to reduce the sample. This sample was used as the background for a spectrophotometric scan from 400 nm to 600 nm. Carbon monoxide was bubbled through this sample for one minute and the sample was scanned again from 400-600 nm. Electronic subtraction of the reduced plus carbon monoxide minus reduced sample revealed a sharp peak at 450 nm, indicative of the active cytochrome P450 enzyme. This assay was used before, during and after Examples 19 to 26 to ensure that the daunomycin C-14 hydroxylase was active and stable. In all cases, the cytochrome P450 activity appeared to be 100% of the original.
Method C
The Fusion Protein
Plasmid pANT199 was introduced by transformation into E. coli strain TOP10 from Invitrogen. Transformants were selected using ampicillin and grown in 3.0 ml cultures of SOB medium overnight at 37.degree. C. The recipe for the SOB medium was provided by Invitrogen. Fifty mL of this culture was used to inoculate 3.0 ml of fresh SOB medium. The new culture was grown at 37.degree. C. for 2 hours to an optical density of 0.6 and then induced with IPTG at 1.0 mM final concentration for 5 hours. The culture was then harvested by centrifugation in a microcentrifuge and the pellet was frozen overnight at -20.degree. C. The next day the pellet was boiled in SDS-PAGE sample buffer described in Laemmli, U.K. (1970) "Cleavage of Structural Proteins during the assembly of the head of Bacteriophage T4" Nature volume 227, pages 680-685, and run on a 10% (w/v) SDS-PAGE gel. A protein with M.sub.r of about 52,000 was observed that was insert-specific, the approximate size expected for the fusion protein based on amino acid sequence.
The fusion protein is then bound to a nickel-agarose column from Invitrogen, Inc., San Diego, Calif., and washed with 50 mM sodium phosphate buffer at pH 8.0 containing also 300 mM NaCl and 20 mM imidazole. The protein is then eluted using the same buffer but containing with 250 mM imidazole buffer at pH of 8, to provide a pure fusion protein with a modified N-terminus as shown in FIG. 9 and SEQ ID NO:8 . The leader sequence is then cleaved from the fusion protein using enterokinase available from Biozyme Lab. Int'l Ltd. San Diego Calif., according to the manufacturer's directions, to provide pure N-terminal-modified daunomycin C14 hydroxylase as shown in SEQ ID NO:9.
Methods of Converting Daunomycin to Doxorubicin
A host microorganism transformed with a plasmid containing the doxA gene is grown preferably in liquid culture, and daunomycin is added to the culture broth. Preferably, the daunomycin is added at a concentration of from about 2 mg/L to 22.2 mg/L, more preferably about 2 to 10 mg/L. Preferably, the daunomycin concentration is below about 10 mg/L. Where the concentration is above about 10 mg/L, the daunomycin tends to kill the host microorganisms although doxorubicin is still produced. The culture of transformed host microorganism is then incubated with the daunomycin; the longer the incubation the greater the amount of daunomycin is converted to doxorubicin. Preferably, the culture is incubated at least 6 hours, more preferably, at least 24 hours with the daunomycin.
A 48 hour culture has sufficient biomass to convert 2 mg/L daunomycin to doxorubicin within 24 hours.
Next, the doxorubicin is extracted preferably from both the transformed microorganisms and the culture fluid, using conventional techniques. A suitable technique involves extracting the transformed microorganisms and the culture fluid, preadjusted to a pH of about 8.5, with a mixture of chloroform and methanol and separating and drying the organic phase to provide a culture extract. The culture extract is resuspended in methanol and the components of the culture extract are separated, preferably by chromatography, to provide doxorubicin.
Media Composition
GPS production medium contains: glucose, 22.5 g/L; Proflo from Traders, Memphis, Tenn., 10 g/L; NaCl, 3 g/L; CaCO.sub.3, 3 g/L, and 10 ml/L trace salts according to Dekleva, M. L. et. al. (1985), "Nutrient Effects on Anthracycline Production by Streptomyces peucetius in a Defined Medium", Canad. J. Microbiol. vol. 31, pages 287-294.
APM seed medium contains the following: yeast extract, 8 g/L; malt extract, 20 g/L; NaCl, 2 g/L 3-(N-morpholino)propanesulfonic acid buffer, 15 g/L; antifoam B from Sigma Chemical Co., St. Louis, Mo., 4 ml/L; 10% weight to volume MgSO.sub.4, 1 ml/L; 1% weight to volume FeSO.sub.4, 1 ml/L; 10% weight to volume ZnSO.sub.4, 0.1 ml/L; 50% weight to volume glucose, 120 ml/L, added after autoclaving; tap water to 1.0 L as described in Guilfoile and Hutchinson, (1991), "A Bacterial Analog of the mdr Gene of Mammalian Tumor Cells is present in Streptomyces peucetius, the Producer of Daunorubicin and Doxorubicin", Proc. Nat'l. Acad. Sci. USA volume 88, pages 8553-8557.
The YEME medium contained 3 g/L yeast extract available from U.S. Biohemical Corp. Cleveland, Ohio; 5 g/L bacto-peptone from Difco Detroit, Mich.; 3 g/L Difco malt extract; 10 g/L glucose; 200 g/L sucrose; and 2 ml/L of an autoclave-sterilized solution of 2.5 M MgCl.sub.2 .times.6H.sub.2 O. The pH was adjusted to 7.2 and the solution was autoclaved at 121.degree. C. for 20 minutes at 15 psi, to provide the YEME medium.
The nitrate-defined-plus-yeast extract medium, also referred to herein as "NDYE medium", contains the following: yeast extract, 5.0 g/L; N-(2-hydroxyethyl)piperazine-N.sub.-- -(2-ethanesulfonic acid) buffer 4.8 g/L; 0.06 g/L anhydrous MgSO.sub.4 ; 0.24 g/L K.sub.2 HPO.sub.4 .times.3H.sub.2 O; 4.28 g/L NaNO.sub.3; 1.0 ml/L 20.times.trace elements; 45% (w/v) glucose solution, 50 ml/L; pH 7.3. The 20.times.trace elements solution contains the following elements in double distilled water: ZnCl.sub.2, 800 mg/L; FeCl.sub.3 .times.6H.sub.2 O, 4000 mg/L; CuCl.sub.2 .times.2H.sub.2 O, 40 mg/L; MnCl.sub.2 .times.4H.sub.2 O, 40 mg/L; Na.sub.2 B.sub.4 O.sub.3 .times.10H.sub.2 O, 40 mg/L; (NH.sub.4).sub.6 Mo.sub.7 O.sub.24 .times.4H.sub.2 O, 200 mg/L; NiCl, 100 mg/L as described by Dekleva et al. (1985) Can. J. Microbiol volume 31, pages 287-294. A few drops of Mazu DF60-P antifoam, obtained from Mazer Chemical Co., Gurney, Ill., were added to control foaming in cultures containing NDYE medium. Other antifoam agents, such as Sigma Antifoam B from Sigma Chemical Company, are also suitable.
EXAMPLES
The following examples are illustrative and not intended to be limiting.
Methods of Producing Doxorubicin Employing Host Microorganisms
Example 1
Cultures of S. lividans TK24 containing plasmid pANT195 and control cultures of S. lividans TK24 containing plasmid pANT849 were grown on R2YE agar medium containing 10 mg/ml of thiostrepton in standard 100 mm.times.15 mm plastic petri dishes for 5 days at 30.degree. C., at which time the entire cultures had sporulated. The spores from one entire petri plate were used to inoculate 50 ml of modified YEME medium in 250 ml erlenmeyer flasks. Then 10 mg/ml thiostrepton in DMSO were added to the medium. The thiostrepton was added as selective pressure to maintain the plasmids. The cultures were grown for 48 hours at 30.degree. C. with rotary shaking at 250 rpm, one inch throw on the shaker. After 48 hours, a 1.5 ml sample was removed for plasmid analysis to ensure the presence and size of the insert DNA containing the doxA gene using a "mini-prep" procedure according to Carter, M. J., and I. D. Milton, (1993), "An Inexpensive and Simple Method for DNA Purification on Silica Particles," Nucleic Acid Res., Vol. 21, page 1044. Restriction endonuclease digestion with BspEI and agarose gel electrophoresis generated 1.7 kbp, 2.2 kbp, and 3.14 kbp fragments which indicated an intact plasmid and insert. Then a 10 mL solution containing 100 mg of filter sterilized daunomycin-HCl in distilled water was added to the cultures for a final concentration of 2.0 mg of daunomycin per ml of culture broth. Incubation was continued for 72 hours.
After a total of 120 hours, that is, 48 hours growth and another 72 hours of continued growth in presence of the daunomycin, the pH of the culture was 7.6. The remaining culture broth, a volume of 48.5 ml, was brought to pH 8.5 with the dropwise addition of 5 N NaOH. Then the whole culture broth, including culture fluid and cells, was extracted once with a 2.times.volume of chloroform:methanol at a ratio of 9:1. The organic phase was separated from the aqueous phase by centrifugation at about 10,000.times.g for 10 minutes and then the organic phase was removed by pipet. The organic phase was air dried in a chemical fume hood, then resuspended in 1 ml of 100% reagent grade methanol and spotted onto aluminum-backed, 0.25 mm silica gel thin layer chromatography plates from Whatman, Clifton, N.J. The components derived from the organic phase culture extract were separated using a solvent system of chloroform:methanol:acetic acid:water (80:20:16:6). The anthracyclines in the culture extracts were visualized on the plates by their normal pigmentation and by their fluorescence under ultraviolet irradiation at 365 nm. Table 1 shows the results.
The culture extracts of Example 1 and known standards also were separated and analyzed by high performance liquid chromatography using a C.sub.18 mBondaPak reverse phase column from Waters Corp. Milford, Mass. The solutions of standards and culture extracts of Example 1 were filtered through 0.2 mm Nylon Acrodisc.RTM.13 filters from Gelman Sciences, Ann Arbor, Mich. and separated by HPLC using a mobile phase of methanol:water (65:35) brought to a pH of 2.5 with 85% phosphoric acid using a Waters 600E Multisolvent Delivery Pump and Controller and U6K 0-2.0 ml manual injector and detected on-line at 254 nm using a Waters 486 Tunable Absorbance Detector. The data were analyzed on-line and post-run using "Baseline 815" software and a 386 SX PC-compatible computer. The products extracted from the cultures were compared to standards run in parallel and by co-chromatography. These results are shown in Table 2.
