The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Dec. 22, 2020, is named 167741_022201_PCT_SL.txt and is 15,471 bytes in size.
DNA methylation is an important epigenetic mechanism. It is involved in many biological processes, such as development, transcriptional regulation, genome stability, aging, and disease (e.g., cancer biology), among others. CpG density is bimodal, depleted from most of the genome, with the exception of high density CpG islands that are frequently promoter-associated. DNA methylation at promoter-associated CpG islands is associated with gene silencing and intricately regulated to guide complex biological processes such as embryogenesis, aging, and tumorigenesis. Beyond promoters, DNA methylation patterns at genomic regulatory elements have been implicated in determining cell identity and chromatin structure, especially at enhancers and CCCTC-Binding factor (CTCF) regions.
Whole genome and reduced-representation methods have clarified biological roles of DNA methylation, but do not efficiently survey the vast numbers of noncoding regulatory elements in mammalian genomes. The study of dynamic DNA methylation remains difficult for a number of reasons. For example, multiple factors regulate DNA methylation, such as active enzymatic regulation and passive loss through iterative cell division. Additionally, heterogeneity within the population and low resolution attained in bulk data are obstacles that must be overcome or avoided to obtain a better understanding of this epigenetic mechanism. Current technologies use bisulfite conversion to change unmethylated cytosines to uracils while leaving methylated cytosines undisturbed for further analysis. However, bisulfite conversion is a harsh chemical reaction that can result in sample degradation, and methylation analysis remains expensive and labor intensive.
The gold standard method for reading CpG methylation is to convert unmethylated cytosines to uracil with bisulfite treatment prior to sequencing. Whole genome bisulfite sequencing (whole genome bisulfite sequencing (WGBS)) provides coverage of the entire genome, but is inefficient because vast CpG-depleted regions consume sequencing capacity. In contrast, reduced representation bisulfite sequencing (reduced representation bisulfite sequencing (RRBS)) uses restriction digest to enrich for CpG dense regions and thus provides high coverage of a fraction of the genome at reduced sequencing cost. However, reduced representation bisulfite sequencing (RRBS) lacks coverage of enhancer regions and CTCF binding sites that are outside of CpG islands. Methylation arrays that capture established regions of interest, typically promoters and CpG islands, are not ideal for profiling regulatory elements, which are of high interest.
Thus, improved methods are needed for comprehensive profiling of DNA methylation to better understand cell state dynamics. Moreover, there is a need for a strategy for profiling DNA methylation across promoters, enhancers, and CTCF sites that is efficient and compatible with low input samples and single cells.
As described below, the present invention features compositions and methods for assaying DNA methylation in a single cell.
In one aspect of the present invention, a method is provided for polynucleotide methylation profiling, the method involving (a) contacting a double stranded polynucleotide with an endonuclease and a ligase in the presence of a double stranded adapter, where the adapter top strand contains a barcode, at least a partial sequencing primer binding site, and one or more methylated cytosines, and the bottom strand of the adapter is at least partially complementary to the top strand, and further contains a 5′ overhang, and a first member of a binding pair, where the contacting generates an adapter ligation product; (b) converting cytosines present in the adapter ligation product to uracils and isolating the adapter ligation product by contacting the first member of a binding pair with a second member of a binding pair; (c) contacting the adapter ligation product of (b) with a polymerase and one or more primers containing a random sequence and at least a partial sequencing primer binding site, thereby generating linear amplicons; (d) contacting the linear amplicons of (c) with a polymerase and forward and reverse amplification primers, thereby generating amplicons; and (e) characterizing the amplicons of (d), thereby generating a polynucleotide methylation profile.
In some embodiments, the step involving contacting the double stranded polynucleotide with an endonuclease and a ligase in the presence of a double stranded adapter is used to prepare adapter ligation products from two or more distinct double stranded polynucleotides each being from a distinct biological sample. In some embodiments, the adapter ligation products are pooled prior to converting cytosines present in the adapter ligation product to uracils. In various embodiments, characterizing the amplicons involves using the barcode to identify the biological sample corresponding to each amplicon. In various embodiments, the bottom strand of the adapter is unphosphorylated.
Another aspect of the present invention provides a method for characterizing functionally-relevant genomic regions using polynucleotide methylation profiling. The method involves (a) generating a polynucleotide methylation profile according to the above aspect, where the double stranded polynucleotide contains genomic DNA from a cell. The method further involves (b) determining a methylation state of a functionally-relevant genomic region of the genomic DNA, where the functionally-relevant genomic region is selected from any one or more of promoters, enhancers, CTCF binding sites, and CpG islands. The method also involves (c) characterizing the functionally-relevant genomic regions based upon the methylation state thereof.
