METHODS, USES & COMPOSITIONS

Information

  • Patent Application
  • 20220162270
  • Publication Number
    20220162270
  • Date Filed
    January 27, 2020
    6 years ago
  • Date Published
    May 26, 2022
    4 years ago
Abstract
The invention relates to the production of transduction particles, such as phage, as well as compositions comprising the particles and use of these. The particles are particularly useful for delivering toxic payloads into target bacteria for antibacterial action. The invention is also useful for the production of wild-type (“native”) phage and phage cocktails comprising different types of phage. Embodiments enable production of compositions of such particles for use in medical, environmental or food production settings.
Description
TECHNICAL FIELD

The invention relates to the production of transduction particles, such as phage, as well as compositions comprising the particles and use of these. The particles are particularly useful for delivering toxic payloads into target bacteria for antibacterial action. The invention is also useful for the production of wild-type (“native”) phage and phage cocktails comprising different types of phage. Embodiments enable production of compositions of such particles for use in medical, environmental or food production settings.


BACKGROUND

The use of helper phage to package phagemid DNA into phage virus particles is known. An example is the M13KO7 helper phage, a derivative of M13, used in E coli host cells. Other examples are R408 and CM13.


Bacteriophages (phages) are a phylum of viruses that infect bacteria and are distinct from the animal and plant viruses. Phages can have either a “lytic” life cycle, a “lysogenic” life cycle that can potentially become lytic, or a “non-lytic” life cycle. Phages replicating through the lytic cycle cause lysis of the host target bacterial cell as a normal part of their life cycles. Phages replicating through the lysogenic cycles are called temperate phages. These can either replicate by means of the lytic life cycle and cause lysis of the host bacterium, or they can incorporate their DNA into the host bacterial DNA and become noninfectious prophages. Bacteriophages are bacterial viruses that only infect and multiply within their specific bacterial hosts. Host specificity is generally found at strain level, species level, or, more rarely, at genus level. This specificity allows for directed targeting of dangerous bacteria using phages. The adsorption of bacteriophages onto host cells is, in all but a few rare cases, a sine qua non condition for the onset of the infection process.


The natural capability of phages to infect and kill bacteria, together with the specificity of the phage-bacterial interactions, is the basic phenomena on which the concept of phage therapy is built. Therefore, phages that possess lytic life cycle are suitable candidates for phage therapy. The use of phage in food production has recently become an option for the food industry as a novel method for biocontrol of unwanted pathogens, enhancing the safety of especially fresh and ready-to-eat food products.


PCT/EP2018/082053 and U.S. Ser. No. 15/985,658 disclose the production of non-replicative transduction particles. PCT/EP2018/071454 discloses methods of transduction particle propagation.


International Patent Application No. WO 00/69269 discloses the use of certain phage strain for treating infections caused by Vancomycin-sensitive as well as resistant strains of Enterococcus faecium, and International Patent Application No. WO 01/93904 discloses the use of bacteriophage, alone or in combination with other anti-microbial means, for preventing or treating gastrointestinal diseases associated with the species of the genus Clostridium.


US Patent Application No. 2001/0026795 describes methods for producing bacteriophage modified to delay inactivation by the host defense system, and thus increasing the time period in which the phage is active in killing the bacteria.


US Patent Application No. 2002/0001590 discloses the use of phage therapy against multi-drug resistant bacteria, specifically methicillin-resistant Staphylococcus aureus, and International Patent Application No. WO 02/07742 discloses the development of bacteriophage having multiple host range.


The use of phage therapy for the treatment of specific bacterial-infectious disease is disclosed, for example, in US Patent Application Nos. 2002/0044922; 2002/0058027 and International Patent Application No. WO 01/93904.


US20160333348 describes the use of CRISPR/Cas systems delivered to host target bacterial cells using phage as vectors.


The commercial scale production of bacteriophage compositions for therapeutic use is still limited.


In current techniques, the titer of the phage composition is low, usually in the range of 109-1011 pfu/ml on a laboratory scale, and 107-109 on a commercial scale, whereas the titer typically required for phage therapy is 1012 pfu/ml. Additionally, to reach the desirable titer, very large volumes of liquid are required.


As transduction particle (eg, bacteriophage) use in industrial and medical settings grows there is a need for commercial quantities of such particles. Therefore, there is a need for a method for production of transduction particles that provides good yield titer and/or reduces manufacturing volume.


SUMMARY OF THE INVENTION

The invention provides:—


In a First Configuration


A method of producing transduction particles wherein the particles are capable of recognising a receptor on bacterial target cells for transduction of the cells, the method comprising producing the particles in bacterial producer cells, wherein the producer cells do not express the receptor on their surface.


In a Second Configuration


Use of the producer cells, for enhancing the production yield of transduction particles.


In a Third Configuration


A composition (optionally a pharmaceutical composition) comprising transduction particles obtained or obtainable by the method or use of the invention.


In a Fourth Configuration


A method of killing bacterial target cells, the method comprising contacting the cells with a composition according to the invention, wherein transduction particles infect the cells and introduce therein a nucleic acid or nucleotide sequence of interest (NSI), wherein the NSI comprises or encodes an antibacterial agent that kills the target cells, or wherein the NSI comprises or encodes a component of such an agent.


In a Fifth Configuration


A composition according to the invention for use in a method of treating or preventing a disease or condition in a human or animal subject, wherein the disease or condition is mediated by bacterial target cells, the method comprising administering the composition to the subject and contacting the target cells with a composition, whereby target cells are killed or the growth or proliferation of target cells is inhibited, thereby treating or preventing the disease or condition.


In a Sixth Configuration


A plurality of transduction particles obtainable by the method.


“Transduction particles” may be phage or smaller than phage and are particles that are capable of transducing nucleic acid (eg, encoding an antibiotic or component thereof) into target cells. Examples of transduction particles are phage or particles comprising a phage capsid. In an example, each particle is a replication-defective phage particle. In an example, each particle is a particle produced from a genomic island (eg, a pathogenicity island such as a SaPI) or a modified version thereof.





BRIEF DESCRIPTION OF THE DRAWINGS


FIG. 1: The LPS core biosynthesis pathway of E. coli (www.ecocyc.org). Numbers indicate the sequence of synthesis. Genes involved in the pathway were individually knocked out and P2 phage propagation was tested on each mutant. Genes which are essential for P2 plaque formation are marked with a star.



FIG. 2: Transduction of E. coli C1a cells by the lysates prepared from wild type (WT) and from phage receptor mutant (ΔrfaD) cells. (A) The yield of production was assayed by transduction of the spectinomycin marker to C1a cells. Lysates were serially diluted and mixed with a constant number of recipient cells. (B) Transduction efficiencies, defined as the number of Spectinomycin resistant colonies obtained per 1 ml of lysate, were calculated from 6 independent lysates for both strains. Error bars show standard deviations from the means.





DETAILED DESCRIPTION

The invention relates to the production of transduction particles, such as phage, as well as compositions comprising the particles and use of these. The particles are particularly useful for delivering toxic payloads into target bacteria for antibacterial action. The invention is also useful for the production of wild-type (“native”) phage and phage cocktails comprising different types of phage. Embodiments enable production of compositions of such particles for use in medical, environmental or food production settings. Transduction particles, eg, phage, can be used in compositions, such as medicaments, herbicides and other agents where such particles may usefully be used. Thus, the invention provides the following Clauses and embodiments.


CLAUSES



  • 1. A method of producing transduction particles wherein the particles are capable of recognising a receptor on bacterial target cells for transduction of the cells, the method comprising producing the particles in bacterial producer cells, wherein the producer cells do not express the receptor on their surface.



The particles can be capable of attaching to the receptor when surface expressed on target cells. In an example, the particles attach to the receptor on target cells and transduce DNA into the target cells. In an embodiment, the DNA comprises a NSI. In an example, the particles are phage-like or are phage. For example, the particles comprise a phage capsid in which the DNA is packaged.


In an example, the producer and target cells are bacterial cells. In another example, they are archaeal cells.


The producer cells are different from the target cells. At least, they differ in that the former do not (or substantially do not) surface express the receptor and the latter do.

  • 2. The method of Clause 1, wherein the producer and target cells are cell of the same species.


Optionally, the producer and target cells are cell of the same strain, with the exception that the target cells surface express the receptor.

  • 3. The method of any preceding Clause, wherein the producer cells are E coli cells.


In an example the cells are E coli Nissle or K-12 (eg, K-12 MG1655) cells.


In an example, each producer cell comprises a nucleic acid comprising a nucleic acid sequence of interest (NSI), a phage packaging sequence (eg, pac or cos or a homologue thereof) and an origin of replication. In an embodiment, nucleic acid is a phagemid of plasmid. The nucleic acid is packaged in the producer cell to produce the particles of the invention. In an embodiment, the producer cell comprises the genome of a helper virus or phage which is used to provide essential functions required for packaging and/or replicating the nucleic acid in the producer cell. The skilled person will be familiar with helper viruses and helper phage.


In an example, each producer cell comprises (i) a helper phage genome; and (ii) a nucleic acid comprising a nucleic acid sequence of interest (NSI), a phage packaging sequence (eg, pac or cos), an origin of replication and optionally one or more nucleotide sequences each encoding a helper phage transactivation factor for activating the helper phage. In an embodiment, component (i) is comprised by the nucleic acid (ii). In an embodiment, nucleic acid (ii) is a phagemid of plasmid.


In an embodiment, the NSI encodes a protein of interest (POI), eg, an enzyme, a nuclease, an antibiotic, an antigen binding site, a marker (eg, an antibiotic marker or fluorescence marker) or a medicament or component thereof.

  • 4. The method of any preceding Clause, wherein the transduction particles comprise a phage capsid, wherein the capsid comprises a packaged nucleic acid of interest (NSI) for transduction into target bacterial cells.


In an example, the NSI is comprised by a phagemid. In an example, the NSI is comprised by a plasmid.

  • 5. The method of Clause 4, wherein the NSI comprises or encodes an antibacterial agent that kills target cells, or wherein the NSI comprises or encodes a component of such an agent.
  • 6. The method of Clause 5, wherein the NSI comprises a nucleotide sequence encoding a guide RNA (optionally a single guide RNA) of a CRISPR/Cas system.


Optionally, the guide comprises a spacer sequence that is capable of hybridising to a protospacer sequence comprised by target cells. In one embodiment, the target cells comprise endogenously active Cas (eg, Cas 3 or Cas9) that is operable with the guide RNA in the target cells to guide the Cas to the cognate protospacer sequence for modification (eg, cutting) of the sequence, and optionally killing of the target cell. In another embodiment, the Cas is instead or additionally encoded by DNA transduced into the target cell by the particle of the invention.

  • 7. The method of any preceding Clause, wherein the transduction particles are phages.
  • 8. The method of any preceding Clause, wherein the transduction particles are non-self-replicative.
  • 9. The method of any preceding Clause, wherein the genome of each producer cell comprises a genetic modification that disrupts synthesis of the receptor and/or its expression as a cell surface receptor.


In an example, each producer cell is a rfa mutant, eg, wherein the producer cell is an E coli cell. In an embodiment, the rfa is rfaC. In an embodiment, the rfa is rfaD. In an embodiment, the rfa is rfaF. In an embodiment, the rfa is rfaG. In an embodiment, the rfa is rfaI. In an embodiment, the rfa is rfa J. See FIG. 1, for example.


Optionally there is a disruption of a rfa gene in the genome (eg, chromosome) of the producer cell, eg, rfaC, rfaD, rfaE, rfaF, rfaG, rfaP, rfaQ, rfaY, rfaB, rfaI or rfaJ. Optionally, the disruption is a disruption (eg, deletion) of rfaD and/or rfaE. Optionally, the producer cell here is an E coli cell. The disruption may be a knock-out of the gene, insertion of a heterologous nucleotide sequence in the gene, one or mutations (eg, deletions, substitutions or additions, or any combination in the gene) that renders the gene non-functional for production of the receptor, a component of the receptor, or a gene product that is essential for receptor production in the producer cell. Standard molecular biology techniques for effecting this will be apparent to the skilled person.

  • 10. The method of Clause 9, wherein the modification is a modification of a lipopolysaccharide (LPS) synthesis pathway.
  • 11. The method of any preceding Clause, wherein the receptor comprises a LPS.


In an example, the receptor is any receptor mentioned in Tables 1-3 or otherwise mentioned herein. In an example, the particles comprise P2 phage capsids and the receptor is a P2 receptor.

  • 12. Use of producer cells as defined in any preceding Clause, for enhancing the production yield of transduction particles.
  • 13. The use of Clause 12, wherein the transduction particles are as defined in any one of Clauses 1 to 11.
  • 14. The use of Clause 12 or 13, for increasing the yield at least 10-fold compared to production in producer cells that surface express the receptor.
  • 15. The use of Clause 14, wherein the increase is at least 100-fold.
  • 16. The use of Clause 14, wherein the increase is 10-1000-fold.
  • 17. The method or use of any preceding Clause, comprising isolating the transduction particles from cellular material.
  • 18. A composition (optionally a pharmaceutical composition) comprising transduction particles obtained or obtainable by the method or use of Clause 17.


Optionally the composition comprises an antibiotic that kills or is toxic to the target cells.

  • 19. The composition according to Clause 18, wherein the composition comprises no producer cell LPS.
  • 20. A method of killing bacterial target cells, the method comprising contacting the cells with a composition according to Clause 18 or 19, wherein transduction particles infect the cells and introduce therein a NSI, wherein the NSI comprises or encodes an antibacterial agent that kills the target cells, or wherein the NSI comprises or encodes a component of such an agent.


Optionally, any method or use of the composition, population or particles of the invention is a method or use in vitro or ex vivo. Optionally, the method or use is not performed in or on a human or animal. Optionally, the method or use is performed in or on a human or animal tissue, cell or serum sample in vitro.

  • 21. A composition according to Clause 18 or 19 for use in a method of treating or preventing a disease or condition in a human or animal subject, wherein the disease or condition is mediated by bacterial target cells, the method comprising administering the composition to the subject and contacting the target cells with a composition according to Clause 18 or 19, whereby target cells are killed or the growth or proliferation of target cells is inhibited, thereby treating or preventing the disease or condition.
  • 22. The composition of Clause 21, wherein transduction particles comprised by the composition infect the target cells and introduce therein a NSI, wherein the NSI comprises or encodes an antibacterial agent that kills the target cells, or wherein the NSI comprises or encodes a component of such an agent
  • 23. The composition of Clause 21 or 22, wherein the target cells are Escherichia, Klebsiella, Clostridium or Pseudomonas cells.
  • 24. The composition of Clause 21 or 22, wherein the target cells are E. coli, K pneumoniae, C. dificile or P. aeruginosa cells.


Examples of receptors for use in the present invention are discussed below.


Proteinaceous receptors are mainly outer membrane proteins; sugar moieties include those that compose the cell wall, pellicles, teichoic and LTA. The receptor of the invention is, for, example selected from any of these.


Bacteriophage adsorption initiates the infection process. Through a series of interactions between binding proteins of the bacteriophage (phage) and receptors on the bacterial cell surface, the virus recognizes a potentially sensitive host and then positions itself for DNA ejection. Phage adsorption is thus not only a crucial step in the infection process, but also represents the initial point of contact between virus and host and dictates host range specificity.


Bacteriophage adsorption generally consists of three steps: initial contact, reversible binding and irreversible attachment (Duckworth 1987). The first step involves random collisions between phage and host caused by Brownian motion, dispersion, diffusion or flow (Kokjohn and Miller 1992). In the reversible step, binding to bacterial surface components is not definitive and the phage can desorb from the host. This process, firstly identified by Garen and Puck (1951) through experimental observations of phage detachment after elution, may serve to keep the phage close to the cell surface as it searches for a specific receptor (Kokjohn and Miller 1992). The specific connection between bacterial receptor and phage-binding domains is sometimes mediated by an enzymatic cleavage. This step triggers conformational rearrangements in other phage molecules that allow the insertion of the genetic material into the host (for further details on the mechanism of phage genome ejection, see the review by Molineux and Panja (2013)).


Numerous review studies have highlighted the extensive range of host-associated receptors (proteins, sugars and cell surface structures) that bacteriophages target during adsorption (Lindberg 1977; Schwartz 1980; Wright, McConnell and Kanegasaki 1980; Heller 1992; Frost 1993; Henning and Hashemolhosseini 1994; Vinga et al. 2006; Rakhuba et al. 2010; Chaturongakul and Ounjai 2014). The nature and location of the host cell receptors recognised by bacteriophages varies greatly depending on the phage and host. They range from peptide sequences to polysaccharide moieties. In fact, bacteriophages have been shown to bind to receptors located in the walls of both Gram-positive (Xia et al. 2011) and Gram-negative bacteria (Marti et al. 2013), in bacterial capsules or slime layers (Fehmel et al. 1975), and in appendages [e.g. pili (Guerrero-Ferreira et al. 2011) and flagella (Shin et al. 2012)]. This diversity in receptors and structures involved is a testament to the multiplicity of mechanisms developed by phages and hosts to overcome the evolutionary strategies adopted by their counterparts. It is not unexpected to encounter so many possibilities considering the diversity and staggering amount of phages estimated to populate the different environments of the planet (Clokie et al. 2011). Nevertheless, in all cases, adsorption has so far been shown to involve either constituents of the bacterial cell wall or protruding structures. In an embodiment, therefore, a receptor in the present invention can be any such receptor mentioned in this paragraph or elsewhere in this disclosure.


Optionally, the receptor comprises lipopolysaccharide (LPS), a heptose moiety, the host's glucosylated cell wall teichoic acid (WTA), YueB, or a receptor recognized by a tail fiber protein of the phage or gp21 of the phage.


Receptors in the Cell Wall of Gram-Positive Bacteria

Peptidoglycan, or murein, is an important component of the bacterial cell wall and is often involved in bacteriophage adsorption. It is a polymer composed of multiple units of amino acids and sugar derivatives—N-acetylglucosamine and N-acetylmuramic acid. These sugar constituents are connected through glycosidic bonds, forming glycan tetrapeptide sheets that are joined together through the cross-linking of amino acids. The cross-linking occurs through peptide bonds between diaminopimelic acid (an amino acid analog) and D-alanine, or through short peptide interbridges. These interbridges are more numerous in Gram-positive bacteria, leading to their characteristically thicker cell walls.


Another main component of the cell wall of Gram-positive bacteria that can be involved in phage adsorption is teichoic acid-polysaccharides composed of glycerol phosphate or ribitol phosphate and amino acids. They are bonded to the muramic acid of peptidoglycans. When teichoic acids are bonded to the lipids of the plasma membrane, they are called lipoteichoic acids (LTA). Further details of the composition of cell walls of bacteria can be found in Tortora, Funke and Case (2007), Willey, Sherwood and Woolverton (2008), Pommerville (2010) and Madigan et al. (2012).


The majority of the receptors so far identified are associated either with peptidoglycan or teichoic acid structures (Table 1). Out of 30 phages targeting Gram-positive bacteria reported in Table 1, only 10 utilize other structures for adsorption. Among these 10 phages, 9 display interactions with residues of either teichoic acid (phage SPP1) or peptidoglycan (phages 5, 13, c2, h, m13, kh, L and p2) for reversible binding. This highlights the important role these structures may play in the adsorption of phage to Gram-positive bacteria.


Optionally, the receptor of the invention is peptidoglycan, murein, teichoic acid or lipoteichoic acid (LTA). Optionally, each transduction particle of the invention is a first phage or comprises a capsid of a first phage, wherein the first phage is a phage of a family listed in Table 1 (and optionally the producer and/or target cell is the host for the phage as listed in Table 1 and/or the receptor is the receptor for the phage as listed in Table 1). In an embodiment, the producer and target cells are gram-positive cells. Optionally the producer and/or target cells are of a species or strain listed in Table 1 (where the producer and target cell species are different or the same). Preferably when the producer cell is a gram-positive bacteria, the receptor is a peptidoglycan. Alternatively, when the producer cell is a gram-positive bacteria, the receptor is a teichoic acid.


Receptors in the Cell Wall of Gram-Negative Bacteria

In Gram-negative bacteria, the peptidoglycan layer is relatively thin and is located inward of the outer membrane, the major component of the cell wall. These two layers are connected by Braun's lipoproteins. The outer membrane is a sophisticated structure composed of a lipid bilayer ornamented with proteins, polysaccharides and lipids; the latter two molecules form the LPS layer. LPSs are complexes that consist of three parts: lipid A, the core polysaccharide and the O-polysaccharide. Lipid A is, in general, composed of fatty acids attached to glucosamine phosphate disaccharides. The core polysaccharide is connected to the lipid A through a ketodeoxyoctonate linker. The core polysaccharide and the O-polysaccharide (O-chain or O-antigen) contain several units of sugar residues extending outward to the outer membrane. Cells that contain all three components of the LPS are denominated as smooth (S) type and those that lack the O-polysaccharide portion are distinguished as rough (R) type. In general, the saccharides composing the O-antigen are highly variable and those of the core polysaccharide are more conserved among species. Because of this, phages specific to only S-type strains tend to target the O-polysaccharide and, thus, have generally a narrower host range when compared to those able to adsorb to R-type cells (Rakhuba et al. 2010).


Table 2(a) compiles Gram-negative bacterial receptors located in the cell wall that interact with phage receptor-binding proteins (RBPs). Interestingly, in coliphages there is no preference for proteinaceous or polysaccharide receptors: some phages adsorb on cell wall proteins, some on sugar moieties and others require both structures for adsorption. In the case of Salmonella phages, the picture is not so different: some use proteins, some sugar moieties and some both types of receptors. On the other hand, Pseudomonas phages commonly adsorb onto polysaccharide receptors. Although definitive conclusions cannot be drawn from such a small sample size, it should be noted that Pseudomonas can have two LPS moieties, a short chain LPS named A band and a longer B-band LPS (Beveridge and Graham 1991).


Optionally, the receptor of the invention is a host cell wall protein. Optionally, the receptor is a saccharide. Optionally, the receptor comprises O-antigen, LPS lipid A or LPS core polysaccharide. In an example, the receptor is smooth LPS or rough LPS. Optionally, the host cells are S-type bacteria and the receptor comprises O-antigen of the host. Optionally, the host cells are R-type bacteria and the receptor comprises LPS lipid A of the host.


Optionally, the receptor is a host cell wall protein. Optionally, the receptor is a saccharide. Optionally, the receptor comprises O-antigen, LPS lipid A or LPS core polysaccharide. In an example, the receptor is smooth LPS or rough LPS. Optionally, the host cells are S-type bacteria and the receptor comprises O-antigen of the host. Optionally, the host cells are R-type bacteria and the receptor comprises LPS lipid A of the host.


In an example, the host is E coli and the transduction particles are coliphage (or comprise coliphage capsids), wherein the receptor is a polysaccharide receptor and/or a host cell wall protein receptor. In an example, the producer cells are engineered not to express E coli polysaccharide receptor and/or an E coli cell wall protein receptor.


In an example, the host is Salmonella, wherein the receptor is a polysaccharide receptor and/or a host cell wall protein receptor. In an example, the producer cells are engineered not to express Salmonella polysaccharide receptor and/or a Salmonella cell wall protein receptor.