TABLE 1______________________________________THIN LAYER CHROMATOGRAPHY OF DOXORUBICINPRODUCED ACCORDING TO EXAMPLE 1 AS COMPARED TOKNOWN STANDARDS R.sub.f of Sam-Sample ple______________________________________Daunomycin Standard 0.56Doxorubicin Standard 0.3613-Dihydrodaunomycin Standard 0.39Doxorubicin from Cultures Containing Plasmid doxA (pANT195) 0.3613-Dihydrodaunomycin from Control Culture 0.39______________________________________ A few grains of each standard was reconstituted in 1 ml of methanol.
As indicated by the results in Table 1, the cultures transformed with plasmid pANT195 containing doxA which were incubated with daunomycin, produced doxorubicin. In contrast, the control cultures produced 13-dihydrodaunomycin. Co-chromatography confirmed these results.
TABLE 2______________________________________HIGH PERFORMANCE LIQUID CHROMATOGRAPHY OFDOXORUBICIN PRODUCED ACCORDING TO EXAMPLE 1AS COMPARED TO KNOWN STANDARDS Retention time of sample.sup.2Sample (minutes)______________________________________Daunomycin.sup.1 Standard 13.3Doxorubicin.sup.1 Standard 8.413-Dihydrodaunomycin Standard 10.6Doxorubicin from doxATransformants 4.1; 7.2 (minor)Control 4.1; 10.6; 21.2______________________________________ .sup.1 Standards were reconstituted at 1.0 mg/ml in methanol. .sup.2 A methanol peak at 2.9 minutes was found in all samples.
The doxA transformants converted greater than 90% of the daunomycin to doxorubicin in 72 hours as evidenced by both TLC and HPLC analyses. The control cultures, which lack the doxA gene, converted daunomycin to 13-dihydrodaunomycin, but not to doxorubicin.
The culture extracts of Example 1 and the standards were hydrolyzed to their respective aglycones to verify the chemical structures. The acid hydrolysis product of the doxorubicin is adriamycinone, and the acid hydrolysis product of the 13-dihydrodaunomycin is 13-dihydrodaunomycinone. The acid hydrolysis product of the doxorubicin produced by Example 1 was adriamycinone. The acid hydrolysis product of the 13-dihydrodaunomycin produced by control cultures of Example 1 was 13-dihydrodaunomycinone.
Example 2
The procedure of Example 1 was repeated, with the following exceptions. The cultures were grown at 28.degree. C. rather than 30.degree. C., for 48 hours. After 48 hours of growth, 500 mg of daunomycin-HCl were added to the cultures for a final concentration of 10.0 mg/ml of daunomycin followed by further incubation for 36 hours, instead of 72 hours.
The culture broth then was extracted and the entire sample volume was spotted in a line onto a 250 mm layer thickness 20 cm.times.20 cm glass-backed TLC plate containing a fluorescent indicator (254 nm) from Aldrich, Milwaukee, Wis. The doxorubicin was separated from contaminants by chromatography for 2 hours using a mobile phase of chloroform:methanol:acetic acid:water (80:20:16:6), after which the silica gel containing the band having R.sub.f, 0.3-0.4 was scraped from the plate. The silica gel was extracted three times with about 1.5 ml of methanol each time. The methanol extracts were combined, filtered through a 0.2 mm Nylon Acrodisc.RTM.13 filter, and air-dried. The dried product was resuspended in 500 mL of chloroform:methanol in a ratio of 9:1, back-extracted with an equal volume of water that had been previously made alkaline to pH 10.0 using Na.sub.2 CO.sub.3, and the organic phase from this extraction procedure was removed and dried. The dried sample was resuspended in 500 mL of methanol, from which 50 mL were removed for HPLC and TLC analysis. HPLC analysis of this sample confirmed that doxA transformant cultures converted virtually all of the 500 mg of daunomycin to doxorubicin.
The remainder was redried and subjected for mass spectrometry analysis. MS spectra were recorded on a SCIEX API III+ triple quadruple mass spectrometer fitted with an atmospheric pressure chemical ionization source operating in a positive ion mode. MS spectra were acquired by scanning the first quadruple (Q1), the results are shown in Table 3.
TABLE 3______________________________________MS ANALYSIS ON THE DOXORUBICIN PRODUCED ACCORDINGTO EXAMPLE 2 Calculated AverageSample MW M + 1______________________________________Daunomycin standard 527.51 528.00Doxorubicin standard 543.54 544.0513-Dihydrodaunomycin standard 529.50 530.01Doxorubicin from TransformantsContaining doxA -- 544.00______________________________________
The results of the MS analysis, shown in Table 3, indicate that the doxorubicin from doxA transformed cultures has an M+1 of 544.00, essentially the same value as obtained with the doxorubicin standard. The M+1 value of the doxorubicin produced by the doxA transformed culture was not similar to the M+1 values obtained with either daunomycin standard or the 13-dihydrodaunomycin standard.
Example 3
A 50 ml culture of Streptomyces lividans TK24(pANT195) culture was prepared as in Example 1. This culture was grown for 48 hours at 28.degree. C. and then 25 ml were removed and used to inoculate 200 ml of YEME medium containing 10 mg/L of thiostrepton in a 1.0 L flask, having total, 225 ml of culture volume. After incubation for 48 hours at 28.degree. C., 5.0 mg of daunomycin-HCl in 1000 ml of distilled water were added to the culture to give a final concentration of 22.2 mg/ml. A control culture of S. lividans TK24 containing plasmid pANT849 which lacks the doxA gene, was incubated in the presence of 100 mg of daunomycin-HCl. The cultures were incubated for 48 hours and then extracted as described in Example 1 and analyzed by HPLC and TLC. The doxorubicin which migrated in a broad band having an R.sub.f of 0.3-0.4 was separated from contaminants by chromatography and prepared for MS analysis as in Example 2. The results are shown in Table 4.
The doxA transformed culture converted essentially all of the 5 mg of daunomycin to doxorubicin. Notably, the doxA transformed culture was virtually dead at the end of 48 hours, whereas the cultures of Examples 1 and 2 which received 2 mg/ml of daunomycin were fully viable. Nevertheless, even though the culture was eventually killed by the daunomycin, the culture converted essentially all of the daunomycin to doxorubicin.
HPLC analysis showed that the doxA transformed cultures converted greater than 95% of the daunomycin to doxorubicin. The control culture converted essentially 100% of the daunomycin to 13-dihydrodaunomycin, and did not produce doxorubicin.
TABLE 4______________________________________MASS SPECTROPHOTOMETRY ANALYSIS ON THEDOXORUBICIN PRODUCED ACCORDING TO EXAMPLE 3 Calculated AverageSample MW M + 1______________________________________Doxorubicin Standard 543.54 543.6513-Dihydrodaunomycin Standard 529.50 529.85Doxorubicin from Transfomants -- 543.90Containing doxA13-Dihydrodaunomycin from Control -- 529.15culture______________________________________
The results of the MS analysis, shown in Table 4, indicate that the doxorubicin produced by cultures containing plasmid pANT195, has an M+1 of 543.90, essentially the same as obtained with doxorubicin standard. An MS-MS analysis was run on the parent 543.9 peak and is shown in Table 5.
TABLE 5__________________________________________________________________________MASS SPECTROPHOTOMETRY ANALYSIS OF DOXORUBICINPRODUCED ACCORDING TO EXAMPLE 3Sample M + 1 Major fragmentation__________________________________________________________________________Doxorubicin Standard 543.65 489.90.sup.m, 396.95, 378.70, 360.45 345.95.sup.m 320.85 299.45 130.15Doxorubicin produced according 543.90 396.80, 378.90, 361.00,to Example 313-Dihydrodaunomycin 529.85 382.85, 365.30, 346.35, 320.85, 129.35, 113.10StandardControl 529.15 497.20.sup.m, 482.00.sup.m, 382.80, 364.60, 320.75, 305.75,culture extract 129.95__________________________________________________________________________ .sup.1 The product sample was significantly less concentrated than the standard sample, leading to recovery of only the most abundant fragmentation species. .sup.mminor fragmentation species.
The MS-MS analysis on 543.90 peak from the doxorubicin produced in Example 3 shows daughter peaks which are essentially identical to the daughter peaks from the doxorubicin standard. Thus, the doxorubicin produced by the transformants containing doxA has the M+1 and MS/MS fragmentation patterns of standard doxorubicin. Similarly, the culture extract from the control culture had an M+1 and fragmentation pattern similar to that of standard 13-dihydrodaunomycin.
Example 4
Fifty ml cultures of Streptomyces lividans TK24(pANT195) and S. lividans TK24(pANT849) as a control were inoculated and prepared as in Example 1 except that they were grown at 28.degree. C. for 48 hours. At that time, 100 mg of daunomycin in 10 mL of distilled water was added to the cultures for a final concentration of 2 mg/ml. The cultures were further incubated for 24 hours. The cultures were then extracted as described in Example 1 and subjected to HPLC analysis.
The transformed culture containing the doxA gene converted greater than 95% of the daunomycin to doxorubicin within 24 hours. The control culture converted approximately 100% of the daunomycin to 13-dihydrodaunomycin.
Example 5
The procedure of Example 4 was repeated except that 100 mg of 13-dihydrodaunomycin, rather than daunomycin, were added to the cultures and the cultures were further incubated for 48 hours rather than 24 hours.
In 48 hours, the culture containing plasmid doxA (pANT195) converted 100% of the 13-dihydrodaunomycin to doxorubicin. The control culture did not convert the 13-dihydrodaunomycin.
Example 6
Fifty ml cultures of Streptomyces lividans TK24(pANT 196) and S. lividans TK24(pIJ702) as a control, were treated as in Example 4 except that the cultures were incubated with daunomycin for 72 hours.
The culture containing plasmid pANT196, which contains the doxA gene expressed from the melC1 promoter, converted 20% of the daunomycin to doxorubicin. Thus the melC1 promoter is less preferred than the snpA promoter. The control cultures converted 100% of the daunomycin to 13-dihydrodaunomycin.
Example 7
50 ml cultures of Streptomyces lividans TK24(pANT192), having wild type and snpA promoters, Streptomyces lividans TK24(pANT193), having wild type and snpA promoters, Streptomyces lividans TK24(pANT194) which lacks the snpA-promoter and snpR activator gene, and S. lividans TK24(pANT849) as a control, were prepared and analyzed prepared as in Example 4, except that the cultures were incubated in the presence of the daunomycin for 48 hours. The results are presented in Table 6.