In some embodiments, step (c) involves predicting chromatin structure of a functionally-relevant genomic region based upon the methylation state thereof. In some embodiments, predicting the chromatin structure comprises predicting whether the functionally-relevant genomic region comprises an active transcript, facultative heterochromatin, or constitutive heterochromatin. In some embodiments, predicting the chromatin structure comprises predicting whether the functionally-relevant genomic region comprises H3K36me3, H3K27me3, or H3K9me3. In some embodiments, characterizing the functionally-relevant genomic region comprises predicting CTCF binding. In some embodiments, characterizing the functionally-relevant genomic region comprises predicting enhancer activity. Another aspect of the present invention features a method for analyzing genetic variability within a cell population. The method involves (a) preparing DNA methylation profiles for single cells according to the method of any one of the above aspects, where each of the single cells is from the same cell line. The method further involves (b) comparing the DNA methylation profiles to determine: (i) genetic copy-number variations among the cells, and/or
Another aspect of the present invention provides a method for single cell genomic DNA methylation profiling, the method involving (a) contacting DNA isolated from a single cell with a restriction enzyme and a ligase in the presence of a double stranded adapter under conditions suitable for cleavage of the double stranded polynucleotide with the restriction enzyme and ligation of the cleaved ends of the double stranded polynucleotide to the adapter, where the adapter top strand contains a cell specific barcode, at least a partial sequencing primer binding site, and one or more methylated cytosines, and the bottom strand of the adapter is at least partially complementary to the top strand, and contains a 5′ overhang, and a first member of a binding pair, thereby forming an adapter ligation product; (b) converting cytosines present in the adapter ligation product to uracils and isolating the adapter ligation product by contacting the first member of a binding pair with a second member of a binding pair; (c) contacting the adapter ligation product with a polymerase, a forward amplification primer containing a random hexamer fused to at least a partial sequencing primer binding site thereby generating linear amplicons; (d) contacting the linear amplicons of (c) with a polymerase and forward and reverse amplification primers, thereby generating amplicons; and (e) sequencing the amplicons of (d) to detect converted bases, where the first sequencing read starts at the random hexamer and the second read starts at the cell specific barcode, and the first C at the 5′ end is informative, thereby generating a single cell genomic DNA methylation profile.
A method is provided in another aspect of the present invention for single cell genomic DNA methylation profiling, the method involving (a) characterizing a population of cells using flow cytometry; (b) sorting the cells into individual reaction vessels; (c) contacting DNA isolated from a single cell with a restriction enzyme and a ligase in the presence of a double stranded adapter under conditions suitable for cleavage of the double stranded polynucleotide with the restriction enzyme and ligation of the cleaved ends of the double stranded polynucleotide to the adapter, where the adapter top strand containing a cell specific barcode, at least a partial sequencing primer binding site, and one or more methylated cytosines, and the bottom strand of the adapter is at least partially complementary to the top strand, and containing a 5′ overhang, and a first member of a binding pair, thereby forming an adapter ligation product; (d) converting cytosines present in the adapter ligation product to uracils and isolating the adapter ligation product by contacting the first member of a binding pair with a second member of a binding pair; (e) contacting the adapter ligation product with a polymerase, a forward amplification primer containing a random hexamer fused to at least a partial sequencing primer binding site thereby generating linear amplicons; (f) contacting the linear amplicons of (e) with a polymerase and forward and reverse amplification primers, thereby generating amplicons; and (g) sequencing the amplicons of (f) to detect converted bases, where the first sequencing read starts at the random hexamer and the second read starts at the cell specific barcode, and the first C at the 5′ end is informative, thereby generating a single cell genomic DNA methylation profile. In some embodiments, the cells are characterized using antibodies. In some embodiments, the individual reaction vessel is a well, droplet, tube, or microfluidic chamber. In some embodiments, the population of cells is derived from a subject. In some embodiments, the population of cells is derived from a biological sample of a subject.
