Methods of screening tyramine- and octopamine-expressing cells for compounds and compositions having potential insect control activity

Information

  • Patent Grant
  • 7622269
  • Patent Number
    7,622,269
  • Date Filed
    Monday, March 21, 2005
    19 years ago
  • Date Issued
    Tuesday, November 24, 2009
    15 years ago
  • Inventors
  • Original Assignees
  • Examiners
    • Landsman; Robert
    Agents
    • Davis Wright Tremaine LLP
Abstract
A screening method for identifying compounds that are effective insect control agents includes providing cells expressing an octopamine receptor, adding the compounds to the cells, and measuring the effects of the compounds and compositions. The effects of the compounds may be determined by measuring the binding affinity of the compounds to the octopamine receptor or measuring the change in intracellular cAMP or Ca2+ levels.
Description
FIELD OF THE INVENTION

The present invention relates to compounds, compositions and method for controlling insects.


BACKGROUND OF THE INVENTION

Animals have chemosensory and mechanosensory systems that recognize a large array of environmental stimuli, generating behavioral responses. Many behavioral studies have been conducted to understand the genetics of these systems. The olfactory system plays a crucial role in the survival and maintenance of species, particularly in insects.


Biogenic amines serve a neurotransmitter or neuromodulator role in the olfactory system. The biogenic amine, octopamine, has a prominent role in insects and other invertebrates as it is involved in the regulation of multiple physiological events, for example, effects on muscular systems, sensory organs, endocrine tissues as well as learning and behavior. Octopamine (OA) occurs in large amounts in the nervous systems of species representing the phylum Arthropoda, including the classes Insecta and Crustacea. OA has a broad spectrum of biological roles in insects acting as a neurotransmitter, neurohormone and neuromodulator. OA exerts its effects through interaction with at least four classes of membrane bound receptors that belong to the family of G-protein coupled receptors (GPCRs). All members of GPCRs share the common motif of seven transmembrane (TM) domains.


When a GPCR is activated, depending on its type and the protein to which it binds, changes in intracellular concentrations of cAMP, Ca2+ or both often take place. Since changes in intracellular levels of cAMP or Ca2+ are the most commonly found cellular responses to biogenic amine treatments (e.g., serotonin, dopamine, octopamine, etc.), they are used to functionally classify receptor subtypes. As a result of GPCR activation, intracellular cAMP levels can either be elevated or reduced. The cellular response strictly relies on the specificity of interaction between the receptor and the G protein (See e.g., Gudermann T, Kalkbrenner F, Schultz G. 1996, “Diversity and selectivity of receptor-G protein interaction,” Annu Rev Pharmacol Toxicol 36: 429-459; and Gudermann T, Schoneberg T, Schultz G. 1997, “Functional and structural complexity of signal transduction via G-protein-coupled receptors,” Annu Rev Neurosci 20: 399-427, both of which are incorporated herein by this reference). When the receptor binds to Gs-type protein, the activated Gas subunit will interact with adenylyl cyclase (AC) in the plasma membrane. This leads to an increase of AC activity and production of cAMP from ATP.


Several biogenic amine receptors are also known to inhibit AC activity. This effect is mediated by interaction of the receptor with inhibitory G protein (Gi). Interaction of AC with activated Gαi subunits most likely competes with binding of activated Gas subunits and thereby interferes with AC activation.


Another pathway that is activated by several biogenic amine receptors results in a rise of intracellular Ca2+ levels. In such a scenario the amine-activated receptor binds to G proteins of the Gq/o family (See e.g., supra, Gudermann et al., 1996 and Gudermann et al., 1997). The activated Gαq/o subunits bind to and stimulate phospholipase C (PLC) activity. The enzyme hydrolyzes a membrane-bound substrate, phosphatidylinositol 4,5-bisphosphate which gives rise to two second messengers IP3 and DAG. After binding of IP3 to its receptors, the calcium channel pore is opened and Ca2+ is released into the cytoplasm. Ca2+ ions play a vital role in the regulation of many cellular functions by binding to members of large family of Ca2+-binding proteins and/or directly controlling enzymatic or ion channel activities.


Multiple insect species have been utilized to understand the biological functions and pharmacological characteristics of octopamine receptors. Studies with Periplaneta americana (American cockroach) have provided insight into the pharmacology and second messenger signaling of octopamine through octopamine receptors. For example, octopamine has been found to activate adenylate cyclase in certain cells in this species. Furthermore, octopamine has been found to increase inositol triphosphates in certain cells in this species.


As the octopaminergic system is believed to be unique to invertebrate physiology, this pathway has been proposed to offer a target for invertebrate pesticides with potential for low vertebrate toxicity. Formamidine-like chemicals have been found to be octopaminergic agonists and inhibit the uptake of sodium-sensitive octopamine in certain insects; for example, the formamidine pesticides chlordimeform and demethylchloridimeform were found to target the octopamine signaling pathway in certain invertebrates, including Periplaneta americana. To provide insight into the design of octopamine agonists that could be used as potential insecticides, structure function analyses have been performed with 2-(arylimino)oxazolidines and 2-(substituted benzylamino)-2-oxazolines in regard to activation of the octopamine sensitive adenylate cyclase in certain cells in Periplaneta Americana. More recently, it has been suggested that one site of action for the insecticidal activity of plant essential oils against Periplaneta americana is the octopaminergic system and that octopamine receptors may be targeted by these compounds, as described in Enan, E., 2001, “Insecticidal activity of essential oils: octopaminergic sites of action,” Comp. Biochem. Physiol. C Toxicol. Pharmacol. 130, 325-327, which is incorporated herein by this reference.


Identifying plant essential oils and combinations thereof, having insect-controlling activity is particularly desirable given that many such compounds do not produce unwanted or harmful affects on humans, other animal species, and certain plants. However, identifying the most effective plant essential oils and combinations thereof requires random selection and use of tedious screening methods, which, given the vast number of plant essential oils and possible combinations thereof, is a substantially impossible task.


As such, there is a need in the art for an improved method for screening compounds and compositions for insect control activity.


SUMMARY OF THE PRESENT INVENTION

The present invention addresses the above identified problems, and others, by providing a screening method for identifying compounds and compositions that are effective insect control agents; a screening method for identifying compounds and compositions that are effective species-specific insect control agents; compounds and compositions isolated from the screening methods; cell lines expressing an octopamine receptor; and isolated nucleic acid molecule sequences.





DESCRIPTION OF THE DRAWINGS


FIG. 1A is an alignment of the nucleic acid sequence and the translated amino acid sequence from Pa oa1, of SEQ ID NO: 1 and SEQ ID NO: 2;



FIG. 1B is the nucleic acid sequence from Pa oa1 of SEQ ID NO: 1, with the seven putative transmembrane domains (TM) overlined and numbered 1 through 7, the stop codons (SC) underlined, and the initiation codon (M) underlined;



FIG. 2 is an alignment of the translated amino acid sequences of Pa oa1 of SEQ ID NO: 2 and OAMB of SEQ ID NO: 3, with the seven putative transmembrane domains (TM) overlined and numbered 1 through 7;



FIG. 3A is saturation binding curve of 3-H-yohimbine to Pa oa1, where total binding is designated by the squares, nonspecific binding is designated by the triangle, and specific binding is designated by the inverted triangle;



FIG. 3B is saturation binding curve of 3H-yohimbine to OAMB, where total binding is designated by the squares, nonspecific binding is designated by the triangle, and specific binding is designated by the inverted triangle;



FIG. 4 is a hydropathy profile of Pa oa1 with the transmembrane domains (TM) numbered 1 through 7;



FIG. 5 depicts the similarity between octopamine and tyramine receptors from different insect species;



FIG. 6 is a graph depicting the change of intracellular cAMP levels in HEK-293 cells expressing Pa oa1 in response to treatment with various concentrations of either octopamine (OA) or tyramine (TA); and



FIG. 7 is a graph depicting the change in intracellular calcium levels in HEK-293 cells expressing Pa oa1 in response to treatment with either 100 nM octopamine (OA) or 100 nM tyramine (TA);



FIG. 8 is a bar graph depicting the change in intracellular cAMP levels in HEK-293 expressing Pa oa1 in response to treatment with 0, 100 nM, or 1 μM octopamine (OA) in the presence and absence of 20 μM BAPTA/AM, a calcium chelator;



FIG. 9 is a bar graph depicting the cAMP response to octopamine through Pa oa1 and OAMB expressed in HEK-293 cells where the cells expressing either receptor are treated with 10 μM octopamine and the level of cAMP is determined;



FIGS. 10A and 10B are graphs depicting the calcium response to octopamine through Pa oa1 and OAMB, respectively, expressed in HEK-293 cells;



FIG. 11 is a depiction of the chemical structures of p-cymene [methyl(1-methylethyl)benzene], eugenol [2-methoxy-4-(2-propenyl)phenol], trans-anethole [1-methoxy-4-(1-propenyl)benzene], cinnamic alcohol [3-phenyl-2-propen-1-ol], α-terpineol [p-menth-1-en-8-ol], methyl salicylate [2-hydroxybenzoic acid methyl ester], 2-phenylethyl propionate, and geraniol [3,7-dimethyl-2,6-octadien-1-ol];



FIG. 12 is a bar graph depicting the effect of certain plant essential oils on specific binding of 3H-yohimbine to Pa oa1 and OAMB;



FIG. 13 is a bar graph depicting the effect of certain plant essential oils on cAMP levels in HEK-293 cells expressing either Pa oa1 or OAMB; and



FIGS. 14A-14F are graphs depicting the effect of certain plant essential oils on intracellular calcium [Ca2+]i levels in HEK-293 cells either transfected with Pa oa1 or OAMB.