TABLE 6______________________________________COMPARISON OF DIFFERENT PLASMIDS ONPERCENT CONVERSION OF DAUNOMYCIN TO DOXORUBICINPlasmid Products______________________________________pANT192 75% 13-dihydrodaunomycin/25%pANT193 80% doxorubicin/20% 13-pANT194 90% 13-dihydrodaunomycin/ 10% doxorubicinpANT195 100% doxorubicinpANT849 100% 13-DHD(control)______________________________________
As shown in Table 6, the culture containing pANT192, which contains doxA, converted 25% of daunomycin to doxorubicin and 75% of daunomycin to the 13-dihydrodaunomycin. The culture containing plasmid pANT193, which contains doxA, converted 80% of daunomycin to doxorubicin and 20% of daunomycin to the 13-dihydrodaunomycin. The culture containing plasmid pANT194, which contains doxA but lacks the snpA-promoter and snpR activator, converted 10% of daunomycin to doxorubicin and 90% of daunomycin to the 13-dihydrodaunomycin. The control culture converted the daunomycin to 13-dihydrodaunomycin, but not doxorubicin.
Example 8
Fifty ml cultures of Streptomyces lividans TK24(pANT195) and S. lividans TK24(pANT849) as a control, were prepared as in Example 4, except that the pH of the YEME medium was adjusted before inoculation using NaOH or HCl to provide an initial culture pH as shown in Table 7. The cultures were further incubated for 48 hours, rather than 24 hours. The results are shown in Table 7.
TABLE 7______________________________________EFFECT OF CULTURE PH ON DOXORUBICIN PRODUCTION Percent DaunomycinInitial pH Final pH bioconverted to Doxorubicin______________________________________6.0 7.0 50%6.5 7.6 90%7.0 7.9 100%7.5 7.0 100%8.0 -- No growth or bioconversion______________________________________ The % conversion is approximate.
The culture containing plasmid pANT195 which contains doxA, and which was initially at pH of 7.0 or 7.5, converted 100% of the daunomycin to doxorubicin. The cultures containing plasmid doxA which were initially at pH 6.0 converted 50% of the daunomycin to doxorubicin. The cultures containing plasmid doxA which were initially at pH 6.5 converted 90% of the daunomycin to doxorubicn. Accordingly it is preferred that the transformed host cultures be grown at an initial pH of higher than 6.5.
Example 9
The procedure of Example 4 was repeated except that cultures were grown at either 22.degree. C., 28.degree. C., or 37.degree. C. and incubated with the daunomycin for 48 hours at such temperatures.
All three of the cultures containing plasmid doxA converted 100% of the daunomycin to doxorubicin.
Example 10
A 50 ml culture of Streptomyces lividans TK24(pANT195), inoculated and prepared as in Example 1, was grown at 28.degree. C. for 48 hours. At that time, the cultures were harvested by centrifugation at 10,000'g in a high speed centrifuge, washed once with 100 mM 3-(N-morpholino)propanesulfonic acid buffer at pH 7.2. The cells from the cultures were reconstituted in 5.0 ml of the 100 mM 3-(N-morpholino)propanesulfonic acid buffer to give a final volume of 6.0 ml which included the volume of the packed cell mass, resulting in an approximately 8-fold concentration of the recombinant mycelia in buffer. Then 100 mg of daunomycin were added in 10 mL of distilled water for a final concentration of 16.7 mg/ml of daunomycin. A concentration of 16.7 mg/ml of daunomycin is toxic to the host. The culture was further incubated for 7.0 hours, after which it was extracted as described in Example 1 and subjected to HPLC analysis.
In 7 hours, the concentrated cultures containing the plasmid with a doxA insert converted about 25% of the daunomycin to doxorubicin.
Example 11
Five ml each of APM seed medium containing 10 mg/ml of thiostrepton were inoculated by loop from R2YE agar plates, containing 50 mg/ml thiostrepton of S. peucetius 29050(pANT195) and S. peucetius 29050(pANT849). Each culture was grown at 28.degree. C. for 48 hours. Fifty ml each of GPS "production" medium containing 10 mg/ml of thiostrepton were inoculated with 2.5 mls of seed culture grown in APM seed medium. The cultures were grown at 28.degree. C. for 48 hours as in Example 1. Then 100 mg of daunomycin in 10 mL of distilled water for a final concentration of 2 mg/ml of daunomycin was added to the cultures. The cultures were further incubated for 48 hours, then extracted as described in Example 1.
After 48 hours, the culture containing plasmid pANT195, which contains the doxA gene, converted about one-half of the daunomycin to doxorubicin. The control cultures did not convert daunomycin to doxorubicin.
Example 12
Fifty ml cultures of Streptomyces coelicolor CH999 (pANT195), and Streptomyces coelicolor CH999 (pANT849) as a control, were used in the procedure of Example 4 except that the cultures were incubated with the daunomycin for 48 hours.
Again the cultures containing pANT195 converted 100% of the daunomycin to doxorubicin, while the control converted 80% of the daunomycin to 13-dihydrodaunomycin. In the control cultures 20% of the daunomycin was not converted.
Example 13
The procedure of Example 12 was repeated, except that after the daunomycin addition, the cultures were only incubated for 1, 2, or 4 hours.
After 1 hour, 0.7% of the daunomycin was converted to doxorubicin by the cultures which contained pANT195. After 2 hours, 1.0% of the daunomycin was converted and by 4 hours 15% of the daunomycin was converted to doxorubicin. The control cultures which lacked the plasmid containing doxA did not convert any of the daunomycin.
Example 14
50 ml cultures of Streptomyces sp. strain C5(pANT195) and Streptomyces sp. strain C5(pANT849) as a control, were grown at 28.degree. C. for 72 hours in NDYE medium as described in Example 1. After 72 hours, 100 mg of unlabelled daunomycin and 5 mCi of .sup.3 H-daunomycin, having a specific radioactivity of 5.0 Ci/mmol, were added to each culture and they were incubated for another 48 hours. The cultures were extracted as described in Example 1 and analyzed by TLC and autoradiography.
The cultures of containing plasmid pANT195 converted approximately 5% of the radiolabelled daunomycin to doxorubicin. No other products other than the substrate daunomycin and doxorubicin were observed in these cultures. The control cultures converted approximately 90% of the radiolabelled daunomycin to baumycin A1 and baumycin A2.
Example 15
50 ml cultures of Streptomyces sp. strain C5, which does not appear to synthesize doxorubicin, and the following mutants of Streptomyces sp. strain C5: SC5-dauA74, SC5-dauCE147, SC5-dauE24, and SC5-dauH54, were grown for 48 hours in NDYE medium. These mutants do not synthesize daunomycin. At 48 hours, 100 mg of daunomycin was added for a final concentration of 2 mg/ml, and the cultures were incubated for 36 hours. The products were extracted as in Example 1 and subjected to HPLC analysis.
All Streptomyces sp. strain C5 cultures, each of which lacked a plasmid containing doxA, converted about 10% of the daunomycin to doxorubicin. Baumycins A1 and A2 were also detected.
Example 16
The procedure of Example 4 was repeated except that the cultures were then incubated for 48 hours with 100 mg, for a final concentration of 2ug/ml of one of the following: carminomycin, idarubicin, daunomycinone, or carminomycinone.
Incubation of S. lividans TK24(pANT195) cultures with carminomycin or idarubicin, resulted in greater than 85% recovery of carminomycin and idarubicin. The cultures which contained plasmid pANT195 converted 100% of the daunomycinone to 13-hydroxydaunomycinone and 100% of the carminomycinone to 13-hydroxycarminomycinone. The control cultures, which lack the doxA gene, converted 100% of the carminomycin, idarubicin, daunomycinone, and carminomycinone to their 13-dihydro derivatives.
Example 17
The procedure of Example 4 was repeated except that the cultures received 100 mg of 13-dihydrocarminomycin rather than daunomycin. The cultures were then incubated for 36 hours and analyzed by TLC and HPLC.
The cultures containing plasmid pANT195 converted 100% of the 13-dihydrocarminomycin to carminomycin. No other products were observed. In the control culture, none of the 13-dihydrocarminomycin was converted. The doxA gene confers the ability to oxidize the C-13 hydroxyl function of the 13-dihydro-carminomycin to a keto function.
Novel Synthesis of 13-deoxycarminomycin and 13-deoxydaunomycin
Example 18
e-Rhodomycin D compound was converted to both 13-deoxycarminomycin and 13-deoxydaunomycin, by host microorganisms containing plasmid which contains the Streptomyces sp. strain C5 dauP gene which encodes e-rhodomycin D esterase and the Streptomyces sp. strain C5 dauK gene which encodes carminomycin 4-O-methyltransferase.
Plasmid pANT144 as shown in FIG. 12, and described in Dickens, M. L., et. al., (1995) "Analysis of Clustered Genes Encoding both Early and Late Steps in Daunomycin Biosynthesis by Streptomyces sp. strain C5 " J. Bacteriol. . volume 177, pages 536-543, was introduced into S. lividans TK24 by protoplast transformation. S. lividans TK24(pANT144) was grown for 48 hours in 50 ml of YEME medium containing 10 mg/ml of thiostrepton and then used to inoculate 450 ml of the YEME medium which contained 10 mg/ml of thiostrepton for a total culture volume of 500 ml, in a two liter flask. The resultant 500 ml culture was incubated for 48 hours at 28.degree. C. as in Example 1. Next, 5.0 mg of e-rhodomycin D, the glycone of e-rhodomycinone, from the National Cancer Institute, Drug Synthesis and Chemistry Branch, Bethesda, Md. designated compound #263854-H, were added to the culture for a final concentration of 10 mg/ml and the cultures were incubated for an additional 48 hours. The culture then was adjusted to pH 8.5, and then extracted twice, each with 1 volume of chloroform:methanol (9:1) as in Example 3. The organic extract was reduced to dryness, reconstituted in 500 mL of chloroform:methanol (9:1), filtered, back extracted, dried, and reconstituted in 2.0 ml of methanol. The extract was separated and extracted as in Example 2. R.sub.f values for 13-deoxycarminomycin and 13-deoxydaunomycin were approximately 0.60 and 0.64, respectively. The 13-deoxycarminomycin and 13-deoxydaunomycin were reduced to dryness and each was brought up again in 50 ml of methanol.