Another aspect provides a method for characterizing DNA methylation of a subject having or suspected of having a disease, the method involving (a) characterizing a population of cells using flow cytometry; (b) sorting the cells into individual reaction vessels; (c) contacting DNA isolated from a single cell with restriction enzyme and a ligase in the presence of a double stranded adapter under conditions suitable for cleavage of the double stranded polynucleotide with the restriction enzyme and ligation of the cleaved ends of the double stranded polynucleotide to the adapter, where the adapter top strand containing a cell specific barcode, at least a partial sequencing primer binding site, and one or more methylated cytosines, and the bottom strand of the adapter is at least partially complementary to the top strand, and contains a 5′ overhang, and a first member of a binding pair, thereby forming an adapter ligation product; (d) converting cytosines present in the adapter ligation product to uracils and isolating the adapter ligation product by contacting the first member of a binding pair with a second member of a binding pair; (e) contacting the adapter ligation product with a polymerase, a forward amplification primer containing a random hexamer fused to at least a partial sequencing primer binding site thereby generating linear amplicons; (f) contacting the linear amplicons of (e) with a polymerase and forward and reverse amplification primers, thereby generating amplicons; and (g) sequencing the amplicons of (f) to detect converted bases, where the first sequencing read starts at the random hexamer and the second read starts at the cell specific barcode, and the first C at the 5′ end is informative, thereby characterizing DNA methylation of the subject. In some embodiments, the subject has or is suspected of having a disease associated with an alteration in DNA methylation. In some embodiments, the disease is cancer or an imprinting disorder. In some embodiments, the cancer is acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), glioma, or chondrosarcoma. In some embodiments, the imprinting disorder is Angelman syndrome (AS) or Prader-Willi syndrome (PWS). In some embodiments, the disease is Lynch Syndrome or age related clonal hematopoiesis (ARCH). In some embodiments, the amplicons are sequenced using the Illumina NextSeq 500 platform.
Another aspect provides a method for polynucleotide methylation profiling, the method involving (a) contacting a double stranded polynucleotide with a transposase in the presence of a double stranded adapter, where the adapter top strand contains a barcode, at least a partial transposase binding site, and one or more methylated cytosines, and the bottom strand of the adapter is at least partially complementary to the top strand, where the contacting generates an adapter transposition product; (b) converting cytosines present in the adapter transposition product to uracils; (c) contacting the adapter transposition product of (b) with a polymerase and a primer containing a random sequence, a barcode, and at least a partial sequencing primer binding site, thereby generating linear amplicons; (d) contacting the linear amplicons of (c) with a polymerase and forward and reverse amplification primers, thereby generating amplicons; and (e) characterizing the amplicons of (d), thereby generating a polynucleotide methylation profile.
In some embodiments of the foregoing aspects, the double stranded polynucleotide is DNA. In some embodiments, the forward amplification primer contains a random hexamer fused to at least a partial sequencing primer binding site. In some embodiments, the reverse primer contains a barcode and at least a partial sequencing primer binding site. In some embodiments, a first sequencing read starts at the random hexamer and the second read starts at the cell specific barcode, and the first C at the 5′ end is informative. In some embodiments, the endonuclease activity is dependent on the methylation state of a recognition sequence. In some embodiments, the endonuclease is MspI, ScaI, BamHI, HindIII, NotI, and SpeI. In some embodiments, the bottom strand of the adapter does not contain a methylated cytosine. In some embodiments, the polynucleotide is isolated from a cell in vivo or in vitro. In some embodiments, the first member of the binding pair is biotin and the second member of the binding pair is streptavidin. In some embodiments, the first or second member of the binding pair is fixed to a substrate. In some embodiments, the substrate is selected from any one or more of a bead, a membrane, a chip, and a slide. In some embodiments, the polymerase is a strand-displacing polymerase. In some embodiments, the strand displacing polymerase is Klenow exo− or Bst DNA polymerase. In some embodiments, the partial sequencing primer binding site is SBS3, SBS12, P5, or P7. In some embodiments, the ligase is T4 ligase.
In any of the above aspects, the hexamer extensions are used to characterize an amplicon as a PCR duplicate.
A method is also provided for bisulfite conversion of a nucleic acid molecule, the method involving contacting a polynucleotide with a double-stranded adapter containing a top strand containing one or more methylated cytosines and a bottom strand that lacks methylated cytosines, an MspI enzyme, and a ligase to form a nucleic acid fragment having adapters at its termini; and contacting the nucleic acid fragment with bisulfite to form a converted nucleic acid fragment.
In any of the above aspects, the step involving contacting DNA isolated from a single cell with restriction enzyme and a ligase in the presence of a double stranded adapter is used to prepare adapter ligation products from DNA from two or more cells and the adapter ligation products are pooled prior to the step involving converting cytosines present in the adapter ligation product to uracils. In any of the above aspects, the method involves an analysis, which involves using the barcode to identify the cell corresponding to each amplicon. In any of the above aspects, the method involves an analysis, and the analysis involves characterizing an amplicon as corresponding to a cell based upon a single nucleotide polymorphism unique to the cell. In any of the above aspects, the bottom strand of the adapter is unphosphorylated. In any of the above aspects, the cell was exposed to a stimulus prior to preparing the polynucleotide methylation profile. In some embodiments, the stimulus comprises contacting the cell with an agent.