DETAILED DESCRIPTION OF THE INVENTION

The present invention includes: a screening method for identifying compounds and compositions that are effective insect control agents; a screening method for identifying compounds and compositions that are effective species-specific insect control agents; compounds and compositions isolated from the screening methods; transfected cell lines; and isolated nucleic acid molecule sequences.


The present invention includes: an isolated nucleic acid molecule sequence which encodes a protein that binds a biogenic amine, resulting in changes in intracellular concentrations of cAMP, Ca2+, or both, having a nucleotide sequence of SEQ ID NO: 1, or a fragment or derivative thereof and/or having an amino acid sequence of SEQ ID NO: 2, or a fragment or derivative thereof; an isolated nucleic acid molecule of having at least about 30% similarity to the nucleotide sequence of SEQ ID NO: 1, wherein the isolated nucleic acid molecule encodes a protein, resulting in changes in intracellular concentrations of cAMP, Ca2+, or both; an isolated nucleic acid molecule of having at least about 30% similarity to the nucleotide sequence of SEQ ID NO: 1, wherein the molecule encodes an octopamine receptor or a protein having an amino acid sequence of SEQ ID NO: 2, or a fragment or derivative thereof; and an isolated nucleic acid molecule having a nucleotide sequence of SEQ ID NO: 1, or a fragment or derivative thereof, wherein the molecule encodes a protein designated Pa oa1. SEQ ID NO: 1 and SEQ ID NO: 2 are shown in alignment in FIG. 1A and SEQ ID NO: 1 is also provided in FIG. 1B. Fragments and derivatives of the sequences shall include transmembrane domains (TM) 3, 5 and 6. Fragments and derivatives of the sequences may exclude, for example, portions upstream of TM 1, portions upstream of TM 2, or portions downstream of TM 7.


The present invention also includes: a strain of cells including a DNA vector having a nucleic acid sequence of SEQ ID NO: 1; a strain of cells expressing an octopamine receptor cloned from an insect species of interest; a strain of cells expressing an octopamine receptor cloned from Periplaneta Americana (Pa oa1); a strain of cells expressing a protein having an amino acid sequence of SEQ ID NO: 2, or fragments or derivatives thereof, wherein the fragments or derivatives thereof bind octopamine; a strain of cells expressing an octopamine receptor cloned from Drosophila melanogaster (QAMB); a strain of cells expressing a protein having an amino acid sequence of SEQ ID NO: 3, or fragments or derivatives thereof, wherein the fragments or derivatives thereof bind octopamine. The transfected cells may be mammalian cells or insect cells; for example, they may be African green monkey kidney COS-7 cells (COS-7 cells) or human embryonic kidney-293 cells (HEK-293 cells).


The present invention also includes a screening method of using a cell line expressing an octopamine receptor to identify compounds and compositions that are effective insect control agents. For example, the octopamine receptor expressed by the cell line may be Pa oa1; or have an amino acid sequence of SEQ ID NO: 2, or fragments or derivatives thereof, wherein the fragments or derivatives thereof bind octopamine.


The present invention also includes a method of using multiple cell lines, wherein the cell lines are transfected with octopamine receptors from different insect species of interest, to identify compounds and compositions that are effective species-specific insect control agents. For example, a cell line expressing Pa oa1 and a cell line expressing OAMB could be used to screen compounds and compositions having insect control activity which is specific to Periplaneta Americana or to Drosophila melanogaster.


The present invention also includes compounds and compositions having the ability to control target insects, which compounds and/or compositions are identified using the screening methods of the present invention. These compounds and/or compositions may include compounds that are general regarded as safe (GRAS compounds) meaning that they do not produce unwanted or harmful affects on humans and other non-target animal species and that they are exempt from the Environmental Protection Agency's (EPA) pesticide registration requirements. The compounds and/or compositions of the present invention include certain plant essential oils identified using the screening methods of the present invention.


The compounds and compositions of the present invention control insects by targeting an octopamine receptor, resulting in a disruptive change in the intracellular levels of cAMP, Ca2+ or both. For purposes of simplicity, the term insect has been and shall be used through out this application; however, it should be understood that the term insect refers, not only to insects, but also to arachnids, larvae, and like invertebrates. Also for purposes of this application, the term “insect control” shall refer to repelling or killing an insect.


The present invention is further illustrated by the following specific but non-limiting examples.


EXAMPLE 1
Preparation of Stably Transfected COS-7 Cell Lines and HEK-293 Cell Lines with Octopamine Receptor
A. Isolation of a cDNA Encoding a G-Protein-Coupled Receptor From Periplaneta americana

G protein-coupled receptors from insects and a tick that are demonstrated to be octopamine receptors or have significant DNA similarity to known octopamine receptors are aligned using the program DNAStar (Ma). The following degenerate oligonucleotides are designed based on this alignment: Transmembrane (TM) VI oligonucleotide 5′TACAAGCTTTG(C, T)TGG(C, T)(G, T)(A, C, G, T)CC(A, C, G, T)TTCTT3′ (SEQ ID NO: 4), and TM VII oligonucleotide 5′CATGCGGCCGCTTT(A, C, G, T)(A, C)(A, C)(A, G)TA(A, C, G T)CC(A, C)AGCCA3′ (SEQ ID NO: 5). The underlined sequence corresponds to the TM regions.


The TM VI oligonucleotide contains a HindIII site and the TM VII oligonucleotide contains a NotI site flanking the TM sequences Total RNA from the heads of mixed sex adult American cockroaches that have the antennae excised is prepared by ultracentrifugation through cesium chloride, as described in Chirgwin et al., 18 Biochemistry 5294-5299 (1979), and is reverse transcribed into cDNA using random hexamers and murine leukemia virus reverse transcriptase (Applied Biosystems, Foster City, Calif.). The polymerase chain reaction (PCR) is performed on this cDNA using AmpliTaq polymerase (Applied Biosystems) and the TM VI and VII oligonucleotides at final concentrations of about 5 μM The reaction conditions are about 95° C., about 5 min for about one cycle; about 95° C., about 45 s, about 40° C., about 2 min, about 72° C., about 30 s for about three cycles; about 95° C., about 45 s, about 55° C., about 2 min; about 72° C., about 30 s for about 37 cycles; and about 72° C., about 10 min for about one cycle.


Products are digested with HindIII and NotI and ligated into pBK-RSV (Stratagene, La Jolla, Calif.). Inserts are sequenced and compared to known genes by searching the NCBI database with the Blast program.


To obtain the corresponding cDNA for an approximately 101 nucleotide fragment with the highest similarity to octopamine receptors from other species, 5′ and 3′ rapid amplification of cDNA ends (RACE) are performed using the SMART RACE cDNA amplification system (Clontech, Palo Alto, Calif.). Poly(A) RNA is prepared from total RNA isolated from the head of Periplaneta americana using an oligo-dT column as per the manufacturer's protocol (Amersham Biosciences, Piscataway, N.J.). The poly(A) RNA is used as template in the RACE reverse transcription reaction for production of 5′ and 3′ RACE cDNA as per the manufacturer's instructions The gene specific oligonucleotides used for the RACE PCR are 5′ RACE oligonucleotide 5′CAGTAGCCCAGCCAGAAGAGGACGGAGAAG3′ (SEQ ID NO: 6), and 3′ RACE oligonucleotide 5′GCTGGCTGCCGTTCTTCACCATGTACCTGG3′ (SEQ ID NO: 7). 5′ RACE and 3′ RACE polymerase chain reactions are each about 50 μl and consist of about 2.5 μl of the respective cDNA reaction, about 0.2 μM of the gene specific oligonucleotide and the additional RACE components including Advantage 2 polymerase as per the manufacturer (Clontech). The cycling conditions for the 5′ RACE are about 95° C., about 1 min for about one cycle; about 94° C., about 20 s, about 72° C., about 3 min for about five cycles; about 94° C., about 20 s, about 70° C., about 10 s, about 72° C., about 3 min for about five cycles; about 94° C., about 20 s, about 68° C., about 10 s, about 72° C., about 3 min for about 32 cycles; and about 72° C., about 10 min for about one cycle.


An approximately 1.9 kb product is gel purified and further, amplified using the same oligonucleotides, Advantage 2 polymerase and cycling parameters of about 95° C., about 3 min for about one cycle; about 94° C., about 20 s, about 68° C., about 10 s, about 72° C., about 3 min for about 35 cycles; and about 72° C., about 10 min for about one cycle. To facilitate T/A ligation, the product is A-tailed by precipitating with ethanol, resuspending in 1×PCR Buffer II (Applied Biosystems), 2 mM MgCl2, 1 mM dATP and 0.05 U AmpliTaq per μl and incubating at about 72° C. for about 15 min The PCR product is ligated into pBK-RSV (Stratagene) that has been digested with SmaI and T-tailed using dTTP and AmpliTaq. The insert is sequenced on both strands by automated fluorescent DNA sequencing (Vanderbilt Cancer Center).