Methods of Producing Anthracyclines Employing Daunomycin C-14 Hydroxylase
Example 19
904 ml of the daunomycin C-14 hydroxylase produced according to the method of Example B, containing approximately 1 mg of total protein, was incubated in a 16 mm well of a 24 well culture plate at 30.degree. C. with shaking for 2 hours with 25 mg in 5 ml of either daunomycin, 13-dihydrodaunomycin, or 13-dihydrocarminomycin. The final volume of each well was 1.0 ml; 0.1M sodium phosphate buffer at pH 7.5, was added to bring the total volume to 1 ml, as needed. After 2 hours of incubation, the pH of each reaction mixture was increased to pH 8.5 using 1 M NaOH and each was extracted twice each with 500 ml of chloroform: methanol (9:1). The organic layers were combined, reduced to dryness, reconstituted in 10 ml of methanol, separated and analyzed by TLC as in Example 1.
The daunomycin C-14 hydroxylase converted 50% of the 13-dihydrocarminomycin to carminomycin and 50% of the 13-dihydrodaunomycin to daunomycin.
Example 20
The procedure of example 19 was repeated except that 10 ml of NADH, 1 mM final concentration; 10 ml of NADPH, 1 mM final concentration, were added.
The daunomycin C-14 hydroxylase converted 100% of the 13-dihydrocarminomycin to carminomycin and 100% of the 13-dihydrodaunomycin to daunomycin.
Example 21
The procedure of Example 20 was repeated except that the following reagents, available from Sigma Chemical Co., were added: 20 ml of glucose-6-phosphate; 10 mM final concentration; 10 ml of NADP.sup.+, 1 mM final concentration; 1.0 ml of glucose-6-phosphate dehydrogenase; 0.84 units, final activity; 20 ml of spinach ferredoxin, 44 mg final concentration; and 10 ml of spinach ferredoxin-NADP.sup.+ reductase, 0.05 units final activity. The glucose-6-phosphate, glucose-6-phosphate dehydrogenase and NADP.sup.+ constitute a "NADPH-regenerating system". After 2 hours of incubation, the extracts were extracted and analyzed by TLC and HPLC.
The daunomycin C-14 hydroxylase converted 100% of the 13-dihydrocarminomycin to carminomycin and 100% of the 13-dihydrodaunomycin to daunomycin, as shown by TLC. HPLC revealed the conversion of about 5% of the daunomycin to doxorubicin.
Example 22
The procedure of Example 21 was repeated, except 10 ml of flavin adenine mononucleotide from Sigma, 10 mg final concentration; and 10 mg in 10 ml, flavin adenine dinucleotide, were also added.
100% of the 13-dihydrocarminomycin was converted to carminomycin and 100% of the 13-dihydrodaunomycin was converted to daunomycin by the daunomycin C-14 hydroxylase. Doxorubicin was not detected using TLC.
Example 23
The procedure of Example 20 was repeated except that different anthracyclines were used, incubation was for 1 hour and 10 ml of NADP.sup.+, 1 mM final concentration was added. 25 mg in 5 ml the following anthracyclines were used: either e-rhodomycin D, 13-deoxydaunomycin from example 18, or 13-deoxycarminomycin, from example 18.
About 20% of the 13-deoxycarminomycin was converted to 13-dihydrocarminomycin and about 80% was converted to carminomycin; and 13-deoxydaunomycin was converted to about 20% 13-dihydrodaunomycin and about 80% daunomycin. The e-rhodomycin D did not appear to be converted.
Thus, the daunomycin C-14 hydroxylase converted 13-deoxycarminomycin to 13-dihydrocarminomycin and carmninomycin; 13-dihydrocarminomycin to carminomycin; 13-deoxydaunomycin to 13-dihyrodaunomycin and daunomycin; and 1 3-dihydrodaunomycin to daunomycin. Thus, daunomycin C-14 hydroxylase catalyzes the oxidation of the C-13 methylene to a C-13 hydroxyl function, and catalyzes the oxidation of the C-13 hydroxyl function to C-13 keto function. The daunomycin C-14 hydroxylase is useful for making 13-dihydrocarminomycin, carminomycin, 13-dihydrodaunomycin and daunomycin.
Example 24
The procedure of Example 22 was repeated except that the daunomycin C-14 hydroxylase was incubated with daunomycin for 18 hours rather than 2 hours and in 25 ml erylenmyer flasks shaken at 250 rpm on a rotary shaker.
Doxorubicin was not detected by HPLC or TLC.
Example 25
The procedure of Example 24 was repeated except that the reagent volumes were tripled. The reagent concentrations however were not increased.
Approximately 5% of the daunomycin was converted to doxorubicin as determined by a HPLC.
Example 26
The procedure of Example 24 was repeated except that the reagent volumes were quintupled. The reagent concentrations however, were not increased.
Approximately 20 to 25% of the daunomycin was converted to doxorubicin, as determined by HPLC.
The present invention includes: the DNA sequences encoding a protein daunomycin C-14 hydroxylase, which adds a hydroxyl group to carbon 14 of daunomycin; the messenger RNA transcript of such DNA sequence; and an isolated protein which adds a hydroxyl group to carbon 14 of daunomycin.
For example, the DNA sequences include: DNA molecules which, but for the degeneracy of the genetic code would hybridize to DNA encoding the daunomycin C-14 hydroxylase, thus the degenerate DNA which encodes the daunomycin C-14 hydroxylase protein; DNA strands complementary to: DNA sequences encoding the daunomycin C-14 hydroxylase protein including DNA in FIGS. 3, 6, 9 and 11; heterologous DNA having substantial sequence homology to the DNA encoding the daunomycin C-14 hydroxylase protein, including the DNA sequences in FIGS. 3, 6, 9 and 11 or portions thereof.
The daunomycin C-14 hydroxylase protein includes, for example, the daunomycin C-14 hydroxylase protein of strains other than Streptomyces sp. strain C5; proteins having 75% homology to the proteins in FIGS. 3, 6, 9 and 11, and proteins or portions thereof having substantially the same amino acid sequence as shown in FIGS. 3, 6, 9 and 11.