In any of the above aspects, the cell is associated with a disease. In any of the above aspects, the disease is cancer, autoimmune disease, Angelman syndrome (AS), Prader-Willi syndrome (PWS), Lynch syndrome, or age related clonal hematopoiesis (ARCH). In some embodiments, the cancer is bladder, bone, breast, colon, esophageal, glioblastoma, leukemia, liver, lung, ovarian, prostate, or thyroid cancer.
Compositions and articles defined by the invention were isolated or otherwise manufactured in connection with the examples provided below. Other features and advantages of the invention will be apparent from the detailed description, and from the claims.
Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention belongs. The following references provide one of skill with a general definition of many of the terms used in this invention: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, the following terms have the meanings ascribed to them below, unless specified otherwise.
As used herein, “adapter” refers to a nucleic acid molecule that can be ligated to the end of a DNA or RNA molecule. In one embodiment, an adapter is recognized by a primer used in a sequencing reaction or sequencing platform. In some embodiments, the sequencing platform is an Illumina sequencing platform. In some embodiments, the adapter comprises a barcode or other identifying nucleic acid sequence.
By “agent” is meant any small molecule chemical compound, antibody, nucleic acid molecule, or polypeptide, or fragments thereof.
By “alteration” is meant a change (increase or decrease) in the sequence, methylation state, expression levels or activity of a gene or polypeptide as detected by standard art known methods such as those described herein. As used herein, an alteration includes a 10% change in expression levels, preferably a 25% change, more preferably a 40% change, and most preferably a 50% or greater change in expression levels.
By “amplicon”, is meant a polynucleotide sequence that is the source and/or product of the amplification of another polynucleotide sequence. In some embodiments, the amplicon is a product of a polymerase chain (PCR) reaction used to amplify a polynucleotide sequence.
By “analog” is meant a molecule that is not identical, but has analogous functional or structural features. For example, a polypeptide analog retains the biological activity of a corresponding naturally-occurring polypeptide, while having certain biochemical modifications that enhance the analog's function relative to a naturally occurring polypeptide. Such biochemical modifications could increase the analog's protease resistance, membrane permeability, or half-life, without altering, for example, ligand binding. An analog may include an unnatural amino acid.
“Biological sample” as used herein refers to a cell or to a sample obtained from a biological subject, including a sample of a biological tissue or fluid origin, obtained or collected in vivo or in situ, that contains genomic DNA. A biological sample also includes samples from a region of a biological subject containing precancerous or cancer cells or tissues. Such samples can be, but are not limited to, organs, tissues, fractions and cells isolated from mammals including, humans such as a patient, mice, and rats. Biological samples also may include sections of the biological sample including tissues, for example, frozen sections taken for histologic purposes. A biological sample in various embodiments is of an eukaryotic origin, for example, insects, protozoa, birds, fish, reptiles, and preferably a mammal, for example, rat, mouse, cow, dog, guinea pig, or rabbit, and more preferably a primate, for example, chimpanzees or humans. Non-limiting examples of cell lines to which the cell may belong include a K562 cell, a Kasumi-1 cell, an OCI-AML3 cell, an HL-60 cell, a primary T-cell, an H1 embryonic stem cell, a primary mammary epithelial cell, an IMR90 fibroblast cell, or a GM12878 cell. By “cell line” is meant cells with a substantially uniform genetic makeup and descended from a single cell.
By “barcode” is meant a portion of a nucleotide sequence that provides for molecular identification of the sequence. For example, a barcode sequence enables the segregation of sequence reads thereby allowing identification of the source of the sequence (e.g., a particular cell).
By “binding pair” is meant two molecules that specifically bind to each other, and that do not specifically bind to other molecules. For example, biotin and streptavidin, an antibody and a molecule having an epitope that specifically binds the antibody, and the like are binding pairs.
By “chromatin” is meant a complex of DNA and protein found in cells. In various embodiments, chromatin comprises histones.
By “chromatin structure” is meant the state of folding of chromatin (e.g., heterochromatin or euchromatin) and/or the proteins and nucleotides comprising the chromatin and states of modification of the proteins and nucleotides.
In this disclosure, “comprises,” “comprising,” “containing” and “having” and the like can have the meaning ascribed to them in U.S. Patent law and can mean “includes,” “including,” and the like; “consisting essentially of” or “consists essentially” likewise has the meaning ascribed in U.S. Patent law and the term is open-ended, allowing for the presence of more than that which is recited so long as basic or novel characteristics of that which is recited is not changed by the presence of more than that which is recited, but excludes prior art embodiments.
By “CpG island” is meant a region of a genome where a cytosine nucleotide is followed by a guanine nucleotide, or vice versa, in the linear sequence of bases at a high frequency. In various embodiments, a CpG island is a region of a genome comprising a least about or about 50 bp, 100 bp, 150 bp, 200 bp, or 250 bp, and with a GC percentage of greater than about 25%, 50%, or 75%.