In an example, the host is Klebsiella, wherein the receptor is a polysaccharide receptor and/or a host cell wall protein receptor. In an example, the producer cells are engineered not to express Klebsiella polysaccharide receptor and/or a Klebsiella cell wall protein receptor.


In an example, the host is Pseudomonas, wherein the receptor is a polysaccharide receptor. In an example, the second cells are engineered not to express Pseudomonas polysaccharide receptor.


Optionally, each transduction particle of the invention is a first phage or comprises a capsid of a first phage, wherein the first phage is a phage of a family listed in Table 2 (and optionally the producer cell is the host for the phage as listed in Table 2 and/or the receptor is the receptor for the phage as listed in Table 2).


In an embodiment, the producer and target cells are gram-negative cells. Preferably, the producer cells are E coli cells. Optionally the producer and/or target cells are of a species or strain listed in Table 2 (eg, where the cell species are different or the same).


Table 2(b) reports cases where phages not only adsorb onto bacterial surfaces but also enzymatically degrade the sugar moieties in the O-chain structure. It should be noted that all these phages belong to the Podoviridae family.


Receptors in Other Structures of Gram-Negative Bacteria

In this section, bacterial structures, other than cell wall moieties, that also serve as receptors for particles or phages are discussed. These include structures such as flagella, pili and capsules. They can be found in species from both Gram stains. See Table 3 for examples.


Optionally, the receptor of the invention is a flagellum, pilus or capsule component (eg, a component listed in Table 3 in the listed species or as found in a host that is of a different species to that listed). Optionally, the phage is a phage of a family listed in Table 3 (and optionally the host is the host for the phage as listed in Table 3 and/or the receptor is the receptor for the phage as listed in Table 3). Optionally, the phage is a phage listed in Table 3 (and optionally the host is the host for the phage as listed in Table 3 and/or the receptor is the receptor for the phage as listed in Table 3).


Flagella are long thin helical structures that confer motility to cells. They are composed of a basal body, a flagellar hook and a flagellar filament composed of subunits of flagellin proteins (Willey, Sherwood and Woolverton 2008). Table 3(a) reports phages attaching to flagellal proteins. The adhesion of phages to the filament structure is generally reversible and the flagellum's helical movement causes the phage to move along its surface until they reach the bacterial wall. Irreversible adsorption occurs, then, on receptors located on the surface of the bacterium, near the base of the flagellum (Schade, Adler and Ris 1967; Lindberg 1973; Guerrero-Ferreira et al. 2011). Interestingly, some phages (ϕCbK and ϕCb13) were observed to contain filaments protruding from their capsids that are responsible for reversible binding onto the host's flagellum; irreversible adsorption occurs only when the phage's tails interact with pili portals on the cell pole (Guerrero-Ferreira et al. 2011). Because for these phages irreversible adsorption occurs on the pilus, even if they interact with the flagellum, they were reported in Table 3(b), which focuses on phages interacting with receptors in pili and mating pair formation structures.


Pili are rod-shaped filamentous appendages used for bacterial conjugation (Lindberg 1973). They extend from the donor cell and attach to receptors on the wall of the recipient cell. A depolymerization of the pilus causes its retraction, bringing both cells closer to each other. Further adhesion of the cells is achieved through binding proteins on their surfaces; genetic material is transferred through this conjugating junction (Madigan et al. 2012). Adsorption to the pilus structure has been so far associated with phages that belong to orders different from Caudovirales (Table 3b). In fact, according to Frost (1993), the families Cystoviridae and Inoviridae compose the majority of phages that adsorb onto pili structures. Interestingly, phages can be selective towards certain parts of the pili. That is the case for F-type phages, whose adsorption occur only on the tip of the pilus (Click and Webster 1998). In other phages, such as 46, the attachment happens at the sides (shaft) of the structure (Daugelavicius et al. 2005).


Capsules are flexible cementing substances that extend radially from the cell wall. They act as binding agents between bacteria and/or between cells and substrates (Beveridge and Graham 1991). Slime layers are similar to capsules, but are more easily deformed. Both are made of sticky substances released by bacteria, and their common components are polysaccharides or proteins (Madigan et al. 2012). Adsorption of phages to capsules or slime layers is mediated by enzymatic cleavage of the exopolysaccharides that compose the layers. The hydrolysis of the layer is a reversible step, whereas irreversible binding is achieved through bonding of the phage with receptors on the cell wall (Rakhuba et al. 2010). As can be seen in Table 3(c), the few phages identified to have RBP recognizing exopolysaccharides are mostly of Podoviridae morphology.


In an example, the producer cell is a Salmonella (eg, S enterica Serovar Typhimurium) cell and the receptor is selected from flagella, vitamin B12 uptake outer membrane protein, BtuB and lipopolysaccharide-related O-antigen. In an example the receptor is a flagellum or BtuB and the first phage are Siphoviridae phage. In an example the receptor is O-antigen of LPS and the first phage are Podoviridae phage. Optionally, the receptor is FliC host receptor or FUjB receptor.


Optionally, the producer cell is a S enterica or P aeruginosa cell. Optionally, the receptor is the receptor of the host as listed in Table 4.


The O-antigen structure of Salmonella O66 has been established, which reportedly differs from the known O-antigen structure of Escherichia coli O166 only in one linkage (most likely the linkage between the O-units) and O-acetylation. The O-antigen gene clusters of Salmonella O66 and E. coli O166 were found to have similar organizations, the only exception being that in Salmonella O66, the wzy gene is replaced by a non-coding region. The function of the wzy gene in E. coli O166 was confirmed by the construction and analysis of deletion and trans-complementation mutants. It is proposed that a functional wzy gene located outside the O-antigen gene cluster is involved in Salmonella O66 O-antigen biosynthesis, as has been reported previously in Salmonella sero groups A, B and D1. The sequence identity for the corresponding genes between the O-antigen gene clusters of Salmonella O66 and E. coli O166 ranges from 64 to 70%, indicating that they may originate from a common ancestor. It is likely that after the species divergence, Salmonella O66 got its specific O-antigen form by inactivation of the wzy gene located in the O-antigen gene cluster and acquisition of two new genes (a wzy gene and a prophage gene for O-acetyl modification) both residing outside the O-antigen gene cluster.


In an example, the producer cells are E coli cells and do not comprise an expressible E coli (eg, Escherichia coli O166) wzy gene.


Optionally, the receptor is selected from lipopolysaccharides, teichoic acids (optionally a ManNAc(β1→4)GlcNAc disaccharide with one to three glycerol phosphates attached to the C4 hydroxyl of the ManNAc residue followed by a long chain of glycerol- or ribitol phosphate repeats), proteins and flagella.


Optionally, the receptor comprises an O-antigen of the producer cell species.


Optionally, the phage or particles of the invention are operable to express an endolysin or holin in the producer cells, optionally when phage or particles replicate in producer cells. This is useful for releasing the particles for subsequent purification away from cellular material to produce a composition of the invention.


In an embodiment, each particle is capable of infecting a target bacterium, the particle comprising a nucleotide sequence of interest (NSI) that is capable of expressing a protein or RNA in the target bacterium, or wherein the NSI comprises a regulatory element that is operable in the target bacterium. In an example, the NSI is capable of recombination with the target cell chromosome or an episome comprised by the target cell to modify the chromosome or episome. Optionally, this is carried out in a method wherein the chromosome or episome is cut (eg, at a predetermined site using a guided nuclease, such as a Cas, TALEN, zinc finger or meganuclease; or a restriction endonuclease) and simultaneously or sequentially the cell is infected by a particle that comprises first DNA comprising the NSI, wherein the DNA is introduced into the cell and the NSI or a sequence thereof is introduced into the chromosome or episome at or adjacent the cut site. In an example the first DNA comprises one or more components of a CRISPR/Cas system operable to perform the cutting (eg, comprising at least a nucleotide sequence encoding a guide RNA or crRNA for targeting the site to be cut) and further comprising the NSI.


In an embodiment, the presence in the target bacterium of the NSI or its encoded protein or RNA mediates target cell killing, or downregulation of growth or propagation of target cells, or mediates switching off of expression of one or more RNA or proteins encoded by the target cell genome, or downregulation thereof.


In an embodiment, the presence in the target bacterium of the NSI or its encoded protein or RNA mediates upregulation of growth or propagation of the target cell, or mediates switching on of expression of one or more RNA or proteins encoded by the target cell genome, or upregulation thereof.


In an embodiment, the NSI encodes a component of a CRISPR/Cas system that is toxic to the target bacterium.


In an embodiment, the first NSI is comprised by a vector (eg, a plasmid or shuttle vector).


An embodiment provides a method of treating an environment ex vivo, the method comprising exposing the environment to a population of transduction particles obtainable by the production method of the invention, wherein the environment comprises target bacteria and the particles (eg, phage or particles comprising a phage capsid) infect and kill the target bacteria. In an example an agent is further administered to the environment simultaneously or sequentially with the phage administration. In an example, the agent is an herbicide, pesticide, insecticide, plant fertilizer or cleaning agent.


A method of treating an infection of target bacteria in a human or animal subject is provided, the method comprising exposing the bacteria to a population of transduction particles obtainable by the production method, wherein the particles infect and kill the target bacteria.


Optionally, target bacteria herein are comprised by a microbiome of the subject, eg, a gut microbiome. Alternatively, the microbiome is a skin, scalp, hair, eye, ear, oral, throat, lung, blood, rectal, anal, vaginal, scrotal, penile, nasal or tongue microbiome.


In an example the subject is further administered a medicament simultaneously or sequentially with the transduction particle administration. In an example, the medicament is an antibiotic, antibody, immune checkpoint inhibitor (eg, an anti-PD-1, anti-PD-LI or anti-CTLA4 antibody), adoptive cell therapy (eg, CAR-T therapy) or a vaccine.


In an example, the invention employs helper phage for packaging the NSI. In an example, the helper phage are capable of packaging DNA comprising the NSI to produce first transduction particles, wherein the particles are different from the helper phage and the helper phage are incapable themselves of producing helper phage particles.


A composition is provided comprising a population of transduction particles of the invention, wherein the particles require helper phage according to the immediately preceding paragraph for replication of the transduction particles; and optionally wherein less than 20, 15, 10, 5, 4, 3, 2, 1, 0.5, 0.4, 0.2 or 0.1% of total transduction particles comprised by the composition are particles of such helper phage. In an example the composition comprises helper phage and less than 1% of total transduction particles comprised by the composition are particles of such helper phage. In an example the composition comprises helper phage and less than 0.5% of total transduction particles comprised by the composition are particles of such helper phage. In an example the composition comprises helper phage and less than 0.1% of total transduction particles comprised by the composition are particles of such helper phage. In an example the composition comprises helper phage and less than 0.01% of total transduction particles comprised by the composition are particles of such helper phage. In an example the composition comprises helper phage and less than 0.001% of total transduction particles comprised by the composition are particles of such helper phage. In an example the composition comprises helper phage and less than 0.0001% of total transduction particles comprised by the composition are particles of such helper phage. In an example the composition comprises helper phage and less than 0.00001% of total transduction particles comprised by the composition are particles of such helper phage. In an example the composition comprises helper phage and less than 0.000001% of total transduction particles comprised by the composition are particles of such helper phage.


In an example the composition comprises helper phage and less than 0.0000001% of total transduction particles comprised by the composition are particles of such helper phage. In an example the composition comprises helper phage and less than 0.00000001% of total transduction particles comprised by the composition are particles of such helper phage.


In an example, the composition or population comprises at least 103, 104, 105 or 106 transduction particles, as indicated a transduction assay, for example. In an example, the composition or population comprises at least 103 transduction particles and eg, no more than 1011 particles. In an example, the composition or population comprises at least 104 transduction particles and eg, no more than 1014 particles. In an example, the composition or population comprises at least 105 transduction particles and eg, no more than 1014 particles. In an example, the population comprises at least 106 transduction particles and eg, no more than 1014 particles. To have a measure of the particle concentration, for example, one can perform a standard transduction assay when the genome of the particles of the invention contains an antibiotic marker. Thus, in this case the particles of the invention are capable of infecting target bacteria and in a sample of 1 ml the composition of population comprises at least 103, 104, 105 or 106 transduction particles, which can be determined by infecting susceptible bacteria at a multiplicity of infection <0.1 and determining the number of infected cells by plating on a selective agar plate corresponding to the antibiotic marker in vitro at 20 to 37 degrees centigrade, eg, at 20 or 37 degrees centrigrade.


Optionally at least 99.9, 99.8, 99.7, 99.6, 99.5, 99.4, 99.3, 99.2, 99.1, 90, 85, 80, 70, 60, 50 or 40% of total transduction particles comprised by the composition are particles of particles of the invention.


In an example, genome of the particles of the invention comprises an f1 origin of replication.


In an example, the helper phage are E coli phage. In an example, the particles of the invention are E coli, C dificile, Streptococcus, Klebsiella, Pseudomonas, Acitenobacter, Enterobacteracea, Firmicutes or Bacteroidetes phage or comprise a capsid of such a genus, wherein the capsid packages a NSI. In an example, the helper phage are engineered M13 phage.


In an example, the genome of the particles of the invention comprises a phagemid, wherein the phagemid comprises a packaging signal for packaging the particles in the presence of the helper phage.


The particles of the invention may contain DNA comprising a nucleotide sequence of interest (NSI), eg, as defined herein, such as a NSI that encodes a component of a CRISPR/Cas system operable in target bacteria that can be infected by the particles. Once inside the target bacteria, optionally the particle DNA is incapable of being packaged to form transduction particles in the absence of the helper phage. This usefully contains the activity of the genome of the particles of the invention and its encoded products (proteins and/or nucleic acid), as well as limits or controls dosing of the NSI and its encoded products in an environment comprising the target bacteria that have been exposed to the particles of the invention. This is useful, for example to control the medical treatment of an environment comprised by a human or animal subject, plant or other environment (eg, soil or a foodstiff or food ingredient).


In an embodiment, each particle of the invention comprises one or more phage structural proteins and/or comprises a phage capsid. Examples of phage structural proteins are phage coat proteins, collar proteins and phage tail fibre proteins. In an example, the particle comprises a capsid and tail fibre proteins of first type of phage. For example, the phage type is an E coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Clostridium dificile, Helicobacter pylori, Staphylococcus aureus, Salmonella (eg, typhimurium) or Campylobacter phage.


Optionally, at least 95% (eg, 100%) of transduction particles comprised by the composition are particles of the invention.


In another embodiment, the composition comprises second transduction (eg, phage) particles, wherein the second particles are different from the first particles of the invention (ie, the particles recited in claim 1).


Optionally, the composition population comprises at least 103, 104, 105 or 106 phage particles, as indicated in a transduction assay.


Optionally, each particle of the invention comprises a vector for the NSA, wherein the vectors are plasmids or phagemids. For example, the vectors are shuttle vectors (eg, pUC vectors) that can be replicated in host bacteria.


Optionally, the genome of each particle of the invention comprises a packaging signal, such as a pac or cos sequence or homologue thereof.


Optionally, the transduction particles of the invention are temperate phage. Optionally, the transduction particles of the invention are lytic phage.


Optionally, the particles of the invention are capable of infecting target bacteria, the particles comprising a nucleotide sequence of interest (NSI) that is capable of expressing a protein or RNA (eg, gRNA or crRNA) in target bacteria, or wherein the NSI comprises a regulatory element that is operable in target bacteria.


Optionally, the presence in target bacteria of the NSI or its encoded protein or RNA mediates target cell killing, or downregulation of growth or propagation of target cells, or mediates switching off of expression of one or more RNA or proteins encoded by the target cell genomes, or downregulation thereof.


Optionally, the presence in target bacteria of the NSI or its encoded protein or RNA mediates upregulation of growth or propagation of target cells, or mediates switching on of expression of one or more RNA or proteins encoded by the target cell genomes, or upregulation thereof.


Optionally, the particles of the invention are capable of infecting target bacteria and each particle comprises engineered antibacterial means for killing target bacteria. By use of the term “engineered” it will be readily apparent to the skilled addressee that the relevant means has been introduced and is not naturally-occurring in the phage or particle. For example, the means is recombinant, artificial or synthetic.


In an example, each particle of the invention comprises a genomic island DNA or pathogenicity island (eg, saPI) DNA, wherein optionally the DNA comprises the NSI or engineered antibacterial means for killing target bacteria (eg, the DNA encodes a nuclease, such as Cas nuclease (eg, Cas9 or Cas3), and/or a guide RNA for expression in a target bacterium).


Optionally, the antibacterial means comprises one or more components of a CRISPR/Cas system.


Optionally, the component(s) comprise (i) a DNA sequence encoding a guide RNA (eg, a single guide RNA) or comprising a CRISPR array for producing guide RNA, wherein the guide RNA is capable of targeting the genome of target bacteria; (ii) a Cas nuclease-encoding DNA sequence; and/or (iii) a DNA sequence encoding one or more components of Cascade. In an example, a Cas herein is a Cas9. In an example, a Cas herein is a Cas3. The Cas may be identical to a Cas encoded by the target bacteria.


Optionally, the antibacterial means comprises a nucleic acid encoding a guided nuclease, such as a Cas nuclease, TALEN, zinc finger nuclease or meganuclease.


Optionally, the composition, population or transduction particles is each for use in medicine practised on a human or animal subject, or the composition is a pharmaceutical composition for use in medicine practised on a human or animal subject. In an example, the animal is a livestock or companion pet animal (eg, a cow, pig, goat, sheep, horse, dog, cat or rabbit). In an example, the animal is an insect (an insect at any stage of its lifecycle, eg, egg, larva or pupa). In an example, the animal is a protozoan. In an example, the animal is a cephalopod.


Optionally, the composition is a herbicide, pesticide, food or beverage processing agent, food or beverage additive, petrochemical or fuel processing agent, water purifying agent, cosmetic additive, detergent additive or environmental (eg, soil) additive or cleaning agent.


The inability in some embodiments of the particles of the invention to self-replicate and to require helper phage to do this usefully provides containment in the location (eg, gut) of action of the composition and/or in the environment of the subject, eg, when exposed to secretions such as urine and faeces of the subject that otherwise may contain replicated first phage. Inability of the helper phage in some embodiments to self-package limits availability of factors required by the particles to form packaged particles, hence providing containment by limiting propagation of the particles of the invention. This may be useful, for example, to contain an antibacterial activity provided by the particles, such as a CRISPR/Cas killing principle.


In an example, when the subject is a human, the subject is not an embryo.


Optionally, the environment is a microbiome of soil; a plant, part of a part (e.g., a leaf, fruit, vegetable or flower) or plant product (e.g., pulp); water; a waterway; a fluid; a foodstuff or ingredient thereof; a beverage or ingredient thereof; a medical device; a cosmetic; a detergent; blood; a bodily fluid; a medical apparatus; an industrial apparatus; an oil rig; a petrochemical processing, storage or transport apparatus; a vehicle or a container. In an example, the environment is an ex vivo bodily fluid (e.g., urine, blood, blood product, sweat, tears, sputum or spit), bodily solid (e.g., faeces) or tissue of a human or animal subject that has been administered the composition.


Optionally, the antibacterial means comprises one or more components of a CRISPR/Cas system.


For example, the component(s) comprise (i) a DNA sequence encoding a guide RNA (eg, a single guide RNA) or comprising a CRISPR array for producing guide RNA, wherein the guide RNA is capable of targeting the genome of target bacteria; (ii) a Cas (eg, Cas9, Cas3, Cpf1, CasX or CasY) nuclease-encoding DNA sequence; and/or (iii) a DNA sequence encoding one or more components of Cascade (eg, CasA).


Optionally, the antibacterial means comprises a nucleic acid encoding a guided nuclease, such as a Cas nuclease, TALEN, zinc finger nuclease or meganuclease.


In an example, the particles, population or composition of the invention is comprised by a medical container, eg, a syringe, vial, IV bag, inhaler, eye dropper or nebulizer. In an example, the particles, population or composition of the invention is comprised by a sterile container. In an example, the particles, population or composition of the invention is comprised by a medically-compatible container. In an example, the particles, population or composition of the invention is comprised by a fermentation vessel, eg, a metal, glass or plastic vessel.


In an example, the particles, population or composition of the invention is comprised by a medicament, e,g in combination with instructions or a packaging label with directions to administer the medicament by oral, IV, subcutaneous, intranasal, intraocular, vaginal, topical, rectal or inhaled administration to a human or animal subject. In an example, the particles, population or composition of the invention is comprised by an oral medicament formulation. In an example, the particles, population or composition of the invention is comprised by an intranasal or ocular medicament formulation. In an example, the particles, population or composition of the invention is comprised by a personal hygiene composition (eg, shampoo, soap or deodorant) or cosmetic formulation. In an example, the particles, population or composition of the invention is comprised by a detergent formulation. In an example, the particles, population or composition of the invention is comprised by a cleaning formulation, eg, for cleaning a medical or industrial device or apparatus. In an example, the particles, population or composition of the invention is comprised by foodstuff, foodstuff ingredient or foodstuff processing agent. In an example, the particles, population or composition of the invention is comprised by beverage, beverage ingredient or beverage processing agent. In an example, the particles, population or composition of the invention is comprised by a medical bandage, fabric, plaster or swab. In an example, the particles, population or composition of the invention is comprised by an herbicide or pesticide. In an example, the particles, population or composition of the invention is comprised by an insecticide.


In an example, each particle is a first phage particle or comprises a capsid of a first phage (and optionally also tail fibres of the first phage), wherein the first phage is a is a Corticoviridae, Cystoviridae, Inoviridae, Leviviridae, Microviridae, Myoviridae, Podoviridae, Siphoviridae, or Tectiviridae virus. In an example, the helper phage is a is a Corticoviridae, Cystoviridae, Inoviridae, Leviviridae, Microviridae, Myoviridae, Podoviridae, Siphoviridae, or Tectiviridae virus. In an example, the helper phage is a filamentous M13, a Noviridae, a tailed phage (eg, a Myoviridae, Siphoviridae or Podoviridae), or a non-tailed phage (eg, a Tectiviridae).


In an example, both the first phage are Corticoviridae. In an example, the first phage are Cystoviridae. In an example, the first phage are Inoviridae. In an example, the first phage are Leviviridae.


In an example, the first phage are Microviridae. In an example, the first phage are Podoviridae. In an example, the first phage are Siphoviridae. In an example, the first phage are Tectiviridae.


In an example, the CRISPR/Cas component(s) are component(s) of a Type I CRISPR/Cas system. In an example, the CRISPR/Cas component(s) are component(s) of a Type II CRISPR/Cas system. In an example, the CRISPR/Cas component(s) are component(s) of a Type III CRISPR/Cas system. In an example, the CRISPR/Cas component(s) are component(s) of a Type IV CRISPR/Cas system. In an example, the CRISPR/Cas component(s) are component(s) of a Type V CRISPR/Cas system. In an example, the CRISPR/Cas component(s) comprise a Cas9-encoding nucleotide sequence (eg, Spyogenes Cas9, S aureus Cas9 or S thermophilus Cas9). In an example, the CRISPR/Cas component(s) comprise a Cas3-encoding nucleotide sequence (eg, E coli Cas3, C dificile Cas3 or Salmonella Cas3). In an example, the CRISPR/Cas component(s) comprise a Cpf-encoding nucleotide sequence. In an example, the CRISPR/Cas component(s) comprise a CasX-encoding nucleotide sequence. In an example, the CRISPR/Cas component(s) comprise a CasY-encoding nucleotide sequence.


