Patent Application
20200115718
Applicant asserts that the information recorded in the form of an Annex C/ST.25 text file submitted under Rule 13ter.1(a), entitled UNIA 17.30_PCT_Sequence_Listing_ST25.txt, is identical to that forming part of the international application as filed. The content of the sequence listing is incorporated herein by reference in its entirety.
The present invention relates to protein production in legumes, more particularly to production of various proteins such as therapeutic proteins in legumes, and further to production of legume-based materials and therapeutic constructs comprising therapeutic proteins.
Protein therapeutics have emerged as increasingly vital therapy for a wide range of conditions. For example, in diabetes, diabetic foot ulceration results in both acute and chronic wounds that are difficult to heal without growth factor administration, often resulting in amputation. In children, necrotizing enterocolitis often leads to malabsorption and requires growth factor administration for repairing damaged intestinal epithelia. While growth factors have increasingly been brought forward as biological therapeutic agents, their production, processing, and delivery to the recipient (e.g., human, animal, etc.), remains complex, expensive, and cumbersome.
The present invention features methods, systems, and compositions for producing proteins (e.g., therapeutic proteins) in legumes. Legumes may include but are not limited to alfalfa, clover, mesquite, tamarind, carob, peas, beans, peanuts or other legume nuts, lentils, and soybeans. The proteins produced by the legumes may be used for delivery in animals such as humans or other species. As a non-limiting example, the present invention features transgenic legumes expressing a gene to produce a growth factor, e.g., EGF, FGF, PDGF, VEGF, IGF, HSF, TGF-alpha, TGF-beta, etc. or bioregulatory or therapeutic proteins such as insulin, fibronectin or HIF-1 alpha.
Methods of production of said proteins (e.g., therapeutic proteins) may feature gene splicing into legumes. While the present invention discloses EGF production in soybeans, the specific genetic manipulative methodology described in the present invention is broadly applicable to a range of proteins (e.g., therapeutic proteins, e.g., growth factors) and a range of legumes.
The present invention also features methods to remove at least a portion of mutagenic and/or inflammatory elements of the soybean plant, e.g., selectively clone out or reduce expression of specific host (plant) proteins or factors that may be inflammatory when applied as a concomitant unprocessed therapeutic to an individual. As an example, some proteins expressed in soy ultimately may be inflammatory and/or allergenic to a human. Without wishing to limit the present invention to any theory or mechanism, it is believed that removing mutagenic and/or inflammatory elements of the soybean plant, e.g., when applied to humans or animals, will not reduce efficacy of the therapeutic protein.
The present invention also features methods for delivery of a protein (e.g., growth factor) from the plant (legume) source. Conventional methodologies may take a spliced in, transduced and translated human protein therapeutic raised in a cross-kingdom source, (e.g., a plant), and go through a range of processing steps to extract the human therapeutic. Without wishing to limit the present invention to any theory or mechanism, a potential downside or limitation of this type of approach may include a reduction in yield, a risk of protein denaturation, storage and stability issues, and/or an ultimate reduction in efficacy and possible safety. The present invention features a range of methods and products for delivery of the protein (e.g., therapeutic protein) using the plant substance as a delivery vehicle. The entire raw plant may be processed, or any other part or combination of parts. Methods of fabrication of raw materials include but are not limited to grinding, particulating, pulverizing, morselating and other alteration of mass means. In addition, the non-protein yielding elements of the plant may similarly be processed by the above techniques, stripped, sub-fractionated, or otherwise extracted to yield materials with a range of material properties and stiffness.