The cycling conditions for the 3′ RACE reaction are about 95° C., about 1 min for about one cycle; about 94° C., about 5 s, about 72° C., about 3 min for about five cycles; about 94° C., about 5 s, about 70° C., about 10 s, about 72° C., about 3 min for about five cycles; about 94° C., about 5 s, about 68° C., about 10 s, about 72° C., about 3 min for about 32 cycles; and about 72° C., about 10 min for about one cycle. The product of this reaction is A-tailed, subcloned and sequenced as for the 5′ RACE product.


B. Generation of the Open Reading Frame for Octopamine Receptor (Pa oa1)

Oligonucleotides used to amplify the open reading frame are a sense oligonucleotide 5′ CAGGAATTCATGAGGGACGGGGTTATGAACGCTAG 3′ (SEQ ID NO: 8), and an antisense oligonucleotide 5′ GCTTCTAGATCACCTGGAGTCCGATCCATCGTTG 3′ (SEQ ID NO: 9). Sequences corresponding to the open reading frame are underlined. The sense oligonucleotide contains an EcoRI restriction site and the antisense oligonucleotide an Xbal restriction site. These oligonucleotides are used in a polymerase chain reaction that included the 5′RACE cDNA as template and VENT polymerase (New England Biolabs, Beverly, Mass.).


The product is subcloned into the plasmid pAc5.1/V5-His (Invitrogen Life Technologies, Carlsbad, Calif.) at the EcoRI and XbaI restriction sites and sequenced. This plasmid is designated pAc-Pa oa1. For mammalian cell expression, a Kozak sequence is inserted using a sense oligonucleotide 5′ACAGAATTCGCCACCATGAGGGACGGGGTTATGAACGCTAG 3′ (SEQ ID NO: 10) and an internal antisense oligonucleotide that contains an XhoI site 5′ TTGACGGCGCTCGAGGACGTC 3′ (SEQ ID NO: 11). The sense oligonucleotide contains an EcoRI site These oligonucleotides are used in a polymerase chain reaction that includes pAc-Pa oa1 as template and VENT polymerase. The product is inserted at EcoRI and Xhol sites into pAc-Pa oa1, in which the corresponding EcoRI and Xhol fragment have been removed The product is sequenced. The entire open reading frame is then transferred into pCDNA3 (Invitrogen Life Technologies, Carlsbad, Calif.) at EcoRI and Apal restriction sites, and this plasmid is designated pCDNA3-Pa oa1.


C. Amplification and Subcloning of OAMB, an Octopamine Receptor from the Fruit Fly, Drosophila melanogaster

The Drosophila melanogaster head cDNA phage library GH is obtained through the Berkeley Drosophila Genome Project (world wide web <dot> fruitfly <dot> org). Phage DNA is purified from this library using a liquid culture lysate as described in Lech, Current Protocols in Molecular Biology, John Wiley & Sons, Inc., pp. 1 (2001). Oligonucleotides designed to amplify the open reading frame of Drosophila melanogaster OAMB consist of the sense oligonucleotide 5′ CAGGAATTCGCCACCATGAATGAAACAGAGTGCGAGGATCTC 3′ (SEQ ID NO: 12) and the antisense oligonucleotide 5′ AATGCGGCCGCTCAGCTGAAGTCCACGCCCTCG 3′ (SEQ ID NO: 13). Sequences corresponding to the open reading frame are underlined. A Kozak sequence is included in the sense oligonucleotide. In addition, the 5′ oligonucleotide includes an EcoRI restriction site and the 3′ oligonucleotide a NotI site.


For amplification by the polymerase chain reaction, about 200 ng of the GH library DNA is used as template with about 0.5 μM of each oligonucleotide and VENT DNA polymerase (New England Biolabs). Cycling conditions are about 95° C., about 5 min for about one cycle; about 95° C., about 30 s and about 70° C., about 1.5 min for about 40 cycles; and about 70° C., about 10 min for about one cycle. The product is digested with EcoRI and NotI, ligated into pCDNA3 and sequenced on both strands by automated fluorescent DNA sequencing (Vanderbilt Cancer Center).


D. Isolation of cDNA Encoding Octopamine Receptor (Pa oa1)

A polymerase chain reaction with degenerate oligonucleotides corresponding to regions of TM VI and TM VII of previously identified octopamine receptors is used to isolate an approximately 101 nucleotide fragment of cDNA from the head of Periplaneta americana This cDNA fragment is used to design gene specific oligonucleotides to amplify the full-length cDNA of the corresponding gene by RACE. This method generates overlapping 5′ and 3′ segments that include the original cDNA fragment from TM VI to TM VII indicating these segments originate from the same cDNA. The cDNA includes an approximately 1887 nucleotide open reading frame and 5′ and 3′ untranslated regions (Genbank accession number is AY333178). The predicted initiation codon is preceded by an in-frame stop codon, indicating that the 5′ end of the open reading frame is included in the cDNA and that the encoded protein will be full length. This cDNA and encoded protein are designated Pa oa1.


The open reading frame encodes a protein of approximately 628 amino acids with a predicted molecular mass of about 68,642 Da. Hydropathy analysis by the method described in Kyte et al., J. Mol. Biol. 157, 105-132 (1982), with a window of about nine amino acids indicates about seven potential transmembrane spanning domains. In addition, a protein BLAST search finds similarity of Pa oa1 to the rhodopsin family of 7 transmembrane G protein-coupled receptors contained within the conserved domain database.


The BLAST analysis also indicates Pa oa1, is most similar to other biogenic amine receptors. As mentioned above, all members of GPCRs share the common motif of seven transmembrane (TM) domains. Of these seven domains, TM 3, 5 and 6 comprise the binding sites. Compared to proteins with defined functions, Pa oa1 is most closely related to OAMB, an octopamine receptor from the fruit fly Drosophila melanogaster and to Lym-oa1, an octopamine receptor from the pond snail Lymnaea stagnalis). Sequence similarity is also detected with vertebrate α1A adrenergic receptors and invertebrate tyramine receptors. Protein alignment indicates Pa oa1 is about 51% identical to OAMB, 37% identical to Lym oa1, and about 27% identical to both the insect tyramine receptors Tyr-Loc from Locusta migratoria and Tyr-Dro from Drosophila melanogaster. Sequence conservation between Pa oa1, OAMB and Lym oa1, is greatest within the TM domains, as shown in FIG. 2. The regions of lowest similarity among these three proteins are in the amino terminus extending into TM 1, extracellular loop 2 (between TM IV and V), intracellular loop 3 (between TM V and VI) and the carboxyl termini following TM VII.


E. Cell Culture and Transfection of Cells

Cell culture reagents may be obtained from Sigma-Aldrich (St. Louis, Mo.), or as otherwise indicated. African green monkey kidney COS-7 cells and human embryonic kidney (HEK)-293 cells are obtained from American Type Culture Collection (Manassas, Va.). COS-7 cells are grown in Dulbecco's modified Eagle's medium (about 4.5 g glucose/l) and about 10% fetal bovine serum. HEK-293 cells are grown in Dulbecco's modified Eagle's medium (about 1 g glucose/1), about 5% fetal bovine serum and about 5% newborn calf serum Both types of media are supplemented with about 100 U penicillin G/ml, about 100 μg streptomycin/ml and about 0.25 μg amphotericin B/ml) except during Lipofectamine 2000 transfections.


Lipofectamine 2000 and Opti-MEM I media may be obtained from Invitrogen Life Technologies (Carlsbad, Calif.). COS-7 cells are transiently transfected using Lipofectamine 2000. Cells are plated at about 1.5×106 cells per dish (about 55 cm2) in about 10 ml growth medium without antibiotics the day before transfection. For each dish, about 30 μl Lipofectamine 2000 in about 1 ml Opti-MEM I medium is mixed with about 12 μg plasmid DNA in about 1 ml Opti-MEM I medium and added to the cells after an approximately 20 min incubation at room temperature. The cells are harvested for membrane preparation 24 h following transfection.


For stable transfections of HEK-293 cells, about 1×106 cells in about 2.5 ml growth media without antibiotics are plated into dishes (about 10 cm2) the day before transfection. For transfection, about 10 μl Lipofectamine 2000 is added to about 250 μl Opti-MEM I medium. This is mixed with about 4 μg plasmid DNA in about 250 μl OptiMEM I medium. After an approximately 20 min incubation at room temperature, the approximately 500 μl of solution is added to cells in a single dish. Cells are split about 24 h after transfection into growth media containing about 0.8 mg G418 sulfate/ml (Mediatech Inc., Heradon, VA). Clonal lines are selected and assayed for receptor expression with whole cell binding by incubating about 500,000 cells in about 1 ml phosphate buffered saline (PBS; 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.4 mM KH2PO4 (pH 7.4)) with about 2 nM 3H-yohimbine for about 30 min at about 27° C. Cells are pelleted by centrifugation, washed with PBS, and then transferred to scintillation vials Nonspecific binding is determined by including about 50 μM phentolamine in the binding reaction.