In an example, the genomes of the particles encode a CRISPR/Cas component or protein of interest from a nucleotide sequence comprising a promoter that is operable in the target bacteria.


In an example, the host bacteria and/or target bacteria are E coli. In an example, the host bacteria and/or target bacteria are C difficile (eg, the vector is a shuttle vector operable in E coli and the host bacteria are C difficile). In an example, the host bacteria and/or target bacteria are Streptococcus, such as S thermophilus (eg, the vector is a shuttle vector operable in E coli and the host bacteria are Streptococcus). In an example, the host bacteria and/or target bacteria are Pseudomonas, such as P aeruginosa (eg, the vector is a shuttle vector operable in E coli and the host bacteria are P aeruginosa). In an example, the host bacteria and/or target bacteria are Klebsiella, such as K pneumoniae (eg, the vector is a shuttle vector operable in E coli and the host bacteria are Klebsiella). In an example, the host bacteria and/or target bacteria are Salmonella, eg, S typhimurium (eg, the vector is a shuttle vector operable in E coli and the host bacteria are Salmonella).


Optionally, each producer and/or target bacterium is a gram negative bacterium (eg, a spirilla or vibrio). Optionally, each producer and/or target bacterium is a gram positive bacterium. Optionally, each producer and/or target bacterium is a mycoplasma, chlamydiae, spirochete or mycobacterium. Optionally, each producer and/or target bacterium is a Streptococcus (eg, pyogenes or thermophilus). Optionally, each producer and/or target bacterium is a Staphylococcus (eg, aureus, eg, MRSA). Optionally, each producer and/or target bacterium is an E. coli (eg, O157: H7) host, eg, wherein the Cas is encoded by the vecor or an endogenous host Cas nuclease activity is de-repressed. Optionally, each producer and/or target bacterium is a Pseudomonas (eg, aeruginosa). Optionally, each producer and/or target bacterium is a Vibro (eg, cholerae (eg, O139) or vulnificus). Optionally, each producer and/or target bacterium is a Neisseria (eg, gonnorrhoeae or meningitidis). Optionally, each producer and/or target bacterium is a Bordetella (eg, pertussis). Optionally, each producer and/or target bacterium is a Haemophilus (eg, influenzae). Optionally, each producer and/or target bacterium is a Shigella (eg, dysenteriae). Optionally, each producer and/or target bacterium is a Brucella (eg, abortus). Optionally, each producer and/or target bacterium is a Francisella host. Optionally, each producer and/or target bacterium is a Xanthomonas host. Optionally, each producer and/or target bacterium is an Agrobacterium host. Optionally, each producer and/or target bacterium is an Erwinia host. Optionally, each producer and/or target bacterium is a Legionella (eg, pneumophila). Optionally, each producer and/or target bacterium is a Listeria (eg, monocytogenes). Optionally, each producer and/or target bacterium is a Campylobacter (eg, jejuni). Optionally, each producer and/or target bacterium is a Yersinia (eg, pestis). Optionally, each producer and/or target bacterium is a Borelia (eg, burgdorferi). Optionally, each producer and/or target bacterium is a Helicobacter (eg, pylon). Optionally, each producer and/or target bacterium is a Clostridium (eg, drjicile or botulinum). Optionally, each producer and/or target bacterium is a Erlichia (eg, chafeensis). Optionally, each producer and/or target bacterium is a Salmonella (eg, typhi or enterica, eg, serotype typhimurium, eg, DT 104). Optionally, each producer and/or target bacterium is a Chlamydia (eg, pneumoniae). Optionally, each producer and/or target bacterium is a Parachlamydia host. Optionally, each producer and/or target bacterium is a Corynebacterium (eg, amycolatum). Optionally, each producer and/or target bacterium is a Klebsiella (eg, pneumoniae). Optionally, each producer and/or target bacterium is an Enterococcus (eg, faecalis or faecim, eg, linezolid-resistant). Optionally, each producer and/or target bacterium is an Acinetobacter (eg, baumannii, eg, multiple drug resistant).


Further examples of target cells and targeting of antibiotic resistance in such cells using the present invention are as follows:—

  • 1. Optionally the target bacteria are Staphylococcus aureus cells, eg, resistant to an antibiotic selected from methicillin, vancomycin, linezolid, daptomycin, quinupristin, dalfopristin and teicoplanin.
  • 2. Optionally the target bacteria are Pseudomonas aeuroginosa cells, eg, resistant to an antibiotic selected from cephalosporins (eg, ceftazidime), carbapenems (eg, imipenem or meropenem), fluoroquinolones, aminoglycosides (eg, gentamicin or tobramycin) and colistin.
  • 3. Optionally the target bacteria are Klebsiella (eg, pneumoniae) cells, eg, resistant to carbapenem.
  • 4. Optionally the target bacteria are Streptoccocus (eg, thermophilus, pneumoniae or pyogenes) cells, eg, resistant to an antibiotic selected from erythromycin, clindamycin, beta-lactam, macrolide, amoxicillin, azithromycin and penicillin.
  • 5. Optionally the target bacteria are Salmonella (eg, serotype Typhi) cells, eg, resistant to an antibiotic selected from ceftriaxone, azithromycin and ciprofloxacin.
  • 6. Optionally the target bacteria are Shigella cells, eg, resistant to an antibiotic selected from ciprofloxacin and azithromycin.
  • 7. Optionally the target bacteria are Mycobacterium tuberculosis cells, eg, resistant to an antibiotic selected from Resistance to isoniazid (NH), rifampicin (RMP), fluoroquinolone, amikacin, kanamycin and capreomycin and azithromycin.
  • 8. Optionally the target bacteria are Enterococcus cells, eg, resistant to vancomycin.
  • 9. Optionally the target bacteria are Enterobacteriaceae cells, eg, resistant to an antibiotic selected from a cephalosporin and carbapenem.
  • 10. Optionally the target bacteria are E. coli cells, eg, resistant to an antibiotic selected from trimethoprim, itrofurantoin, cefalexin and amoxicillin.
  • 11. Optionally the target bacteria are Clostridium (eg, dificile) cells, eg, resistant to an antibiotic selected from fluoroquinolone antibiotic and carbapenem.
  • 12. Optionally the target bacteria are Neisseria gonnorrhoea cells, eg, resistant to an antibiotic selected from cefixime (eg, an oral cephalosporin), ceftriaxone (an injectable cephalosporin), azithromycin and tetracycline.
  • 13. Optionally the target bacteria are Acinetoebacter baumannii cells, eg, resistant to an antibiotic selected from beta-lactam, meropenem and a carbapenem.
  • 14. Optionally the target bacteria are Campylobacter cells, eg, resistant to an antibiotic selected from ciprofloxacin and azithromycin.
  • 15. Optionally, the target cell(s) produce Beta (β)-lactamase.
  • 16. Optionally, the target cell(s) are bacterial cells that are resistant to an antibiotic recited in any one of examples 1 to 14.


    Mobile Genetic Elements. Genomic Islands. Pathogenicity Islands Etc.


Genetic variation of bacteria and archaea can be achieved through mutations, rearrangements and horizontal gene transfers and recombinations. Increasing genome sequence data have demonstrated that, besides the core genes encoding house-keeping functions such as essential metabolic activities, information processing, and bacterial structural and regulatory components, a vast number of accessory genes encoding antimicrobial resistance, toxins, and enzymes that contribute to adaptation and survival under certain environmental conditions are acquired by horizontal gene transfer of mobile genetic elements (MGEs). Mobile genetic elements are a heterogeneous group of molecules that include plasmids, bacteriophages, genomic islands, chromosomal cassettes, pathogenicity islands, and integrative and conjugative elements. Genomic islands are relatively large segments of DNA ranging from 10 to 200 kb often integrated into tRNA gene clusters flanked by 16-20 bp direct repeats. They are recognized as discrete DNA segments acquired by horizontal gene transfer since they can differ from the rest of the chromosome in terms of GC content (% G+C) and codon usage.


Pathogenicity islands (PTIs) are a subset of horizontally transferred genetic elements known as genomic islands. There exists a particular family of highly mobile PTIs in Staphylococcus aureus that are induced to excise and replicate by certain resident prophages. These PTIs are packaged into small headed phage-like particles and are transferred at frequencies commensurate with the plaque-forming titer of the phage. This process is referred to as the SaPI excision replication-packaging (ERP) cycle, and the high-frequency SaPI transfer is referred to as SaPI-specific transfer (SPST) to distinguish it from classical generalized transduction (CGT). The SaPIs have a highly conserved genetic organization that parallels that of bacteriophages and clearly distinguishes them from all other horizontally acquired genomic islands. The SaPI1-encoded and SaPIbov2-encoded integrases are used for both excision and integration of the corresponding elements, and it is assumed that the same is true for the other SaPIs. Phage 80α can induce several different SaPIs, including SaPI11, SaPI2, and SaPlbov1, whereas φ11 can induce SaPlbov1 but neither of the other two SaPIs.


Reference is made to “Staphylococcal pathogenicity island DNA packaging system involving cos-site packaging and phage-encoded HNH endonucleases”, Quiles-Puchalt et al, PNAS Apr. 22, 2014. 111 (16) 6016-6021. Staphylococcal pathogenicity islands (SaPIs) are highly mobile and carry and disseminate superantigen and other virulence genes. It was reported that SaPIs hijack the packaging machinery of the phages they victimise, using two unrelated and complementary mechanisms. Phage packaging starts with the recognition in the phage DNA of a specific sequence, termed “pac” or “cos” depending on the phage type. The SaPI strategies involve carriage of the helper phage pac- or cos-like sequences in the SaPI genome, which ensures SaPI packaging in full-sized phage particles, depending on the helper phage machinery. These strategies interfere with phage reproduction, which ultimately is a critical advantage for the bacterial population by reducing the number of phage particles.


Staphylococcal pathogenicity islands (SaPIs) are the prototypical members of a widespread family of chromosomally located mobile genetic elements that contribute substantially to intra- and interspecies gene transfer, host adaptation, and virulence. The key feature of their mobility is the induction of SaPI excision and replication by certain helper phages and their efficient encapsidation into phage-like infectious particles. Most SaPIs use the headful packaging mechanism and encode small terminase subunit (TerS) homologs that recognize the SaPI-specific pac site and determine SaPI packaging specificity. Several of the known SaPIs do not encode a recognizable TerS homolog but are nevertheless packaged efficiently by helper phages and transferred at high frequencies. Quiles-Puchalt et al report that one of the non-terS-coding SaPIs, SaPIbov5, and found that it uses two different, undescribed packaging strategies. SaPIbov5 is packaged in full-sized phage-like particles either by typical pac-type helper phages, or by cos-type phages—i.e., it has bothpac and cossites and uses the two different phage-coded TerSs. This is an example of SaPI packaging by a cos phage, and in this, it resembles the P4 plasmid of Escherichia coli. Cos-site packaging in Staphylococcus aureus is additionally unique in that it requires the HNH nuclease, carried only by cos phages, in addition to the large terminase subunit, for cos-site cleavage and melting.


Characterization of several of the phage-inducible SaPIs and their helper phages has established that the pac (or headful) mechanism is used for encapsidation. In keeping with this concept, some SaPIs encode a homolog of TerS, which complexes with the phage-coded large terminase subunit TerL to enable packaging of the SaPI DNA in infectious particles composed of phage proteins. These also contain a morphogenesis (cpm) module that causes the formation of small capsids commensurate with the small SaPI genomes. Among the SaPI sequences first characterized, there were several that did not include either a TerS homolog or a cpm homolog, and the same is true of several subsequently identified SaPIs from bovine sources and for many phage-inducible chromosomal islands from other species. It was assumed, for these several islands, either that they were defective derivatives of elements that originally possessed these genes, or that terS and cpm genes were present but not recognized by homology.


Quiles-Puchalt et al observed that an important feature of ϕSLT/SaPlbov5 packaging is the requirement for an HNH nuclease, which is encoded next to the ϕSLT terminase module. Proteins carrying HNH domains are widespread in nature, being present in organisms of all kingdoms. The HNH motif is a degenerate small nucleic acid-binding and cleavage module of about 30-40 as residues and is bound by a single divalent metal ion. The HNH motif has been found in a variety of enzymes playing important roles in many different cellular processes, including bacterial killing; DNA repair, replication, and recombination; and processes related to RNA. HNH endonucleases are present in a number of cos-site bacteriophages of Gram-positive and -negative bacteria, always adjacent to the genes encoding the terminases and other morphogenetic proteins. Quiles-Puchalt et al have demonstrated that the HNH nucleases encoded by #12 and the closely related ϕSLT have nonspecific nuclease activity and are required for the packaging of these phages and of SaPIbov5. Quiles-Puchalt et al have shown that HNH and TerL are jointly required for cos-site cleavage. Quiles-Puchalt et al have also observed that only cos phages of Gram-negative as well as of Gram-positive bacteria encode HNH nucleases, consistent with a special requirement for cos-site cleavage as opposed to pac-site cleavage, which generates flush-ended products. The demonstration that HNH nuclease activity is required for some but not other cos phages suggests that there is a difference between the TerL proteins of the two types of phages-one able to cut both strands and the other needing a second protein to enable the generation of a double-stranded cut.


In the alternative, instead of a bacterium, each producer and/or target cell is an archaeal cell and instead of a phage there is a virus that is capable of infecting the archaeal cell (or each particle comprises a capsid (and optionally tail fibres) of such a virus).


Optionally, the transduction particles are non-self replicative particles. A “non-self replicative transduction particle” refers to a particle, (eg, a phage or phage-like particle; or a particle produced from a genomic island (eg, a SaPI) or a modified version thereof) capable of delivering a nucleic acid molecule encoding an antibacterial agent or component into a bacterial cell, but does not package its own replicated genome into the transduction particle. In an alternative herein, instead of a phage, there is used or packaged a virus that infects an animal, human, plant or yeast target cell. For example, an adenovirus when the target cell is a human cell.


Optionally, the genome of each particle is devoid of genes encoding phage structural proteins. These can be supplied instead by a helper phage during production. Optionally, the genome of each particle is devoid of one or more phage genes rinA, terS and terL.


Optionally, the genomic island is an island that is naturally found in target and/or producer bacterial cells (and optionally in particles of the invention, the genomic island DNA comprises the NSI). In an example, the genomic island is selected from the group consisting of a SaPI, a SaPI1, a SaPI2, a SaPIbov1 and a SaPibov2 genomic island. For example, the island is a modified pathogenicity island. Optionally, the pathogenicity island is an island that is naturally found in target and/or producer bacterial cells, eg, a Staphylococcus SaPI or a Vibro PLE or a P. aeruginosa pathogenicity island (eg, a PAPI or a PAGI, eg, PAPI-1, PAGI-5, PAGI-6, PAGI-7, PAGI-8, PAGI-9, PAGI-10, or PAGI-11. Optionally, the pathogenicity island is a SaPI (S aureus pathogenicity island); optionally, a helper phage is used during production in this case, wherein the helper phage is ϕ11, 80α, ϕ12 or ϕSLT. Staphylococcus phage 80α appears to mobilise all known SaPIs. Thus, in an example, the genome of each particle comprises modified SaPI and the helper phage is a 80α. Optionally, the pathogenicity island is a V. cholerae PLE (phage-inducible chromosomal island-like element) and optionally the first phage is ICP1. Optionally, the pathogenicity island is a E coli PLE.


Optionally, each particle genome comprises P4 DNA, eg, at least P4 packaging signal sequence. The particle may comprise DNA comprising a P4 packaging signal and the NSI or antibacterial means. In an embodiment, a helper phage is used to produce the particle, wherein the helper phage is a P2 phage or a modified P2 phage that is self-replicative defective; optionally present as a prophage in the producer cell genome.


Optionally, the transcription of particle nucleic acid is under the control of a constitutive promoter, for transcription of copies of the antibacterial agent or component or NSI in a target cell. Optionally, Constitutive transcription and production in target cells may be used where the target cells should be killed, eg, in medical settings.


Optionally, the transcription of particle nucleic acid is under the control of an inducible promoter, for transcription of copies of the antibacterial agent or component or NSI in a target cell. This may be useful, for example, to control switching on of the antibacterial activity against target bacterial cells, such as in an environment (eg, soil or water) or in an industrial culture or fermentation container containing the target cells. For example, the target cells may be useful in an industrial process (eg, for fermentation, eg, in the brewing or dairy industry) and the induction enables the process to be controlled (eg, stopped or reduced) by using the antibacterial agent against the target bacteria.


When the agent comprises a plurality of components, eg, wherein the agent is a CRISPR/Cas system, or is a CRISPR array encoding crRNA or a nucleic acid encoding a guide RNA (eg, single guide RNA) operable with a Cas in target cells, wherein the crRNA or gRNA guides the Cas to a target sequence in the cell to modify the target (eg, cut it or repress transcription from it). Optionally, the genes are comprised by the target cell chromosome and/or one or more cell episome(s).


Optionally, the agent is a guided nuclease system or a component thereof, wherein the agent is capable of recognising and cutting target cell DNA (eg, chromosomal DNA).


In examples, such cutting causes one or more of the following:—

    • (i) The target cell is killed by the antibacterial agent;
    • (ii) growth or proliferation of the target cell is reduced; and/or
    • (iii) The target cell is sensitised to an antibiotic, whereby the antibiotic is toxic to the cell.


Optionally, the guided nuclease system is selected from a CRISPR/Cas system, TALEN system, meganuclease system or zinc finger system. Optionally, the system is a CRISPR/Cas system and each particle genome encodes a (a) CRISPR array encoding crRNA or (b) a nucleic acid encoding a guide RNA (gRNA, eg, single guide RNA), wherein the crRNA or gRNA is operable with a Cas in target cells, wherein the crRNA or gRNA guides the Cas to a target nucleic acid sequence in the target cell to modify the target sequence (eg, cut it or repress transcription from it). Optionally, the Cas is a Cas encoded by a functional endogenous nucleic acid of a target cell. For example, the target is comprised by a DNA or RNA of the target cell. Optionally, the system is a CRISPR/Cas system and each particle genome encodes a Cas (eg, a Cas nuclease) that is operable in a target bacterial cell to modify a target nucleic acid sequence comprised by the target cell.


Any Cas herein may be a Cas3, Cas9, Cas13, CasX, CasY or Cpf1.


Optionally, the system is a CRISPR/Cas system and each particle genome encodes one or more Cascade Cas (eg, Cas, A, B, C, D and E).


Optionally, each particle genome further encodes a Cas3 that is operable in a target bacterial cell with the Cascade Cas.


Optionally, the producer and/or target cell is a cell of a first species or strain, wherein the first species or strain is a gram positive species or strain.


Optionally, the producer and/or target cell is a cell of a first species or strain, wherein the first species or strain is a gram negative species or strain.


Optionally, the first species or strain is selected from Table 6 For example, the first species or strain is selected from Shigella, E coli, Salmonella, Serratia, Klebsiella, Yersinia, Pseudomonas and Enterobacter. These are species that P2 phage can infect. Thus, in an embodiment, the particle genome comprises one or more P4 sequences (eg, a P4 packaging sequence) and the genome is packaged by a P2 phage capsid. Thus, the genome is packaged by P2 structural proteins and the resultant transduction particles can usefully infect a broad spectrum of species, ie, two or more of Shigella, E coli, Salmonella, Serratia, Klebsiella, Yersinia, Pseudomonas and Enterobacter. This provides a broadly-applicable delivery platform, where target cell antibacterial specificity can be achieved by encoding on the particle genome guide RNA(s) that specifically target one or more predetermined species within the group of Shigella, E coli, Salmonella, Serratia, Klebsiella, Yersinia, Pseudomonas and Enterobacter.


By “non-replicative” or “replicative-defective” it is meant that the particle is not capable by itself of self-replicating. For example, the particle genome is devoid of one or more nucleotide sequences encoding a protein (eg, a structural protein) that is necessary to produce a transduction particle.


In an example, the reduction in growth or proliferation of target cells is at least 50, 60, 70, 80, 90 or 95%.


In an example each producer cell and/or target cell is selected from a Staphylococcal, Vibrio, Pseudomonas, Clostridium, E coli, Helicobacter, Klebsiella and Salmonella cell.


Optionally, each particle comprise a plasmid comprising

    • a. A nucleotide sequence encoding an antibacterial agent or component thereof for expression in target bacterial cells;
    • b. A constitutive promoter for controlling the expression of the agent or component;
    • c. An optional terS nucleotide sequence;
    • d. An origin of replication (on); and
    • e. A phage packaging sequence (optionally pac, cos or a homologue thereof); and
    • f. the plasmid being devoid of
    • g. All nucleotide sequences encoding phage structural proteins necessary for the production of a transduction particle (optionally a phage), or the plasmid being devoid of at least one of such sequences; and
    • h. Optionally terL.


Optionally, the antibacterial agent is a CRISPR/Cas system and the plasmid encodes a crRNA or guide RNA (eg, single gRNA) that is operable with a Cas in the target cells to guide the Cas to a target nucleotide sequence to modify (eg, cut) the sequence, whereby

    • (a) target cells are killed by the antibacterial agent;
    • (b) growth or proliferation of target cells is reduced; or
    • (c) target cells are sensitised to an antibiotic, whereby the antibiotic is toxic to the cells.


Optionally, the antibacterial agent is a CRISPR/Cas system and the plasmid encodes a Cas that is operable with a crRNA or guide RNA (eg, single gRNA) in the target cells to guide the Cas to a target nucleotide sequence to modify (eg, cut) the sequence, whereby

    • (a) target cells are killed by the antibacterial agent;
    • (b) growth or proliferation of target cells is reduced; or
    • (c) target cells are sensitised to an antibiotic, whereby the antibiotic is toxic to the cells.


Optionally, the plasmid further encodes said crRNA or gRNA.


A plurality of transduction particles obtainable by the method of the invention is provided for use in medicine, eg, for treating or preventing an infection of a human or animal subject by target bacterial cells, wherein transducing particles are administered to the subject for infecting target cells and killing the cells using the antibacterial agent.


Optionally, the particles are for administration to a human or animal for medical use.


Further Concepts of the invention are as follows:—


The present invention is optionally for an industrial or domestic use, or is used in a method for such use. For example, it is for or used in agriculture, oil or petroleum industry, food or drink industry, clothing industry, packaging industry, electronics industry, computer industry, environmental industry, chemical industry, aeorspace industry, automotive industry, biotechnology industry, medical industry, healthcare industry, dentistry industry, energy industry, consumer products industry, pharmaceutical industry, mining industry, cleaning industry, forestry industry, fishing industry, leisure industry, recycling industry, cosmetics industry, plastics industry, pulp or paper industry, textile industry, clothing industry, leather or suede or animal hide industry, tobacco industry or steel industry.