The present invention also features a range of protein therapeutic products that may be fabricated from these base materials into novel configurations with novel properties. As an example, these raw base materials may then be fabricated via a range of processing/manufacturing techniques including film formation—either alone or with intermixed adjuvants and binders including natural and synthetic gelation materials, e.g., PEG, PEG-lactide, Plutronics, Tetronics, Carbopol, Eudragits, Gelatins (see, for example, U.S. Pat. No. 6,290,729, the disclosure of which is incorporated herein by reference in its entirety), spray drying, drop casting, spin casting, extrusion, electrospinning, low-temperature thermoforming, micro- and nano-particle or micro- and nano-capsule formation and/or other related formation techniques. These materials may then be processed and admixed with other constructive elements to form specific delivery products that may be utilized for topical, dermal or enteral use. As an example of a novel construct, soybean bulk plant shaft material in combination with raw soy bean containing EGF has been micro pulverized, formed into a slurry and electrospun to yield a matte bandage and gauze, which may be applied directly to a wound such as a diabetic foot ulcer, a post-surgical incision site, or a non-healing sternal wound or mediastinitis site. Similarly, constructed products may be utilized in the animal domain, e.g., in significant wounds to a racehorse wherein non-healing wounds may result in animal euthanasia. Another example is the fabrication of an endoluminal stent-like construct that may be applied by balloon catheter endoluminally to the G.I. tract for local ulceration, either in the stomach or anywhere from mouth to anus. Novelty in the construct includes adding in non-active plant elements or synthetic elements that may be hygroscopic, leading to reduction of edema, removing of fluid from weeping wounds, and otherwise drying up a supportive wound bed. In the non-therapeutic elements, indicators markers and sensors may also be admixed to provide active probing and feedback information as to wound status and progression. In another formulation, non-allergenic soy may be admixed with binders as above and locally injected in the more superficial layers of skin to yield depots for local release of the therapeutic human agent. Also admixed in these constructs both topical and intradermal or enteral may be a range of synergistic medications that may be anti-inflammatory, anti-infective or anesthetic for pain reduction.
The present invention shows the feasibility of using plants as a biofactory to produce therapeutic agents for a delivery platform.
Without wishing to limit the present invention to any theory or mechanism, it is believed that there are a number of ways to eliminate inflammatory proteins, e.g., using genetic engineering approach, selective breeding using mutants from collections, conventional gene silencing via suppression, CRISPR mediated mutation, natural spontaneous mutation (e.g., used for a triple null soybean), etc. Using such a platform, the expression of a variety of different proteins including but not limited to EGF could be engineered.
See references Hemendrasinh J Rathod and Dhruti P Mehta. “A Review on Pharmaceutical Gel”. International Journal of Pharma and Drug Development (2016): 25-36; and Ganapathy et al., J Pharm Bioallied Sci. 2012 August; 4(Suppl 2): S334-S337.
The present invention features methods, systems, and compositions for plant-based production of proteins (e.g., therapeutic proteins) and therapeutic materials. For example, the present invention features transgenic legumes expressing a protein, the protein being an animal protein (e.g., a human protein, a human growth factor, etc.). In some embodiments, the protein is a therapeutic protein. In some embodiments, the transgenic legume is a soybean, a lentil, a bean, a pea, or a peanut. In some embodiments, the protein is a growth factor. In some embodiments, the protein is an antibody. In some embodiments, the animal protein is a human protein. In some embodiments, the transgenic legume is a non-allergenic legume. In some embodiments, the transgenic legume is a non-allergenic soybean.
The present invention also features compositions comprising the animal protein according the present invention. In some embodiments, the composition comprises soymilk.
The present invention also features methods of harvesting a recombinant protein expressed in a transgenic legume. In some embodiments, the method comprises processing an entire plant of the transgenic legume. In some embodiments, processing the entire plant comprises grinding. In some embodiments, processing the entire plant comprises micro pulverizing.
The present invention also features medical materials comprising an animal protein derived from a transgenic legume according to the present invention and at least a portion of the transgenic legume that produced said protein. In some embodiments, the material is for epidermal or dermal application. In some embodiments, the material comprises gauze or a bandage. In some embodiments, the material is constructed by spin-coating, drop casting, spin casting, extrusion, electrospinning, film formation, spraying, spray drying, drop casting, spin casting, extrusion, electrospinning, low-temperature thermoforming, micro-particle formation, nano-particle formation, micro-capsule formation, nano-capsule formation, or a combination thereof. In some embodiments, the medical material reduces inflammation. In some embodiments, the material further comprises a non-active plant element. In some embodiments, the material further comprises a synthetic element. In some embodiments, the element comprises an excipient or adjuvant. In some embodiments, the excipient or adjuvant comprises a colloidal binder, a gelatin, polyethylene glycol (PEG), PEG-lactide, Plutronics, Tetronics, Carbopol, Eudragits, or a combination thereof. In some embodiments, the element is hygroscopic. In some embodiments, the element is hydrophobic. In some embodiments the construct contains a hydrogel, aerogel or organogel element or material or a combination thereof or other gel or gellant materials similar to those discussed in Rathod and Mehta 2016. In some embodiments, the material further comprises a marker or sensor or means of detection. In some embodiments, the sensor is for providing feedback information as to status of the topical condition. In some embodiments, the sensor or marker is for pH detection or indication. In some embodiments, the sensor or marker is for detecting infection. In some embodiments, the material further comprises a medication. In some embodiments, the medication is an anti-inflammatory medication, an anti-bacterial medication, an anti-microbial medication, an antifungal medication, an anti-infective medication, an anesthetic medication, or a combination thereof. In some embodiments, the material further comprises a perfumant. In some embodiments, the material further comprises a compound or compounds for reducing odor. In some embodiments, the material further comprises non-allergenic soy. In some embodiments the material may contain and/or deliver a cell or cell product. As an example, the material may deliver live, dead or attenuated epithelial cells, platelets or white blood cells; in some embodiments the material may contain or deliver a cell product or constituent such as platelet-rich plasma or extract; in some embodiments the material may contain or deliver a viral vector, gene, plasmid, episome or bacteriophage, siRNA, aptamer, and the like genetic material.