By “CTCF binding site” is meant a DNA sequence recognized by transcriptional repressor CTCF. In various embodiments, CTCF is alternatively referred to as CCCTC-binding factor. In some embodiments, a CTCF binding site comprises three regularly spaced repeats each comprising the sequence CCCTC.
“Detect” refers to identifying the presence, absence or amount of the analyte to be detected.
By “detectable label” is meant a composition that when linked to a molecule of interest renders the latter detectable, via spectroscopic, photochemical, biochemical, immunochemical, or chemical means. For example, useful labels include radioactive isotopes, magnetic beads, metallic beads, colloidal particles, fluorescent dyes, electron-dense reagents, enzymes (for example, as commonly used in an ELISA), biotin, digoxigenin, or haptens.
By “disease” is meant any condition or disorder that damages or interferes with the normal function of a cell, tissue, or organ. Examples of diseases include cancers (e.g., acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), glioma, and chondrosarcoma. In some embodiments, the disease is Lynch Syndrome, an inherited disease resulting primarily in colorectal cancer. In some embodiments, the disease is age related clonal hematopoiesis (ARCH; also called clonal hematopoiesis of indeterminate potential (CHIP)). In some embodiments, the disease is an imprinting disease such as Angelman syndrome (AS) or Prader-Willi syndrome (PWS).
By “enhancer” is meant a region of DNA sufficient to increase the likelihood that transcription of a particular gene will occur. In various embodiments, an enhancer is a region of DNA that can be bound by proteins that, when bound to the enhancer, increase transcription rates of a gene associated with the enhancer.
By “fragment” is meant a portion of a polypeptide or nucleic acid molecule. This portion contains, preferably, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the entire length of the reference nucleic acid molecule or polypeptide. A fragment may contain 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides or amino acids.
“Hybridization” means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. For example, adenine and thymine are complementary nucleobases that pair through the formation of hydrogen bonds.
The terms “isolated,” “purified,” or “biologically pure” refer to material that is free to varying degrees from components which normally accompany it as found in its native state. “Isolate” denotes a degree of separation from original source or surroundings. “Purify” denotes a degree of separation that is higher than isolation. A “purified” or “biologically pure” protein is sufficiently free of other materials such that any impurities do not materially affect the biological properties of the protein or cause other adverse consequences. That is, a nucleic acid or peptide of this invention is purified if it is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. Purity and homogeneity are typically determined using analytical chemistry techniques, for example, polyacrylamide gel electrophoresis or high-performance liquid chromatography. The term “purified” can denote that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. For a protein that can be subjected to modifications, for example, phosphorylation or glycosylation, different modifications may give rise to different isolated proteins, which can be separately purified.
By “isolated polynucleotide” is meant a nucleic acid (e.g., a DNA) that is free of the genes which, in the naturally-occurring genome of the organism from which the nucleic acid molecule of the invention is derived, flank the gene. The term therefore includes, for example, a recombinant DNA that is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote; or that exists as a separate molecule (for example, a cDNA or a genomic or cDNA fragment produced by PCR or restriction endonuclease digestion) independent of other sequences. In addition, the term includes an RNA molecule that is transcribed from a DNA molecule, as well as a recombinant DNA that is part of a hybrid gene encoding additional polypeptide sequence.
The term “Next Generation Sequencing (NGS)” refers to massive parallel sequencing of clonally amplified molecules or single nucleic acid molecules. “Massive parallel sequencing” refers to simultaneously performing more than 1000 separate sequencing reactions. Non-limiting examples of NGS include sequencing-by-synthesis using reversible dye terminators, sequencing-by-ligation, and electronic detection sequencing methods. In some embodiments, NGS is carried out using the Illumina NextSeq 500 platform. Electronic detection sequencing methods include those used in the Ion Torrent sequencing strategy (ThermoFisher Scientific) or MiSeq platform (Illumina), wherein changes in pH are detected when a nucleotide is incorporated into a nucleic acid strand resulting in release of a hydrogen ion.
As used herein, “obtaining” as in “obtaining an agent” includes synthesizing, purchasing, or otherwise acquiring the agent.
By “PCR duplicate” is meant a sequence read that results from sequencing two or more copies of the exact same adapter ligation product.
By “promoter” is meant a polynucleotide sufficient to direct transcription.
By “reduces” is meant a negative alteration of at least 10%, 25%, 50%, 75%, or 100%.
By “reference” is meant a standard or control condition.