The present invention is optionally for use in an industry or the environment is an industrial environment, wherein the industry is an industry of a field selected from the group consisting of the medical and healthcare; pharmaceutical; human food; animal food; plant fertilizers; beverage; dairy; meat processing; agriculture; livestock farming; poultry fanning; fish and shellfish fanning; veterinary; oil; gas; petrochemical; water treatment; sewage treatment; packaging; electronics and computer; personal healthcare and toiletries; cosmetics; dental; non-medical dental; ophthalmic; non-medical ophthalmic; mineral mining and processing; metals mining and processing; quarrying; aviation; automotive; rail; shipping; space; environmental; soil treatment; pulp and paper; clothing manufacture; dyes; printing; adhesives; air treatment; solvents; biodefence; vitamin supplements; cold storage; fibre retting and production; biotechnology; chemical; industrial cleaning products; domestic cleaning products; soaps and detergents; consumer products; forestry; fishing; leisure; recycling; plastics; hide, leather and suede; waste management; funeral and undertaking; fuel; building; energy; steel; and tobacco industry fields.


In an example, each particle genome comprises a CRISPR array that encodes a respective guide RNA that targets target bacteria, wherein the array comprises one, or two or more spacers (eg, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50 or more spacers) for targeting the genome of target bacteria.


In an example, the target bacteria are comprised by an environment as follows. In an example, the environment is a microbiome of a human, eg, the oral cavity microbiome or gut microbiome or the bloodstream. In an example, the environment is not an environment in or on a human. In an example, the environment is not an environment in or on a non-human animal. In an embodiment, the environment is an air environment. In an embodiment, the environment is an agricultural environment. In an embodiment, the environment is an oil or petroleum recovery environment, eg, an oil or petroleum field or well. In an example, the environment is an environment in or on a foodstuff or beverage for human or non-human animal consumption.


In an example, the environment is a human or animal microbiome (eg, gut, vaginal, scalp, armpit, skin or oral cavity microbiome). In an example, the target bacteria are comprised by a human or animal microbiome (eg, gut, vaginal, scalp, armpit, skin or oral cavity microbiome).


In an example, the particles, population or composition of the invention are administered intranasally, topically or orally to a human or non-human animal, or is for such administration. The skilled person aiming to treat a microbiome of the human or animal will be able to determine the best route of administration, depending upon the microbiome of interest. For example, when the microbiome is a gut microbiome, administration can be intranasally or orally. When the microbiome is a scalp or armpit microbiome, administration can be topically. When the microbiome is in the mouth or throat, the administration can be orally.


In any use or method herein, in an embodiment particles of the invention are contacted with the target bacteria at a multiplicity of infection (MOI) of at least 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, 500, 600 or 700. For example, the MOI is from 20 to 200, from 20 to 100, fro 50 to 200, from 50 to 100, from 75 to 150, 100 or about 100, or 200 or about 200. In an example, this may be determined by obtaining a sample of the microbiome containing the target bacteria (eg, a sample of a waterway or gut microbiome of a subject) and determining the number of CFU/ml or mg in the sample and using this to titrate the phage dose at the desired MOI to be exposed to the microbiome or administered to the environment or subject to be treated.


In an example, the environment is harboured by a beverage or water (eg, a waterway or drinking water for human consumption) or soil. The water is optionally in a heating, cooling or industrial system, or in a drinking water storage container.


In an example, the producer and/or target bacteria are Firmicutes selected from Anaerotruncus, Acetanaerobacterium, Acetitomaculum, Acetivibrio, Anaerococcus, Anaerofilum, Anaerosinus, Anaerostipes, Anaerovorax, Butyrivibrio, Clostridium, Capracoccus, Dehalobacter, Dialister, Dorea, Enterococcus, Ethanoligenens, Faecalibacterium, Fusobacterium, Gracilibacter, Guggenheimella, Hespellia, Lachnobacterium, Lachnospira, Lactobacillus, Leuconostoc, Megamonas, Moryella, Mitsuokella, Oribacterium, Oxobacter, Papillibacter, Proprionispira, Pseudobutyrivibrio, Pseudoramibacter, Roseburia, Ruminococcus, Sarcina, Seinonella, Shuttleworthia, Sporobacter, Sporobacterium, Streptococcus, Subdoligranulum, Syntrophococcus, Thermobacillus, Turibacter and Weisella.


In an example, the particles, population, composition, use or method is for reducing pathogenic infections or for re-balancing gut or oral microbiota eg, for treating or preventing obesity or disease in a human or animal. For example, the particles, population, composition, use or method is for knocking-down Clostridium dificile or E col bacteria in a gut microbiota of a human or animal.


In an example, the disease or condition is a cancer, inflammatory or autoimmune disease or condition, eg, obesity, diabetes, IBD (eg, wherein the target cell is an E coli or Klebsiella cell), a GI tract condition or an oral cavity condition.


Optionally, the environment is comprised by, or the target bacteria are comprised by, a gut microbiota, skin microbiota, oral cavity microbiota, throat microbiota, hair microbiota, armpit microbiota, vaginal microbiota, rectal microbiota, anal microbiota, ocular microbiota, nasal microbiota, tongue microbiota, lung microbiota, liver microbiota, kidney microbiota, genital microbiota, penile microbiota, scrotal microbiota, mammary gland microbiota, ear microbiota, urethra microbiota, labial microbiota, organ microbiota or dental microbiota. Optionally, the environment is comprised by, or the target bacteria are comprised by, a plant (eg, a tobacco, crop plant, fruit plant, vegetable plant or tobacco, eg on the surface of a plant or contained in a plant) or by an environment (eg, soil or water or a waterway or aqueous liquid).


Optionally, the disease or condition of a human or animal subject is selected from

    • (a) A neurodegenerative disease or condition;
    • (b) A brain disease or condition;
    • (c) A CNS disease or condition;
    • (d) Memory loss or impairment;
    • (e) A heart or cardiovascular disease or condition, eg, heart attack, stroke or atrial fibrillation;
    • (f) A liver disease or condition;
    • (g) A kidney disease or condition, eg, chronic kidney disease (CKD);
    • (h) A pancreas disease or condition;
    • (i) A lung disease or condition, eg, cystic fibrosis or COPD;
    • (j) A gastrointestinal disease or condition;
    • (k) A throat or oral cavity disease or condition;
    • (l) An ocular disease or condition;
    • (m) A genital disease or condition, eg, a vaginal, labial, penile or scrotal disease or condition;
    • (n) A sexually-transmissible disease or condition, eg, gonorrhea, HIV infection, syphilis or Chlamydia infection;
    • (o) An ear disease or condition;
    • (p) A skin disease or condition;
    • (q) A heart disease or condition;
    • (r) A nasal disease or condition
    • (s) A haematological disease or condition, eg, anaemia, eg, anaemia of chronic disease or cancer,
    • (t) A viral infection;
    • (u) A pathogenic bacterial infection;
    • (v) A cancer;
    • (w) An autoimmune disease or condition, eg, SLE;
    • (x) An inflammatory disease or condition, eg, rheumatoid arthritis, psoriasis, eczema, asthma, ulcerative colitis, colitis, Crohn's disease or IBD;
    • (y) Autism;
    • (z) ADHD;
    • (aa) Bipolar disorder;
    • (bb) ALS [Amyotrophic Lateral Sclerosis];
    • (cc) Osteoarthritis;
    • (dd) A congenital or development defect or condition;
    • (ee) Miscarriage;
    • (ff) A blood clotting condition;
    • (gg) Bronchitis;
    • (hh) Dry or wet AMD;
    • (ii) Neovascularisation (eg, of a tumour or in the eye);
    • (ij) Common cold;
    • (kk) Epilepsy;
    • (ll) Fibrosis, eg, liver or lung fibrosis;
    • (mm) A fungal disease or condition, eg, thrush;
    • (nn) A metabolic disease or condition, eg, obesity, anorexia, diabetes, Type I or Type II diabetes.
    • (oo) Ulcer(s), eg, gastric ulceration or skin ulceration;
    • (pp) Dry skin,
    • (qq) Sjogren's syndrome;
    • (rr) Cytokine storm;
    • (ss) Deafness, hearing loss or impairment;
    • (tt) Slow or fast metabolism (ie, slower or faster than average for the weight, sex and age of the subject);
    • (uu) Conception disorder, eg, infertility or low fertility;
    • (vv) Jaundice;
    • (ww) Skin rash,
    • (xx) Kawasaki Disease;
    • (yy) Lyme Disease;
    • (zz) An allergy, eg, a nut, grass, pollen, dust mite, cat or dog fur or dander allergy;
    • (aaa) Malaria, typhoid fever, tuberculosis or cholera;
    • (bbb) Depression;
    • (ccc) Mental retardation;
    • (ddd) Microcephaly;
    • (eee) Malnutrition;
    • (fff) Conjunctivitis;
    • (ggg) Pneumonia;
    • (hhh) Pulmonary embolism;
    • (iii) Pulmonary hypertension;
    • (jjj) A bone disorder;
    • (kkk) Sepsis or septic shock;
    • (lll) Sinusitis;
    • (mmm) Stress (eg, occupational stress);
    • (nnn) Thalassemia, anaemia, von Willebrand Disease, or haemophilia;
    • (ooo) Shingles or cold sore;
    • (ppp) Menstruation;
    • (qqq) Low sperm count.


Neurodegenerative or CNS Diseases or Conditions for Treatment or Prevention by the Invention


In an example, the neurodegenerative or CNS disease or condition is selected from the group consisting of Alzheimer disease, geriopsychosis, Down syndrome, Parkinson's disease, Creutzfeldt-jakob disease, diabetic neuropathy, Parkinson syndrome, Huntington's disease, Machado-Joseph disease, amyotrophic lateral sclerosis, diabetic neuropathy, and Creutzfeldt Creutzfeldt-Jakob disease. For example, the disease is Alzheimer disease. For example, the disease is Parkinson syndrome.


In an example, wherein the method of the invention is practised on a human or animal subject for treating a CNS or neurodegenerative disease or condition, the method causes downregulation of Treg cells in the subject, thereby promoting entry of systemic monocyte-derived macrophages and/or Treg cells across the choroid plexus into the brain of the subject, whereby the disease or condition (eg, Alzheimer's disease) is treated, prevented or progression thereof is reduced. In an embodiment the method causes an increase of IFN-gamma in the CNS system (eg, in the brain and/or CSF) of the subject. In an example, the method restores nerve fibre and/or reduces the progression of nerve fibre damage. In an example, the method restores nerve myelin and/or reduces the progression of nerve myelin damage. In an example, the method of the invention treats or prevents a disease or condition disclosed in WO2015136541 and/or the method can be used with any method disclosed in WO2015136541 (the disclosure of this document is incorporated by reference herein in its entirety, eg, for providing disclosure of such methods, diseases, conditions and potential therapeutic agents that can be administered to the subject for effecting treatment and/or prevention of CNS and neurodegenerative diseases and conditions, eg, agents such as immune checkpoint inhibitors, eg, anti-PD-1, anti-PD-LI, anti-TIM3 or other antibodies disclosed therein).


Cancers for Treatment or Prevention by the Method


Cancers that may be treated include tumours that are not vascularized, or not substantially vascularized, as well as vascularized tumours. The cancers may comprise non-solid tumours (such as haematological tumours, for example, leukaemias and lymphomas) or may comprise solid tumours. Types of cancers to be treated with the invention include, but are not limited to, carcinoma, blastoma, and sarcoma, and certain leukaemia or lymphoid malignancies, benign and malignant tumours, and malignancies e.g., sarcomas, carcinomas, and melanomas. Adult tumours/cancers and paediatric tumours/cancers are also included.


Haematologic cancers are cancers of the blood or bone marrow. Examples of haematological (or haematogenous) cancers include leukaemias, including acute leukaemias (such as acute lymphocytic leukaemia, acute myelocytic leukaemia, acute myelogenous leukaemia and myeloblasts, promyeiocytic, myelomonocytic, monocytic and erythroleukaemia), chronic leukaemias (such as chronic myelocytic (granulocytic) leukaemia, chronic myelogenous leukaemia, and chronic lymphocytic leukaemia), polycythemia vera, lymphoma, Hodgkin's disease, non-Hodgkin's lymphoma (indolent and high grade forms), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, myeiodysplastic syndrome, hairy cell leukaemia and myelodysplasia.


Solid tumours are abnormal masses of tissue that usually do not contain cysts or liquid areas. Solid tumours can be benign or malignant. Different types of solid tumours are named for the type of cells that form them (such as sarcomas, carcinomas, and lymphomas). Examples of solid tumours, such as sarcomas and carcinomas, include fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, and other sarcomas, synovioma, mesothelioma, Ewing's tumour, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, lymphoid malignancy, pancreatic cancer, breast cancer, lung cancers, ovarian cancer, prostate cancer, hepatocellular carcinoma, squamous eel! carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, medullary thyroid carcinoma, papillary thyroid carcinoma, pheochromocytomas sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, Wilms' tumour, cervical cancer, testicular tumour, seminoma, bladder carcinoma, melanoma, and CNS tumours (such as a glioma (such as brainstem glioma and mixed gliomas), glioblastoma (also known as glioblastoma multiforme) astrocytoma, CNS lymphoma, germinoma, medu!loblastoma, Schwannoma craniopharyogioma, ependymoma, pineaioma, hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma, neuroblastoma, retinoblastoma and brain metastases).


Autoimmune Diseases for Treatment or Prevention by the Method

    • 1. Acute Disseminated Encephalomyelitis (ADEM)
    • 2. Acute necrotizing hemorrhagic leukoencephalitis
    • 3. Addison's disease
    • 4. Agammaglobulinemia
    • 5. Alonecia areata
    • 6. Amyloidosis
    • 7. Ankylosing spondylitis
    • 8. Anti-GBM/Anti-TBM nephritis
    • 9. Antiphospholipid syndrome (APS)
    • 10. Autoimmune angioedema
    • 11. Autoimmune aplastic anemia
    • 12. Autoimmune dysautonomia
    • 13. Autoimmune hepatitis
    • 14. Autoimmune hyperlipidemia
    • 15. Autoimmune immunodeficiency
    • 16. Autoimmune inner ear disease (AIED)
    • 17. Autoimmune myocarditis
    • 18. Autoimmune oophoritis
    • 19. Autoimmune pancreatitis
    • 20. Autoimmune retinopathy
    • 21. Autoimmune thrombocytopenic purpura (ATP)
    • 22. Autoimmune thyroid disease
    • 23. Autoimmune urticaria
    • 24. Axonal & neuronal neuropathies
    • 25. Balo disease
    • 26. Behcet's disease
    • 27. Bullous pemphigoid
    • 28. Cardiomyopathy
    • 29. Castleman disease
    • 30. Celiac disease
    • 31. Chagas disease
    • 32. Chronic fatigue syndrome
    • 33. Chronic inflammatory demyelinating polyneuropathy (CIDP)
    • 34. Chronic recurrent multifocal ostomyelitis (CRMO)
    • 35. Churg-Strauss syndrome
    • 36. Cicatricial pemphigoid/benign mucosal pemphigoid
    • 37. Crohn's disease
    • 38. Cogans syndrome
    • 39. Cold agglutinin disease
    • 40. Congenital heart block
    • 41. Coxsackie myocarditis
    • 42. CREST disease
    • 43. Essential mixed cryoglobulinemia
    • 44. Demyelinating neuropathies
    • 45. Dermatitis herpetiformis
    • 46. Dermatomyositis
    • 47. Devic's disease (neuromyelitis optica)
    • 48. Discoid lupus
    • 49. Dressler's syndrome
    • 50. Endometriosis
    • 51. Eosinophilic esophagitis
    • 52. Eosinophilic fasciitis
    • 53. Erythema nodosum
    • 54. Experimental allergic encephalomyelitis
    • 55. Evans syndrome
    • 56. Fibromyalgia
    • 57. Fibrosing alveolitis
    • 58. Giant cell arteritis (temporal arteritis)
    • 59. Giant cell myocarditis
    • 60. Glomerulonephritis
    • 61. Goodpasture's syndrome
    • 62. Granulomatosis with Polyangiitis (GPA) (formerly called Wegener's Granulomatosis)
    • 63. Graves' disease
    • 64. Guillain-Barre syndrome
    • 65. Hashimoto's encephalitis
    • 66. Hashimoto's thyroiditis
    • 67. Hemolytic anemia
    • 68. Henoch-Schonlein purpura
    • 69. Herpes gestationis
    • 70. Hypogammaglobulinemia
    • 71. Idiopathic thrombocytopenic purpura (ITP)
    • 72. IgA nephropathy
    • 73. IgG4-related sclerosing disease
    • 74. Immunoregulatory lipoproteins
    • 75. Inclusion body myositis
    • 76. Interstitial cystitis
    • 77. Juvenile arthritis
    • 78. Juvenile diabetes (Type 1 diabetes)
    • 79. Juvenile myositis
    • 80. Kawasaki syndrome
    • 81. Lambert-Eaton syndrome
    • 82. Leukocytoclastic vasculitis
    • 83. Lichen planus
    • 84. Lichen sclerosus
    • 85. Ligneous conjunctivitis
    • 86. Linear IgA disease (LAD)
    • 87. Lupus (SLE)
    • 88. Lyme disease, chronic
    • 89. Meniere's disease
    • 90. Microscopic polyangiitis
    • 91. Mixed connective tissue disease (MCTD)
    • 92. Mooren's ulcer
    • 93. Mucha-Habermann disease
    • 94. Multiple sclerosis
    • 95. Myasthenia gravis
    • 96. Myositis
    • 97. Narcolepsy
    • 98. Neuromyelitis optica (Devic's)
    • 99. Neutropenia
    • 100. Ocular cicatricial pemphigoid
    • 101. Optic neuritis
    • 102. Palindromic rheumatism
    • 103. PANDAS (Pediatric Autoimmune Neuropsychiatric Disorders Associated with Streptococcus)
    • 104. Paraneoplastic cerebellar degeneration
    • 105. Paroxysmal nocturnal hemoglobinuria (PNH)
    • 106. Parry Romberg syndrome
    • 107. Parsonnage-Turner syndrome
    • 108. Pars planitis (peripheral uveitis)
    • 109. Pemphigus
    • 110. Peripheral neuropathy
    • 111. Perivenous encephalomyelitis
    • 112. Pernicious anemia
    • 113. POEMS syndrome
    • 114. Polyarteritis nodosa
    • 115. Type I. II. & III autoimmune polyglandular syndromes
    • 116. Polymyalgia rheumatica
    • 117. Polymyositis
    • 118. Postmyocardial infarction syndrome
    • 119. Postpericardiotomy syndrome
    • 120. Progesterone dermatitis
    • 121. Primary biliary cirrhosis
    • 122. Primary sclerosing cholangitis
    • 123. Psoriasis
    • 124. Psoriatic arthritis
    • 125. Idiopathic pulmonary fibrosis
    • 126. Pyoderma gangrenosum
    • 127. Pure red cell aplasia
    • 128. Raynauds phenomenon
    • 129. Reactive Arthritis
    • 130. Reflex sympathetic dystrophy
    • 131. Reiter's syndrome
    • 132. Relapsing polychondritis
    • 133. Restless legs syndrome
    • 134. Retroperitoneal fibrosis
    • 135. Rheumatic fever
    • 136. Rheumatoid arthritis
    • 137. Sarcoidosis
    • 138. Schmidt syndrome
    • 139. Scleritis
    • 140. Scleroderma
    • 141. Sjogren's syndrome
    • 142. Sperm & testicular autoimmunity
    • 143. Stiff person syndrome
    • 144. Subacute bacterial endocarditis (SBE)
    • 145. Susac's syndrome
    • 146. Sympathetic ophthalmia
    • 147. Takayasu's arteritis
    • 148. Temporal arteritis/Giant cell arteritis
    • 149. Thrombocytopenic purpura (TTP)
    • 150. Tolosa-Hunt syndrome
    • 151. Transverse myelitis
    • 152. Type 1 diabetes
    • 153. Ulcerative colitis
    • 154. Undifferentiated connective tissue disease (UCTD)
    • 155. Uveitis
    • 156. Vasculitis
    • 157. Vesiculobullous dermatosis
    • 158. Vitiligo
    • 159. Wegener's granulomatosis (now termed Granulomatosis with Polyangiitis (GPA).


Inflammatory Diseases for Treatment or Prevention by the Method

  • 1. Alzheimer
  • 2. ankylosing spondylitis
  • 3. arthritis (osteoarthritis, rheumatoid arthritis (RA), psoriatic arthritis)
  • 4. asthma
  • 5. atherosclerosis
  • 6. Crohn's disease
  • 7. colitis
  • 8. dermatitis
  • 9. diverticulitis
  • 10. fibromyalgia
  • 11. hepatitis
  • 12. irritable bowel syndrome (IBS)
  • 13. systemic lupus erythematous (SLE)
  • 14. nephritis
  • 15. Parkinson's disease
  • 16. ulcerative colitis.


In an example, any composition of the invention comprises at least 1×103 transduction particles of the invention per ml or mg, such as when the composition is comprised by a fluid (eg, a liquid) or solid. In an example, any composition of the invention comprises at least 1×104 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×105 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×106 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×107 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×108 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×109 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×1010 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×1011 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×1012 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×1013 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×1014 transduction particles of the invention per ml or mg.


In an example, any composition of the invention comprises up to 1×1014 transduction particles of the invention per ml or mg, such as when the composition is comprised by a fluid (eg, a liquid) or solid. In an example, any composition of the invention comprises up to 1×1013 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises up to 1×1012 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises up to 1×1011 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises up to 1×1010 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises up to 1×109 transduction particles of the invention per ml or mg.


In an example, any composition of the invention comprises at least 1×103 to 1×1010, 1×1011, 1×1012, 1×1013 or 1×1014 transduction particles of the invention per ml or mg, such as when the composition is comprised by a fluid (eg, a liquid) or solid. In an example, any composition of the invention comprises at least 1×104 to 1×1010, 1×1011, 1×1012, 1×1013 or 1×1014 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×105 to 1×1010, 1×1011, 1×1012, 1×1013 or 1×1014 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×106 to 1×1010, 1×1011, 1×1012, 1×1013 or 1×1014 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×107 to 1×1010, 1×1011, 1×1012, 1×1013 or 1×1014 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×108 to 1×1010, 1×1011, 1×1012, 1×1013 or 1×1014 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×109 to 1×1010, 1×1011, 1×1012, 1×1013 or 1×1014 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×1010 to 1×1010, 1×1011, 1×1012, 1×1013 or 1×1014 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×1011 to 1×1010, 1×1011, 1×1012, 1×1013 or 1×1014 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×1012 to 1×1010, 1×1011, 1×1012, 1×1013 or 1×1014 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×1013 to 1×1010, 1×1011, 1×1012, 1×1013 or 1×1014 transduction particles of the invention per ml or mg. In an example, any composition of the invention comprises at least 1×1014 to 1×1010, 1×1011, 1×1012, 1×1013 or 1×1014 transduction particles of the invention per ml or mg.


In an example, the composition comprises one or more doses of the transduction particles of the invention for administration to a subject for medical use, eg, to treat or prevent a disease or condition in the subject. In an example, the composition comprises a single dose. In an example, the composition comprises (or comprises at least) 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 doses. In an example, each dose is (or is at least) a 0.5, 1, 2, 3, 4, 5, 10, 20, 25, 30, 40, 50, 75, 100, 125, 200 or 250 mg or ml dose comprising said phage (ie, the dose is said amount and comprises phage and an excipient, diluent or carrier for example).