__________________________________________________________________________# SEQUENCE LISTING- (1) GENERAL INFORMATION:- (iii) NUMBER OF SEQUENCES: 9- (2) INFORMATION FOR SEQ ID NO:1:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:# 24GGTG CCTC- (2) INFORMATION FOR SEQ ID NO:2:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:# 20 GGGG- (2) INFORMATION FOR SEQ ID NO:3:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 48 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:# 48CTAG AGCTCAAGCT TTAAACTAGT TAACGCGT- (2) INFORMATION FOR SEQ ID NO:4:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 3196 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: mat.sub.-- - #peptide (B) LOCATION: 1498..2764- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1498..2764- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:- GGTACCCGCG CATCGATGTC ATGGCCGGCA ACGCCGGCGG CATGTTCTGG TC - #GCGCACCA 60- CGACCCAGGA CGGGTTCGAG GCCACCCTCC AGGTCAATCA TCTCGCGGGC TT - #CCTGCTGG 120- CACGGCTGCT GCGGGAGCGG CTCGCGGGCG GGCGGTTGAT CCTCACCTCG TC - #CGACGCGT 180- ACACCCAGGG CCGGATCGAC CCGGACGATC TCAACGGCGA CCGTCACCGC TA - #CAGCGCGG 240- GCCAGGCGTA CGGCACGTCC AAACAGGCCA ACATCATGAC CGCCACGGAG GC - #CGCCCGGC 300- GCTGGCCGGA CGTGCTGACG GTCAGCTACC ACCCCGGCGA GGTCCGCACC CG - #CATCGGGC 360- GGGGCACAGT CGCCTCGACC TACTTCCGGT TCAACCCCTT CCTGCGGTCC GC - #GGCCAAGG 420- GCGCCGACAC TCTCGTGTGG CTGGCGGCCG CGCCGGCCGA GGAGTTGACC AC - #GGGCGGCT 480- ACTACAGCGA CCGGCGGCTG TCCCCGGTGA GCGGCCCGAC CGCCGACGCC GG - #CCTCGCGG 540- CCAAGCTCTG GGAGGCCAGC GCGGCCGCCG TCGGCCACAC CGCGCGCTGA CC - #GCGGCGGG 600- CCTCCCCGCC CGCATGCCCG TCTCATCCGC GAGCGCAGAC GCTCGTGTGC CG - #ATCCGTCG 660- AAAGGAACGA TTCGTGACCA GGTTCGCGCC CGGCGCCCCC GCATGGTTCG AC - #CTCGGGTC 720- GCCCGATGTC GCCGCCTCGG CCGACTTCTA CACCGGCCTC TTCGCGTGGA CC - #GCGACCGT 780- GGTCAGCGAC CCGGGTGCCG GGGGATACAC TACTTTCAGC TCCGACGGGA AG - #CCTGTCGC 840- CGCGGTCGCC CGCCATCAGA TCGACACGCC CTACCACCGT CCGTACGGGC CC - #GGCAAGCA 900- CCAGCACGGC ATGCCGGCCA TCTGGACCGT GTACTTCGCC ACCAACGACG CC - #GACGCACT 960- GACCAAACGG GTCGAAGCGG CGGGTGGCGA CGTCATCATG CACCCGATGG AC - #GTCCTCGG1020- TCTCGGCCGG ATGGCGGTCT TCGCCGACCC ATCGGGGGCC GCGTTCGCGG TG - #TGGCGCAA1080- GGGCGTCATG GAGGGCGCGG AGGTGACGGG CGTGCCCGGC TCGGTCGGCT GG - #GTGGAACT1140- GGTGACCGAC GACATCGGGA CCGCCCGTGG CTTCTACCGT GCGACCCTCG GC - #CTGGCTCC1200- GGCCGACACC GGACGCAAGG GCGTCACCGA CCCGGTTTGG CACATCCATG AC - #ACACCGGT1260- CGCCGGCACC CGGGAACTGG GCACGACCGG CGCGGTACGG CCCCACTGGG CC - #GTGCTGTT1320- CTCCGTGCAC GACTGCGACG CGACGGTCCG GCGGGCCGTC GAACTCGGCG GC - #TCCGTCGA1380- GAACGAGCCC GTCGACACCC CCAGGGGGCG GCGGGCGGAC CTGCTCGACC CG - #CACGGGGC1440- CGGCTTCTCG GTGGTCGAAC TGCGGGAGGC GTACCCCGCG GCGGCGGACG GT - #GCCTC1497- ATG AGC GGC GAG GCG CCG CGG GTG GCC GTC GA - #C CCG TTC TCG TGT CCC1545Met Ser Gly Glu Ala Pro Arg Val Ala Val As - #p Pro Phe Ser Cys Pro# 15- ATG ATG ACC ATG CAG CGC AAA CCC GAG GTG CA - #C GAC GCA TTC CGA GAG1593Met Met Thr Met Gln Arg Lys Pro Glu Val Hi - #s Asp Ala Phe Arg Glu# 30- GCG GGC CCC GTC GTC GAG GTG AAC GCC CCC GC - #G GGC GGA CCC GCC TGG1641Ala Gly Pro Val Val Glu Val Asn Ala Pro Al - #a Gly Gly Pro Ala Trp# 45- GTC ATC ACC GAT GAC GCC CTC GCC CGC GAG GT - #G CTG GCC GAT CCC CGG1689Val Ile Thr Asp Asp Ala Leu Ala Arg Glu Va - #l Leu Ala Asp Pro Arg# 60- TTC GTG AAG GGA CCC GAT CTC GCG CCC ACC GC - #C TGG CGG GGG GTG GAC1737Phe Val Lys Gly Pro Asp Leu Ala Pro Thr Al - #a Trp Arg Gly Val Asp# 80- GAC GGT CTC GAC ATC CCC GTT CCG GAG CTG CG - #T CCG TTC ACG CTC ATC1785Asp Gly Leu Asp Ile Pro Val Pro Glu Leu Ar - #g Pro Phe Thr Leu Ile# 95- GCC GTG GAC GGT GAG GAC CAC CGG CGT CTG CG - #C CGC ATC CAC GCA CCG1833Ala Val Asp Gly Glu Asp His Arg Arg Leu Ar - #g Arg Ile His Ala Pro# 110- GCG TTC AAC CCG CGC CGG CTG GCC GAG CGG AC - #G GAT CGC ATC GCC GCC1881Ala Phe Asn Pro Arg Arg Leu Ala Glu Arg Th - #r Asp Arg Ile Ala Ala# 125- ATC GCC GAC CGG CTG CTC ACC GAA CTC GCC GA - #C TCC TCC GAC CGG TCG1929Ile Ala Asp Arg Leu Leu Thr Glu Leu Ala As - #p Ser Ser Asp Arg Ser# 140- GGC GAA CCG GCC GAG CTG ATC GGC GGC TTC GC - #G TAC CAC TTC CCG CTG1977Gly Glu Pro Ala Glu Leu Ile Gly Gly Phe Al - #a Tyr His Phe Pro Leu145 1 - #50 1 - #55 1 -#60- TTG GTC ATC TGC GAA CTG CTC GGC GTG CCG GT - #C ACC GAT CCG GCA ATG2025Leu Val Ile Cys Glu Leu Leu Gly Val Pro Va - #l Thr Asp Pro Ala Met# 175- GCC CGC GAG GCC GTC GGC GTG CTC AAG GCA CT - #C GGC CTC GGC GGC CCG2073Ala Arg Glu Ala Val Gly Val Leu Lys Ala Le - #u Gly Leu Gly Gly Pro# 190- CAG AGC GCC GGC GGT GAC GGC ACG GAC CCT GC - #C GGG GAC GTG CCG GAC2121Gln Ser Ala Gly Gly Asp Gly Thr Asp Pro Al - #a Gly Asp Val Pro Asp# 205- ACG TCG GCG CTG GAG AGC CTT CTC CTC GAA GC - #C GTG CAC GCG GCC CGG2169Thr Ser Ala Leu Glu Ser Leu Leu Leu Glu Al - #a Val His Ala Ala Arg# 220- CGG AAA GAC ACC CGG ACC ATG ACC CGC GTG CT - #C TAT GAA CGC GCA CAG2217Arg Lys Asp Thr Arg Thr Met Thr Arg Val Le - #u Tyr Glu Arg Ala Gln225 2 - #30 2 - #35 2 -#40- GCA GAG TTC GGC TCG GTC TCC GAC GAC CAG CT - #C GTC TAC ATG ATC ACC2265Ala Glu Phe Gly Ser Val Ser Asp Asp Gln Le - #u Val Tyr Met Ile Thr# 255- GGA CTC ATC TTC GCC GGC CAC GAC ACC ACC GG - #C TCG TTC CTG GGC TTC2313Gly Leu Ile Phe Ala Gly His Asp Thr Thr Gl - #y Ser Phe Leu Gly Phe# 270- CTG CTT GCG GAG GTC CTG GCG GGC CGT CTC GC - #G GCG GAC GCC GAC GGG2361Leu Leu Ala Glu Val Leu Ala Gly Arg Leu Al - #a Ala Asp Ala Asp Gly# 285- GAC GCC ATC TCC CGG TTC GTG GAG GAG GCG CT - #G CGC CAC CAC CCG CCG2409Asp Ala Ile Ser Arg Phe Val Glu Glu Ala Le - #u Arg His His Pro Pro# 300- GTG CCC TAC TCG TTG TGG AGG TTC GCT GCC AC - #G GAG GTG GTC ATC CGC2457Val Pro Tyr Ser Leu Trp Arg Phe Ala Ala Th - #r Glu Val Val Ile Arg305 3 - #10 3 - #15 3 -#20- GGT GTC CGG CTG CCC CGC GGA GCG CCG GTA CT - #G GTG GAC ATC GAG GGC2505Gly Val Arg Leu Pro Arg Gly Ala Pro Val Le - #u Val Asp Ile Glu Gly# 335- ACC AAC ACC GAC GGC CGC CAT CAC GAC GCC CC - #G CAC GCT TTC CAC CCG2553Thr Asn Thr Asp Gly Arg His His Asp Ala Pr - #o His Ala Phe His Pro# 350- GAC CGC CCT TCG AGG CGG CGG CTC ACC TTC GG - #C GAC GGG CCG CAC TAC2601Asp Arg Pro Ser Arg Arg Arg Leu Thr Phe Gl - #y Asp Gly Pro His Tyr# 365- TGC ATC GGG GAG CAG CTC GCC CAG CTG GAA TC - #G CGC ACG ATG ATC GGC2649Cys Ile Gly Glu Gln Leu Ala Gln Leu Glu Se - #r Arg Thr Met Ile Gly# 380- GTA CTG CGC AGC AGG TTC CCC CAA GCC CGA CT - #G GCC GTG CCG TAC GAG2697Val Leu Arg Ser Arg Phe Pro Gln Ala Arg Le - #u Ala Val Pro Tyr Glu385 3 - #90 3 - #95 4 -#00- GAG TTG CGG TGG TGC AGG AAG GGG GCC CAG AC - #A GCG CGG CTC ACT GAC2745Glu Leu Arg Trp Cys Arg Lys Gly Ala Gln Th - #r Ala Arg Leu Thr Asp# 415#GCACGGGACC 2794 T GATGGGCCGA CCGCGACCCGLeu Pro Val Trp Leu Arg 420- GCCCACCGCC CATCGCGCGG TGGGCGGTCC CGTGCCGGTC GCCCGGTGCG GT - #CCTCTCCC2854- GACGCTCGCT CCCCCTGTGA CTTTCTCACA TCGAGACGTG ACGAAATAAT CC - #CAGCAAGT2914- GCCATGCACA CTTTCATGGC GGACATTCAC TTGCGAGGAT GGAGTGAGCA CA - #CGGGGCCG2974- CCCGAGACAC CCTACGGCCG CCGGAAGTAT GCCACCTGTT GACGCGAATG GA - #ACGCCACA3034- GAGGGAGCAC CGGCAATGCA GATCAATATG TTGGGCCCGC TCGTTGCACA TC - #ACAATGGC3094- ACGTCGGTGA CCCCGATAGC CAGAAAACCC CGGCAGGTAT TCTCACTGCT CG - #CTCTTCAG3154#3196 CGGT CCCCGCGCTG ATGGAGGAGC TC- (2) INFORMATION FOR SEQ ID NO:5:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 422 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:- Met Ser Gly Glu Ala Pro Arg Val Ala Val As - #p Pro Phe Ser Cys Pro# 15- Met Met Thr Met Gln Arg Lys Pro Glu Val Hi - #s Asp Ala Phe Arg Glu# 30- Ala Gly Pro Val Val Glu Val Asn Ala Pro Al - #a Gly Gly Pro Ala Trp# 45- Val Ile Thr Asp Asp Ala Leu Ala Arg Glu Va - #l Leu Ala Asp Pro Arg# 60- Phe