The present invention also features a method of treating a topical condition, wherein the method may comprise applying to the topical condition a medical material according to the present invention.
The present invention also features methods and compositions for producing epidermal growth factor (EGF) (e.g., human EGF) in soybean seeds. For example, the present invention also features a method of producing human epidermal growth factor (hEGF). The method may comprise expressing a protein encoded by SEQ ID NO: 1 (a codon-optimized gene for EGF expression) in a transgenic soybean comprising a transgene according to SEQ ID NO: 1 (see
As such, the present invention also features a nucleic acid according to SEQ ID NO: 1. The present invention also features a protein encoded by a nucleic acid according to SEQ ID NO: 1. The present invention also features a transgenic soybean expressing SEQ ID NO: 1. The present invention also features a soymilk composition comprising soybean-derived human epidermal growth factor (hEGF).
As previously discussed, the methods of the present invention are such that one does not necessarily have to process the soybean or other legume to extract the protein, which could reduce yield or risk damaging or denaturing the protein. Methods of the present invention may feature grinding and optionally processing the entire plant (e.g., not necessarily just the bean) to create a range of constructs including spun gauze, bandages injectable intradermal fields of local depots. In addition, this may be used in other open lumens and including the sinus for sinusitis, the mouth for oral ulcers and anywhere in the enteral tract. This may be formed into an enteral stent for local ulceration, and/or local delivery of other protein therapeutics. The present invention also features antibody production. Antibodies may be used for a range of indications including but not limited to inflammatory bowel disease.
Any feature or combination of features described herein are included within the scope of the present invention provided that the features included in any such combination are not mutually inconsistent as will be apparent from the context, this specification, and the knowledge of one of ordinary skill in the art. Additional advantages and aspects of the present invention are apparent in the following detailed description and claims.
The features and advantages of the present invention will become apparent from a consideration of the following detailed description presented in connection with the accompanying drawings in which:
Referring now to
The present invention shows the accumulation of human EGF (hEGF) in genetically engineered soybean seeds. Further, the present invention shows that the recombinant EGF is indistinguishable from authentic human EGF and is bioactive at stimulating EGF receptor (EGFR) activity. Briefly, the present invention utilizes transgenic soybean seeds expressing a seed-specific codon optimized gene encoding of the human EGF protein with an added ER signal tag at the N terminal. Seven independent lines were grown to homozygous and found to accumulate a range of 6.7+/−3.1 to 129.0+/−36.7 ug EGF/g of dry soybean seed. Proteomic and immunoblot analysis indicate that the inserted EGF is the same as the human EGF protein. Phosphorylation and immunohistochemical assays on the EGF receptor in HeLa cells indicate the EGF protein produced in soybean seed is bioactive and comparable to commercially available human EGF.
To produce hEGF in soybean, a strong soybean seed-specific promoter and terminator was used to regulate gene expression of a synthetic soybean codon optimized hEGF (ShEGF) gene that included an N-terminal 60 nucleotide ER-signal sequence (
The hEGF soybeans and non-transgenic soybeans were evaluated to determine the biochemical authenticity of the soybean-produced EGF protein. Using 1D SDS/PAGE and parallel immunoblots probed with anti-EGF, the soluble low molecular weight (<10 kDa) seed proteins and the Mr of the soybean-produced hEGF was evaluated. The total protein polypeptide of the hEGF expressing lines appeared to be identical to the standard parental control (See
To evaluate the potential of EGF activity in soymilk delivery, commercial recombinant human EGF (rhEGF) was added as a supplement to soymilk and the intrinsic activity of the EGF was tested with a HeLa cell assay.