In an example, the composition comprises one or more doses of the transduction particles of the invention for administration to a subject for non-medical use, eg, for agricultural use. In an example, the composition comprises a single dose. In an example, the composition comprises (or comprises at least) 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 doses. In an example, each dose is (or is at least) a 0.5, 1, 2, 3, 4, 5, 10, 20, 25, 30, 40, 50, 75, 100, 125, 200, 250, 500, 750, 1000, 2000, 3000, 4000, 5000, 10000, 50000, 100000 mg or ml dose comprising said phage (ie, the dose is said amount and comprises phage and an excipient, diluent or carrier for example). The dose may be dissolved or diluted in a solvent (eg, an aqueous solvent or water) before use for contacting with target bacteria. In an example 1 imperial gallon comprises one dose of the transduction particles of the invention, eg, for agricultural use, such as crop spraying, or for animal or livestock use, such as use as a beverage.


Optionally, the NSI is comprised by a high copy number plasmid. Optionally, the NSI is comprised by a medium copy number plasmid. The meaning of low, medium and high copy number or and plasmids is known to the skilled addressee and these are terms of art. As is known by the skilled person, copy number denotes the average number of plasmid copies per cell. For example, a low copy number plasmid is a plasmid that exists in from 1 to 10 copies per bacterial cell in which the plasmid is harboured; a medium copy number plasmid exists in from 11 to 50 (eg, 11 to 40 or 20 to 30 or 40) copies per cell; and a high copy number is >50 (eg, up to 100, 200, 250, 300, 400, 500, 600 or 700) copies per cell. In an example, the plasmid or vector comprising first DNA is a medium copy number plasmid or vector. In an example, the plasmid or vector comprising first DNA is a high copy number plasmid or vector. An example of common on and plasmids is shown in Table 8.


Examples
Example 1: Increased Production of Transduction Particles by Inhibition of Phage Re-Absorption
BACKGROUND

This study relates to the production of transduction particles which contain a DNA sequence of interest, where the particles can usefully be used to infect target bacteria in to introduce the DNA for expression in the target bacteria. These particles can inject their DNA into the same set of bacterial strains as the original phage on which the particle design is based. Binding of the phage particles to the host cell requires the presence of one or more specific molecules on the surface of the cell, providing a phage receptor. We surprisingly see a very large increase in yield of particle production. Whilst not wishing to be bound by any theory, elimination of the phage receptor from the surface of the producer cells may prevent re-absorption of the produced particles thus increasing production yield significantly.


Methods & Results

We used the well-studied P2 phage/Escherichia coli system as a model. To identify P2 receptor mutants, we tested a set of single knockout mutants from the KEIO collection (“Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection”, Tomoya Baba et al, DOI 10.1038/msb4100050, Molecular Systems Biology (2006) 2, 2006.0008) for P2 plaque formation in a standard soft agar overlay spot test. LB agar was prepared in petri dishes and covered by 3 ml soft agar overlay (LB+0.6% agar) containing 100 ul overnight cell culture. P2 vir phage lysate was spotted on the plates and after overnight incubation at 37° C. the plates were checked for plaque formation. We found that P2 does not plaque on a set of rfa mutants involved in LPS core biosynthesis (FIG. 1).


To construct a receptor deletion mutant for further studies, we replaced the rfaD gene with a zeocin resistance marker in the E. coli C1a P2 lysogen using the Lambda Red system (“One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products”, Kirill A. Datsenko and Barry L. Wanner, PNAS Jun. 6, 2000 97 (12) 6640-6645; https://doi.org/10.1073/pnas.120163297). The zeocin marker of plasmid pEM7/zeo (Invitrogen) was PCR amplified using the primers rfaDupR (SEQ ID NO: 1) and rfaDdnR (SEQ ID NO: 2). E. coli C1a P2 lysogen cells were transformed with the plasmid pKD46 (GenBank: MF287367.1), carrying the Lambda Red system. The transformants were grown at 30° C. to mid log phase in LB containing 100 ug/ml ampicillin and induced with 0.4% arabinose for 2 h. Cells were washed with 20% glycerol and electroporated with the PCR fragment containing the zeo marker.


Recombinants were selected on LB zeo plates at 37° C., also eliminating the pKD46 plasmid, which has a temperature sensitive replication. Proper replacement of the rfaD gene with a zeo marker was sequence verified.


Both the parental strain (C1a P2 lysogen) and the receptor mutant (C1a P2 lysogen ΔrfaD) were transformed with a plasmid, containing (i) the arabinose inducible P4 phage transactivation region (to induce the P2 helper functions), (ii) the P4 packaging site, (iii) a spectinomycin resistance marker, and (iv) the CloDF13 replication origin.


To compare the yield of the transduction particles obtained in the two strains, overnight cell cultures were diluted 1:25 in LB medium containing 50 μg/ml Spectinomycin, 10 mM MgSO4, and 5 mM CaCl2. After 90 minutes shaking at 37° C., 0.8% arabinose was added to the cultures. Due to the induction of the chromosomal P2 phage, cells lysed after 3 hours. Cell debris was removed by centrifugation and the lysate was extracted with chloroform to remove any remaining cells.


The yield of production was quantified by measuring transduction of the spectinomycin marker. The lysates were serially diluted in LB medium containing 10 mM MgSO4, and 5 mM CaCl2 (10-fold steps) in 100 μl volume and the dilutions were mixed with 100 μl overnight E. coli C1a cell cultures. After 30 minutes at 37° C., 10 μl of each sample was spotted on LB spectinomycin plates. Colonies were counted after overnight incubation. Results are shown in FIG. 2.


Conclusion:

Removal of the phage receptor surprisingly increased the yield of transduction particles by more than 100 times. Therefore, this invention can greatly reduce the production cost of transduction particles or phages.













TABLE 1





Phages
Family
Main host
Recetpor(s)
References







γ
Siphoviridae

Bacillus anthracis

Membrane surface-anchored protein
Davison et al. (2005)





gamma phage receptor (GamR)


SPP1
Siphoviridae

Bacillus subtilis

Glucosyl residues of poly(glycerophosphate)
São-José, Baptista





on WTA for reversible binding and
and Santos (2004),





membrane protein YueB for
Baptista, Santos





irreversible binding
and São-José (2008)


ϕ29
Podoviridae

Bacillus subtilis

Cell WTA (primary receptor)
Xiang et al. (2009)


Bam35
Tectiviridae

Bacillus thuringiensis

N-acetyl-muramic acid (MurNAc) of
Gaidelyte et al. (2006)





peptidoglycan in the cell wall


LL-H
Siphoviridae

Lactobacillus delbrueckii

Glucose moiety of LTA for reversible
Munsch-Alatossava





adsorption and negatively charged
and Alatossava (2013)





glycerol phosphate group of the LTA for





irreversible binding


B1
Siphoviridae

Lactobacillus plantarum

Galactose component of the
Douglas and Wolin (1971)





wall polysaccharide


B2
Siphoviridae

Lactobacillus plantarum

Glucose substituents in teichoic acid
Douglas and Wolin (1971)


513c2hml3khL
Siphoviridae

Lactococcus lactis

Rhamnosea moieties in
Monteville, Ardestani





the cell wall peptidoglycan for reversible
and Geller (1994)





binding and membrane phage infection protein





(PIP) for irreversible binding


ϕLC3TP901ermTP901-1
Siphoviridae

Lactococcus lactis

Cell wall polysaccharides
Ainsworth, Sadovskaya






and Vinogradov (2014)


p2
Siphoviridae

Lactococcus lactis

Cell wall saccharides for reversible
Bebeacua et al. (2013)





attachment and





pelliclebphosphohexasaccharide





motifs for irreversible





adsorption


A511
Myoviridae

Listeria monocytogenes

Peptidoglycan (murein)
Wendlinger, Loessner






and Scherer (1996)


A118
Siphoviridae

Listeria monocytogenes

Glucosaminyl and rhamnosyl components of
Wendlinger, Loessner





ribitol teichoic acid
and Scherer (1996)


A500
Siphoviridae

Listeria monocytogenes

Glucosaminyl residues in teichoic acid
Wendlinger, Loessner






and Scherer (1996)


ϕ812ϕK
Myoviridae

Staphylococcus aureus

Anionic backbone of WTA
Xia et al. (2011)


52A
Siphoviridae

Staphylococcus aureus

O-acetyl group from the 6-position of muramic
Shaw and Chatterjee (1971)





acid residues in murein


Wϕ13ϕ47ϕ77ϕSa2m
Siphoviridae

Staphylococcus aureus

N-acetylglucosamine (GlcNAc)
Xia et al. (2011)





glycoepitope on WTA


ϕSLT
Siphoviridae

Staphylococcus aureus

Poly(glycerophosphate) moiety of LTA
Kaneko et al. (2009)






aMonteville, Ardestani and Geller (1994) noted that since phages can also bind to glucose and galactose moieties in the cell wall, these might, to a lesser extent, be involved in the adsorption mechanism;




bPellicle is a protective polysaccharide layer that covers the cell surface of Lactococcus lactis(Chapot-Chartier et al. 2010).














TABLE 2







Receptors in the cell wall of Gram-negative bacteria. Host names are ordered alphabetically.











Phages
Family
Main host
Receptor(s)
References










(a) Receptors that bind to RBP of phages











ϕCr30
Myoviridae

Caulobacter crescentus

Paracrystalline surface
Edwards and Smit (1991)





(S) layer protein


434
Siphoviridae

Escherichia coli

Protein Ib (OmpC)
Hantke (1978)


BF23
Siphoviridae

Escherichia coli

Protein BtuB (vitamin
Bradbeer, Woodrow and





B12 receptor)
Khalifah (1976)


K3
Myoviridae

Escherichia coli

Protein d or 3A (OmpA) with LPS
Skurray, Hancock and






Reeves (1974);






Manning and Reeves






(1976); Van Alphen,






Havekes and






Lugtenberg (1977)


K10
Siphoviridae

Escherichia coli

Outer membrane protein LamB
Roa (1979)





(maltodextran selective channel)


Me1
Myoviridae

Escherichia coli

Protein c (OmpC)
Verhoef, de Graaff






and Lugtenberg (1977)


Mu G(+)
Myoviridae

Escherichia coli

Terminal Glcα-2Glcα1- or
Sandulache,





GlcNAcα1-2Glcα1- of the LPS
Prehm and Kamp (1984)


Mu G(−)
Myoviridae

Escherichia coli

Terminal glucose with
Sandulache et al. (1985)





a βl,3 glycosidic linkage





Erwinia

Terminal glucose linked





in βl,6 configuration


M1
Myoviridae

Escherichia coli

Protein OmpA
Hashemolhosseini et al. (1994)


Ox2
Myoviridae

Escherichia coli

Protein OmpAa
Morona and Henning (1984)


ST-1
Microviridae

Escherichia coli

Terminal Glcα-2Glcα1-
Sandulache,





or GlcNAcα1-
Prehm and Kamp (1984)





2Glcα1- of the LPS


TLS
Siphoviridae

Escherichia coli

Antibiotic efflux protein TolC
German and





and the inner core of LPS
Misra (2001)


TuIa
Myoviridae

Escherichia coli

Protein Ia (OmpF)
Datta, Arden and





with LPS
Henning (1977)


TuIb
Myoviridae

Escherichia coli

Protein Ib (OmpC)





with LPS


TuII*
Myoviridae

Escherichia coli

Protein II* (OmpA)





with LPS


T1
Siphoviridae

Escherichia coli

Proteins TonA (FhuA, involved in
Hantke and Braun (1975, 1978);





ferrichrome uptake) and TonBb
Hancock and Braun (1976)


T2
Myoviridae

Escherichia coli

Protein Ia (OmpF) with
Hantke (1978); Morona and





LPS and the outer
Henning (1986); Black (1988)





membrane protein





FadL (involved in





the uptake of





long-chain fatty acids)


T3
Podoviridae

Escherichia coli

Glucosyl-α-1,3-glucose
Prehm et al. (1976)





terminus of rough LPS


T4
Myoviridae

Escherichia coli
K-12

Protein O-8 (OmpC) with LPS
Prehm et al. (1976);






Mutoh, Furukawa and






Mizushima (1978); Goldberg,






Grinius and Letellier (1994)





Escherichia coli B

Glucosyl-α-1,3-glucose





terminus of rough LPS


T5
Siphoviridae

Escherichia coli

Polymannose sequence in the
Braun and Wolff (1973);





O-antigen and protein FhuA
Braun, Schaller and






Wolff (1973); Heller






and Braun (1982)


T6
Myoviridae

Escherichia coli

Outer membrane protein Tsx
Manning and Reeves (1976, 1978)





(involved in nucleoside uptake)


T7
Podoviridae

Escherichia coli

LPSc
Lindberg (1973)


U3
Microviridae

Escherichia coli

Terminal galactose residue in LPS
Picken and Beacham (1977)


λ
Siphoviridae

Escherichia coli

Protein LamB
Randall-Hazelbauer






and Schwartz (1973)


ϕX174
Microviridae

Escherichia coli

Terminal galactose in the core
Feige and Stirm (1976)





oligosaccharide of rough LPS


ϕ80
Siphoviridae

Escherichia coli

Proteins FhuA and TonBb
Hantke and Braun






(1975, 1978); Wayne and






Neilands (1975);






Hancock and Braun (1976)


PM2
Corticoviridae

Pseudoalteromonas

Sugar moieties on the
Kivela et al. (2008)





cell surfaced


E79
Myoviridae

Pseudomonas aeruginosa

Core polysaccharide of LPS
Meadow and Wells (1978)


JG004
Myoviridae

Pseudomonas aeruginosa

LPS
Garbe et al. (2011)


ϕCTX
Myoviridae

Pseudomonas aeruginosa

Core polysaccharide of
Yokota, Hayashi





LPS, with emphasis
and Matsumoto (1994)





on L-rhamnose and D-glucose





residues in the outer core


ϕPLS27
Podoviridae

Pseudomonas aeruginosa

Galactosamine-alanine region
Jarrell and Kropinski (1981)





of the LPS core


ϕ13
Cystoviridae

Pseudomonas syringae

Truncated O-chain of LPS
Mindich et al. (1999);






Daugelavicius et al. (2005)


ES18
Siphoviridae

Salmonella

Protein FhuA
Killmann et al. (2001)


Gifsy-1Gifsy-2
Siphoviridae

Salmonella

Protein OmpC
Ho and Slauch (2001)


SPC35
Siphoviridae

Salmonella

BtuB as the main receptor
Kim and Ryu (2012)





and O12-antigen as





adsorption-assisting apparatus


SPN1SSPN2TCWSPN4B
Podoviridae

Salmonella

O-antigen of LPS
Shin et al. (2012)


SPN6TCW SPN8TCW


SPN9TCW SPN13U


SPN7CSPN9C SPN10H
Siphoviridae

Salmonella

Protein BtuB


SPN12C SPN14


SPN17T SPN18


vB_SenM-S16 (S16)
Myoviridae

Salmonella

Protein OmpC
Marti et al. (2013)


L-413CP2 vir1
Myoviridae

Yersinia pestis

Terminal GlcNAc residue
Filippov et al. (2011)





of the LPS outer





core. HepII/HepIII and





HepI/Glc residues





are also involved in





receptor activitye


ϕJA1
Myoviridae

Yersinia pestis

Kdo/Ko pairs of inner





core residues.





LPS outer and inner





core sugars are also





involved in receptor





activitye


T7YpY (YpP-Y)
Podoviridae

Yersinia pestis

HepI/Glc pairs of inner





core residues.





HepII/HepIII and





Kdo/Ko pairs are also





involved in receptor





activitye


Pokrovskaya
Podoviridae

Yersinia pestis

HepII/HepIII pairs of


YepE2YpP-G


inner core residues.





HepI/Glc residues





are also involved in





receptor activitye


ϕA1122
Podoviridae

Yersinia pestis

Kdo/Ko pairs of inner





core residues.





HepI/Glc residues are





also involved in





receptor activitye


PST
Myoviridae

Yersinia pseudotuberculosis

HepII/HepIII pairs of inner





core residuese







(b) Receptors in the O-chain structure that are enzymatically cleaved by phages











Ω8
Podoviridae

Escherichia coli

The α-1,3-mannosyl linkages between
Reske, Wallenfels





the trisaccharide repeating unit
and Jann (1973)





α-mannosyl-1,2-α-mannosyl-





1,2-mannose


c341
Podoviridae

Salmonella

The O-acetyl group in the mannosyl-
Iwashita and





rhamnosyl-O-acetylgalactose
Kanegasaki (1976)





repeating sequence


P22
Podoviridae

Salmonella

α-Rhmanosyl 1-3 galactose
Iwashita and Kanegasaki (1973)





linkage of the O-chain


ε34
Podoviridae

Salmonella

[-β-Gal-Man-Rha-]
Takeda and Uetake (1973)





polysaccharide units of the O-antigen


Sf6
Podoviridae

Shigella

Rha II 1-α-3 Rha III linkage
Lindberg et al. (1978)





of the O-polysaccharide.






aSukupolvi (1984) suggested that LPS is also required for adsorption of phage Ox2 on E. coli and S. typhimurium, although the study verified that isolated OmpA is enough to inactivate the phage and that the binding is not increased with the addition of LPS to the protein.




bAccording to Rakhuba et al. (2010), TonB is not a receptor itself, but acts as a mediator of electrochemical potential transmission; Vinga et al. (2006) stated that TonB is a membrane protein required for genome entry; Letellier et al. (2004) explained that TonB is part of a protein complex involved in the energy transduction from the electron transfer chain in the cytoplasmic membrane to the outer membrane receptors and speculated that it possibly might be critical for the genome injection through its interaction with FhuA.




cRhakuba et al. (2010) mentioned proteins FhuA and TonB as the receptors for T7; Molineux (2001) reported that ‘Bayer patches’, described as adhesion sites between the cytoplasmic membrane and the outer envelope of Gram-negative bacteria, are the proposed receptors for T7.




dIn 2010 the same group suggested that the adsorption of the phage on the sugar moieties of the host is an initial interaction, and that the true receptor is a protein molecule or protein complex (Cvirkaite-Krupovic 2010).




eKdo, 2-keto-3-deoxy-octulosonic acid; Ko, D-glycero-D-talo-oct-2-ulosonic acid; Hep, heptulose (ketoheptose); Glc, glucose; Gal, galactose; GlcNAc, N-acetylglucosamine (from Filippov et al. 2011).














TABLE 3







Receptors in bacterial complexes other than cell wall structures. Host names are ordered alphabetically.











Phages
Family
Main host
Receptor(s)
References










(a) Receptors in flagella











SPN2T SPN3C
Siphoviridae

Salmonella

Flagellin protein FliC
Shin et al. (2012)


SPN8T SPN9T


SPN11T SPN13B


SPN16C


SPN4SSPN5T
Siphoviridae

Salmonella

Flagellin proteins FliC or FliB


SPN6T SPN19


iEPS5
Siphoviridae

Salmonella

Flagellal molecular ruler protein FliK
Choi et al. (2013);






Chaturongakul and Ounjai






(2014)







(b) Receptors in pili and mating pair formation structures











ϕCbK ϕCb13
Siphoviridae

Caulobacter

Initial contact between phage head
Guerrero-Ferreira et al. (2011)





crescentus

filament and host's flagellum followed





by pili portals on the cell pole


FdFff1M13
Inoviridae

Escherichia

Tip of the F pilus followed by TolQRA
Loeb (1960); Caro and Schnos





coli

complex in membrane after pilus
(1966); Russel et al. (1988);





retraction
Click and Webster (1998)


PRD1
Tectiviridae

Escherichia

Mating pair formation (Mpf) complex in
Daugelavicius et al. (1997)





coli

the membrane


ϕ6
Cystoviridae

Pseudomonas

Sides of the type IV pilus
Vidaver, Koski and Van Etten






(1973); Daugelavicius et al.






(2005)


MPK7
Podoviridae

Pseudomonas

Type IV pili (TFP)
Bae and Cho (2013)





aeruginosa



MP22
Siphoviridae

Pseudomonas

Type IV pili (TFP)
Heo et al. (2007)





aeruginosa



DMS3
Siphoviridae

Pseudomonas

Type IV pili (TFP)
Budzik et al. (2004)





aeruginosa








(c) Receptors in bacterial capsules











29
Podoviridae

Escherichia

Endoglycosidase hydrolysis in β-D-
Stirm et al. (1971); Fehmel et





coli

glucosido-(1-3)-D-glucoronic acid bonds
al. (1975)





in the capsule composed of





hexasaccharides repeating units


K11
Podoviridae

Klebsiella

Hydrolysis of β-D-glucosyl-(1-3)-β-D-
Thurow, Niemann and Stirm





glucuronic acid linkages. The phage is
(1975)





also able to cleave α-D-galactosyl-(1-3)-





β-D-glucose bonds


Vi I
Myoviridae

Salmonella

Acetyl groups of the Vi
Pickard et al. (2010)





exopolysaccharide capsule (a polymer of





α-1,4-linked N-acetyl





galactosaminuronate)


Vi II
Siphoviridae

Salmonella

Acetyl groups of the Vi





exopolysaccharide capsule (a polymer of





α-1,4-linked N-acetyl





galactosaminuronate)


Vi IIIVi IVVi VVi
Podoviridae

Salmonella

Acetyl groups of the Vi


VIVi VII


exopolysaccharide capsule (a polymer of





α-1,4-linked N-acetyl





galactosaminuronate)
















TABLE 4







Specific host receptors for Salmonella and P. aeruginosa phages.










Specific host




receptors
Reference













Flagellar proteins










S. enterica

FliC and
Shin et al. (2012)



FljB



FliK
Choi et al. (2013)









Outermembrane proteins










OmpC
Ho and Slauch (2001), Marti et al. (2013)



BtuB
Kim and Ryu (2011)



TolC
Ricci and Piddock (2010)



FhuA
Casjens et al. (2005)









Surface antigens










O-antigen
Shin et al. (2012)



Vi-antigen
Pickard et al. (2010)









Surface antigens










P. aeruginosa

O-antigen
Le et al. (2013)



Vi-antigen
Temple et al. (1986), Hanlon et al. (2001)









Type IV pili










PilA
Bae and Cho (2013), Heo et al. (2007)

















TABLE 5







Sequences


Sequences are written in 5′ to 3′ direction.