Nucleic acid molecules useful in the methods of the invention include any nucleic acid molecule that encodes a polypeptide of the invention or a fragment thereof. Such nucleic acid molecules need not be 100% identical with an endogenous nucleic acid sequence, but will typically exhibit substantial identity. Polynucleotides having “substantial identity” to an endogenous sequence are typically capable of hybridizing with at least one strand of a double-stranded nucleic acid molecule. Nucleic acid molecules useful in the methods of the invention include any nucleic acid molecule that encodes a polypeptide of the invention or a fragment thereof. Such nucleic acid molecules need not be 100% identical with an endogenous nucleic acid sequence, but will typically exhibit substantial identity. Polynucleotides having “substantial identity” to an endogenous sequence are typically capable of hybridizing with at least one strand of a double-stranded nucleic acid molecule. By “hybridize” is meant pair to form a double-stranded molecule between complementary polynucleotide sequences (e.g., a gene described herein), or portions thereof, under various conditions of stringency. (See, e.g., Wahl, G. M. and S. L. Berger (1987) Methods Enzymol. 152:399; Kimmel, A. R. (1987) Methods Enzymol. 152:507).
For example, stringent salt concentration will ordinarily be less than about 750 mM NaCl and 75 mM trisodium citrate, preferably less than about 500 mM NaCl and 50 mM trisodium citrate, and more preferably less than about 250 mM NaCl and 25 mM trisodium citrate. Low stringency hybridization can be obtained in the absence of organic solvent, e.g., formamide, while high stringency hybridization can be obtained in the presence of at least about 35% formamide, and more preferably at least about 50% formamide. Stringent temperature conditions will ordinarily include temperatures of at least about 30° C., more preferably of at least about 37° C., and most preferably of at least about 42° C. Varying additional parameters, such as hybridization time, the concentration of detergent, e.g., sodium dodecyl sulfate (SDS), and the inclusion or exclusion of carrier DNA, are well known to those skilled in the art. Various levels of stringency are accomplished by combining these various conditions as needed. In a preferred: embodiment, hybridization will occur at 30° C. in 750 mM NaCl, 75 mM trisodium citrate, and 1% SDS. In a more preferred embodiment, hybridization will occur at 37° C. in 500 mM NaCl, 50 mM trisodium citrate, 1% SDS, 35% formamide, and 100 μg/ml denatured salmon sperm DNA (ssDNA). In a most preferred embodiment, hybridization will occur at 42° C. in 250 mM NaCl, 25 mM trisodium citrate, 1% SDS, 50% formamide, and 200 μg/ml ssDNA. Useful variations on these conditions will be readily apparent to those skilled in the art.
For most applications, washing steps that follow hybridization will also vary in stringency. Wash stringency conditions can be defined by salt concentration and by temperature. As above, wash stringency can be increased by decreasing salt concentration or by increasing temperature. For example, stringent salt concentration for the wash steps will preferably be less than about 30 mM NaCl and 3 mM trisodium citrate, and most preferably less than about 15 mM NaCl and 1.5 mM trisodium citrate. Stringent temperature conditions for the wash steps will ordinarily include a temperature of at least about 25° C., more preferably of at least about 42° C., and even more preferably of at least about 68° C. In a preferred embodiment, wash steps will occur at 25° C. in 30 mM NaCl, 3 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 42 C in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 68° C. in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. Additional variations on these conditions will be readily apparent to those skilled in the art. Hybridization techniques are well known to those skilled in the art and are described, for example, in Benton and Davis (Science 196:180, 1977); Grunstein and Hogness (Proc. Natl. Acad. Sci., USA 72:3961, 1975); Ausubel et al. (Current Protocols in Molecular Biology, Wiley Interscience, New York, 2001); Berger and Kimmel (Guide to Molecular Cloning Techniques, 1987, Academic Press, New York); and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York.
By “substantially identical” is meant a polypeptide or nucleic acid molecule exhibiting at least 50% identity to a reference amino acid sequence (for example, any one of the amino acid sequences described herein) or nucleic acid sequence (for example, any one of the nucleic acid sequences described herein). Preferably, such a sequence is at least 60%, more preferably 80% or 85%, and more preferably 90%, 95% or even 99% identical at the amino acid level or nucleic acid to the sequence used for comparison.
Sequence identity is typically measured using sequence analysis software (for example, Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, BLAST, BESTFIT, GAP, or PILEUP/PRETTYBOX programs). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and/or other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. In an exemplary approach to determining the degree of identity, a BLAST program may be used, with a probability score between e−3 and e−100 indicating a closely related sequence.
By “single nucleotide polymorphism (SNP)” is meant a variation at a single position in a DNA sequence among a population of cells sharing a common genetic makeup. In some embodiments, a single nucleotide polymorphism can be used to identify a cell.
By “subject” is meant a human or non-human mammal, such as a bovine, equine, canine, ovine, or feline. In some embodiments, “subject” refers to any domesticated animal.