To assess the bioactivity of soybean-produced hEGF, samples were prepared from both ShEGF transgenic soybean lines and non-transgenic controls that were used to stimulate HeLa cells to induce EGFR internalization, degradation and phosphorylation. As shown in
To test for potential collateral composition in the hEGF-producing soybeans, the ShEGF transgenic and non-transgenic control soybeans were analyzed by non-targeted proteomics and metabolomics. Among the significant proteins identified include various well-documented allergens and anti-metabolite proteins. A comparison of standard soybeans with hEGF-producing soybean lines showed that there was no significant difference (p=0.01) between non-transgenic control and ShEGF transgenic soybeans aside from the targeted production of hEGF for any other proteins of concern. This data is available in PRIDE partner repository with the dataset identifier PXD003326 and 10.6019/PXD003326.
Non-targeted small molecule metabolomics was used to conduct a parallel analysis of the non-transgenic and hEGF soybeans. Again there were insignificant differences between non-transgenic soybean seeds and the ShEGF transgenic seeds (see
The following Example describes non-limiting methods associated with the present invention.
Epidermal growth factor protein from humans was produced in soybean seeds by constructing a plant gene expression cassette that involved a synthetic codon optimized EGF nucleotide sequence (protein sequence from Genbank accession CCQ43157). This 162 bp open reading frame was placed in-frame behind a 20-amino acid endoplasmic reticulum (ER) signal sequence from the Arabidopsis chitinase gene [30,31]. The ER-directed EGF encoding open reading frame was developmentally regulated by the strong seed-specific storage protein glycinin regulatory elements [31]. The entire seed specific cassette to direct EGF production was placed in a vector containing the hygromycin resistance gene under the strong constitutive expression of the potato ubiquitin 3 regulatory elements as previously described (Schmidt M A, Herman E M. The Collateral Protein Compensation Mechanism Can Be Exploited To Enhance Foreign Protein Accumulation In Soybean Seeds. Plant Biotechnol J. 2008; 6: 832-842; Schmidt M A, Herman E M. A RNAi knockdown of soybean 24 kda oleosin results in the formation of micro-oil bodies that aggregate to form large complexes of oil bodies and ER containing caleosin. Mol Plant. 2008; 1: 910-924; Schmidt M A, Parrott W A, Hildebrand D F, Berg R H, Cooksey A, Pendarvis K, et al. Transgenic soybean seeds accumulating β-carotene exhibit the collateral enhancements of high oleate and high protein content traits. Plant Biotechnol J. 2015; 13: 590-600). The result plasmid pGLY::ShEGF was sequenced using a glycinin promoter primer (5′ TCATTCAC CTTCCTCTCTTC 3′) to ensure the EGF open reading frame was placed correctly between the regulatory elements. Somatic soybean (Glycine max L. Merrill cv Jack (wild type)) embryos were transformed via biolistics using 30 mg/L hygromycin B selection and regenerated as previously described (Schmidt M A, Tucker D M, Cahoon E B, Parrott W A. Towards normalization of soybean somatic embryo maturation. Plant Cell Rep. 2004; 24: 383-391). Embryos from resistant lines were analyzed by genomic PCR to confirm the presence of inserted hygromycin cassette using primers specific to the hygromycin gene (HygF 5′CTCACTATTCCTTTGCCCTC3′ and HygR 5′CTGACCTATTGCATCTCCCG3′), cetyl trimethyl ammonium bromide (CTAB) extraction genomic DNA isolation and the following amplification conditions: 150 ng genomic DNA in 25 μl total reaction containing 200 nM primers and 3 U Taq polymerase (NEB) and the following cycling parameters (initial 95° C. 4 min then 45 cycles of 95° C. 30 s, 55° C. 45 s, 72° C. 90 s; followed by a final extension of 72° C. 7 min). Dry seeds from two successive generations of PCR positive plants were analyzed by ELISA for the expression of EGF protein until all 7 lines were confirmed to be homozygous. EGF transgenic soybean plants along with non-transgenic control wild type cultivar plants were grown side by side in a greenhouse at 25° C. under 16 h daylight with 1000 μm-2/s.