SEQ ID NO:
DESCRIPTION
SEQUENCE





1
Primer rfaDupR
ATTCGTGTCTGAGATTGTCTCTGACTCCATAATTCGAAGGTTACAGTTATGATC




ATCGTTGATATCGCTAGCTCGAGCACGTGTTGAC





2
Primer rfaDdnR
CCAAGACGGGCCGATCACCAGTATTTTCATGCAGAGCTCTTATGCGTCGCGATT




CAGCCACGTTGTAAAACGACGGCCAGTGCCAAGC





3
RfaD coding sequence
atgatcatc gttaccggcg gcgcgggctt tatcggcagc aacatcgtta



in Cla
aagccctgaa tgataaaggc atcaccgata ttctggtggt ggacaacctg



(NCBI REF:
aaagacggca ccaagtttgt gaacctggtg gatctggata tcgcggacta



NZ_CP010116.1)
tatggataag gaagacttcc tgatccagat tatggctggc gaagagttcg




gcgatgtcga agcgattttc cacgaaggtg cgtgctcttc caccaccgag




tgggacggca agtatatgat ggataacaac tatcaatact ccaaagagct




gctgcactac tgtctggagc gcgaaatccc gttcctgtat gcctcttccg




cagccaccta cggcggacgc acctccgact ttattgaatc ccgcgagtac




gaaaaaccgt tgaatgtcta cggttactca aaattcctgt ttgatgaata




tgttcgtcaa atcctgccag aagcgaactc gcagattgtt ggcttccgct




atttcaacgt ttatggaccg cgtgaaggcc ataaaggcag catggcgagc




gtcgctttcc atctcaacac tcagcttaac aacggtgaat cgccgaagct




gttcgaaggt agcgagaact tcaaacgcga cttcgtttac gtaggcgacg




tggcagatgt aaacctgtgg ttcctggaaa atggcgtttc cggcatcttc




aacctcggta ctggtcgtgc ggaatccttc caggcggtag cagatgctac




gcttgcttat cacaagaaag gccaaatcga atacattccg ttcccggata




aactgaaagg ccgctaccag gcgttcacgc aggcagatct gacaaatctg




cgcgcggcgg gttacgacaa accgttcaaa accgttgccg aaggtgtaac




ggaatacatg gcttggctga atcgcgacgc ataa





4
Zeo marker
GATATCGCTAGCTCGAGCACGTGTTGACAATTAATCATCGGCATAGTATATCGG




CATAGTATAATACGACAAGGTGAGGAACTAAACCATGGCCAAGTTGACCAGTGC




CGTTCCGGTGCTCACCGCGCGCGACGTCGCCGGAGCGGTCGAGTTCTGGACCGA




CCGGCTCGGGTTCTCCCGGGACTTCGTGGAGGACGACTTCGCCGGTGTGGTCCG




GGACGACGTGACCCTGTTCATCAGCGCGGTCCAGGACCAGGTGGTGCCGGACAA




CACCCTGGCCTGGGTGTGGGTGCGCGGCCTGGACGAGCTGTACGCCGAGTGGTC




GGAGGTCGTGTCCACGAACTTCCGGGACGCCTCCGGGCCGGCCATGACCGAGAT




CGGCGAGCAGCCGTGGGGGCGGGAGTTCGCCCTGCGCGACCCGGCCGGCAACTG




CGTGCACTTCGTGGCCGAGGAGCAGGACTGAGAATTCCCGGGGATCCTCTAGAG




TCGACCTGCAGGCATGCAAGCTTGGCACTGGCCGTCGTTTTACAACGT
















TABLE 6





Example Bacteria


Optionally, the producer cells are selected from this Table and/or the target cells are selected from this Table (eg, wherein the producer and target cells are of


a different species; or of the same species but are a different strain or the host cells are engineered but the target cells are wild-type or vice versa). For


example the producter cells are E coli and the target cells are C dificile, E coli, Akkermansia, Enterobacteriacea, Ruminococcus, Faecalibacterium,



Firmicutes, Bacteroidetes, Salmonella, Klebsiella, Pseudomonas, Acintenobacter or Streptococcus cells.





















Abiotrophia


Acidocella


Actinomyces


Alkalilimnicola


Aquaspirillum




Abiotrophia defectiva


Acidocella aminolytica


Actinomyces bovis


Alkalilimnicola ehrlichii


Aquaspirillum polymorphum




Acaricomes


Acidocella facilis


Actinomyces denticolens


Alkaliphilus


Aquaspirillum




Acaricomes phytoseiuli


Acidomonas


Actinomyces europaeus


Alkaliphilus oremlandii


putridiconchylium




Acetitomaculum


Acidomonas methanolica


Actinomyces georgiae


Alkaliphilus transvaalensis


Aquaspirillum serpens




Acetitomaculum ruminis


Acidothermus


Actinomyces gerencseriae


Allochromatium


Aquimarina




Acetivibrio


Acidothermus cellulolyticus


Actinomyces


Allochromatium vinosum


Aquimarina latercula




Acetivibrio cellulolyticus


Acidovorax


hordeovulneris


Alloiococcus


Arcanobacterium




Acetivibrio ethanolgignens


Acidovorax anthurii


Actinomyces howellii


Alloiococcus otitis


Arcanobacterium




Acetivibrio multivorans


Acidovorax caeni


Actinomyces hyovaginalis


Allokutzneria


haemolyticum




Acetoanaerobium


Acidovorax cattleyae


Actinomyces israelii


Allokutzneria albata


Arcanobacterium pyogenes




Acetoanaerobium noterae


Acidovorax citrulli


Actinomyces johnsonii


Altererythrobacter


Archangium




Acetobacter


Acidovorax defluvii


Actinomyces meyeri


Altererythrobacter ishigakiensis


Archangium gephyra




Acetobacter aceti


Acidovorax delafieldii


Actinomyces naeslundii


Altermonas


Arcobacter




Acetobacter cerevisiae


Acidovorax facilis


Actinomyces neuii


Altermonas haloplanktis


Arcobacter butzleri




Acetobacter cibinongensis


Acidovorax konjaci


Actinomyces odontolyticus


Altermonas macleodii


Arcobacter cryaerophilus




Acetobacter estunensis


Acidovorax temperans


Actinomyces oris


Alysiella


Arcobacter halophilus




Acetobacter fabarum


Acidovorax valerianellae


Actinomyces radingae


Alysiella crassa


Arcobacter nitrofigilis




Acetobacter ghanensis


Acinetobacter


Actinomyces slackii


Alysiella filiformis


Arcobacter skirrowii




Acetobacter indonesiensis


Acinetobacter baumannii


Actinomyces turicensis


Aminobacter


Arhodomonas




Acetobacter lovaniensis


Acinetobacter baylyi


Actinomyces viscosus


Aminobacter aganoensis


Arhodomonas aquaeolei




Acetobacter malorum


Acinetobacter bouvetii


Actinoplanes


Aminobacter aminovorans


Arsenophonus




Acetobacter nitrogenifigens


Acinetobacter calcoaceticus


Actinoplanes auranticolor


Aminobacter niigataensis


Arsenophonus




Acetobacter oeni


Acinetobacter gerneri


Actinoplanes brasiliensis


Aminobacterium


nasoniae




Acetobacter orientalis


Acinetobacter haemolyticus


Actinoplanes consettensis


Aminobacterium mobile


Arthrobacter




Acetobacter orleanensis


Acinetobacter johnsonii


Actinoplanes deccanensis


Aminomonas


Arthrobacter agilis




Acetobacter pasteurianus


Acinetobacter junii


Actinoplanes derwentensis


Aminomonas paucivorans


Arthrobacter albus




Acetobacter pornorurn


Acinetobacter lwoffi


Actinoplanes digitatis


Ammoniphilus


Arthrobacter aurescens




Acetobacter senegalensis


Acinetobacter parvus


Actinoplanes durhamensis


Ammoniphilus oxalaticus


Arthrobacter chlorophenolicus




Acetobacter xylinus


Acinetobacter radioresistens


Actinoplanes ferrugineus


Ammoniphilus oxalivorans


Arthrobacter citreus




Acetobacterium


Acinetobacter schindleri


Actinoplanes globisporus


Amphibacillus


Arthrobacter crystallopoietes




Acetobacterium bakii


Acinetobacter soli


Actinoplanes humidus


Amphibacillus xylanus


Arthrobacter cumminsii




Acetobacterium carbinolicum


Acinetobacter tandoii


Actinoplanes italicus


Amphritea


Arthrobacter globiformis




Acetobacterium dehalogenans


Acinetobacter tjernbergiae


Actinoplanes liguriensis


Amphritea balenae


Arthrobacter




Acetobacterium fimetarium


Acinetobacter towneri


Actinoplanes lobatus


Amphritea japonica


histidinolovorans




Acetobacterium malicum


Acinetobacter ursingii


Actinoplanes missouriensis


Amycolatopsis


Arthrobacter ilicis




Acetobacterium paludosum


Acinetobacter venetianus


Actinoplanes palleronii


Amycolatopsis alba


Arthrobacter luteus




Acetobacterium tundrae


Acrocarpospora


Actinoplanes philippinensis


Amycolatopsis albidoflavus


Arthrobacter methylotrophus




Acetobacterium wieringae


Acrocarpospora corrugata


Actinoplanes rectilineatus


Amycolatopsis azurea


Arthrobacter mysorens




Acetobacterium woodii


Acrocarpospora


Actinoplanes regularis


Amycolatopsis coloradensis


Arthrobacter nicotianae




Acetofilamentum


macrocephala


Actinoplanes


Amycolatopsis lurida


Arthrobacter nicotinovorans




Acetofilamentum rigidum


Acrocarpospora pleiomorpha


teichomyceticus


Amycolatopsis mediterranei


Arthrobacter oxydans




Acetohalobium


Actibacter


Actinoplanes utahensis


Amycolatopsis rifamycinica


Arthrobacter pascens




Acetohalobium arabaticum


Actibacter sediminis


Actinopolyspora


Amycolatopsis rubida


Arthrobacter




Acetomicrobium


Actinoalloteichus


Actinopolyspora halophila


Amycolatopsis sulphurea


phenanthrenivorans




Acetomicrobium faecale


Actinoalloteichus


Actinopolyspora mortivallis


Amycolatopsis tolypomycina


Arthrobacter




Acetomicrobium flavidum


cyanogriseus


Actinosynnema


Anabaena


polychromogenes




Acetonema


Actinoalloteichus


Actinosynnema mirum


Anabaena cylindrica


Atrhrobacter protophormiae




Acetonema longum


hymeniacidonis


Actinotalea


Anabaena flos-aquae


Arthrobacter




Acetothermus


Actinoalloteichus spitiensis


Actinotalea fermentans


Anabaena variabilis


psychrolactophilus




Acetothermus paucivorans


Actinobaccillus


Aerococcus


Anaeroarcus


Arthrobacter ramosus




Acholeplasma


Actinobacillus capsulatus


Aerococcus sanguinicola


Anaeroarcus burkinensis


Arthrobacter sulfonivorans




Acholeplasma axanthum


Actinobacillus delphinicola


Aerococcus urinae


Anaerobaculum


Arthrobacter sulfureus




Acholeplasma brassicae


Actinobacillus hominis


Aerococcus urinaeequi


Anaerobaculum mobile


Arthrobacter uratoxydans




Acholeplasma cavigenitalium


Actinobacillus indolicus


Aerococcus urinaehominis


Anaerobiospirillum


Arthrobacter ureafaciens




Acholeplasma equifetale


Actinobacillus lignieresii


Aerococcus viridans


Anaerobiospirillum


Arthrobacter viscosus




Acholeplasma granularum


Actinobacillus minor


Aeromicrobium


succiniciproducens


Arthrobacter woluwensis




Acholeplasma hippikon


Actinobacillus muris


Aeromicrobium erythreum


Anaerobiospirillum thomasii


Asaia




Acholeplasma laidlawii


Actinobacillus


Aeromonas


Anaerococcus


Asaia bogorensis




Acholeplasma modicum


pleuropneumoniae


Aeromonas


Anaerococcus hydrogenalis


Asanoa




Acholeplasma morum


Actinobacillus porcinus


allosaccharophila


Anaerococcus lactolyticus


Asanoa ferruginea




Acholeplasma multilocale


Actinobacillus rossii


Aeromonas bestiarum


Anaerococcus prevotii


Asticcacaulis




Acholeplasma oculi


Actinobacillus scotiae


Aeromonas caviae


Anaerococcus tetradius


Asticcacaulis biprosthecium




Acholeplasma palmae


Actinobacillus seminis


Aeromonas encheleia


Anaerococcus vaginalis


Asticcacaulis excentricus




Acholeplasma parvum


Actinobacillus succinogenes


Aeromonas


Anaerofustis


Atopobacter




Acholeplasma pleciae


Actinobaccillus suis


enteropelogenes


Anaerofustis stercorihominis


Atopobacter phocae




Acholeplasma vituli


Actinobacillus ureae


Aeromonas eucrenophila


Anaeromusa


Atopobium




Achromobacter


Actinobaculum


Aeromonas ichthiosmia


Anaeromusa acidaminophila


Atopobium fossor




Achromobacter denitrificans


Actinobaculum massiliense


Aeromonas jandaei


Anaeromyxobacter


Atopobium minutum




Achromobacter insolitus


Actinobaculum schaalii


Aeromonas media


Anaeromyxobacter


Atopobium parvulum




Achromobacter piechaudii


Actinobaculum suis


Aeromonas popoffii


dehalogenans


Atopobium rimae




Achromobacter ruhlandii


Actinomyces urinale


Aeromonas sobria


Anaerorhabdus


Atopobium vaginae




Achromobacter spanius


Actinocatenispora


Aeromonas veronii


Anaerorhabdus furcosa


Aureobacterium




Acidaminobacter


Actinocatenispora rupis


Agrobacterium


Anaerosinus


Aureobacterium barkeri




Acidaminobacter


Actinocatenispora


Agrobacterium


Anaerosinus glycerini


Aurobacterium




hydrogenoformans


thailandica


gelatinovorum


Anaerovirgula


Aurobacterium liquefaciens




Acidaminococcus


Actinocatenispora sera


Agrococcus


Anaerovirgula multivorans


Avibacterium




Acidaminococcus fermentans


Actinocorallia


Agrococcus citreus


Ancalomicrobium


Avibacterium avium




Acidaminococcus intestini


Actinocorallia aurantiaca


Agrococcus jenensis


Ancalomicrobium adetum


Avibacterium gallinarum




Acidicaldus


Actinocorallia aurea


Agromonas


Ancylobacter


Avibacterium paragallinarum




Acidicaldus organivorans


Actinocorallia cavernae


Agromonas oligotrophica


Ancylobacter aquaticus


Avibacterium volantium




Acidimicrobium


Actinocorallia glomerata


Agromyces


Aneurinibacillus


Azoarcus




Acidimicrobium ferrooxidans


Actinocorallia herbida


Agromyces fucosus


Aneurinibacillus aneurinilyticus


Azoarcus indigens




Acidiphilium


Actinocorallia libanotica


Agromyces hippuratus


Aneurinibacillus migulanus


Azoarcus tolulyticus




Acidiphilium acidophilum


Actinocorallia longicatena


Agromyces luteolus


Aneurinibacillus


Azoarcus toluvorans




Acidiphilium angustum


Actinomadura


Agromyces mediolanus


thermoaerophilus


Azohydromonas




Acidiphilium cryptum


Actinomadura alba


Agromyces ramosus


Angiococcus


Azohydromonas australica




Acidiphilium multivorum


Actinomadura atramentaria


Agromyces rhizospherae


Angiococcus disciformis


Azohydromonas lata




Acidiphilium organovorum


Actinomadura


Akkermansia


Angulomicrobium


Azomonas




Acidiphilium rubrum


bangladeshensis


Akkermansia muciniphila


Angulomicrobium tetraedrale


Azomonas agilis




Acidisoma


Actinomadura catellatispora


Albidiferax


Anoxybacillus


Azomonas insignis




Acidisoma sibiricum


Actinomadura chibensis


Albidiferax ferrireducens


Anoxybacillus pushchinoensis


Azomonas macrocytogenes




Acidisoma tundrae


Actinomadura chokoriensis


Albidovulum


Aquabacterium


Azorhizobium




Acidisphaera


Actinomadura citrea


Albidovulum inexpectatum


Aquabacterium commune


Azorhizobium caulinodans




Acidisphaera rubrifaciens


Actinomadura coerulea


Alcaligenes


Aquabacterium parvum


Azorhizophilus




Acidithiobacillus


Actinomadura echinospora


Alcaligenes denitrificans



Azorhizophilus paspali




Acidithiobacillus albertensis


Actinomadura fibrosa


Alcaligenes faecalis



Azospirillum




Acidithiobacillus caldus


Actinomadura formosensis


Alcanivorax



Azospirillum brasilense




Acidithiobacillus ferrooxidans


Actinomadura hibisca


Alcanivorax borkumensis



Azospirillum halopraeferens




Acidithiobacillus thiooxidans


Actinomadura kijaniata


Alcanivorax jadensis



Azospirillum irakense




Acidobacterium


Actinomadura latina


Algicola



Azotobacter




Acidobacterium capsulatum


Actinomadura livida


Algicola bacteriolytica



Azotobacter beijerinckii





Actinomadura


Alicyclobacillus



Azotobacter chroococcum





luteofluorescens


Alicyclobacillus



Azotobacter nigricans





Actinomadura macra


disulfidooxidans



Azotobacter salinestris





Actinomadura madurae


Alicyclobacillus



Azotobacter vinelandii





Actinomadura oligospora


sendaiensis





Actinomadura pelletieri


Alicyclobacillus vulcanalis





Actinomadura rubrobrunea


Alishewanella





Actinomadura rugatobispora


Alishewanella fetalis





Actinomadura umbrina


Alkalibacillus





Actinomadura


Alkalibacillus





verrucosospora


haloalkaliphilus





Actinomadura vinacea





Actinomadura viridilutea





Actinomadura viridis





Actinomadura yumaensis




Bacillus


Bacteroides


Bibersteinia


Borrelia


Brevinema



[see below]

Bacteroides caccae


Bibersteinia trehalosi


Borrelia afzelii


Brevinema andersonii




Bacteriovorax


Bacteroides coagulans


Bifidobacterium


Borrelia americana


Brevundimonas




Bacteriovorax stolpii


Bacteroides eggerthii


Bifidobacterium adolescentis


Borrelia burgdorferi


Brevundimonas alba





Bacteroides fragilis


Bifidobacterium angulatum


Borrelia carolinensis


Brevundimonas aurantiaca





Bacteroides galacturonicus


Bifidobacterium animalis


Borrelia coriaceae


Brevundimonas diminuta





Bacteroides helcogenes


Bifidobacterium asteroides


Borrelia garinii


Brevundimonas intermedia





Bacteroides ovatus


Bifidobacterium bifidum


Borrelia japonica


Brevundimonas subvibrioides





Bacteroides pectinophilus


Bifidobacterium boum


Bosea


Brevundimonas vancanneytii





Bacteroides pyogenes


Bifidobacterium breve


Bosea minatitlanensis


Brevundimonas variabilis





Bacteroides salyersiae


Bifidobacterium catenulatum


Bosea thiooxidans


Brevundimonas vesicularis





Bacteroides stercoris


Bifidobacterium choerinum


Brachybacterium


Brochothrix





Bacteroides suis


Bifidobacterium coryneforme


Brachybacterium


Brochothrix campestris





Bacteroides tectus


Bifidobacterium cuniculi


alimentarium


Brochothrix thermosphacta





Bacteroides thetaiotaomicron


Bifidobacterium dentium


Brachybacterium faecium


Brucella





Bacteroides uniformis


Bifidobacterium gallicum


Brachybacterium


Brucella canis





Bacteroides ureolyticus


Bifidobacterium gallinarum


paraconglomeratum


Brucella neotomae





Bacteroides vulgatus


Bifidobacterium indicum


Brachybacterium rhamnosum


Bryobacter





Balnearium


Bifidobacterium longum


Brachybacterium


Bryobacter aggregatus





Balnearium lithotrophicum


Bifidobacterium


tyrofermentans


Burkholderia





Balneatrix


magnumBifidobacterium


Brachyspira


Burkholderia ambifaria





Balneatrix alpica


merycicum


Brachyspira alvinipulli


Burkholderia andropogonis





Balneola


Bifidobacterium minimum


Brachyspira hyodysenteriae


Burkholderia anthina





Balneola vulgaris


Bifidobacterium


Brachyspira innocens


Burkholderia caledonica





Barnesiella


pseudocatenulatum


Brachyspira murdochii


Burkholderia caryophylli





Barnesiella viscericola


Bifidobacterium


Brachyspira


Burkholderia cenocepacia





Bartonella


pseudolongum


pilosicoli


Burkholderia cepacia





Bartonella alsatica


Bifidobacterium pullorum


Bradyrhizobium


Burkholderia cocovenenans





Bartonella bacilliformis


Bifidobacterium ruminantium


Bradyrhizobium canariense


Burkholderia dolosa





Bartonella clarridgeiae


Bifidobacterium saeculare


Bradyrhizobium elkanii


Burkholderia fungorum





Bartonella doshiae


Bifidobacterium subtile


Bradyrhizobium japonicum


Burkholderia glathei





Bartonella elizabethae


Bifidobacterium


Bradyrhizobium liaoningense


Burkholderia glumae





Bartonella grahamii


thermophilum


Brenneria


Burkholderia graminis





Bartonella henselae


Bilophila


Brenneria alni


Burkholderia kururiensis





Bartonella rochalimae


Bilophila wadsworthia


Brenneria nigrifluens


Burkholderia multivorans





Bartonella vinsonii


Biostraticola


Brenneria quercina


Burkholderia phenazinium





Bavariicoccus


Biostraticola tofi


Brenneria quercina


Burkholderia plantarii





Bavariicoccus seileri


Bizionia


Brenneria salicis


Burkholderia pyrrocinia





Bdellovibrio


Bizionia argentinensis


Brevibacillus


Burkholderia silvatlantica





Bdellovibrio bacteriovorus


Blastobacter


Brevibacillus agri


Burkholderia stabilis





Bdellovibrio exovorus


Blastobacter capsulatus


Brevibacillus borstelensis


Burkholderia thailandensis





Beggiatoa


Blastobacter denitrificans


Brevibacillus brevis


Burkholderia tropica





Beggiatoa alba


Blastococcus


Brevibacillus centrosporus


Burkholderia unamae





Beijerinckia


Blastococcus aggregatus


Brevibacillus choshinensis


Burkholderia vietnamiensis





Beijerinckia derxii


Blastococcus saxobsidens


Brevibacillus invocatus


Buttiauxella





Beijerinckia fluminensis


Blastochloris


Brevibacillus laterosporus


Buttiauxella agrestis





Beijerinckia indica


Blastochloris viridis


Brevibacillus parabrevis


Buttiauxella brennerae





Beijerinckia mobilis


Blastomonas


Brevibacillus reuszeri


Buttiauxella ferragutiae





Belliella


Blastomonas natatoria


Brevibacterium


Buttiauxella gaviniae





Belliella baltica


Blastopirellula


Brevibacterium abidum


Buttiauxella izardii





Bellilinea


Blastopirellula marina


Brevibacterium album


Buttiauxella noackiae





Bellilinea caldifistulae


Blautia


Brevibacterium aurantiacum


Buttiauxella warmboldiae





Belnapia


Blautia coccoides


Brevibacterium celere


Butyrivibrio





Belnapia moabensis


Blautia hansenii


Brevibacterium epidermidis


Butyrivibrio fibrisolvens





Bergeriella


Blautia producta


Brevibacterium


Butyrivibrio hungatei





Bergeriella denitrificans


Blautia wexlerae


frigoritolerans


Butyrivibrio proteoclasticus





Beutenbergia


Bogoriella


Brevibacterium halotolerans





Beutenbergia cavernae


Bogoriella caseilytica


Brevibacterium iodinum






Bordetella


Brevibacterium linens






Bordetella avium


Brevibacterium lyticum






Bordetella bronchiseptica


Brevibacterium mcbrellneri






Bordetella hinzii


Brevibacterium otitidis






Bordetella holmesii


Brevibacterium oxydans






Bordetella parapertussis


Brevibacterium paucivorans






Bordetella pertussis


Brevibacterium stationis






Bordetella petrii






Bordetella trematum




Bacillus




B. acidiceler


B. aminovorans


B. glucanolyticus


B. taeanensis


B. lautus




B. acidicola


B. amylolyticus


B. gordonae


B. tequilensis


B. lehensis




B. acidiproducens


B. andreesenii


B. gottheilii


B. thermantarcticus


B. lentimorbus




B. acidocaldarius


B. aneurinilyticus


B. graminis


B. thermoaerophilus


B. lentus




B. acidoterrestris


B. anthracis


B. halmapalus


B. thermoamylovorans


B. licheniformis




B. aeolius


B. aquimaris


B. haloalkaliphilus


B. thermocatenulatus


B. ligniniphilus




B. aerius


B. arenosi


B. halochares


B. thermocloacae


B. litoralis




B. aerophilus


B. arseniciselenatis


B. halodenitrificans


B. thermocopriae


B. locisalis




B. agaradhaerens


B. arsenicus


B. halodurans


B. thermodenitrificans


B. luciferensis




B. agri


B. aurantiacus


B. halophilus


B. thermoglucosidasius


B. luteolus




B. aidingensis


B. arvi


B. halosaccharovorans


B. thermolactis


B. luteus




B. akibai


B. aryabhattai


B. hemicellulosilyticus


B. thermoleovorans


B. macauensis




B. alcalophilus


B. asahii


B. hemicentroti


B. thermophilus


B. macerans




B. algicola


B. atrophaeus


B. herbersteinensis


B. thermoruber


B. macquariensis




B. alginolyticus


B. axarquiensis


B. horikoshii


B. thermosphaericus


B. macyae




B. alkalidiazotrophicus


B. azotofixans


B. horneckiae


B. thiaminolyticus


B. malacitensis




B. alkalinitrilicus


B. azotoformans


B. horti


B. thioparans


B. mannanilyticus




B. alkalisediminis


B. badius


B. huizhouensis


B. thuringiensis


B. marisflavi




B. alkalitelluris


B. barbaricus


B. humi


B. tianshenii


B. marismortui




B. altitudinis


B. bataviensis


B. hwajinpoensis


B. trypoxylicola


B. marmarensis




B. alveayuensis


B. beijingensis


B. idriensis


B. tusciae


B. massiliensis




B. alvei


B. benzoevorans


B. indicus


B. validus


B. megaterium




B. amyloliquefaciens


B. beringensis


B. infantis


B. vallismortis


B. mesonae



B.