Ranges provided herein are understood to be shorthand for all of the values within the range. For example, a range of 1 to 50 is understood to include any number, combination of numbers, or sub-range from the group consisting 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50.
Unless specifically stated or obvious from context, as used herein, the term “or” is understood to be inclusive. Unless specifically stated or obvious from context, as used herein, the terms “a,” “an,” and “the” are understood to be singular or plural.
Unless specifically stated or obvious from context, as used herein, the term “about” is understood as within a range of normal tolerance in the art, for example within 2 standard deviations of the mean. About can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise clear from context, all numerical values provided herein are modified by the term about.
The recitation of a listing of chemical groups in any definition of a variable herein includes definitions of that variable as any single group or combination of listed groups. The recitation of an embodiment for a variable or aspect herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.
Any compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein.
As described below, the present invention features compositions and methods for assaying DNA methylation in a single cell.
The invention provides an extended representation bisulfite sequencing method (expanded representation bisulfite sequencing (XRBS)) for targeted profiling of DNA methylation. The method draws a balance between expanding coverage of regulatory elements and enriching for informative CpG dinucleotides in promoters, enhancers, and CTCF insulators. In various aspects, barcoded DNA fragments are pooled prior to bisulfite conversion, allowing multiplex processing and technical consistency in low input samples. The Examples provided herein present the application of expanded representation bisulfite sequencing (XRBS) to leukemia cells to determine genetic copy-number variations and evaluate methylation variability across single cells. Not wishing to be bound by theory, the analysis provided in the Examples demonstrate the utility of the method by demonstrating, through use of data gathered using expanded representation bisulfate sequencing (XRBS), that heterochromatic H3K9me3 regions have the highest cell-to-cell variability in their methylation, likely reflecting inherent epigenetic instability of these late replicating regions, compounded by differences in cell cycle stages among sampled cells.
Not wishing to be bound by theory, DNA methylation of CpG dinucleotides impacts transcriptional activity and genome stability, and is altered in human disease. In various aspects, expanded representation bisulfite sequencing (XRBS) leverages an early barcoding step for high sensitivity and sample multiplexing, and enriches for regions where CpG methylation has been shown to be functionally-relevant-promoters, CpG islands, CTCF insulators, and enhancers. Expanded representation bisulfite sequencing (XRBS) thus provides significant advantages over prior methods in terms of its efficiency, coverage, and sensitivity.
Single cell expanded representation bisulfite sequencing (XRBS) data provides for the resolution of DNA methylation, the linking of heterogeneity to late replicating domains, and the identification of both epimutations and genetic mutations, including copy number variations (CNVs). Expanded representation bisulfite sequencing (XRBS) complements the existing repertoire of single cell epigenetic technologies by providing a highly multiplexed and sensitive method that targets informative genomic regions and is compatible with small inputs and single cells. The computational strategies introduced herein can be used to contextualize single cell DNA methylation within a background of genetic alterations, an area of interest especially in the field of cancer epigenetics. Expanded representation bisulfite sequencing (XRBS) data, as shown in the Examples provided herein, enabled the identification of the highest cell to cell variability in DNA methylation at late replicating H3K9me3-marked regions. This heterogeneity may be a result of the innate variability of these regions, and is likely compounded by variability in cell cycle phase of the individual cells for which single cell methylomes were collected. In other embodiments, XRBS could leverage droplets or nanowells to increase throughput and gain new insights into methylomes and their variability in tissues, tumors, and experimental models.
DNA methylation plays a role in many biological processes, including tumorigenesis. It is hypothesized that rare, tumor promoting or tumorigenic DNA methylation events can be selected for during clonal evolution. Understanding tumor heterogeneity is critical for the development of effective long-term cancer therapeutics. Single cell technologies represent a powerful approach to improving understanding of the transcriptional and epigenetic heterogeneity in tumors.
Dynamic DNA methylation contributes to tumor heterogeneity and pathogenesis. For example, isocitrate dehydrogenase (NADP(+)) 1 (IDH) is a metabolic enzyme that is mutated in some cases of acute myeloid leukemia (AML), glioma, and chondrosarcoma. Mutated IDH produces 2-hydroxyglutarate, which inhibits demethylases. This leads to hypermethylation that can, for example, result in disrupted CTCF binding (
Evaluating heterogeneity through single cell technologies has yielded insights into tumor biology. Specifically, single cell RNA sequencing has enabled a deep dive into transcriptional heterogeneity and the multiple cellular identities present in a tumor. Similarly, understanding epigenetic heterogeneity provides insights into regulatory mechanisms. Prior to the present invention, single cell epigenetic technologies read out DNA methylation through bisulfite sequencing and DNA accessibility, an indicator of active regions of the genome, through ATAC-sequencing. While single cell methylation technologies have provided insights into various biological systems, including the human and mouse brain, further development of a single cell methylation technology could make it more accessible for the broader scientific community. As the cost of sequencing decreases, these highly multiplexed methods will increase the number of cells profiled.