As previously discussed, the present invention features compositions comprising nucleic acid sequence, SEQ ID NO: 1 of Table 1 below. The vector of SEQ ID NO: 1 comprises a modified hEGF gene (the sequence within SEQ ID NO: 1 that encodes hEGF is outlined). The optimized hEGF nucleic acid sequence is not limited to SEQ ID NO: 1 and comprises a nucleic acid that encodes a peptide of interest.
In some embodiments, the nucleic acid is at least about 90% identical to SEQ ID NO: 1. In some embodiments, the nucleic acid is at least about 93% identical to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence is at least about 95% identical to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence is at least about 98% identical to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence is at least about 99% identical to SEQ ID NO: 1. Non-limiting examples of such nucleic acid sequences can be found in Table 1 below. For example, SEQ ID NO: 2 and SEQ ID NO: 7 are sequences for a modified hEGF that is about 99% identical to SEQ ID NO: 1. SEQ ID NO: 3 and SEQ ID NO: 8 are sequences for a modified EGF that is about 98% identical to SEQ ID NO: 1; SEQ ID NO: 4 and SEQ ID NO: 9 are sequences for a modified EGF that is about 95% identical to SEQ ID NO: 1 (note that the bold letters in Table 1 are nucleotide substitutions as compared to SEQ ID NO: 1, and the codon underlined).
tcactctcccatgatggcgattgtttgcacgacgg
ggccaatacagggacctcaaacggtgggagct
cactctcccctgatggcgattgtttgcacgacgga
ataactgcgttgtggaatatatcggtgaaagagg
ccaatacaggaacctcaaacggtgggagctga
cactctcccctgatggcgattgtttgcaagacgta
ggccaatacaggaacctcaaacggtggaagct
ctactctgccatgctgtctattgttcgcacgacag
agtttgcatgtatattgtagctgtggataagtactc
atgtaactgcgctgtgggatgtatcggtgcaaga
The vector comprises a nucleic acid that encodes a peptide of interest. In some embodiments, the nucleic acid sequence is at least about 90% identical to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence is at least about 93% identical to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence is at least about 95% identical to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence is at least about 98% identical to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence is at least about 99% identical to SEQ ID NO: 1. Non-limiting examples of resulting amino acid sequences encoded by such nucleic acid sequences can be found in Table 2 below. For example, SEQ ID NO: 12 and SEQ ID NO: 18 are amino acid sequences encoded by modified hEGF polynucleotide sequences of Seq ID NO: 2 and SEQ ID NO: 6, respectively, that are about 99% identical to SEQ ID NO: 1 (note that the bold letters in Table 2 are amino acid substitutions as compared to SEQ ID NO: 12).
K
LR
The present invention also features compositions comprising nucleic acid SEQ ID NO: 26 of Table 3 below. The vector of SEQ ID NO: 1 comprises a modified hEGF gene comprising a modified polynucleotide for the protein-coding region of hEGF, SEQ ID NO: 26 (the sequence within SEQ ID NO: 1 that encodes hEGF is outlined). The optimized hEGF nucleic acid protein-coding sequence is not limited to SEQ ID NO: 26 and comprises a nucleic acid that encodes a peptide of interest.
In some embodiments, the hEGF protein-coding nucleotide sequence is at least 90% identical to SEQ ID NO: 26. In some embodiments, the nucleic acid is at least 93% identical to SEQ ID NO: 26. In some embodiments, the nucleic acid is at least 95% identical to SEQ ID NO: 26. In some embodiments, the nucleic acid is at least 98% identical to SEQ ID NO: 26. In some embodiments, the nucleic acid is at least 99% identical to SEQ ID NO: 26. Non-limiting examples of such nucleic acid sequences can be found in Table 3 below. For example, SEQ ID NO: 27 is a sequence for a modified hEGF that is about 99% identical to SEQ ID NO: 26. SEQ ID NO: 28 is a sequence for a modified EGF that is about 98% identical to SEQ ID NO: 26; SEQ ID NO: 29 is a sequence for a modified EGF that is about 95% identical to SEQ ID NO: 26 (note that the bold letters in Table 3 are nucleotide substitutions as compared to SEQ ID NO: 26, and the codon underlined).