B. berkeleyi


B. infernus


B. vedderi


B. methanolicus



a. subsp. amyloliquefaciens

B. beveridgei


B. insolitus


B. velezensis


B. methylotrophicus



B. a. subsp. plantarum

B. bogoriensis


B. invictae


B. vietnamensis


B. migulanus





B. boroniphilus


B. iranensis


B. vireti


B. mojavensis




B. dipsosauri


B. borstelensis


B. isabeliae


B. vulcani


B. mucilaginosus




B. drentensis


B. brevis Migula


B. isronensis


B. wakoensis


B. muralis




B. edaphicus


B. butanolivorans


B. jeotgali


B. weihenstephanensis


B. murimartini




B. ehimensis


B. canaveralius


B. kaustophilus


B. xiamenensis


B. mycoides




B. eiseniae


B. carboniphilus


B. kobensis


B. xiaoxiensis


B. naganoensis




B. enclensis


B. cecembensis


B. kochii


B. zhanjiangensis


B. nanhaiensis




B. endophyticus


B. cellulosilyticus


B. kokeshiiformis


B. peoriae


B. nanhaiisediminis




B. endoradicis


B. centrosporus


B. koreensis


B. persepolensis


B. nealsonii




B. farraginis


B. cereus


B. korlensis


B. persicus


B. neidei




B. fastidiosus


B. chagannorensis


B. kribbensis


B. pervagus


B. neizhouensis




B. fengqiuensis


B. chitinolyticus


B. krulwichiae


B. plakortidis


B. niabensis




B. firmus


B. chondroitinus


B. laevolacticus


B. pocheonensis


B. niacini




B. flexus


B. choshinensis


B. larvae


B. polygoni


B. novalis




B. foraminis


B. chungangensis


B. laterosporus


B. polymyxa


B. oceanisediminis




B. fordii


B. cibi


B. salexigens


B. popilliae


B. odysseyi




B. formosus


B. circulans


B. saliphilus


B. pseudalcalophilus


B. okhensis




B. fortis


B. clarkii


B. schlegelii


B. pseudofirmus


B. okuhidensis




B. fumarioli


B. clausii


B. sediminis


B. pseudomycoides


B. oleronius




B. funiculus


B. coagulans


B. selenatarsenatis


B. psychrodurans


B. oryzaecorticis




B. fusiformis


B. coahuilensis


B. selenitireducens


B. psychrophilus


B. oshimensis




B. galactophilus


B. cohnii


B. seohaeanensis


B. psychrosaccharolyticus


B. pabuli




B. galactosidilyticus


B. composti


B. shacheensis


B. psychrotolerans


B. pakistanensis




B. galliciensis


B. curdlanolyticus


B. shackletonii


B. pulvifaciens


B. pallidus




B. gelatini


B. cycloheptanicus


B. siamensis


B. pumilus


B. pallidus




B. gibsonii


B. cytotoxicus


B. silvestris


B. purgationiresistens


B. panacisoli




B. ginsengi


B. daliensis


B. simplex


B. pycnus


B. panaciterrae




B. ginsengihumi


B. decisifrondis


B. siralis


B. qingdaonensis


B. pantothenticus




B. ginsengisoli


B. decolorationis


B. smithii


B. qingshengii


B. parabrevis




B. globisporus (eg, B.


B. deserti


B. soli


B. reuszeri


B. paraflexus



g. subsp. Globisporus; or B.


B. solimangrovi


B. rhizosphaerae


B. pasteurii



g. subsp. Marinus)


B. solisalsi


B. rigui


B. patagoniensis






B. songklensis


B. ruris






B. sonorensis


B. safensis






B. sphaericus


B. salarius






B. sporothermodurans






B. stearothermophilus






B. stratosphericus






B. subterraneus






B. subtilis (eg, B.





s. subsp. Inaquosorum, or B.




s. subsp. Spizizenr, or B.




s. subsp. Subtilis)



Caenimonas


Campylobacter


Cardiobacterium


Catenuloplanes


Curtobacterium




Caenimonas koreensis


Campylobacter coli


Cardiobacterium hominis


Catenuloplanes atrovinosus


Curtobacterium albidum




Caldalkalibacillus


Campylobacter concisus


Carnimonas


Catenuloplanes castaneus


Curtobacterium citreus




Caldalkalibacillus uzonensis


Campylobacter curvus


Carnimonas nigrificans


Catenuloplanes crispus




Caldanaerobacter


Campylobacter fetus


Carnobacterium


Catenuloplanes indicus




Caldanaerobacter subterraneus


Campylobacter gracilis


Carnobacterium alterfunditum


Catenuloplanes japonicus




Caldanaerobius


Campylobacter helveticus


Carnobacterium divergens


Catenuloplanes nepalensis




Caldanaerobius fijiensis


Campylobacter hominis


Carnobacterium funditum


Catenuloplanes niger




Caldanaerobius


Campylobacter hyointestinalis


Carnobacterium gallinarum


Chryseobacterium




polysaccharolyticus


Campylobacter jejuni


Carnobacterium


Chryseobacterium




Caldanaerobius zeae


Campylobacter lari


maltaromaticum


balustinum




Caldanaerovirga


Campylobacter mucosalis


Carnobacterium mobile


Citrobacter




Caldanaerovirga acetigignens


Campylobacter rectus


Carnobacterium viridans


C. amalonaticus




Caldicellulosiruptor


Campylobacter showae


Caryophanon


C. braakii




Caldicellulosiruptor bescii


Campylobacter sputorum


Caryophanon latum


C. diversus




Caldicellulosiruptor kristjanssonii


Campylobacter upsaliensis


Caryophanon tenue


C. farmeri




Caldicellulosiruptor owensensis


Capnocytophaga


Catellatospora


C. freundii





Capnocytophaga canimorsus


Catellatospora citrea


C. gillenii





Capnocytophaga cynodegmi


Catellatospora


C. koseri





Capnocytophaga gingivalis


methionotrophica


C. murliniae





Capnocytophaga granulosa


Catenococcus


C. pasteurii
[1]





Capnocytophaga haemolytica


Catenococcus thiocycli


C. rodentium





Capnocytophaga ochracea



C. sedlakii





Capnocytophaga sputigena



C. werkmanii







C. youngae







Clostridium






(see below)






Coccochloris







Coccochloris elabens







Corynebacterium







Corynebacterium flavescens







Corynebacterium variabile




Clostridium









Clostridium absonum, Clostridium aceticum, Clostridium acetireducens, Clostridium acetobutylicum, Clostridium acidisoli, Clostridium aciditolerans, Clostridium acidurici, Clostridium aerotolerans, Clostridium




aestuarii, Clostridium akagii, Clostridium aldenense, Clostridium aldrichii, Clostridium algidicarni, Clostridium algidixylanolyticum, Clostridium algifaecis, Clostridium algoriphilum, Clostridium alkalicellulosi,




Clostridium aminophilum, Clostridium aminovalericum, Clostridium amygdalinum, Clostridium amylolyticum, Clostridium arbusti, Clostridium arcticum, Clostridium argentinense, Clostridium asparagiforme,




Clostridium aurantibutyricum, Clostridium autoethanogenum, Clostridium baratii, Clostridium barkeri, Clostridium bartlettii, Clostridium beijerinckii, Clostridium bifermentans, Clostridium bolteae, Clostridium




bornimense, Clostridium botulinum, Clostridium bowmanii, Clostridium bryantii, Clostridium butyricum, Clostridium cadaveris, Clostridium caenicola, Clostridium caminithermale, Clostridium carboxidivorans,




Clostridium carnis, Clostridium cavendishii, Clostridium celatum, Clostridium celerecrescens, Clostridium cellobioparum, Clostridium cellulofermentans, Clostridium cellulolyticum, Clostridium cellulosi,




Clostridium cellulovorans, Clostridium chartatabidum, Clostridium chauvoei, Clostridium chromiireducens, Clostridium citroniae, Clostridium clariflavum, Clostridium clostridioforme, Clostridium coccoides,




Clostridium cochlearium, Clostridium colletant, Clostridium colicanis, Clostridium colinum, Clostridium collagenovorans, Clostridium cylindrosporum, Clostridium difficile, Clostridium diolis, Clostridium




disporicum, Clostridium drakei, Clostridium durum, Clostridium estertheticum, Clostridium estertheticum estertheticum, Clostridium estertheticum laramiense, Clostridium fallax, Clostridium felsineum, Clostridium




fervidum, Clostridium fimetarium, Clostridium formicaceticum, Clostridium frigidicarnis, Clostridium frigoris, Clostridium ganghwense, Clostridium gasigenes, Clostridium ghonii, Clostridium glycolicum,




Clostridium glycyrrhizinilyticum, Clostridium grantii, Clostridium haemolyticum, Clostridium halophilum, Clostridium hastiforme, Clostridium hathewayi, Clostridium herbivorans, Clostridium hiranonis,




Clostridium histolyticum, Clostridium homopropionicum, Clostridium huakuii, Clostridium hungatei, Clostridium hydrogeniformans, Clostridium hydroxybenzoicum, Clostridium hylemonae, Clostridium jejuense,




Clostridium indolis, Clostridium innocuum, Clostridium intestinale, Clostridium irregulare, Clostridium isatidis, Clostridium josui, Clostridium kluyveri, Clostridium lactatifermentans, Clostridium lacusfryxellense,




Clostridium laramiense, Clostridium lavalense, Clostridium lentocellum, Clostridium lentoputrescens, Clostridium leptum, Clostridium limosum, Clostridium litorale, Clostridium lituseburense, Clostridium ljungdahlii,




Clostridium lortetii, Clostridium lundense, Clostridium magnum, Clostridium malenominatum, Clostridium mangenotii, Clostridium mayombei, Clostridium methoxybenzovorans, Clostridium methylpentosum,




Clostridium neopropionicum, Clostridium nexile, Clostridium nitrophenolicum, Clostridium novyi, Clostridium oceanicum, Clostridium orbiscindens, Clostridium oroticum, Clostridium oxalicum, Clostridium




papyrosolvens, Clostridium paradoxum, Clostridium paraperfringens (Alias: C. welchii), Clostridium paraputrificum, Clostridium pascui, Clostridium pasteurianum, Clostridium peptidivorans, Clostridium perenne,




Clostridium perfringens, Clostridium pfennigii, Clostridium phytofermentans, Clostridium piliforme, Clostridium polysaccharolyticum, Clostridium populeti, Clostridium propionicum, Clostridium proteoclasticum,




Clostridium proteolyticum, Clostridium psychrophilum, Clostridium puniceum, Clostridium purinilyticum, Clostridium putrefaciens, Clostridium putrificum, Clostridium quercicolum, Clostridium quinii,




Clostridium ramosum, Clostridium rectum, Clostridium roseum, Clostridium saccharobutylicum, Clostridium saccharogumia, Clostridium saccharolyticum, Clostridium saccharoperbutylacetonicum, Clostridium




sardiniense, Clostridium sartagoforme, Clostridium scatologenes, Clostridium schirmacherense, Clostridium scindens, Clostridium septicum, Clostridium sordellii, Clostridium sphenoides, Clostridium spiroforme,




Clostridium sporogenes, Clostridium sporosphaeroides, Clostridium stercorarium, Clostridium stercorarium leptospartum, Clostridium stercorarium stercorarium, Clostridium stercorarium thermolacticum,




Clostridium sticklandii, Clostridium straminisolvens, Clostridium subterminale, Clostridium sufflavum, Clostridium sulfidigenes, Clostridium symbiosum, Clostridium tagluense, Clostridium




tepidiprofundi, Clostridium termitidis, Clostridium tertium, Clostridium tetani, Clostridium tetanomorphum, Clostridium thermaceticum, Clostridium thermautotrophicum, Clostridium thermoalcaliphilum,




Clostridium thermobutyricum, Clostridium thermocellum, Clostridium thermocopriae, Clostridium thermohydrosulfuricum, Clostridium thermolacticum, Clostridium thermopalmarium,




Clostridium thermopapyrolyticum, Clostridium thermosaccharolyticum, Clostridium thermosuccinogenes, Clostridium thermosulfurigenes, Clostridium thiosulfatireducens, Clostridium tyrobutyricum,




Clostridium uliginosum, Clostridium ultunense, Clostridium villosum, Clostridium vincentii, Clostridium viride, Clostridium xylanolyticum, Clostridium xylanovorans













Dactylosporangium


Deinococcus


Delftia


Echinicola





Dactylosporangium aurantiacum


Deinococcus aerius


Delftia acidovorans


Echinicola pacifica




Dactylosporangium fulvum


Deinococcus apachensis


Desulfovibrio


Echinicola vietnamensis




Dactylosporangium matsuzakiense


Deinococcus aquaticus


Desulfovibrio desulfuricans




Dactylosporangium roseum


Deinococcus aquatilis


Diplococcus




Dactylosporangium thailandense


Deinococcus caeni


Diplococcus pneumoniae




Dactylosporangium vinaceum


Deinococcus radiodurans





Deinococcus radiophilus




Enterobacter


Enterobacter kobei


Faecalibacterium


Flavobacterium




E. aerogenes


E. ludwigii


Faecalibacterium prausnitzii


Flavobacterium antarcticum




E. amnigemis


E. mori


Fangia


Flavobacterium aquatile




E. agglomerans


E. nimipressuralis


Fangia hongkongensis


Flavobacterium aquidurense




E. arachidis


E. oryzae


Fastidiosipila


Flavobacterium balustinum




E. asburiae


E. pulveris


Fastidiosipila sanguinis


Flavobacterium croceum




E. cancerogenous


E. pyrinus


Fusobacterium


Flavobacterium cucumis




E. cloacae


E. radicincitans


Fusobacterium nucleatum


Flavobacterium daejeonense




E. cowanii


E. taylorae



Flavobacterium defluvii




E. dissolvens


E. turicensis



Flavobacterium degerlachei




E. gergoviae


E. sakazakii Enterobacter soli



Flavobacterium




E. helveticus


Enterococcus



denitrificans




E. hormaechei


Enterococcus durans



Flavobacterium filum




E. intermedins


Enterococcus faecalis



Flavobacterium flevense





Enterococcus faecium



Flavobacterium frigidarium





Erwinia



Flavobacterium mizutaii





Erwinia hapontici



Flavobacterium





Escherichia



okeanokoites





Escherichia coli




Gaetbulibacter


Haemophilus


Ideonella


Janibacter




Gaetbulibacter saemankumensis


Haemophilus aegyptius


Ideonella azotifigens


Janibacter anophelis




Gallibacterium


Haemophilus aphrophilus


Idiomarina


Janibacter corallicola




Gallibacterium anatis


Haemophilus felis


Idiomarina abyssalis


Janibacter limosus




Gallicola


Haemophilus gallinarum


Idiomarina baltica


Janibacter melonis




Gallicola barnesae


Haemophilus haemolyticus


Idiomarina fontislapidosi


Janibacter terrae




Garciella


Haemophilus influenzae


Idiomarina loihiensis


Jannaschia




Garciella nitratireducens


Haemophilus paracuniculus


Idiomarina ramblicola


Jannaschia cystaugens




Geobacillus


Haemophilus parahaemolyticus


Idiomarina seosinensis


Jannaschia helgolandensis




Geobacillus thermoglucosidasius


Haemophilus parainfluenzae


Idiomarina zobellii


Jannaschia




Geobacillus stearothermophilus


Haemophilus


Ignatzschineria


pohangensis




Geobacter


paraphrohaemolyticus


Ignatzschineria


Jannaschia rubra




Geobacter bemidjiensis


Haemophilus parasuis


larvae


Janthinobacterium




Geobacter bremensis


Haemophilus pittmaniae


Ignavigranum


Janthinobacterium




Geobacter chapellei


Hafnia


Ignavigranum ruoffiae


agaricidamnosum




Geobacter grbiciae


Hafnia alvei


Ilumatobacter


Janthinobacterium lividum




Geobacter hydrogenophilus


Hahella


Ilumatobacter fluminis


Jejuia




Geobacter lovleyi


Hahella ganghwensis


Ilyobacter


Jejuia pallidilutea




Geobacter metallireducens


Halalkalibacillus


Ilyobacter delafieldii


Jeotgalibacillus




Geobacter pelophilus


Halalkalibacillus halophilus


Ilyobacter insuetus


Jeotgalibacillus




Geobacter pickeringii


Helicobacter


Ilyobacter polytropus


alimentarius




Geobacter sulfurreducens


Helicobacter pylori


Ilyobacter tartaricus


Jeotgalicoccus




Geodermatophilus




Jeotgalicoccus halotolerans




Geodermatophilus obscurus




Gluconacetobacter




Gluconacetobacter xylinus




Gordonia




Gordonia rubripertincta




Kaistia


Labedella


Listeria ivanovii


Micrococcus


Nesterenkonia




Kaistia adipata


Labedella gwakjiensis


L. marthii


Micrococcus luteus


Nesterenkonia holobia




Kaistia soli


Labrenzia


L. monocytogenes


Micrococcus lylae


Nocardia




Kangiella


Labrenzia aggregata


L. newyorkensis


Moraxella


Nocardia argentinensis




Kangiella aquimarina


Labrenzia alba


L. riparia


Moraxella bovis


Nocardia corallina




Kangiella


Labrenzia alexandrii


L. rocourtiae


Moraxella nonliquefaciens


Nocardia




koreensis


Labrenzia marina


L. seeligeri


Moraxella osloensis


otitidiscaviarum




Kerstersia


Labrys


L. weihenstephanensis


Nakamurella




Kerstersia gyiorum


Labrys methylaminiphilus


L. welshimeri


Nakamurella multipartita




Kiloniella


Labrys miyagiensis


Listonella


Nannocystis




Kiloniella laminariae


Labrys monachus


Listonella anguillarum


Nannocystis pusilia




Klebsiella


Labrys okinawensis


Macrococcus


Natranaerobius




K. gramilomatis


Labrys


Macrococcus bovicus


Natranaerobius




K. oxytoca


portucalensis


Marinobacter


thermophilus




K. pneumoniae


Lactobacillus


Marinobacter algicola


Natranaerobius trueperi




K. terrigena

[see below]

Marinobacter bryozoorum


Naxibacter




K. variicola


Laceyella


Marinobacter flavimaris


Naxibacter alkalitolerans




Kluyvera


Laceyella putida


Meiothermus


Neisseria




Kluyvera ascorbata


Lechevalieria


Meiothermus ruber


Neisseria cinerea




Kocuria


Lechevalieria aerocolonigenes


Methylophilus


Neisseria denitrificans




Kocuria roasea


Legionella


Methylophilus methylotrophus


Neisseria gonorrhoeae




Kocuria varians

[see below]