F. Efficacy of Cells Lines Transfected with Octopamine Receptors for Screening Compounds and Compositions for Octopamine Receptor Interaction

All steps are performed at about 4° C. or on ice. Cells are harvested in growth media by scraping from the dishes and then rinsing dishes with PBS. The cells are centrifuged at about 1000 g for about 3 min, washed with PBS and centrifuged again. The cells are suspended in ice cold hypotonic buffer (10 mM Tris-Cl (pH 7.4)), incubated on ice for about 10 min, and lysed using a glass dounce homogenizer and tight glass pestle (Kontes Glass Co., Vineland, NJ) with about 10 strokes Nuclei are pelleted by centrifugation at about 600 g for about 5 min The supernatant is decanted and centrifuged at about 30,000 g for about 30 min to pellet a crude membrane fraction. The pellet is suspended, in binding buffer (50 mM Tris-Cl, 5 mM MgCl2 (pH 7.4)). Protein concentration is determined by the Bradford assay (Bio-Rad Laboratories, Hercules, Calif.). Membranes are frozen on dry ice and stored at about −75° C. in aliquots.


Antagonists and biogenic amines are obtained from Sigma-Aldrich (St. Louis, Mo.). Octopamine is the mixed isomeric form DL-octopamine. 3H-yohimbine is obtained from Perkin Elmer Life Sciences (Boston, Mass.). Radioligand binding is performed with about 7.5-15 μg membrane protein in about 250 μl binding buffer for about 30 min at about 27° C. while shaking at about 100 rpm. Reactions are terminated by addition of about 3 ml ice cold binding buffer and filtered over GF/C filters (Whatman International, Maidstone, England) that have been soaked for about 30 min in about 0.3% polyethylenimine (Sigma-Aldrich). Filters are rinsed again with about 3 ml binding buffer For the determination of Kd and Bmax, a range of 3H-yohimbine is used from about 0.5 to 50 nM, and about 50 μM phentolamine is used as a competitor to determine nonspecific binding. To determine Ki, of different ligands, about 2 nM 3H-yohimbine is used with a concentration range of competitor that gives from 0% to 100% competition. Binding data is analyzed by nonlinear regression using the software GraphPad Prism (San Diego, Calif.).


For pharmacological binding experiments, Pa oa1, is expressed in COS-7 cells by transient transfection. Membrane fractions are analyzed to determine total, nonspecific and specific binding of 3H-yohimbine, as shown in FIG. 3A. The Kd and Bmax for specific binding are determined to be about 28.4 nM and about 11.8 pmol/mg protein, respectively. Membrane fractions from COS-7 cells transiently transfected with empty pCDNA3 do not demonstrate specific binding. The high affinity binding of 3H-yohimbine by Pa oa1 indicate that this is a suitable ligand to be used for competition binding experiments.


The octopamine receptor OAMB from Drosophila melanogaster is amplified by the polymerase chain reaction. Saturation binding analysis with 3H-yohimbine is performed with OAMB expressed in COS-7 cells, as shown in FIG. 3B. The Kd and Bmax are determined to be about 43.0 nM and about 8.04 pmol/mg, respectively.


Competitive binding with various biogenic amines is utilized to determine the affinities for potential natural ligands of Pa oa1. Referring now to Table A, below, DL-Octopamine has the lowest Ki (about 13.3 μM) for Pa oa1 followed by tyramine (about 31.0 μM). The decreasing order of affinity for the biogenic amines is octopamine>tyramine>dopamine>serotonin. The binding affinities for octopamine and tyramine are determined for this receptor. The Ki (mean±standard deviation) of octopamine and tyramine for OAMB are about 8.20±2.60M and about 33.8±7.93 μM, respectively. These values are similar to those obtained for Pa oa1. The affinity of octopamine is about 2.3-fold higher than tyramine for Pa oa1, and for OAMB, the affinity of octopamine is about 4.1-fold higher than tyramine, indicating that octopamine is the likely endogenous ligand for Pa oa1.












TABLE A







Ligand
Ki (μM)









Biogenic Amine




Octopamine
13.3 ± 2.4 



Tyramine
31.0 ± 1.9 



Dopamine
56.6 ± 8.0 



Serotonin
77.4 ± 11.6



Antagonist



Chlorpromazine
0.012 ± 0.003



Phentolamine
0.023 ± 0.009



Mianserin
0.048 ± 0.013



Metoclopramine
4.76 ± 1.32










In addition to using the affinity of octopamine receptors for specific antagonists as a method for classifying these receptors, antagonists may be used to analyze the effects of octopamine on adenylate cyclase activity in the brain, ventral nerve cord and hemocytes of Periplaneta americana. A pharmacological profile is developed for Pa oa1 using these antagonists. With reference to Table A, in order of decreasing affinity, the profile of the antagonists is chlorpromazine>phentolamine>mianserin>metoclopramide.


EXAMPLE 2
Structural Features of Cloned American Cockroach Octopamine Receptor (Pa oa1)

The Pa oa1 cDNA of 2268 bp which includes an 1887 nucleotide open reading frame and 5′ and 3′ untranslated regions is set forth in FIGS. 1A, 1B and SEQ ID NO: 1. With reference to FIG. 1B, the predicted initiation codon (M) is preceded by an in-frame stop codon (SC). This indicates that the 5′ end of the open reading frame is included in the cDNA and that the encoded protein would be full length.


With reference to FIG. 4, hydropathy analysis by the method of Kyte and Doolittle with a window of 9 amino acids indicates that this sequence shares the common motif of 7 potential transmembrane scanning domains. See Kyte and Doolittle, 1982, J. Mol. Biol. 157, 105-132. A phylogenic comparison of invertebrate biogenic amine receptor sequences reveals that both OAMB and Pa oa1 sequences share ˜45% similarity, which is illustrated in FIG. 5. Pa oa1 clusters with octopamine and tyramine receptors from different insect species. Similarity between these receptors is analyzed using BLAST search and calculated based on protein alignment using DNASTAR software program. Pa oa1 is used as a reference for comparisons with other receptors.


With reference to FIG. 2, protein alignment indicates sequence conservation between Pa oa1 and OAMB is greatest within the transmembrane domains (TMs). The regions of lowest similarity among these two proteins are in the amino terminus extending into TM1, extracellular loop2 between TM4 and TM5, intracellular loop between TM5 and TM6 and the carboxy termini following TM7.


EXAMPLE 3
Effects of Treatment with Octopamine on Cells Expressing the Octopamine Receptor (Pa oa1)
A. Effect of Treatment on [cAMP]

Twenty-four hours before cell treatment, about 300,000 HEK-293 cells are plated in about 1 ml media with about 0.8 mg G418/ml into multi-well dishes (e.g., 12-well, 4.5 cm2). For cell treatment, the media is aspirated and about 1 ml PBS with about 300 μM IBMX and the test reagent is added. Cells are incubated at about 37° C. for about 20 min, and the PBS is then aspirated. Cells are incubated with about 70% ethanol for about 1 h at about −20° C. The cellular debris is centrifuged and then the supernatant is removed and lyophilized to dryness. The amount of cAMP in the extract is determined by using a cAMP binding protein from the 3H-cAMP Biotrak assay system (Amersham Biosciences) as per the manufacturer's instructions. To test the effects of calcium chelation on cAMP levels, the cells are incubated with about 20 μl V 1 BAPTA/AM (Calbiochem Biochemicals, La Jolla, Calif.) for about 10 min before the addition of the test reagents.


Octopamine has been demonstrated to increase levels of the second messenger cAMP in brain, thoracic ganglion and hemocytes from Periplaneta americana. To determine which second messenger signaling pathways octopamine could affect through the Pa oa1 receptor, HEK-293 cells are stably transfected with pCDNA3-Pa oa1 or pCDNA3 without an insert as a control. In the control HEK-293 cells, neither DL-octopamine nor tyramine at concentrations up to about 100 μM has significant effects on cAMP levels.


A clone transfected with pCDNA3-Pa oa1 having a high specific binding to 3H-yohimbine is selected for second messenger analysis. Both octopamine and tyramine are able to increase the levels of cAMP in these cells in a dose dependent manner, as shown in FIG. 6. The EC50s for the octopamine and tyramine mediated increases in cAMP are about 1.62 and 97.7 μM, respectively (p<0.05). Octopamine is more potent than tyramine in the cAMP response as a statistically significant increase in cAMP over the basal level (about 0.48 pmol cAMP) is first detected with about 10 nM octopamine (about 1.2 pmol cAMP) (p<0.05). The cAMP concentration with about 10 nM tyramine is about 0.50 pmol cAMP, and therefore not statistically significant from the basal level (p>0.05). A concentration of about 1 μM tyramine results in an increase in cAMP to about 1.2 pmol. In addition, about 100 μM octopamine leads to an approximately 911-fold increase in cAMP compared to an approximately 215-fold increase for about 100 μM tyramine. Since these assays are performed in the presence of the phosphodiesterase inhibitor IBMX, the increases in cAMP is determined to be through activation of adenylate cyclase. As such, it appears that the Pa oa1 receptor is an octopamine receptor, the Pa oa1 receptor may be targeted to effect a disruptive change in intracellular levels of cAMP, controlled targeting of the receptor allows for insect control, and the cell lines stably expressing the Pa oa1 receptor may be used to screen compounds and compositions for insect control activity.