acttccgatagtgagtgtccactctcccatgatgg
aactccgctagtgagtgtccactctcccatgatgg
aactccgctagtgagtgttcactctcccatgatgg
aatatatcggtgaaagaggccaatacagggac
aactccgctattgagtgttcactctcccctgatgg
atatatcggtgaaagaggccaatacaggaacct
aactccgctattgagtgttcactctcccctgatgg
aatatctcggtgaaagaggccaatacaggaac
The present invention also features compositions comprising nucleic acid sequence, SEQ ID NO: 32 of Table 4 below. The vector of SEQ ID NO: 1 comprises a modified hEGF gene comprising a polynucleotide for the non-hEGF protein coding region, SEQ ID NO: 32. The non-hEGF protein coding sequence of the optimized hEGF nucleotide is not limited to SEQ ID NO: 32. In some embodiments, the 3′ end of SEQ ID NO: 32 is operatively coupled to the 5′ end of SEQ ID NO: 26.
In some embodiments, the non-hEGF protein coding nucleotide sequence is at least 90% identical to SEQ ID NO: 32. Non-limiting examples of such nucleic acid sequences can be found in Table 4 below. For example, SEQ ID NO: 33 is a sequence that is at least 90% (<100%) identical to SEQ ID NO: 32 (note that the bold letters in Table 4 are nucleotide substitutions as compared to SEQ ID NO: 26, and the codon underlined).
Total soluble protein was extracted from dry seeds of two homozygous EGF lines and a non-transgenic control by repeated acetone washes followed by acetone precipitation with the protein pellet dissolved in water. Proteins with molecular weight 10 kDa and under were isolated by separately passing each extract through an Amicon Ultra centrifugal filter (Merck, Kenilworth N.J.). The samples were each suspended in sample buffer (50 mM Tris HCL, pH6.8 2% SDS (w/v), 0.7 M β-mercaptoethanol, 0.1% (w/v) bromphenol blue and 10% (v/v) glycerol) and then denaturated 5 min 95° C. Protein content was determined by Bradford assay. A 15% SDS-PAGE gel was used to separate 30 μg protein for each of the three samples: negative control wild type, Lines 4 and 5 of EGF transgenic soybean dry seeds. Commercially available human EGF (Gibco, Life Technologies, United Kingdom) was used at 0.5 μg as positive control. Gel was electroblotted onto Immobilon P transfer membrane (Millipore, Bedford Mass.) and blocked with 3% milk solution in TBS for at least 1 hr. Primary antibody was a commercially available anti-EGF (Calbiochem, San Diego Calif.) and was used in a 1:100 ratio in 3% BSA-TBS buffer overnight at room temperature. After 3 washes of 15 mins each with TBS buffer, the blot was incubated with a 1:10,000 ratio in TBS of secondary antibody anti-rabbit IgG Fabspecific alkaline phosphatase conjugate (Sigma, St. Louis Mo.). After 3 washes, the presence of the EGF protein was detected by using a color substrate (BCIP/NBT: final concentrations 0.02% (w/v) 5-bromo-4-chloro-3-indoyl phosphate and 0.03% (w/v) nitro blue tetrazolium in 70% (v/v) demenjkoplthylformadmide) (KPL, Gaithersburg Mass.).
Total soluble protein was extracted from dry soybean seeds as described previously (Schmidt M A, Herman E M. The Collateral Protein Compensation Mechanism Can Be Exploited To Enhance Foreign Protein Accumulation In Soybean Seeds. Plant Biotechnol J. 2008; 6: 832-842; Schmidt M A, Herman E M. A RNAi knockdown of soybean 24 kda oleosin results in the formation of micro-oil bodies that aggregate to form large complexes of oil bodies and ER containing caleosin. Mol Plant. 2008; 1: 910-924) from all 7 lines of pGLY::ShEGF transgenic plants along with non-transgenic seeds as a negative control. EGF was quantitated by commercially available human EGF ELISA assay (Quantikine ELISA kit from R&D systems, Minneapolis Minn.) according to the manufacturer's instructions. The provided positive control was used to create a standard curve in order to determine the amount of EGF in each soybean protein extract. Each homozygote EGF transgenic line was assayed with three biological replicates and results displayed as mean +/− standard error.