Microbacterium


Neisseria lactamica




Kurthia


Listeria


Microbacterium


Neisseria mucosa




Kurthia zopfii


L. aquatica


ammoniaphilum


Neisseria sicca





L. booriae


Microbacterium arborescens


Neisseria subflava





L. cornellensis


Microbacterium liquefaciens


Neptunomonas





L. fleischmannii


Microbacterium oxydans


Neptunomonas japonica





L. floridensis





L. grandensis





L. grayi





L. innocua




Lactobacillus




L. acetotolerans


L. catenaformis


L. mali


L. parakefiri


L. sakei




L. acidifarinae


L. ceti


L. manihotivorans


L. paralimentarius


L. salivarius




L. acidipiscis


L. coleohominis


L. mindensis


L. paraplantarum


L. sanfranciscensis




L. acidophilus


L. collinoides


L. mucosae


L. pentosus


L. satsumensis




Lactobacillus agilis


L. composti


L. murinus


L. perolens


L. secaliphilus




L. algidus


L. concavus


L. nagelii


L. plantarum


L. sharpeae




L. alimentarius


L. coryniformis


L. namurensis


L. pontis


L. siliginis




L. amylolyticus


L. crispatus


L. nantensis


L. protectus


L. spicheri




L. amylophilus


L. crustorum


L. oligofermentans


L. psittaci


L. suebicus




L. amylotrophicus


L. curvatus


L. oris


L. rennini


L. thailandensis




L. amylovorus


L. delbrueckii subsp. bulgaricus


L. panis


L. reuteri


L. ultunensis




L. animalis


L. delbrueckii subsp.


L. pantheris


L. rhamnosus


L. vaccinostercus




L. antri


delbrueckii


L. parabrevis


L. rimae


L. vaginalis




L. apodemi


L. delbrueckii subsp. lactis


L. parabuchneri


L. rogosae


L. versmoldensis




L. aviarius


L. dextrinicus


L. paracasei


L. rossiae


L. vini




L. bifermentans


L. diolivorans


L. paracollinoides


L. ruminis


L. vitulinus




L. brevis


L. equi


L. parafarraginis


L. saerimneri


L. zeae




L. buchneri


L. equigenerosi


L. homohiochii


L. jensenii


L. zymae




L. camelliae


L. farraginis


L. iners


L. johnsonii


L. gastricus




L. casei


L. farciminis


L. ingluviei


L. kalixensis


L. ghanensis




L. kitasatonis


L. fermentum


L. intestinalis


L. kefiranofaciens


L. graminis




L. kunkeei


L. fornicalis


L. fuchuensis


L. kefiri


L. hammesii




L. leichmannii


L. fructivorans


L. gallinarum


L. kimchii


L. hamsteri




L. lindneri


L. frumenti


L. gasseri


L. helveticus


L. harbinensis




L. malefermentans




L. hilgardii


L. hayakitensis




Legionella




Legionella adelaidensis


Legionella drancourtii


Candidatus Legionella jeonii


Legionella quinlivanii




Legionella anisa


Legionella dresdenensis


Legionella jordanis


Legionella rowbothamii




Legionella beliardensis


Legionella drozanskii


Legionella lansingensis


Legionella rubrilucens




Legionella birminghamensis


Legionella dumoffii


Legionella londiniensis


Legionella sainthelensi




Legionella bozemanae


Legionella erythra


Legionella longbeachae


Legionella santicrucis




Legionella brunensis


Legionella fairfieldensis


Legionella lytica


Legionella shakespearei




Legionella busanensis


Legionella fallonii


Legionella maceachernii


Legionella spiritensis




Legionella cardiaca


Legionella feeleii


Legionella massiliensis


Legionella steelei




Legionella cherrii


Legionella geestiana


Legionella micdadei


Legionella steigerwaltii




Legionella cincinnatiensis


Legionella genomospecies


Legionella monrovica


Legionella taurinensis




Legionella clemsonensis


Legionella gormanii


Legionella moravica


Legionella tucsonensis




Legionella donaldsonii


Legionella gratiana


Legionella nagasakiensis


Legionella tunisiensis





Legionella gresilensis


Legionella nautarum


Legionella wadsworthii





Legionella hackeliae


Legionella norrlandica


Legionella waltersii





Legionella impletisoli


Legionella oakridgensis


Legionella worsleiensis





Legionella israelensis


Legionella parisiensis


Legionella yabuuchiae





Legionella jamestowniensis


Legionella pittsburghensis






Legionella pneumophila






Legionella quateirensis




Oceanibulbus


Paenibacillus


Prevotella


Quadrisphaera




Oceanibulbus indolifex


Paenibacillus thiaminolyticus


Prevotella albensis


Quadrisphaera




Oceanicaulis


Pantoea


Prevotella amnii


granulorum




Oceanicaulis alexandrii


Pantoea


Prevotella bergensis


Quatrionicoccus




Oceanicola


agglomerans


Prevotella bivia


Quatrionicoccus




Oceanicola batsensis


Paracoccus


Prevotella brevis


australiensis




Oceanicola granulosus


Paracoccus alcaliphilus


Prevotella bryantii


Quinella




Oceanicola nanhaiensis


Paucimonas


Prevotella buccae


Quinella




Oceanimonas


Paucimonas lemoignei


Prevotella buccalis


ovalis




Oceanimonas baumannii


Pectobacterium


Prevotella copri


Ralstonia




Oceaniserpentilla


Pectobacterium aroidearum


Prevotella dentalis


Ralstonia eutropha




Oceaniserpentilla haliotis


Pectobacterium atrosepticum


Prevotella denticola


Ralstonia insidiosa




Oceanisphaera


Pectobacterium betavasculorum


Prevotella disiens


Ralstonia mannitolilytica




Oceanisphaera donghaensis


Pectobacterium cacticida


Prevotella histicola


Ralstonia pickettii




Oceanisphaera litoralis


Pectobacterium carnegieana


Prevotella intermedia


Ralstonia




Oceanithermus


Pectobacterium carotovorum


Prevotella maculosa


pseudosolanacearum




Oceanithermus desulfurans


Pectobacterium chrysanthemi


Prevotella marshii


Ralstonia syzygii




Oceanithermus profundus


Pectobacterium cypripedii


Prevotella melaninogenica


Ralstonia solanacearum




Oceanobacillus


Pectobacterium rhapontici


Prevotella micans


Ramlibacter




Oceanobacillus caeni


Pectobacterium wasabiae


Prevotella multiformis


Ramlibacter henchirensis




Oceanospirillum


Planococcus


Prevotella nigrescens


Ramlibacter




Oceanospirillum linum


Planococcus citreus


Prevotella oralis


tataouinensis





Planomicrobium


Prevotella oris


Raoultella





Planomicrobium okeanokoites


Prevotella oulorum


Raoultella ornithinolytica





Plesiomonas


Prevotella pallens


Raoultella planticola





Plesiomonas shigelloides


Prevotella salivae


Raoultella terrigena





Proteus


Prevotella stercorea


Rathayibacter





Proteus vulgaris


Prevotella tannerae


Rathayibacter caricis






Prevotella timonensis


Rathayibacter festucae






Prevotella veroralis


Rathayibacter iranicus






Providencia


Rathayibacter rathayi






Providencia stuartii


Rathayibacter toxicus






Pseudomonas


Rathayibacter tritici






Pseudomonas aeruginosa


Rhodobacter






Pseudomonas alcaligenes


Rhodobacter sphaeroides






Pseudomonas anguillispetica


Ruegeria






Pseudomonas fluorescens


Ruegeria gelatinovorans






Pseudoalteromonas






haloplanktis






Pseudomonas mendocina






Pseudomonas






pseudoalcaligenes






Pseudomonas putida






Pseudomonas tutzeri






Pseudomonas syringae






Psychrobacter






Psychrobacter faecalis






Psychrobacter






phenylpyruvicus




Saccharococcus


Sagittula


Sanguibacter


Stenotrophomonas


Tatlockia




Saccharococcus thermophilus


Sagittula stellata


Sanguibacter keddieii


Stenotrophomonas


Tatlockia maceachernii




Saccharomonospora


Salegentibacter


Sanguibacter suarezii


maltophilia


Tatlockia micdadei




Saccharomonospora azurea


Salegentibacter salegens


Saprospira


Streptococcus


Tenacibaculum




Saccharomonospora cyanea


Salimicrobium


Saprospira grandis

[also see below]

Tenacibaculum




Saccharomonospora viridis


Salimicrobium album


Sarcina


Streptomyces


amylolyticum




Saccharophagus


Salinibacter


Sarcina maxima


Streptomyces


Tenacibaculum discolor




Saccharophagus degradans


Salinibacter ruber


Sarcina ventriculi


achromogenes


Tenacibaculum




Saccharopolyspora


Salinicoccus


Sebaldella


Streptomyces


gallaicum




Saccharopolyspora erythraea


Salinicoccus alkaliphilus


Sebaldella


cesalbus


Tenacibaculum




Saccharopolyspora gregorii


Salinicoccus hispanicus


termitidis


Streptomyces cescaepitosus


lutimaris




Saccharopolyspora hirsuta


Salinicoccus roseus


Serratia


Streptomyces cesdiastaticus


Tenacibaculum




Saccharopolyspora hordei


Salinispora


Serratia fonticola


Streptomyces cesexfoliatus


mesophilum




Saccharopolyspora rectivirgula


Salinispora arenicola


Serratia marcescens


Streptomyces fimbriatus


Tenacibaculum




Saccharopolyspora spinosa


Salinispora tropica


Sphaerotilus


Streptomyces fradiae


skagerrakense




Saccharopolyspora taberi


Salinivibrio


Sphaerotilus natans


Streptomyces fulvissimus


Tepidanaerobacter




Saccharothrix


Salinivibrio costicola


Sphingobacterium


Streptomyces griseoruber


Tepidanaerobacter




Saccharothrix australiensis


Salmonella


Sphingobacterium multivorum


Streptomyces griseus


syntrophicus




Saccharothrix coeruleofusca


Salmonella bongori


Staphylococcus


Streptomyces lavendulae


Tepidibacter




Saccharothrix espanaensis


Salmonella enterica

[see below]

Streptomyces


Tepidibacter




Saccharothrix longispora


Salmonella subterranea



phaeochromogenes


formicigenes




Saccharothrix mutabilis


Salmonella typhi



Streptomyces


Tepidibacter thalassicus




Saccharothrix syringae




thermodiastaticus


Thermus




Saccharothrix tangerinus




Streptomyces tubercidicus


Thermus aquaticus




Saccharothrix texasensis





Thermus filiformis








Thermus thermophilus




Staphylococcus




S. arlettae


S. equorum


S. microti


S. schleiferi




S. agnetis


S. felis


S. muscae


S. sciuri




S. aureus


S. fleurettii


S. nepalensis


S. simiae




S. auricularis


S. gallinarum


S. pasteuri


S. simulans




S. capitis


S. haemolyticus


S. petrasii


S. stepanovicii




S. caprae


S. hominis


S. pettenkoferi


S. succinus




S. carnosus


S. hyicus


S. piscifermentans


S. vitulinus




S. caseolyticus


S. intermedius


S. pseudintermedius


S. warneri




S. chromogenes


S. kloosii


S. pseudolugdunensis


S. xylosus




S. cohnii


S. leei


S. pulvereri




S. condimenti


S. lentus


S. rostri




S. delphini


S. lugdunensis


S. saccharolyticus




S. devriesei


S. lutrae


S. saprophyticus




S. epidermidis


S. lyticans





S. massiliensis




Streptococcus




Streptococcus agalactiae


Streptococcus infantarius


Streptococcus orisratti


Streptococcus thermophilus




Streptococcus anginosus


Streptococcus iniae


Streptococcus parasanguinis


Streptococcus sanguinis




Streptococcus bovis


Streptococcus intermedius


Streptococcus peroris


Streptococcus sobrinus




Streptococcus canis


Streptococcus lactarius


Streptococcus pneumoniae


Streptococcus suis




Streptococcus constellatus


Streptococcus milleri


Streptococcus


Streptococcus uberis




Streptococcus downei


Streptococcus mitis


pseudopneumoniae


Streptococcus vestibularis




Streptococcus dysgalactiae


Streptococcus mutans


Streptococcus pyogenes


Streptococcus viridans




Streptococcus equines


Streptococcus oralis


Streptococcus ratti


Streptococcus




Streptococcus faecalis


Streptococcus tigurinus


Streptococcus salivariu


zooepidemicus




Streptococcus ferus




Uliginosibacterium


Vagococcus


Vibrio


Virgibacillus


Xanthobacter




Uliginosibacterium


Vagococcus carniphilus


Vibrio aerogenes


Virgibacillus


Xanthobacter agilis




gangwonense


Vagococcus elongatus


Vibrio aestuarianus


halodenitrificans


Xanthobacter




Ulvibacter


Vagococcus fessus


Vibrio albensis


Virgibacillus


aminoxidans




Ulvibacter litoralis


Vagococcus fluvialis


Vibrio alginolyticus


pantothenticus


Xanthobacter




Umezawaea


Vagococcus lutrae


Vibrio campbellii


Weissella


autotrophicus




Umezawaea tangerina


Vagococcus salmoninarum


Vibrio cholerae


Weissella cibaria


Xanthobacter flavus




Undibacterium


Variovorax


Vibrio cincinnatiensis


Weissella confusa


Xanthobacter tagetidis




Undibacterium pigrum


Variovorax boronicumulans


Vibrio coralliilyticus


Weissella halotolerans


Xanthobacter viscosus




Ureaplasma


Variovorax dokdonensis


Vibrio cyclitrophicus


Weissella hellenica


Xanthomonas




Ureaplasma


Variovorax paradoxus


Vibrio diazotrophicus


Weissella kandleri


Xanthomonas




urealyticum


Variovorax soli


Vibrio fluvialis


Weissella koreensis


albilineans




Ureibacillus


Veillonella


Vibrio furnissii


Weissella minor


Xanthomonas alfalfae




Ureibacillus composti


Veillonella atypica


Vibrio gazogenes


Weissella


Xanthomonas




Ureibacillus suwonensis


Veillonella caviae


Vibrio halioticoli


paramesenteroides


arboricola




Ureibacillus terrenus


Veillonella criceti


Vibrio harveyi


Weissella soli


Xanthomonas




Ureibacillus thermophilus


Veillonella dispar


Vibrio ichthyoenteri


Weissella thailandensis


axonopodis




Ureibacillus thermosphaericus


Veillonella montpellierensis


Vibrio mediterranei


Weissella viridescens


Xanthomonas





Veillonella parvula


Vibrio metschnikovii


Williamsia


campestris





Veillonella ratti


Vibrio mytili


Williamsia marianensis


Xanthomonas citri





Veillonella rodentium


Vibrio natriegens


Williamsia maris


Xanthomonas codiaei





Venenivibrio


Vibrio navarrensis


Williamsia serinedens


Xanthomonas





Venenivibrio stagnispumantis


Vibrio nereis


Winogradskyella


cucurbitae





Verminephrobacter


Vibrio nigripulchritudo


Winogradskyella


Xanthomonas





Verminephrobacter eiseniae


Vibrio ordalii


thalassocola


euvesicatoria





Verrucomicrobium


Vibrio orientalis


Wolbachia


Xanthomonas fragariae





Verrucomicrobium spinosum


Vibrio parahaemolyticus


Wolbachia persica


Xanthomonas fuscans






Vibrio pectenicida


Wolinella


Xanthomonas gardneri






Vibrio penaeicida


Wolinella succinogenes


Xanthomonas hortorum






Vibrio proteolyticus


Zobellia


Xanthomonas hyacinthi






Vibrio shilonii


Zobellia galactanivorans


Xanthomonas perforans






Vibrio splendidus


Zobellia uliginosa


Xanthomonas phaseoli






Vibrio tubiashii


Zoogloea


Xanthomonas pisi






Vibrio vulnificus


Zoogloea ramigera


Xanthomonas populi







Zoogloea resiniphila


Xanthomonas theicola








Xanthomonas








translucens








Xanthomonas








vesicatoria








Xylella








Xylella fastidiosa








Xylophilus








Xylophilus ampelinus




Xenophilus


Yangia


Yersinia mollaretii


Zooshikella


Zobellella




Xenophilus azovorans


Yangia pacifica


Yersinia philomiragia


Zooshikella ganghwensis


Zobellella denitrificans




Xenorhabdus


Yaniella


Yersinia pestis


Zunongwangia


Zobellella taiwanensis




Xenorhabdus beddingii


Yaniella flava


Yersinia pseudotuberculosis


Zunongwangia profunda


Zeaxanthinibacter




Xenorhabdus bovienii


Yaniella halotolerans


Yersinia rohdei


Zymobacter


Zeaxanthinibacter




Xenorhabdus cabanillasii


Yeosuana


Yersinia ruckeri


Zymobacter palmae


enoshimensis




Xenorhabdus doucetiae


Yeosuana aromativorans


Yokenella


Zymomonas


Zhihengliuella




Xenorhabdus griffiniae


Yersinia


Yokenella regensburgei


Zymomonas mobilis


Zhihengliuella




Xenorhabdus hominickii


Yersinia aldovae


Yonghaparkia


Zymophilus


halotolerans




Xenorhabdus koppenhoeferi


Yersinia bercovieri


Yonghaparkia alkaliphila


Zymophilus paucivorans


Xylanibacterium




Xenorhabdus nematophila


Yersinia enterocolitica


Zavarzinia


Zymophilus raffinosivorans


Xylanibacterium ulmi




Xenorhabdus poinarii


Yersinia entomophaga


Zavarzinia compransoris




Xylanibacter


Yersinia frederiksenii




Xylanibacter oryzae


Yersinia intermedia





Yersinia kristensenii

















TABLE 7







SaPIs

















Lindsay


att site core






and
Size
Inducing
(location,



Element
Staphylococcal genome
Baba*
Holdentext missing or illegible when filed
(kb)
phages
att/int group)
Refs

















SaPI4

S. aureus str. MRSA252

NA
SaPI4
15.1
Endogenous
AAAGAAGAACAATAA
7.39







prophage
TAT (~8′.I)






SaPI1028

S. aureus str. NY940

NA
NA
15.6
Endogenous
AAAGAAGAACAATAA
7.40







prophage
TAT (~8.I)






SaPIbov1

S. aureus str. RF122

vSa2
NA
15.8
φ11 and
TAATTATTCCCAGTC
25.41







80α
AAT (~9′.II)






SaPIbov2

S. aureus str. V329

NA
NA
27
80α
TAATTATTCCCACTC
25








GAT (~9′.II)






SaPlm4

S. aureus str. mu50

vSa3
NA
14.4
Endogenous
TCCCGCCGTCTCCAT
7.12




type I


prophage
(~18.III)






SaPlmw2

S. aureus str. mw2

vSa3
SaPI3
14.4
Endogenous
TCGCGCCGTCTCCAT
7.12




type II


prophage
(~18.III)






SePI1

S. aureus str. FRI909

NA
NA
9.9
Not known
TCCGCCGTCTCCAT
11








(location









unknowntext missing or illegible when filed . III)






ShPI2
S. haemolyticus
vSh2
NA
16.6
Not known
TCCCGCCGTCTCCAT
8








(48′, III)text missing or illegible when filed






SaPI1

S. aureus str. RN4282

vSa1
NA
15.2
80α and
TTATTTAGCAGGAAT
6







φ13
AA (~19′, IV)






SaPI3

S. aureus str. COL

vSa1
SaPI1
15.6
Not known
TTATTTAGCAGGAAT
42








AA (~19′, IV)






SaPI5

S. aureus str. USA300

NA
NA
14.0
Not known
TTATTTAGCAGGAAT
43








AA (~19′, IV)






SaPln1

S. aureus str. n315

vSa4
SaPI2
15
80α
GTTTTACCATCATTC
36 and


and
and
type I



CCGGCAT
J. R. P.,


SaPlm1

S. aureus str. mu50,





(~44′, V)
unpublished



respectively





observations





SaPI2

S. aureus str. RN3984

NA
NA
14.7
80 and 80α
ATTTTACATCATTCC
7.20








TGGCAT









(~44′, V)






SaRIfusB

S. aureus European

NA
NA
20.7
Not known
ATGCCAGGTATGATG
38



fusidic acid-




TAAAAC




resistant impetigo




(~44′, V)




clone CS6











SaPI122

S. aureus str. RF122

NA
NA
17.9
Endogenous
GTTTTACATCATTCC
NAtext missing or illegible when filed







prophage
TGGCAT









(~44′, V)






SaPI6Δ

S. aureus strains

vSa4
NA
3.14
Not known
GTTTTACCATCATTC
12



8325, COL, USA300,
type II



CCGGCATGTTTTACA




MSSA476, Newman and




TCATTCCTGGCAT




mw2




(~44′, V)






SsPI15305

S. saprophyticus str.

vSs15305
NA
16.7
Not known
Unknown
9



15305




sequence









(~48′, VI)





int, integrase: NA, not applicable; S. aureus, Staphylococcus aureus; S. haemolyticus, Staphylococcus haemolyticus;



S. saprophyticus, Staphylococcus saprophyticus.



*Nomencalture proposed by Baba et altext missing or illegible when filed . text missing or illegible when filed Nomenclature used by Lindsay and Holdentext missing or illegible when filed . text missing or illegible when filed This strain has not been


sequenced yet so the genomic location os SaPI1 is unknown. text missing or illegible when filed ShPI2 is located 180° away from the other SaPIs


with the same att core sequence. owling to the major chromosomal inverison that has been documented in the



S. haemolyticus genometext missing or illegible when filed . text missing or illegible when filed GenBank accession NC 007622.




text missing or illegible when filed indicates data missing or illegible when filed














TABLE 8







Example Plasmids and Copy Number











Common
Copy

Incompat-



Vectors
Number+
ORI
ibility Group
Control





pUC
~500-700
pMB1 (derivative)
A
Relaxed


pBR322
~15-20
pMB1
A
Relaxed


pET
~15-20
pBR322
A
Relaxed


pGEX
~15-20
pBR322
A
Relaxed


pColE1
~15-20
ColE1
A
Relaxed


pR6K
~15-20
R6K*
C
Stringent


pACYC
~10 
p15A
B
Relaxed


pSC101
~5
pSC101
C
Stringent


pBluescript
~300-500
ColE1 (derivative)
A
Relaxed




and F1**


pGEM
~300-500
pUC and F1*
A
Relaxed








Claims
  • 1. A method of producing transduction particles wherein the particles are capable of recognising a receptor on bacterial target cells for transduction of the cells, the method comprising producing the particles in bacterial producer cells, wherein the producer cells do not express the receptor on their surface.
  • 2. The method of claim 1, wherein the producer and target cells are cell of the same species.
  • 3. The method of claim 1, wherein the producer cells are E coli cells.
  • 4. The method of claim 1, wherein the transduction particles comprise a phage capsid, wherein the capsid comprises a packaged nucleic acid of interest (NSI) for transduction into target bacterial cells.
  • 5. The method of claim 4, wherein the NSI comprises or encodes an antibacterial agent that kills target cells, or wherein the NSI comprises or encodes a component of such an agent.
  • 6. The method of claim 5, wherein the NSI comprises a nucleotide sequence encoding a guide RNA of a CRISPR/Cas system.
  • 7. The method of claim 1, wherein the transduction particles are phages.
  • 8. The method of claim 1, wherein the transduction particles are non-self-replicative.
  • 9. The method of claim 1, wherein the genome of each producer cell comprises a genetic modification that disrupts synthesis of the receptor and/or its expression as a cell surface receptor.
  • 10. The method of claim 9, wherein the modification is a modification of a lipopolysaccharide (LPS) synthesis pathway.
  • 11. The method of claim 1, wherein the receptor comprises a LPS.
  • 12. The method of claim 1, wherein the production yield of transduction particles is enhanced compared to production in producer cells that express the receptor on their surface.
  • 13. (canceled)
  • 14. The method of claim 12, wherein the yield is increased at least 10-fold compared to production in producer cells that surface express the receptor.
  • 15. The method of claim 14, wherein the increase is at least 100-fold.
  • 16. The method of claim 14, wherein the increase is 10-1000-fold.
  • 17. The method of claim 1, comprising isolating the transduction particles from cellular material.
  • 18. A composition comprising transduction particles obtained or obtainable by the method of claim 17.
  • 19. The composition according to claim 18, wherein the composition comprises no producer cell LPS.
  • 20. A method of killing bacterial target cells, the method comprising contacting the cells with the composition according to claim 18, wherein transduction particles infect the cells and introduce therein a NSI, wherein the NSI comprises or encodes an antibacterial agent that kills the target cells, or wherein the NSI comprises or encodes a component of such an agent.
  • 21. A method of treating or preventing a disease or condition in a human or animal subject, wherein the disease or condition is mediated by bacterial target cells, the method comprising administering the composition of claim 18 to the subject and contacting the target cells with the composition, whereby target cells are killed or the growth or proliferation of target cells is inhibited, thereby treating or preventing the disease or condition.
  • 22. The method of claim 21, wherein transduction particles comprised by the composition infect the target cells and introduce therein a NSI, wherein the NSI comprises or encodes an antibacterial agent that kills the target cells, or wherein the NSI comprises or encodes a component of such an agent.
  • 23. The method of claim 21, wherein the target cells are Escherichia, Klebsiella, Clostridium or Pseudomonas cells.
  • 24. The method of claim 21, wherein the target cells are E. coli, K. pneumoniae, C. dificile or P. aeruginosa cells.
Priority Claims (1)
Number Date Country Kind
1901099.0 Jan 2019 GB national
PCT Information
Filing Document Filing Date Country Kind
PCT/EP2020/051937 1/27/2020 WO 00