Val Lys Gly Pro Asp Leu Ala Pro Thr Al - #a Trp Arg Gly Val Asp# 80- Asp Gly Leu Asp Ile Pro Val Pro Glu Leu Ar - #g Pro Phe Thr Leu Ile# 95- Ala Val Asp Gly Glu Asp His Arg Arg Leu Ar - #g Arg Ile His Ala Pro# 110- Ala Phe Asn Pro Arg Arg Leu Ala Glu Arg Th - #r Asp Arg Ile Ala Ala# 125- Ile Ala Asp Arg Leu Leu Thr Glu Leu Ala As - #p Ser Ser Asp Arg Ser# 140- Gly Glu Pro Ala Glu Leu Ile Gly Gly Phe Al - #a Tyr His Phe Pro Leu145 1 - #50 1 - #55 1 -#60- Leu Val Ile Cys Glu Leu Leu Gly Val Pro Va - #l Thr Asp Pro Ala Met# 175- Ala Arg Glu Ala Val Gly Val Leu Lys Ala Le - #u Gly Leu Gly Gly Pro# 190- Gln Ser Ala Gly Gly Asp Gly Thr Asp Pro Al - #a Gly Asp Val Pro Asp# 205- Thr Ser Ala Leu Glu Ser Leu Leu Leu Glu Al - #a Val His Ala Ala Arg# 220- Arg Lys Asp Thr Arg Thr Met Thr Arg Val Le - #u Tyr Glu Arg Ala Gln225 2 - #30 2 - #35 2 -#40- Ala Glu Phe Gly Ser Val Ser Asp Asp Gln Le - #u Val Tyr Met Ile Thr# 255- Gly Leu Ile Phe Ala Gly His Asp Thr Thr Gl - #y Ser Phe Leu Gly Phe# 270- Leu Leu Ala Glu Val Leu Ala Gly Arg Leu Al - #a Ala Asp Ala Asp Gly# 285- Asp Ala Ile Ser Arg Phe Val Glu Glu Ala Le - #u Arg His His Pro Pro# 300- Val Pro Tyr Ser Leu Trp Arg Phe Ala Ala Th - #r Glu Val Val Ile Arg305 3 - #10 3 - #15 3 -#20- Gly Val Arg Leu Pro Arg Gly Ala Pro Val Le - #u Val Asp Ile Glu Gly# 335- Thr Asn Thr Asp Gly Arg His His Asp Ala Pr - #o His Ala Phe His Pro# 350- Asp Arg Pro Ser Arg Arg Arg Leu Thr Phe Gl - #y Asp Gly Pro His Tyr# 365- Cys Ile Gly Glu Gln Leu Ala Gln Leu Glu Se - #r Arg Thr Met Ile Gly# 380- Val Leu Arg Ser Arg Phe Pro Gln Ala Arg Le - #u Ala Val Pro Tyr Glu385 3 - #90 3 - #95 4 -#00- Glu Leu Arg Trp Cys Arg Lys Gly Ala Gln Th - #r Ala Arg Leu Thr Asp# 415- Leu Pro Val Trp Leu Arg 420- (2) INFORMATION FOR SEQ ID NO:6:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 3013 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:- GCAGGCGGTA CCGCCGACCC GCTGCATCCC CCGCACCGCC GTCCCCCCCC AG - #GGCATCTC 60- CCGTCGGGTT ACGGGAAGGG GGCCGGGGTA CCCGGTCGTC ACGGGAGGGC TG - #GGACGAGT 120- GCCCCCGACC CACTGCGTTC CAGCCACTCC CGGTACGCCG GGGCCTGCCG GG - #CGACCTCC 180- CCGTAGGCCT CCGCGAGGTC GGGGTAGACG CCCTCCAGTT CCGTGTCCGT GC - #GGGCCGCC 240- AGCAGCAGCC GTACGCCGAG CGGGTCGCCG TGCAGCCGGC GGACGGCCGT CT - #CGGCGCGG 300- GAGGGCGAGG TCGGCTGGAC CACGGTGACG ACCTCGCCGG TGGCGACCAG GT - #ACGCGGCG 360- GAGTGGTAGT CCCCGTGCAG GATGCGCGAG TCGAGTCCCT CGGCGCGCAG GA - #CCCGGCGC 420- ACCGCGTTCC ACTCGCCGTC GACGGTGGGG TCGATCATCC AGCGGGTCGT GG - #GCCAGGTC 480- GGCGAGGCGT ACGACGTGGC TTCGGCGGCC GGGTGGTCGG CCGGCAGGCA GA - #CGAACTGC 540- GGTTCCCGCT GGACCAGTAC GCGGACCCGG AGCCCTTCGG GGACGCGCAG GC - #TGCCCTCG 600- ACCTCGTGCA CGAAGGCGAC GTCGAGGTGG CCGTCGGCCA CCATGCGCAG CA - #GGGCGTTG 660- GCGGAGACGT CCATGTGCAG GGTGGGTTCC TGCCAGTGCC GGAGCCGGCG CA - #GCCAGCCC 720- GCCAGGGCCC GGCTGGCCGT GGAGCCGACG CGCAGGCTGG CGTCCGCGAC GG - #CGGCGGCG 780- CGGGCCTCGC TGACGAGGGA GCACAATTCG GCCACCAGGG GGCGGGCACG AC - #TGAGAACC 840- AGCCGGCCCA GCGGTGTGGG GCGGCAGCCG GTGCGGGCCC GGACGAACAG GG - #CACGGCCC 900- AGCTCGTGTT GGATGCGCCG CAGCTGCGTG CTCAACGAGG GCTGTGTCAC TC - #CCAGTTGG 960- CGTGCCGCGC GGTGCAGGCT GCCGGTGTCG GCGATGGCGC ACAGCGCCCT GA - #GGTGCCTG1020- ACCTCAAGCT CCATGTCCTG GGAGGGTAAG GCGGAAGTTC AGCTTTCACC AG - #ACATACAA1080- AATGGCGACC GATCAGGACC ATCGGGCCTT CACGGCGCGA GGCGTCGGCC CG - #GATCGGCA1140- GGGGCCCCGG CCGGGGCCGC CGGGCAGGGC GGCGCAGGTG GGGACGGAGG GG - #GATAGGGC1200- GGCCCTATCG GCGGTTGCCA TCATCACAAC GGCCGTACGG GCACGGACAC TC - #ACGATGTC1260- TGACTCATCC CCCCACCTCG AGGAGTCATC GATGCGCATG CGGAGGGGTG CC - #TCATCAGC1320- GGCCCTATCG GCGGTTGCCA TCATCACAAC GGCCGTACGG GCACGGACAC TC - #ACGATGTC1380- TGACTCATCC CCCCACCTCG AGGAGTCATC GATGCGCATG CGGAGGGGTG CC - #TCATGAGC1440- GCGGGCGGAC CCGCCTGGGT CATCACCGAT GACGCCCTCG CCCGCGAGGT GC - #TGGCCGAT1500- CCCCGGTTCG TGAAGGACCC CGATCTCGCG CCCACCGCCT GGCGGGGGGT GG - #ACGACGGT1560- CTCGACATCC CCGTTCCGGA GCTGCGTCCG TTCACGCTCA TCGCCGTGGA CG - #GTGAGGAC1620- CACCGCCGTC TGCGCCGCAT CCACGCACCG GCGTTCAACC CGCGCCGGCT GG - #CCGAGCGG1680- ACGGATCGCA TCGCCGCCAT CGCCGACCGG CTGCTCACCG AACTCGCCGA CT - #CCTCCGAC1740- CGGTCGGGCG AACCGGCCGA GCTGATCGGC GGCTTCGCGT ACCACTTCCC GC - #TGTTGGTC1800- ATCTGCGAAC TGCTCGGCGT GCCGGTCACC GATCCGGCAA TGGCCCGCGA GG - #CCGTCGGC1860- GTGCTCAAGG CACTCGGCCT CGGCGGCCCG CAGAGCGCCG GCGGTGACGG CA - #CGGACCCT1920- GCCGGGGACG TGCCGGACAC GTCGGCGCTG GAGAGCCTTC TCCTCGAAGC CG - #TGCACGCG1980- GCCCGGCGGA AAGACACCCG GACCATGACC CGCGTGCTCT ATGAACGCGC AC - #AGGCAGAG2040- TTCGGCTCGG TCTCCGACGA CCAGCTCGTC TACATGATCA CCGGACTCAT CT - #TCGCCGGC2100- CACGACACCA CCGGCTCGTT CCTGGGCTTC CTGCTTGCGG AGGTCCTGGC GG - #GCCGTCTC2160- GCGGCGGACG CCGACGGGGA CGCCATCTCC CGGTTCGTGG AGGAGGCGCT GC - #GCCACCAC2220- CCGCCGGTGC CCTACACGTT GTGGAGGTTC GCTGCCACGG AGGTGGTCAT CC - #GCGGTGTC2280- CGGCTGCCCC GCGGAGCGCC GGTACTGGTG GACATCGAGG GCACCAACAC CG - #ACGGCCGC2340- CATCACGACG CCCCGCACGC TTTCCACCCG GACCGCCCTT CGAGGCGGCG GC - #TCACCTTC2400- GGCGACGGGC CGCACTACTG CATCGGGGAG CAGCTCGCCC AGCTGGAATC GC - #GCACGATG2460- ATCGGCGTAC TGCGCAGCAG GTTCCCCCAA GCCCGACTGG CCGTGCCGTA CG - #AGGAGTTG2520- CGGTGGTGCA GGAAGGGGGC CCAGACAGCG CGGCTCACTG ACCTGCCCGT CT - #GGCTGCGT2580- TGATGGGCCG ACCGCGACCC GGCACGGGAC CGCCCACCGC CCATCGCGCG GT - #GGGCGGTC2640- CCGTGCCGGT CGCCCGGTGC GGTCCTCTCC CGACGCTCGC TCCCCCTGTG AC - #TTTCTCAC2700- ATCGAGACGT GACGAAATAA TCCCAGCAAG TGCCATGCAC ACTTTCATGG CG - #GACATTCA2760- CTTGCGAGGA TGGAGTGAGC ACACGGGGCC GCCCGAGACA CCCTACGGCC GC - #CGGAAGTA2820- TGCCACCTGT TGACGCGAAT GGAACGCCAC AGAGGGAGCA CCGCCAATGC AG - #ATCAATAT2880- GTTGGGCCCG CTCGTTGCAC ATCACAATGG CACGTCGGTG ACCCCGATAG CC - #AGAAAACC2940- CCGGCAGGTA TTCTCACTGC TCGCTCTTCA GGCAGGAACC GTCGTTCCGG TC - #CCCGCGCT3000# 3013- (2) INFORMATION FOR SEQ ID NO:7:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 2081 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 227..1649- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:- TGTTGACAAT TAATCATCCG GCTCGTATAA TGTGTGGAAT TGTGAGCGGA TA - #ACAATTTC 60- ACACAGGAAA CAGCGCCGCT GAGAAAAAGC GAAGCGGCAC TGCTCTTTAA CA - #ATTTATCA 120- GACAATCTGT GTGGGCACTC GACCGGAATT GGGCATCGAT TAACTTTATT AT - #TAAAAATT 180#GGG GGT 235AATGT ATCGATTAAA TAAGGAGGAA TAAACC ATG#Gly Met Gly# 1- TCT CAT CAT CAT CAT CAT CAT GGT ATG GCT AG - #C ATG ACT GGT GGA CAG 283Ser His His His His His His Gly Met Ala Se - #r Met Thr Gly Gly Gln# 15- CAA ATG GGT CGG GAT CTG TAC GAC GAT GAC GA - #T AAG GAT CGA TGG ATC 331Gln Met Gly Arg Asp Leu Tyr Asp Asp Asp As - #p Lys Asp Arg Trp Ile# 35- CGA CCT CGA GAT CTG CAG ATG GTA CCA TAT GG - #G AAT TCG GAG GGG TGC 379Arg Pro Arg Asp Leu Gln Met Val Pro Tyr Gl - #y Asn Ser Glu Gly Cys# 50- CTC ATG AGC GGC GAG GCG CCG CGG GTG GCC GT - #C GAC CCG TTC TCG TGT 427Leu Met Ser