B. Effect of Treatment on cAMP and [Ca2+]

To determine cAMP levels in cells, about 24-hours before cell treatment, 300,000 HEK-293 cells are plated in 1 mL media with 0.8 mg G418/mL into multi-dishes (4.5 cm2). For cell treatment, the media is aspirated and 1 mL PBS with 300 μM IBMX and the test reagent is added. Cells are incubated at 37° C. for 20 min, and the PBS is then aspirated. Cells are incubated with 70% ethanol for 1 hour at −20° C. The cellular debris is centrifuged and then the supernatant is removed and lyophilized to dryness. The amount of cAMP in the extract is determined by using a cAMP binding protein from the 3H-cAMP Biotrak assay system (Amersham Biosciences, Piscataway, N.J.) as per the manufacturer's instructions.


To determine Ca2+ levels in the cells, HEK-293 cells are washed once with Hank's balanced salt solution (137 mM NaCl, 5.4 mM KCl, 0.3 mM Na2HPO4, 0.4 mM KH2PO4, 4.2 mM NaHCO3, 1 mM CaCl2, 1 mM MgSO4, and 5.6 mM glucose (pH 7.4)) (HBSS). Cells are collected by scraping and are suspended at about 750,000 cells/ml in HBSS with about 5 μM Fura-2 AM (Sigma-Aldrich). Cells are incubated at about 37° C. for about 1 h in the dark, centrifuged, suspended in HBSS at about 750,000 cells/ml and used for calcium measurements A spectrofluoremeter with Felix software from Photon Technology International (Lawrenceville, NJ) is used for the fluorescence measurements and data collection Octopamine has been demonstrated to modulate intracellular calcium levels in cultured hemocytes of Malacosoma disstria. Also, in hemocytes from Periplaneta americana, octopamine lead to an increase in inositol triphosphate which likely will lead to increases in calcium in these cells as well The ability of both octopamine and tyramine to modulate calcium levels in the HEK-293 clone expressing Pa oa1 is determined Neither about 10 μM octopamine nor about 10 μM tyramine modulates intracellular calcium levels in control HEK-293 cells transfected with pCDNA3 lacking an insert However, when about 100 nM octopamine is added to the Pa oa1 expressing HEK-293 cells, a rapid increase in intracellular calcium is detected, as shown in FIG. 7. In these same cells, about 100 nM tyramine does not modulate intracellular calcium levels, as shown in FIG. 7.


Testing of these amines at additional concentrations indicates that the lowest concentration of octopamine that increases intracellular calcium levels is about 10 nM Tyramine is found to increase intracellular calcium when a concentration of about 1 μM or higher is tested These increases in intracellular calcium by about 10 nM octopamine and about 1 μM tyramine are to a similar level, both of which is lower than the increase in calcium mediated by about 100 nM octopamine. This result is similar to that obtained with the cAMP assay in that an approximately 100-fold increase in tyramine concentration compared to about 10 nM octopamine is required to give a similar level of response.


As such, it appears that the Pa oa1 receptor is an octopamine receptor, the Pa oa1 receptor may be targeted to effect a disruptive change in intracellular levels of Ca2+, controlled targeting of the receptor allows for insect control, and the cell lines stably expressing the Pa oa1 receptor may be used to screen compounds and compositions for insect control activity.


Octopamine is found to increase both cAMP and calcium in HEK-293 cells expressing Pa oa1 and the calcium increase is detected immediately upon octopamine addition. As such, the possibility that calcium is leading to a secondary increase in cAMP levels in the cells expressing Pa oa1 is tested. The intracellular calcium chelator BAPTA/AM is used BAPTA/AM at about 20 μM is found to inhibit the increase in free intracellular calcium when about 1 μM octopamine is added to the Pa oa1-expressing cells. Octopamine-mediated changes in cAMP levels are compared in the absence and presence of about 20 μM BAPTA/AM. cAMP levels following treatment with either about 100 nM or about 1 μM octopamine, as well as basal cAMP levels, are not found to be statistically different, whether in the absence or presence of about 20 μM BAPTA/AM, as shown in FIG. 8. This indicates that the increase in cAMP by octopamine results from direct coupling of Pa oa1 to a G protein that leads to activation of adenylate cyclase, making the expression of Pa oa1 in HEK-293 cells a good model for adenylate cyclase-modulated insect control through this receptor and the cell lines stably expressing the Pa oa1 receptor useful for screening compounds and compositions for insect control activity.


EXAMPLE 4
Receptor Binding and Changes in cAMP and Intracellular Ca2+ in Response to Octopamine Treatment

For radioligand binding studies, the binding of 3H-yohimbine to membranes isolated from COS-7 cells expressing Pa oa1 and octopamine receptor (OAMB) from Drosophila melanogaster Are performed. See Bischof and Enan, 2004, Insect Biochem. Mol. Biol. 34, pp. 511-521, which is incorporated herein by this reference. The data shown in Table B demonstrates that the affinity of Pa oa1 to the radioligand is about 1.5 fold higher than OAMB. Radioligand binding using 3H-yohimbine is performed on membranes expressing either either Pa oa1 or OAMB. For the determination of Kd and Bmax, a range of 3H-yohimbine is used from 0.5 to 50 nM, and 50 μM phentolamine is used as a competitor to determine nonspecific binding. To determine Ki of octopamine, 4 nM 3H-yohimbine is used with a concentration range of octopamine that gives from 0 to 100% competition.














TABLE B









Bmax





Kd
(pmole receptor/
Ki



OAR Species
(nM)
mg protein)
(μM)





















OAR species
28.4
11.80
13.30



OAMB
43.0
8.04
8.20










With reference to FIG. 9, OA (10 μM) increases the level of cAMP in HEK-293 cells permanently expressing either OAMB or Pa oa1. With reference to FIGS. 10A and 10B, OA (10 μM) increases the level [Ca2+]i in HEK-293 cells permanently expressing either OAMB or Pa oa1, where HEK-293 cells expressing either receptor are incubated for 30 s before the addition of 10 μM octopamine (OA). The arrow in the figures indicates addition of the amine. The fluorescence ratio determined from excitation with 340 and 380 nm is plotted to indicate changes in [Ca2+]i levels. These increases are mediated through the OAR as judged by the insignificant changes in cAMP level and [Ca2+] in cells transfected with an empty vector then treated with 10 μM OA (data not shown).


EXAMPLE 5
Effects of Treament with Plant Essential Oils on Cells Expressing the Octopamine Receptor

In this example, membranes isolated from COS-7 cells expressing the receptor are used for receptor binding studies and HEK-293 cells are used for cAMP and [Ca2+] studies. Plant essential oils, including: p-cymene [methyl(1-methylethyl)benzene], eugenol [2-methoxy-4-(2-propenyl)phenol], trans-anethole [1-methoxy-4-(1-propenyl)benzene], cinnamic alcohol [3-phenyl-2-propen-1-ol], α-terpineol [p-menth-1-en-8-ol], methyl salicylate [2-hydroxybenzoic acid methyl ester], 2-phenylethyl propionate, and geraniol [3,7-dimethyl-2,6-octadien-1-ol], are obtained from City Chemical (West Haven, Conn.) and tested for insect control activity. The chemical structures of these compounds are set forth in FIG. 11.


A. Receptor Binding Activity

The binding activity of 3H-yohimbine to membranes expressing Pa oa1 or OAMB is performed in the presence and absence of three structurally related plant essential oil monoterpenoids, which are selected based on their insecticidal activity, the absence or presence and location of the hydroxyl group and a spacing group within the molecule. Membrane protein (10 μg) expressing Pa oa1 is incubated with 4 nM 3H-yohimbine in the presence and absence of 50 μM of the test chemical. The specific activity is calculated as the difference between counts in the presence and absence of test chemical. Specific binding is calculated by determining nonspecific binding with 50 μM tested plant essential oils and subtracting nonspecific binding from total binding.


With reference to FIG. 12, depicting specific binding of 3H-yohimbine to Pa oa1 and OAMB, while eugenol and cinnamic alcohol decrease the binding of 3H-yohimbine to membranes expressing either Pa oa1 or OAMB as compared to the corresponding control, trans-anethole decreases the 3H-yohimbine binding activity to only Pa oa1. It is also found that eugenol and trans-anethole are more potent inhibitors against Pa oa1 than OAMB, while cinnamic alcohol is more potent against OAMB than Pa oa1. The data suggested insect species differences in receptor binding in response to monoterpenoids.


B. Effects of Treatment on [cAMP]


FIG. 13 depicts the effect of certain plant essential oils on cAMP levels in HEK-293 cells expressing either Pa oa1 or OAMB. HEK-293 cells stably expressing either receptor are treated with 300 μM IBMX and the effect of tested plant essential oils (50 μM) on basal cAMP levels is measured.


Eugenol (50 μM) significantly decreases the cAMP level (24%) in cells expressing Pa oa1 but slightly decreased cAMP level in cells expressing OAMB. A 22% increase in cAMP level in cells expressing OAMB is found in response to treatment with (50 μM) trans-anethole. Cinnamic alcohol (50 μM) induces slight increase in cAMP level in both cell models.


C. Effect of Treatment on Intracellular Calcium Mobilization

To address whether changes in [Ca2+]i in octopamine receptor-expressing cells in response to 25 μM of tested plant essential oils is mediated specifically through the receptor, cells transfected with an empty plasmid (pCDNA3) are treated with either test chemicals or solvent only and changes in [Ca2+]i are monitored. In cells transfected with an empty plasmid, none of the test chemicals induce remarkable changes in [Ca2+]i levels as compared with cells treated with the solvent (data not shown).