Total soluble proteins were extracted, quantitated and suspended in sample loading buffer as previously described (Schmidt M A, Herman E M. The Collateral Protein Compensation Mechanism Can Be Exploited To Enhance Foreign Protein Accumulation In Soybean Seeds. Plant Biotechnol J. 2008; 6: 832-842; Schmidt M A, Herman E M. A RNAi knockdown of soybean 24 kda oleosin results in the formation of micro-oil bodies that aggregate to form large complexes of oil bodies and ER containing caleosin. Mol Plant. 2008; 1: 910-924). Approximately 30 μg of protein extract from dry seeds of 4 homozygous EGF lines were separated on a 4-20% gradient SDS-PAGE gel (BioRad, Hercules Calif.) along with extract from a non-transgenic seed. The gel was subsequently stained with 0.1% (w/v) Coomassie Brilliant Blue R250 in 40% (v/v) methanol, 10% (v/v) acetic acid overnight and then destained for approximately 3 hrs in 40% methanol, 10% acetic acid with frequent solution changes.
Total soluble protein was extracted from 3 biological EGF transgenic soybean dry seed samples, lines 4, 5 and 6. As described above, proteins with molecular weights lowers than 10 kDa were concentrated using an Amicon Ultra centrifugal filter (Merck, Kenilworth N.J.). Non-transgenic seeds were used as a negative control and 5 μg commercially available EGF (as above in immunoblot section) was the positive control. Protein was precipitated by adjusting the solution to 20% (v/v) trichloroacetic acid and allowed to sit at 4° C. overnight. Precipitated proteins were pelleted using centrifugation, washed twice with acetone and then dried using vacuum centrifugation. The commercial EGF was not filtered or precipitated, only dried. Dried pellets were rehydrated with the addition of 10 μl 100 mM dithiothreitol in 100 mM ammonium bicarbonate and placed at 85° C. for 5 minutes to reduce disulphide bonds. Samples were then alkylated with addition of 10 μl iodacetamide in 100 mM ammonium bromide and placed at room temperature in the dark for 30 minutes. Two μg trypsin in 200 μl 100 mM ammonium bromide was added to each samples and placed in 37° C. overnight for enzymatic digestion. Post trypsin digest samples were desalted using a peptide reverse phase microtrap (Michrom BioResources, Auburn Calif.), dried and ultimately resuspended in 2 μl of 2% (v/v) acetonitrile, 0.1% (v/v) for-mic acid. Separation of peptides was performed using a Dionex U3000 splitless nanoflow HPLC system operated at 333 nl minute using a gradient from 2-50% acetonitrile over 60 minutes, followed by a 15 minute wash with 95% acetonitrile and a 15 minute equilibration with 2% acetonitrile. The C18 column, an in-house prepared 75 μm by 15 cm reverse phase column packed with Halo 2.7 μm, 90 Å C18 material (MAC-MOD Analytical, Chadds Ford Pa.) was located in the ion source just before a silica emitter. A potential of 2100 volts was applied using a liquid junction between the column and emitter. A Thermo LTQ Velos Pro mass spectrometer using a nanospray Flex ion source was used to analyze the eluate from the U3000. Scan parameters for the LTQ Velos Pro were one MS scan followed by 10 MS/MS scans of the 5 most intense peaks. MS/MS scans were performed in pairs, a CID fragmentation scan followed a HCD fragmentation scan of the same precursor m/z. Dynamic exclusion was enabled with a mass exclusion time of 3 min and a repeat count of 1 within 30 sec of initial m/z measurement. Spectra were collected over the entirety of each 90 minute chromatography run. Raw mass spectra were converted to MGF format using MSConvert, part of the ProteoWizard software library (Kessner D, Chambers M, Burke R, Agus D, Mallick P. ProteoWizard: open source software for rapid proteomics tools development. Bioinformatics. 2008; 24: 2534-2536) X!tandem 2013.09.01.1 (Craig R, Beavis R C. TANDEM: matching proteins with tandem mass spectra. Bioinformatics. 2004; 20: 1466-1467) and OMSSA (Geer L Y, Markey S P, Kowalak J A, Wagner L, Xu M, Maynard D M, et al. Open mass spectrometry search algorithm. J Proteome Res. 2004; 3: 958-964) algorithms were employed via the University of Arizona High Performance Computing Center to perform spectrum matching. Precursor and fragment mass tolerance were set to 0.2 Daltons for both OMSSA and X!tandem. Trypsin cleavage rules were used for both algorithms with up to 2 missed cleavages. Amino acid modifications search consisted of single and double oxidation of methionine, oxidation of proline, N-terminal acetylation, carbamidomethylation of cysteine, deamidation of asparagine and glutamine and phosphorylation of serine, threonine, and tyrosine. X!tandem xml and OMSSA xml results were filtered using Perl to remove any peptide matches with an E-value>0.05 as well as proteins identified by a single peptide sequence. The protein fasta database for Glycine max was downloaded on Aug. 5, 2015 from NCBI RefSeq with the addition of the EGF amino acid sequence. A randomized version of the Glycine max fasta was concatenated to the original as a way to assess dataset quality. The mass spectrometry proteo-mics data have been deposited to the ProteomeXchange Constortium (http://proteomecentral. proteomexchange.org) via the PRIDE partner repository (Guo J, Longshore S, Nair R, Warner B W. Retinoblastoma protein (pRb), but not p107 or p130, is required for maintenance of enterocyte quiescence and differentiation in small intestine. J Biol Chem. 2009; 284:134-40) with the dataset identifier PXD003326 and 10.6019/PXD003326.