Gly Glu Ala Pro Arg Val Ala Va - #l Asp Pro Phe Ser Cys# 65- CCC ATG ATG ACC ATG CAG CGC AAA CCC GAG GT - #G CAC GAC GCA TTC CGA 475Pro Met Met Thr Met Gln Arg Lys Pro Glu Va - #l His Asp Ala Phe Arg# 80- GAG GCG GGC CCC GTC GTC GAG GTG AAC GCC CC - #C GCG GGC GGA CCC GCC 523Glu Ala Gly Pro Val Val Glu Val Asn Ala Pr - #o Ala Gly Gly Pro Ala# 95- TGG GTC ATC ACC GAT GAC GCC CTC GCC CGC GA - #G GTG CTG GCC GAT CCC 571Trp Val Ile Thr Asp Asp Ala Leu Ala Arg Gl - #u Val Leu Ala Asp Pro100 1 - #05 1 - #10 1 -#15- CGG TTC GTG AAG GGA CCC GAT CTC GCG CCC AC - #C GCC TGG CGG GGG GTG 619Arg Phe Val Lys Gly Pro Asp Leu Ala Pro Th - #r Ala Trp Arg Gly Val# 130- GAC GAC GGT CTC GAC ATC CCC GTT CCG GAG CT - #G CGT CCG TTC ACG CTC 667Asp Asp Gly Leu Asp Ile Pro Val Pro Glu Le - #u Arg Pro Phe Thr Leu# 145- ATC GCC GTG GAC GGT GAG GAC CAC CGG CGT CT - #G CGC CGC ATC CAC GCA 715Ile Ala Val Asp Gly Glu Asp His Arg Arg Le - #u Arg Arg Ile His Ala# 160- CCG GCG TTC AAC CCG CGC CGG CTG GCC GAG CG - #G ACG GAT CGC ATC GCC 763Pro Ala Phe Asn Pro Arg Arg Leu Ala Glu Ar - #g Thr Asp Arg Ile Ala# 175- GCC ATC GCC GAC CGG CTG CTC ACC GAA CTC GC - #C GAC TCC TCC GAC CGG 811Ala Ile Ala Asp Arg Leu Leu Thr Glu Leu Al - #a Asp Ser Ser Asp Arg180 1 - #85 1 - #90 1 -#95- TCG GGC GAA CCG GCC GAG CTG ATC GGC GGC TT - #C GCG TAC CAC TTC CCG 859Ser Gly Glu Pro Ala Glu Leu Ile Gly Gly Ph - #e Ala Tyr His Phe Pro# 210- CTG TTG GTC ATC TGC GAA CTG CTC GGC GTG CC - #G GTC ACC GAT CCG GCA 907Leu Leu Val Ile Cys Glu Leu Leu Gly Val Pr - #o Val Thr Asp Pro Ala# 225- ATG GCC CGC GAG GCC GTC GGC GTG CTC AAG GC - #A CTC GGC CTC GGC GGC 955Met Ala Arg Glu Ala Val Gly Val Leu Lys Al - #a Leu Gly Leu Gly Gly# 240- CCG CAG AGC GCC GGC GGT GAC GGC ACG GAC CC - #T GCC GGG GAC GTG CCG1003Pro Gln Ser Ala Gly Gly Asp Gly Thr Asp Pr - #o Ala Gly Asp Val Pro# 255- GAC ACG TCG GCG CTG GAG AGC CTT CTC CTC GA - #A GCC GTG CAC GCG GCC1051Asp Thr Ser Ala Leu Glu Ser Leu Leu Leu Gl - #u Ala Val His Ala Ala260 2 - #65 2 - #70 2 -#75- CGG CGG AAA GAC ACC CGG ACC ATG ACC CGC GT - #G CTC TAT GAA CGC GCA1099Arg Arg Lys Asp Thr Arg Thr Met Thr Arg Va - #l Leu Tyr Glu Arg Ala# 290- CAG GCA GAG TTC GGC TCG GTC TCC GAC GAC CA - #G CTC GTC TAC ATG ATC1147Gln Ala Glu Phe Gly Ser Val Ser Asp Asp Gl - #n Leu Val Tyr Met Ile# 305- ACC GGA CTC ATC TTC GCC GGC CAC GAC ACC AC - #C GGC TCG TTC CTG GGC1195Thr Gly Leu Ile Phe Ala Gly His Asp Thr Th - #r Gly Ser Phe Leu Gly# 320- TTC CTG CTT GCG GAG GTC CTG GCG GGC CGT CT - #C GCG GCG GAC GCC GAC1243Phe Leu Leu Ala Glu Val Leu Ala Gly Arg Le - #u Ala Ala Asp Ala Asp# 335- GGG GAC GCC ATC TCC CGG TTC GTG GAG GAG GC - #G CTG CGC CAC CAC CCG1291Gly Asp Ala Ile Ser Arg Phe Val Glu Glu Al - #a Leu Arg His His Pro340 3 - #45 3 - #50 3 -#55- CCG GTG CCC TAC TCG TTG TGG AGG TTC GCT GC - #C ACG GAG GTG GTC ATC1339Pro Val Pro Tyr Ser Leu Trp Arg Phe Ala Al - #a Thr Glu Val Val Ile# 370- CGC GGT GTC CGG CTG CCC CGC GGA GCG CCG GT - #A CTG GTG GAC ATC GAG1387Arg Gly Val Arg Leu Pro Arg Gly Ala Pro Va - #l Leu Val Asp Ile Glu# 385- GGC ACC AAC ACC GAC GGC CGC CAT CAC GAC GC - #C CCG CAC GCT TTC CAC1435Gly Thr Asn Thr Asp Gly Arg His His Asp Al - #a Pro His Ala Phe His# 400- CCG GAC CGC CCT TCG AGG CGG CGG CTC ACC TT - #C GGC GAC GGG CCG CAC1483Pro Asp Arg Pro Ser Arg Arg Arg Leu Thr Ph - #e Gly Asp Gly Pro His# 415- TAC TGC ATC GGG GAG CAG CTC GCC CAG CTG GA - #A TCG CGC ACG ATG ATC1531Tyr Cys Ile Gly Glu Gln Leu Ala Gln Leu Gl - #u Ser Arg Thr Met Ile420 4 - #25 4 - #30 4 -#35- GGC GTA CTG CGC AGC AGG TTC CCC CAA GCC CG - #A CTG GCC GTG CCG TAC1579Gly Val Leu Arg Ser Arg Phe Pro Gln Ala Ar - #g Leu Ala Val Pro Tyr# 450- GAG GAG TTG CGG TGG TGC AGG AAG GGG GCC CA - #G ACA GCG CGG CTC ACT1627Glu Glu Leu Arg Trp Cys Arg Lys Gly Ala Gl - #n Thr Ala Arg Leu Thr# 465- GAC CTG CCC GTC TGG CTG CGT T GATGGGCCGA CCGC - #GACCCG GCACGGGACC1679Asp Leu Pro Val Trp Leu Arg 470- GCCCACCGCC CATCGCGCGG TGGGCGGTCC CGTGCCGGTC GCCCGGTGCG GT - #CCTCTCCC1739- GACGCTCGCT CCCCCTGTGA CTTTCTCACA TCGAGACGTG ACGAAATAAT CC - #CAGCAAGT1799- GCCATGCACA CTTTCATGGC GGACATTCAC TTGCGAGGAT GGAGTGAGCA CA - #CGGGGCCG1859- CCCGAGACAC CCTACGGCCG CCGGAAGTAT GCCACCTGTT GACGCGAATG GA - #ACGCCACA1919- GAGGGAGCAC CGGCAATGCA GATCAATATG TTGGGCCCGC TCGTTGCACA TC - #ACAATGGC1979- ACGTCGGTGA CCCCGATAGC CAGAAAACCC CGGCAGGTAT TCTCACTGCT CG - #CTCTTCAG2039#2081 CGGT CCCCGCGCTG ATGGAGGAGC TC- (2) INFORMATION FOR SEQ ID NO:8:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 474 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:- Met Gly Gly Ser His His His His His His Gl - #y Met Ala Ser Met Thr# 15- Gly Gly Gln Gln Met Gly Arg Asp Leu Tyr As - #p Asp Asp Asp Lys Asp# 30- Arg Trp Ile Arg Pro Arg Asp Leu Gln Met Va - #l Pro Tyr Gly Asn Ser# 45- Glu Gly Cys Leu Met Ser Gly Glu Ala Pro Ar - #g Val Ala Val Asp Pro# 60- Phe Ser Cys Pro Met Met Thr Met Gln Arg Ly - #s Pro Glu Val His Asp# 80- Ala Phe Arg Glu Ala Gly Pro Val Val Glu Va - #l Asn Ala Pro Ala Gly# 95- Gly Pro Ala Trp Val Ile Thr Asp Asp Ala Le - #u Ala Arg Glu Val Leu# 110- Ala Asp Pro Arg Phe Val Lys Gly Pro Asp Le - #u Ala Pro Thr Ala Trp# 125- Arg Gly Val Asp Asp Gly Leu Asp Ile Pro Va - #l Pro Glu Leu Arg Pro# 140- Phe Thr Leu Ile Ala Val Asp Gly Glu Asp Hi - #s Arg Arg Leu Arg Arg145 1 - #50 1 - #55 1 -#60- Ile His Ala Pro Ala Phe Asn Pro Arg Arg Le - #u Ala Glu Arg Thr Asp# 175- Arg Ile Ala Ala Ile Ala Asp Arg Leu Leu Th - #r Glu Leu Ala Asp Ser# 190- Ser Asp Arg Ser Gly Glu Pro Ala Glu Leu Il - #e Gly Gly Phe Ala Tyr# 205- His Phe Pro Leu Leu Val Ile Cys Glu Leu Le - #u Gly Val Pro Val Thr# 220- Asp Pro Ala Met Ala Arg Glu Ala Val Gly Va - #l Leu Lys Ala Leu Gly225 2 - #30 2 - #35 2 -#40- Leu Gly Gly Pro Gln Ser Ala Gly Gly Asp Gl - #y Thr Asp Pro Ala Gly# 255- Asp Val Pro Asp Thr Ser Ala Leu Glu Ser Le - #u Leu Leu Glu Ala Val# 270- His Ala Ala Arg Arg Lys Asp Thr Arg Thr Me - #t Thr Arg Val Leu Tyr# 285- Glu Arg Ala Gln Ala Glu Phe Gly Ser Val Se - #r Asp Asp Gln Leu Val# 300- Tyr Met Ile Thr Gly Leu Ile Phe Ala Gly Hi - #s Asp Thr Thr Gly Ser305 3 - #10 3 - #15 3 -#20- Phe Leu Gly Phe Leu Leu Ala Glu Val Leu Al - #a Gly Arg Leu Ala Ala# 335- Asp Ala Asp Gly Asp Ala Ile Ser Arg Phe Va - #l Glu Glu Ala Leu Arg# 350- His His Pro Pro Val Pro Tyr Ser Leu Trp Ar - #g Phe Ala Ala Thr Glu# 365- Val Val Ile Arg Gly Val Arg Leu Pro Arg Gl - #y Ala Pro Val Leu Val# 380- Asp Ile Glu Gly Thr Asn Thr Asp Gly Arg Hi - #s His Asp Ala Pro His385 3 - #90 3 - #95 4 -#00- Ala Phe His Pro Asp Arg Pro Ser Arg Arg Ar - #g Leu Thr Phe Gly Asp# 415- Gly Pro His Tyr Cys Ile Gly Glu Gln Leu Al - #a Gln Leu Glu Ser Arg# 430- Thr Met Ile Gly Val Leu Arg Ser Arg Phe Pr - #o Gln Ala