On the other hand, changes in [Ca2+]i level in cells expressing either OAMB or Pa oa1 in response to test chemicals is remarkably high. FIGS. 14A-14F, depict the effect of cinnamic alcohol (FIGS. 14A and 14B), eugenol (FIGS. 14C and 14D), and t-anethole (FIGS. 14E and 14F) on intracellular calcium [Ca2+]i levels in HEK-293 cells either transfected with Pa oa1 or OAMB. HEK-293 cells are incubated for 30 s before the addition of 25 μM tested agents. The arrow in the figures indicates addition of tested agents. The fluorescence ratio determined from excitation with 340 nm and 380 nm is plotted to indicate transient increase in [Ca2+]i levels.


Generally, changes in [Ca2+]i in cells expressing OAMB is more pronounced than changes in cells expressing Pa oa1. Based on increased [Ca2+]i level in cells expressing OAMB, cinnamic alcohol is the most potent agent tested in this example, followed by eugenol and trans-anethole. In cells expressing Pa oa1, eugenol is the most potent agent tested in this example, followed by cinnamic alcohol then trans-anethole. The data suggest that elevation pattern of [Ca2+]i levels is chemical-dependent. While application of octopamine induces an immediate but transient peak (˜20 sec) in [Ca2+]i level, as shown in FIG. 9, the peaked [Ca2+]i level is slower in onset and has a longer recovery time (more than 3 min) in response to treatment with tested plant essential oils.


In cells expressing OAMB, the increase in [Ca2+]i level in response to cinnamic alcohol is slower than the other two chemicals. In Pa oa1-expressing cells, the increase in [Ca2+]i in response to trans-anethole is slower than eugenol and cinnamic alcohol. Thus, the efficacy of coupling of both cloned octopamine receptors to different second messenger signaling varies with the chemical used.


D. Summary of the Effects of Treatment with Certain Plant Essential Oils

The present example studies the molecular interaction of plant essential oils with octopamine receptors from different insect species. Based on the characteristic features of octopamine receptors from American cockroach and fruit fly, the example characterizes certain molecular basis for insect species differences in response to plant essential oils. Although trans-anethole does not have a significant effect on binding to OAMB while eugenol and cinnamic alcohol do (FIG. 12), only trans-anethole increases cAMP level (FIG. 13) and [Ca2+]i (FIGS. 14A-14F) through OAMB. These findings suggest that, in the case of trans-anethole, ionic interaction between the tested agent and the receptor is not critical for the activation of signaling down stream to OAMB.


On the other hand, while both eugenol and cinnamic alcohol decrease the binding activity to Pa oa1 (FIG. 12), only eugenol decreases cAMP levelS through this receptor (FIG. 13). However, these two chemicals increase [Ca2+]i through Pa oa1 and OAMB (FIGS. 14A-14F). The data demonstrates that activation of Pa oa1 by trans-anethole and cinnamic alcohol is not primarily coupled to cyclic nucleotide system. It appears that it is coupled to IP3-system, which activates the release of Ca2+ ions from internal stores. Activation of Pa oa1 by eugenol is found to be coupled to both adenylate cyclase/cAMP and IP3/Ca2+ signaling cascades. Therefore, the current changes in cellular responses suggest that tested plant essential oils differing by only a single hydroxyl group or methoxy group in their chemical structure are capable of differentially coupling each octopamine receptor to different second messenger systems. The data also suggest that, activation of single GPCR such as Pa oa1 or OAMB, may potentially couple to multiple second messenger systems. Thus, a single receptor may have a different pharmacological profile depending on which second messenger system is activated. The variability of the transmembrane regions and N-termini of Pa oa1 and OAMB might determine the selectivity of tested monoterpenoids. In addition, conservation of certain transmembrane motifs and the variability of the intracellular loops might enable Pa oa1 and OAMB to discriminate among the various G-protein subtypes upon treatment with tested monoterpenoids.


Protein alignment indicate that the regions of lowest similarity among these two proteins are in the amino terminus extending into TM1, extracellular loop2 between TM4 and TM5, intracellular loop between TM5 and TM6 and the carboxy termini following TM7 (FIG. 2). On the other hand, protein alignment indicates sequence conservation between Pa oa1 and OAMB is greatest within the transmembrane domains (TMs).


EXAMPLE 6
Toxicity Testing Against Certain Insect Species

Toxicity bioassay against the wild type Drosophila melanogaster fly and American cockroach is performed to address insect species specificity in response to certain plant essential oils and to determine whether the cellular changes in Pa oa1 and OAMB cell models in response to treatment with tested essential oils correlate with their insecticidal activity.



Drosophila melanogaster wild type strain is purchased from Carolina Biological Supply Company (Burlington, NC). Flies carrying the inactive (iav) mutation that exhibit low locomotor activity and poor mating success, both of which are associated with a deficiency in octopamine synthesis are obtained from Bloomington Drosophila Stock Center (flybase ID FBa10005570, stock# BL-6029 iav).


Plant essential oils, including: p-cymene [methyl(1-methylethyl)benzene], eugenol [2-methoxy-4-(2-propenyl)phenol], trans-anethole [1-methoxy-4-(1-propenyl)benzene], cinnamic alcohol [3-phenyl-2-propen-1-ol], α-terpineol [p-menth-1-en-8-ol], methyl salicylate [2-hydroxybenzoic acid methyl ester], 2-phenylethyl propionate, and geraniol [3,7-dimethyl-2,6-octadien-1-ol], are obtained from City Chemical (West Haven, Conn.) and tested for insect control activity. The chemical structures of these compounds are set forth in FIG. 11.


Acetonic solutions of plant essential oils are prepared and different concentrations of each, that give from 10%-100% mortality, are applied by topical application. Controls are treated with the same volume (0.5 μl/insect) of acetone. Replicates, with 5 insects per replicate, are used for each concentration. The mortality is calculated 24 hours after treatment. Data are subjected to probit analysis to determine LD50 value for each compound. See Finney, 1971, Probit Analysis 3rd Ed., Cambridge University Press, London, pg. 333.


To determine whether the octopamine/octopamine receptor (OA/OAR) system is involved in the toxicity of tested plant essential oils, octopamine synthesis mutant (iav) Drosophila melanogaster strain is topically treated with a dose equivalent to the determined LD50 for wild type strain. For this study, the LD50 values of eight monoterpenoid plant essential oils (p-cymene, eugenol, trans-anethole, cinnamic alcohol, α-terpineol, methyl salicylate, phenylethyl propionate, and geraniol) are determined against wild type as described above and being used to treat the octopamine mutant (iav) fruit fly. Controls are treated with the same volume (0.5 μl/fly) of acetone. The mortality is calculated 24 hour after treatment. Multiple replicates and 5 flies per replicate are used for the bioassay of each chemical. Data are subjected to probit analysis to determine LD50 value for each chemical. See Finney, 1971.


To determine insect species differences in response to plant essential oil monoterpenoids, the toxicity of certain monoterpenoids is determined against fruit fly and American cockroach. Based on the calculated LD50 values, shown in Table C, cinnamic alcohol is the most toxic chemical tested in the example (LD50=1.65 μg/fly) against wild type fruit fly strain, followed by eugenol (LD50=1.90 μg/fly), and trans-anethole (LD50=6.00 μg/fly). Eugenol is about 2-fold and about 27-fold more toxic against American cockroach than cinnamic alcohol and trans-anethole, respectively.












TABLE C









LD50, μg/insect












Plant essential oil

D. melanogaster


P. Americana
















Cinnamic alcohol
1.65
98



Eugenol
1.90
47



Trans-anethole
6.00
1300










To determine whether the OA/OAR system mediates the toxicity of certain plant essential oil monoterpenoids, fruit flies carrying the iav mutations, which are highly susceptible to the octopamine analogue p-cresol, are used in parallel with wild type fruit fly strain in the toxicity 5 bioassay test. The toxicity of cinnamic alcohol, eugenol, trans-anethole and 2-phenyethyl propionate is remarkably increased when they are topically applied to the iav strain, as shown in Table D.












TABLE D










% Mortality at




LD50 of wild/type



Wild/type

Drosophila melanogaster




LD50
strain










Chemical name
values (μg/fly)
Wild/type
iav













cinnamic alcohol
1.65
30.0%
80.0%


eugenol
1.90
53.3%
80.0%


trans-anethole
6.00
40.0%
100.0%


methyl salicylate
7.50
40.0%
46.6%


geraniol
10.50
60.0%
60.0%


α-terpineol
13.00
46.6%
60.0%


2-phenylethyl propionate
14.50
53.3%
80.0%


p-cymene
25.00
40.0%
40.0%









However, mutation of the octopamine synthesis does not affect the toxicity of p-cymene, methyl salicylate, and geraniol. Therefore, the current data suggests a correlation between agents inducing cellular changes in clonal cells expressing octopamine receptors and their insecticidal activity. The data also suggests that the insecticidal activity of cinnamic alcohol, eugenol, trans-anethole and 2-phenyethyl propionate is mediated through the octopamine/octopamine receptor system. From these data it can be concluded that the increase in the insecticidal activity of these chemicals results from the deficiency of octopamine synthesis in iav mutants because low octopamine levels may be unable to compete against the toxic effect of these chemicals.