Hela cells (obtained from American Tissue Culture Collection) were cultured in Minimum Essential Media (MEM) complemented with 10% Fetal Bovine Serum (FBS), 100 units/ml penicillin, and 100 μg/ml streptomycin. For western blotting assay, cells grown in 6-well plate were kept in serum free MEM media for 24 hours. Cells were then either kept in serum free medium (control) or stimulated with soymilk alone, soy EGF or commercial recombined human EGF for different time period as indicated. Cells were lysed by directly adding 1×SDS sample buffer (50 mM Tris-HCl, pH 6.8, 10% glycerol, 2% SDS and 5% β-ME) to the cells after washing 3 times with 1×PBS. EGF bio-activity was determined via EGFR phosphorylation and down-stream AKT phosphorylation. Total EGFR was also measured since EGFR is known to undergo internalization when stimulated with EGF. Antibodies used in western blot are anti-p-EGFR (Tyr1068) (#2234, Cell Signaling Technology), anti-total EGFR (#06-847, Millipore), anti-p-AKT (#4060, Cell Signaling Technology) and anti-Lamin B1 (#13435, Cell Signaling Technology) [40]. For immunocytochemistry assay, cells were grown on coverslip in 6-well plate and kept in serum free media for 24 hours before stimulation, cells were then either kept in serum free media (control) or stimulated with human or soy EGF for 6 hours. Cells were washed with PBS and fixed with 4% formalin. EGFR was labeled using anti-EGFR antibody (#4267, Cell Signaling Technology) and detected with Alexa Fluor 594 Goat anti-rabbit IgG (# A11012, Life Technology). The cell nuclei were shown using mounting medium with DAPI (# H-1200, Vectorshield).
Various modifications of the invention, in addition to those described herein, will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. Each reference cited in the present application is incorporated herein by reference in its entirety.
Although there has been shown and described the preferred embodiment of the present invention, it will be readily apparent to those skilled in the art that modifications may be made thereto which do not exceed the scope of the appended claims. Therefore, the scope of the invention is only to be limited by the following claims. Reference numbers recited in the claims are exemplary and only for ease of review by the patent office and are not limiting in any way. In some embodiments, the figures presented in this patent application are drawn to scale, including the angles, ratios of dimensions, etc. In some embodiments, the figures are representative only and the claims are not limited by the dimensions of the figures. In some embodiments, descriptions of the inventions described herein using the phrase “comprising” includes embodiments that could be described as “consisting of”, and as such the written description requirement for claiming one or more embodiments of the present invention using the phrase “consisting of” is met.
The reference numbers recited in the below claims are solely for ease of examination of this patent application, and are exemplary, and are not intended in any way to limit the scope of the claims to the particular features having the corresponding reference numbers in the drawings.
This application claims priority to U.S. Provisional Patent Application No. 62/521,161 filed Jun. 16, 2017, the specification(s) of which is/are incorporated herein in their entirety by reference.
This invention was made with government support under Grant No. R21 DK094065 awarded by NIH. The government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US18/38096 | 6/18/2018 | WO | 00 |
| Number | Date | Country | |
|---|---|---|---|
| 62521161 | Jun 2017 | US |