Arg Leu Ala# 445- Val Pro Tyr Glu Glu Leu Arg Trp Cys Arg Ly - #s Gly Ala Gln Thr Ala# 460- Arg Leu Thr Asp Leu Pro Val Trp Leu Arg465 4 - #70- (2) INFORMATION FOR SEQ ID NO:9:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 443 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:- Asp Arg Trp Ile Arg Pro Arg Asp Leu Gln Me - #t Val Pro Tyr Gly Asn# 15- Ser Glu Gly Cys Leu Met Ser Gly Glu Ala Pr - #o Arg Val Ala Val Asp# 30- Pro Phe Ser Cys Pro Met Met Thr Met Gln Ar - #g Lys Pro Glu Val His# 45- Asp Ala Phe Arg Glu Ala Gly Pro Val Val Gl - #u Val Asn Ala Pro Ala# 60- Gly Gly Pro Ala Trp Val Ile Thr Asp Asp Al - #a Leu Ala Arg Glu Val#80- Leu Ala Asp Pro Arg Phe Val Lys Asp Pro As - #p Leu Ala Pro Thr Ala# 95- Trp Arg Gly Val Asp Asp Gly Leu Asp Ile Pr - #o Val Pro Glu Leu Arg# 110- Pro Phe Thr Leu Ile Ala Val Asp Gly Glu As - #p His Arg Arg Leu Arg# 125- Arg Ile His Ala Pro Ala Phe Asn Pro Arg Ar - #g Leu Ala Glu Arg Thr# 140- Asp Arg Ile Ala Ala Ile Ala Asp Arg Leu Le - #u Thr Glu Leu Ala Asp145 1 - #50 1 - #55 1 -#60- Ser Ser Asp Arg Ser Gly Glu Pro Ala Glu Le - #u Ile Gly Gly Phe Ala# 175- Tyr His Phe Pro Leu Leu Val Ile Cys Glu Le - #u Leu Gly Val Pro Val# 190- Thr Asp Pro Ala Met Ala Arg Glu Ala Val Gl - #y Val Leu Lys Ala Leu# 205- Gly Leu Gly Gly Pro Gln Ser Ala Gly Gly As - #p Gly Thr Asp Pro Ala# 220- Gly Asp Val Pro Asp Thr Ser Ala Leu Glu Se - #r Leu Leu Leu Glu Ala225 2 - #30 2 - #35 2 -#40- Val His Ala Ala Arg Arg Lys Asp Thr Arg Th - #r Met Thr Arg Val Leu# 255- Tyr Glu Arg Ala Gln Ala Glu Phe Gly Ser Va - #l Ser Asp Asp Gln Leu# 270- Val Tyr Met Ile Thr Gly Leu Ile Phe Ala Gl - #y His Asp Thr Thr Gly# 285- Ser Phe Leu Gly Phe Leu Leu Ala Glu Val Le - #u Ala Gly Arg Leu Ala# 300- Ala Asp Ala Asp Gly Asp Ala Ile Ser Arg Ph - #e Val Glu Glu Ala Leu305 3 - #10 3 - #15 3 -#20- Arg His His Pro Pro Val Pro Tyr Thr Leu Tr - #p Arg Phe Ala Ala Thr# 335- Glu Val Val Ile Arg Gly Val Arg Leu Pro Ar - #g Gly Ala Pro Val Leu# 350- Val Asp Ile Glu Gly Thr Asn Thr Asp Gly Ar - #g His His Asp Ala Pro# 365- His Ala Phe His Pro Asp Arg Pro Ser Arg Ar - #g Arg Leu Thr Phe Gly# 380- Asp Gly Pro His Tyr Cys Ile Gly Glu Gln Le - #u Ala Gln Leu Glu Ser385 3 - #90 3 - #95 4 -#00- Arg Thr Met Ile Gly Val Leu Arg Ser Arg Ph - #e Pro Gln Ala Arg Leu# 415- Ala Val Pro Tyr Glu Glu Leu Arg Trp Cys Ar - #g Lys Gly Ala Gln Thr# 430- Ala Arg Leu Thr Asp Leu Pro Val Trp Leu Ar - #g# 440__________________________________________________________________________

Number	Name	Date
5008380	Palladino et al.	Apr 1991
5501969	Hastings et al.	Mar 1996
5695966	Inventi et al.	Dec 1997
5786190	Inventi et al.	Jul 1998

Methods of producing doxorubicin

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

CROSS-REFERENCE TO RELATED APPLICATIONS

US Referenced Citations (4)

Non-Patent Literature Citations (20)

Divisions (1)

Entry
One page computer print-out of search identifying WO 9627014, "New DNA Encoding Daunorubicin 14-hydroxylase", Sep. 6, 1996 and containing abstract of application.
"Adriamycin, 14-Hydroxydauomycin, a New Antitumor Antibiotic from S. peuceilus var. caesius" by Arcamone, et al., Biotechnology and Bioengineering, vol. XI, pp. 1101-1110 (1069).
"Cloning of genetic loci involved in endoprotease activity in Streptomyces lividans 66: a novel neutral protease gene with an adjacent divergent putative regulatory gene", by Butler, et al., Can J. Microbiology, vol. 38, 1992, pp. 912-920.
"Biosynthetic relationships among daunorubicin, doxorubicin and 13-dihydrodaunorubicin in Streptomyces peucetius" by Crespi-Perellino, et al., Experientia 38 (1982), Birkhauser Verlag, CH-4010 Basel-Switzerland, pp. 1455-1456.
"A metallopretease gene from Streptomyces coelicolor `Muller` and its transcriptional activator, a member of the LysR family" by Dammann, et al., Molecular Biology, (1992) 6(16), pp. 2267-2278.
"Isolation and Characterization of a Gene from Streptomyces sp. Strain C5 That Confers the Ability to Convert Daunomycin to Doxorubicin on Streptomyces lividans TK24" by Dickens, et al, Journal of Bacteriology, vol. 178, No. 11, Jun. 1996, pp. 3389-3395.
"Cloning, Sequencing, and Analysis of Aklaviketone Reductase from Streptomyces sp. Strain C5", by Dickens, et al., Journal of Bacteriology, vol. 178, No. 11, Jun. 1996, pp. 3384-3388.
"Biosynthesis of Anthracyclines in Streptomyces Peucetius", by Grein, et al., Sixth Int. Symp. On Actinomycetes Biology, 1985, pp. 263-266.
"Anthracyclines", Chapter 12 of Genetics and Biochemistry of Antiobiotic Production, edited by Leo C. Vining and Colin Struttard.
"Cloning and Sequencing of a Gene Encoding a Novel Extracellular Neutral Proteinase from Streptomyces sp. Strain C5 and Expression of the Gene in Streptomyces lividans 1326" by Lampel, et al., Journal of Bacteriology, vol. 174, No. 9, May 1992, pp. 2797-2808.
"Cloning and characterization of a gene encoding extracellular metalloprotease from Streptomyces lividans" by Lichenstein, et al., Gene 111 (1992), pp. 125-130.
"Microbial Metabolism of Anthracycline Antibiotics Daunomycin and Adrianycin" by Marshall, et al. The Journal of Antibiotics, Apr. 1978, pp. 336-342.
"Biosynthesis of Daunorubicin Glycosides" by McGuire, et al., Antimicrobial Agents and Chemotherapy, vol. 18, No. 3, Sep. 1980, pp. 454-464.
"Microbial Conversion of Daunomycin, Carminomycin I and Feudomycin A to Adriamycin", Journal of Antibiotics, vol. XXXIV No. 9, pp. 1229-1231.
"Cloning and Expression of Daunorubicin Biosynthesis Genes from Streptomyces peucetius and S. peucetius subsp. caesius" by Otten, et al., Journal of Bacteriology, vol. 172, No. 6, Jun. 1990, pp. 3427-3434.
"Identification of a Saccharopolyspora erythraea gene Required for the Final Hydroxylation Step in Erythromycin Biosynthesis" by Stassi, et al. Journal of Bacteriology, vol. 175, No. 1, Jan. 1993, pp. 182-189.
"Biosynthesis of Natural and Hybrid Polyketides by Anthrcycline-Producing Streptomycetes" by Strohl, et al. Genetics and Molecular Biology of Industrial Microorganisms, 1989 American Society for Microbiology, Washington, D.C., pp. 68-84.
"Daunorubicin and Adramycin: Properties, Biosynthesis, and Fermentation" by White, et al., Biotechnology of Industrial Antibiotics, 1984, pp. 569-594.
"Isolation and Sequence Analysis of Polyketide Synthase Genes from the Caunomycin-Producing Streptomyces sp. Strain C5" by Ye, et al., Journal of Bacteriology, vol. 176, No. 20, Oct. 1994, pp. 6270-6280.
"Characterization of Saccharopolyspora erythraea Cytochrome P-450 Genes and Enzymens, Including 6-Deoxyerythronolide B Hydroxylase" by Andersen, et al., Journal of Bacteriology, vol. 174, No. 3, Feb. 1992, pp. 725-735.