As mentioned above, the toxicity data demonstrates significant differences between the toxicity of the tested chemicals against each insect (Table C). The toxicity data also demonstrates differences between the two insects in response to each chemical. The toxicity data against wild type and octopamine mutant (iav) fruit fly suggests that the toxicity of cinnamic alcohol, eugenol and trans-anethol is mediated through octopamine/octopamine receptors system. Among certain other plant essential oils tested against both strains of fruit fly only the toxicity of 2-phenylethyl propionate is mediated through octopamine receptors. Collectively the data suggest a correlation between cellular changes and toxicity of certain plant essential oils.


In the present example, chemical-structure relationships of plant essential oil monoterpenoids against wild type fruit fly suggest certain structural features required for chemical-receptor interaction. Among these features are the presence and location of a hydroxyl group, and a spacing group such as methoxy group. The rank order of toxicity demonstrates that cyclic alcohols and phenolic compounds are more toxic than other monoterpenoids such as acyclic alcohols and esters. The efficacy of each compound is found to be determined by the presence and location of the spacing group on the benzene ring. For example, although the phenolic derivative, eugenol, and propenyl benzene, trans-anethol, contain the same spacing group (—OCH3) on position 2 and 1, respectively, eugenol is 3-fold more toxic against wild type flies than trans-anethole (FIG. 11 and Table D).


In summary, the similarities and differences between both Pa oa1 and OAMB sequences are determining features in the toxicity differences of certain plant essential oil monoterpenoids. Additionally, it appears that the octopamine receptor mediates the insecticidal properties of cinnamic alcohol, eugenol, trans-anethole and 2-phenylethyl propionate and, in part, the toxicity of α-terpineol against Drosophila melanogaster fly. Furthermore, it appears that the presence of an electronegative group such as hydroxyl group, and different spacing groups, may be required for the insecticidal activity of plant essential oils through octopamine receptor.


It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. It is intended that the Specification and Example be considered as exemplary only, and not intended to limit the scope and spirit of the invention. The references and publications cited herein are incorporated herein by this reference.


Unless otherwise indicated, all numbers expressing quantities of ingredients, properties such as reaction conditions, and so forth used in the Specification, Examples, and claims are to be understood as being modified in all instances by the term “about.” Accordingly, unless indicated to the contrary, the numerical parameters set forth in the Specification, Example, and claims are approximations that may vary depending upon the desired properties sought to be determined by the present invention.

Claims
  • 1. A method of screening compounds and/or compositions for potential insect control activity, comprising: providing cells expressing an octopamine receptor and cells expressing a tyramine receptor;adding said compounds and/or compositions to the cells thereb causing an effect through at least the tyramine receptor;measuring the effects of the compounds and/or compositions, wherein measurable effects comprise a change in a level of cAMP and/or Ca2+within the cells, and wherein the effects are indicative of potential insect control activity. classifying the selected compounds and/or compositions as having potential insect control activity.
  • 2. The method of claim 1, wherein the step of measuring the effects of the compounds and/or compositions includes measuring the binding affinity of said compounds and/or compositions to at least one of the said receptors.
  • 3. The method of claim 2, additionally comprising selecting compounds and/or compositions having an affinity for at least one of the said receptors.
  • 4. The method of claim 1, wherein the step of measuring the effects of the compounds and/or compositions includes: extracting intracellular cAMP and/or Ca2+ from the cells; determining the intracellular cAMP and/or Ca2+ levels; and comparing the intracellular cAMP and/or Ca2+ levels in cells treated with said compounds and/or compositions to the intracellular cAMP and/or Ca2+ levels in untreated cells.
  • 5. The method of claim 4, additionally comprising selecting compounds and/or compositions, the treatment with which causes a change in intracellular cAMP and/or Ca2+ levels.
  • 6. A method of screening compounds and/or compositions for potential insect control activity, comprising: providing first cells expressing a first octopamine receptor and cells expressing a tyramine receptor;providing second cells expressing a second octopamine receptor;adding said compounds and/or compositions to the first and the second cells thereby causing an effect through at least the tyramine receptor;measuring the effects of the compounds and/or compositions, wherein measurable effects comprise a change in a level of cAMP and/or Ca2+ within the cells, and wherein the effects are indicative of potential insect control activity. classifying the selected compounds and/or compositions as having potential insect control activity.
  • 7. The method of claim 6, wherein the step of measuring the effects of the compounds and/or compositions includes measuring the binding affinity of said compounds and/or compositions to at least one of the said receptors.
  • 8. The method of claim 7, and additionally comprising selecting compounds and/or compositions having a desired relative affinity for one of the said receptors.
  • 9. The method of claim 6, wherein the step of measuring the effects of the compounds and/or compositions includes: extracting intracellular cAMP and/or Ca2+ from the first and the second cells; determining the intracellular cAMP and/or Ca2+ levels; and comparing the change in intracellular cAMP and/or Ca2+ levels in the first cells and the second cells.
  • 10. The method of claim 9, and additionally comprising selecting compounds and/or compositions, the treatment with which causes a desired relative change in intracellular cAMP and/or Ca2+ levels in one of the cells.
  • 11. The method of claim 9, wherein one of the octopamine receptors has an amino acid sequence of SEQ ID NO:3.
  • 12. A method of testing the effects of compounds and/or compositions on cells, said method comprising: providing first cells expressing a first octopamine receptor cloned from a first insect species-of-interest and a tyramine receptor;providing second cells expressing a second octopamine receptor cloned from a second insect species-of-interest;adding said compounds and/or compositions to the first and the second cells thereby causing an effect through at least the tyramine receptor;measuring the effects of the compounds and/or compositions, wherein measurable effects comprise a change in a level of cAMP and/or Ca2+ within the cells, and wherein the effects are indicative of potential insect control activityclassifying the selected compound and/or compositions as having potential insect control activity.
  • 13. The method of claim 1, wherein the octopamine receptor has an amino acid sequence of SEQ ID NO: 3.
  • 14. The method of claim 1, wherein the octopamine
  • 15. The method of claim 14, wherein the octopamine receptor is an octopamine receptor of an insect species.
  • 16. The method of claim 6, wherein the first octopamine receptor is cloned from a first invertebrate, and the second octopamine receptor is cloned from a second invertebrate.
  • 17. The method of claim 16, wherein the first octopamine receptor is cloned from a first insect species, and the second octopamine receptor is cloned from a second insect species.
  • 18. The method of claim 2, additionally comprising excluding compounds and/or compositions having an affinity for the at least one receptor.
CROSS REFERENCES TO RELATED APPLICATIONS

This application claims priority from U.S. Provisional Application Ser. No. 60/554,968 filed Mar. 19, 2004, and is a continuation-in-part of commonly assigned and U.S. patent application Ser. No. 10/832,022 filed Apr. 26, 2004 (now U.S. Pat. No. 7,541,155). The entire disclosures contained in U.S. Provisional Application Ser. No. 60/554,968 and U.S. application Ser. No. 10/832,022 now U.S. Pat. No. 7,541,155 are incorporated herein by this reference.

US Referenced Citations (209)
Number Name Date Kind
3943063 Morishita et al. Mar 1976 A
3971852 Brenner et al. Jul 1976 A
4211668 Tate Jul 1980 A
4320113 Kydonieus Mar 1982 A
4434181 Marks et al. Feb 1984 A
4678775 Nathanson Jul 1987 A
4693890 Wilson et al. Sep 1987 A
4696676 Wilson et al. Sep 1987 A
4748860 Butler et al. Jun 1988 A
4759228 Butler et al. Jul 1988 A
4762718 Marks, Sr. Aug 1988 A
4764367 Wilson et al. Aug 1988 A
4783457 Nathanson Nov 1988 A
4801446 Wilson et al. Jan 1989 A
4801448 Wilson et al. Jan 1989 A
4808403 Wilson et al. Feb 1989 A
4816248 Wilson et al. Mar 1989 A
4818526 Wilson et al. Apr 1989 A
4859463 Wilson et al. Aug 1989 A
4876087 Wilson et al. Oct 1989 A
4880625 Wilson et al. Nov 1989 A
4885855 Marks et al. Dec 1989 A
4886662 Wilson et al. Dec 1989 A
4892871 Nathanson Jan 1990 A
4902504 Wilson et al. Feb 1990 A
4902690 Nathanson Feb 1990 A
4911906 Wilson et al. Mar 1990 A
4943435 Baker et al. Jul 1990 A
4959209 Wilson et al. Sep 1990 A
4970068 Wilson et al. Nov 1990 A
4988507 Wilson et al. Jan 1991 A
4988508 Wilson et al. Jan 1991 A
4988509 Wilson et al. Jan 1991 A
4990684 Hoelderich et al. Feb 1991 A
4992270 Wilson et al. Feb 1991 A
5091423 Wilson et al. Feb 1992 A
5118711 Wilson et al. Jun 1992 A
5126369 Wilson et al. Jun 1992 A
5134892 Wilson et al. Aug 1992 A
5165926 Wilson et al. Nov 1992 A
5175175 Wilson et al. Dec 1992 A
5196200 Wilson et al. Mar 1993 A
5204372 Wilson et al. Apr 1993 A
5205065 Wilson et al. Apr 1993 A
5228233 Butler et al. Jul 1993 A
5250575 Wilson et al. Oct 1993 A
5272179 Butler et al. Dec 1993 A
5281621 Wilson et al. Jan 1994 A
5321048 Wilson et al. Jun 1994 A
5327675 Butler et al. Jul 1994 A
5344776 Venter et al. Sep 1994 A
5344847 Wilson et al. Sep 1994 A
5354783 Marin et al. Oct 1994 A
5366975 Nathanson Nov 1994 A
5387418 Marin et al. Feb 1995 A
5401500 Warren et al. Mar 1995 A
5407609 Tice et al. Apr 1995 A
5409958 Butler et al. Apr 1995 A
5417009 Butler et al. May 1995 A
5418010 Janda et al. May 1995 A
5439690 Knight Aug 1995 A
5439941 Butler et al. Aug 1995 A
5441988 Butler et al. Aug 1995 A
5447714 Marin et al. Sep 1995 A
5449695 Marin et al. Sep 1995 A
5458882 Marin et al. Oct 1995 A
5464626 Warren et al. Nov 1995 A
5472701 Warren et al. Dec 1995 A
5474898 Venter et al. Dec 1995 A
5521165 Warren et al. May 1996 A
5576010 Warren et al. Nov 1996 A
5576011 Butler et al. Nov 1996 A
5593600 Solomon Jan 1997 A
5633236 Warren et al. May 1997 A
5635173 Warren et al. Jun 1997 A
5635174 Warren et al. Jun 1997 A
5665781 Warren et al. Sep 1997 A
5683687 Marin et al. Nov 1997 A
5693344 Knight et al. Dec 1997 A
5703104 Peck et al. Dec 1997 A
5753686 Marin et al. May 1998 A
5772983 O'Connell et al. Jun 1998 A
5785982 Warren et al. Jul 1998 A
5814325 Rod Sep 1998 A
5840669 Neelakantan Nov 1998 A
5855903 Warren et al. Jan 1999 A
5980931 Fowler et al. Nov 1999 A
5990178 Ninkov Nov 1999 A
5998484 Zobitne et al. Dec 1999 A
6004569 Bessette et al. Dec 1999 A
6006470 Geoghegan et al. Dec 1999 A
6024874 Lott Feb 2000 A
6114384 Bessette et al. Sep 2000 A
6143288 Warren et al. Nov 2000 A
6183767 Bessette et al. Feb 2001 B1
6255356 Butler Jul 2001 B1
6272790 Paganessi et al. Aug 2001 B1
6322825 Ninkov Nov 2001 B1
6329433 Bessette et al. Dec 2001 B1
6331572 Bessette et al. Dec 2001 B1
6333302 Beer et al. Dec 2001 B1
6333360 Bessette et al. Dec 2001 B1
6340710 Bessette et al. Jan 2002 B1
6342535 Bessette et al. Jan 2002 B1
6342536 Bessette et al. Jan 2002 B1
6360477 Flashinski et al. Mar 2002 B1
6368508 Gatz et al. Apr 2002 B1
6372801 Bessette et al. Apr 2002 B1
6372803 Bessette et al. Apr 2002 B1
6376556 Bessette et al. Apr 2002 B1
6395789 Bessette et al. May 2002 B1
6414036 Ninkov Jul 2002 B1
6451844 Watkins et al. Sep 2002 B1
6506707 Bessette Jan 2003 B1
6531163 Bessette et al. Mar 2003 B1
6534099 Bessette et al. Mar 2003 B1
6548085 Zobitne et al. Apr 2003 B1
6555121 Bessette et al. Apr 2003 B1
6610254 Furner et al. Aug 2003 B1
6649660 Ninkov Nov 2003 B2
6660288 Behan et al. Dec 2003 B1
6670311 Aldcroft et al. Dec 2003 B1
6689395 Bessette Feb 2004 B2
6713518 Bessette et al. Mar 2004 B1
6812258 Bessette et al. Nov 2004 B2
6841577 Bessette et al. Jan 2005 B2
6844369 Ninkov Jan 2005 B2
6849614 Bessette et al. Feb 2005 B1
6858653 Bessette Feb 2005 B1
6887899 Bessette May 2005 B1
6921539 Ninkov Jul 2005 B2
6949587 Bessette Sep 2005 B1
6969522 Bessette Nov 2005 B2
6974584 Bessette Dec 2005 B2
6986898 Bessette Jan 2006 B1
7008649 Bessette et al. Mar 2006 B2
7109240 Bessette et al. Sep 2006 B2
7201926 Fried et al. Apr 2007 B2
7208519 Ninkov Apr 2007 B2
7238726 Bessette Jul 2007 B2
7238798 Lee et al. Jul 2007 B2
7241806 Bessette Jul 2007 B2
7250175 Bessette et al. Jul 2007 B2
7291650 Bessette et al. Nov 2007 B2
7320966 Bessette et al. Jan 2008 B2
7351420 Bessette et al. Apr 2008 B2
7357939 Bessette Apr 2008 B2
7361366 Bessette et al. Apr 2008 B2
7381431 Baker et al. Jun 2008 B2
20020028256 Bessette Mar 2002 A1
20020034556 Khazan Mar 2002 A1
20020073928 Ingman et al. Jun 2002 A1
20020076360 Ingman et al. Jun 2002 A1
20020081230 Ingman et al. Jun 2002 A1
20020096121 Ingman et al. Jul 2002 A1
20020107287 Bessette et al. Aug 2002 A1
20030026823 Fried et al. Feb 2003 A1
20030036530 Bessette Feb 2003 A1
20030039674 Bessette Feb 2003 A1
20030091657 Chiasson May 2003 A1
20030091661 Bessette May 2003 A1
20030108622 Bessette et al. Jun 2003 A1
20030108623 Bessette et al. Jun 2003 A1
20030175369 Khazan-Enache Sep 2003 A1
20030194454 Bessette et al. Oct 2003 A1
20040146595 Bessette et al. Jul 2004 A1
20040156922 Bessette et al. Aug 2004 A1
20040185080 Hojo et al. Sep 2004 A1
20040192551 Bessette Sep 2004 A1
20040213822 Birch et al. Oct 2004 A1
20040248791 Spana et al. Dec 2004 A1
20050004233 Bessette et al. Jan 2005 A1
20050008714 Enan Jan 2005 A1
20050013885 Chiasson Jan 2005 A1
20050019269 Marks et al. Jan 2005 A1
20050070576 Spooner-Hart et al. Mar 2005 A1
20050136089 Bessette et al. Jun 2005 A1
20050143260 Bessette et al. Jun 2005 A1
20050147636 Bessette et al. Jul 2005 A1
20050163869 Bessette et al. Jul 2005 A1
20050170024 Bessette et al. Aug 2005 A1
20050170025 Bessette et al. Aug 2005 A1
20050170026 Bessette et al. Aug 2005 A1
20050260241 Bessette et al. Nov 2005 A1
20050260242 Bessette et al. Nov 2005 A1
20050288227 Marks et al. Dec 2005 A1
20060088564 Bessette Apr 2006 A1
20060115507 Bessette Jun 2006 A1
20060115508 Bessette Jun 2006 A1
20060115509 Bessette Jun 2006 A1
20060115510 Bessette Jun 2006 A1
20060121074 Bessette Jun 2006 A1
20070098750 Bessette May 2007 A1
20070178128 Bessette Aug 2007 A1
20070190094 Bessette Aug 2007 A1
20070207221 Bessette et al. Sep 2007 A1
20070298131 Bessette et al. Dec 2007 A1
20070299037 Bessette et al. Dec 2007 A1
20070299038 Bessette et al. Dec 2007 A1
20080003315 Bessette et al. Jan 2008 A1
20080003316 Bessette et al. Jan 2008 A1
20080003317 Bessette et al. Jan 2008 A1
20080004240 Bessette et al. Jan 2008 A1
20080015167 Bessette et al. Jan 2008 A1
20080015249 Bessette et al. Jan 2008 A1
20080020381 Henrich et al. Jan 2008 A1
20080032387 Bailey et al. Feb 2008 A1
20080038383 Bessette et al. Feb 2008 A1
20080153904 Bessette et al. Jun 2008 A1
Foreign Referenced Citations (25)
Number Date Country
WO 9854971 Dec 1998 WO
WO 9921891 May 1999 WO
WO 9933973 Jul 1999 WO
WO 0005964 Feb 2000 WO
WO 0021364 Apr 2000 WO
WO 0050566 Aug 2000 WO
WO 0051436 Sep 2000 WO
WO 0053020 Sep 2000 WO
WO 0075322 Dec 2000 WO
WO 0100020 Jan 2001 WO
WO 0100026 Jan 2001 WO
WO 0100032 Jan 2001 WO
WO 0100033 Jan 2001 WO
WO 0100034 Jan 2001 WO
WO 0100049 Jan 2001 WO
WO 0110214 Feb 2001 WO
WO 0118201 Mar 2001 WO
WO 0160163 Aug 2001 WO
WO 0191554 Dec 2001 WO
WO 0191556 Dec 2001 WO
WO 0191560 Dec 2001 WO
WO 03016477 Feb 2003 WO
WO 2004006968 Jan 2004 WO
WO 2004100971 Nov 2004 WO
WO 2005092016 Oct 2005 WO
Related Publications (1)
Number Date Country
20050214267 A1 Sep 2005 US
Provisional Applications (1)
Number Date Country
60554968 Mar 2004 US
Continuation in Parts (1)
Number Date Country
Parent 10832022 Apr 2004 US
Child 11086615 US