The present invention features compositions and methods that are useful for determining the methylation profile of a cell. The method is a low-input, single cell DNA methylation assay that enriches for enhancers. Advantageous features of the method include early barcoding that allows multiplexing, combined digestion and ligation, bisulfite conversion on streptavidin beads, and libraries compatible with Next-Generation Sequencing (e.g., Illumina sequencing platform). The methods of the present invention capture many more enhancers (5× or more) and 40% or more of total cell type agnostic enhancers than conventional methylation assays. Low input methylation profiles generated by the presently described methods are robust, and the quality of the single cell data produced enables clustering by cell identity.
The disclosure provides a low input (e.g., single cell, 10, 25, 50, 100, 250, 500, 750, 1000 cells) methylation assay that is based on bisulfite chemistry, the standard for distinguishing methylated from unmethylated cytosines. Challenges that arise from the harsh conditions of bisulfite conversion (i.e., loss of nucleic acid) are reduced or eliminated in the present invention by pre- and post-bisulfite tagging to increase the capture of single-stranded converted DNA fragments.
The low input methylation assay enables capture of an informative CpG dinucleotide at the beginning of reads (p7 index), which obviates complicated trimming steps required with standard RRBS protocols, which typically utilize a fill in step and can thereby lose methylation information as well as influence methylation calling. Trimming reads generated from RRBS protocols can result in loss of methylation information and influence methylation calling. The present method also expands coverage of enhancers compared to other methodologies. This is accomplished with hexamer-based second strand synthesis and reduces overall cost of reagents (e.g., hemi-methylated adapters rather than fully methylated adapters). The method also maintains asymmetric adaptation not present in methods like single cell Assay for Transposase Accessible Chromatin (ATAC). Essentially, by tagging nucleic acid fragments with adapters prior to bisulfite conversion, more nucleic acid is retained after conversion compared to other methods. Thus, the present invention provides a significant improvement over known methods and will make single cell DNA methylation profiling more accessible to the broader scientific community.
The present invention provides methods of detecting methylation at single cell resolution (
The lysis reaction product is then contacted simultaneously with a restriction enzyme, a ligase, and adapter molecules. MspI restriction endonuclease cleaves nucleic acid molecules at CCGG sequences, with the cut being made between the cytosine nucleotides. Adapters are designed such that adapter ligation to digested DNA ends provides resistance to restriction enzyme activity (i.e., sequence recognized by the enzyme is destroyed), whereas a digested nucleic acid that intramolecularly ligates recreates the cut site and is susceptible to digestion again. This property of the adapters pushes the equilibrium away from nucleic acids being digested and then re-ligating intramolecularly and towards intermolecular ligation (i.e., adapter-nucleic acid). It also obviates the typical fill-in method and A tailing used in many library preparation protocols. Because the adapters lack a 5′ phosphate, ligase only creates a covalent bond between the phosphorylated the 5′ end of the fragmented DNA and the 3′ end of adapter (note that the 5′ end of the bottom strand of the adapter being unphosphorylated cannot covalently bond to the 3′ hydroxyl end of the digested nucleic acid).
A biotin label on the 3′ end of the bottom strand of the adapter enables streptavidin bead capture of all adapters that are hydrogen bonded/base paired to the covalently attached top strands. The beads can then be combined from different wells and volume adjusted. Pooled beads bound by biotinylated adapters are resuspended and placed in bisulfite conversion reagent. This involves heat denaturing the DNA double helix, thereby freeing ligated fragments from streptavidin beads. Bisulfite conversion, which involves a heating step that makes double stranded DNA single stranded, obviates any complicated steps in breaking the biotin-streptavidin bond. Elution from the beads is used for the remainder of the bisulfite conversion (Zymo Lightning Kit). In some embodiments that do not require bisulfite sequencing (e.g., nanopore sequencing and other technologies), the nucleic acid molecule is denatured (e.g., heat, chemical, or the like) to generate single stranded nucleic molecules.
Randomly annealing hexamers are used to adapt the 3′ end of DNA fragments and create a complementary second strand for bisulfite converted template, using a strand displacing polymerase (e.g., Klenow exo− or Bst DNA polymerase). A solid phase reversible immobilization (SPRI) cleanup is followed by PCR amplification with P7 and P5 barcodes (e.g., P7 (CAAGCAGAAGACGGCATACGAGAT) and P5 primers (AATGATACGGCGACCACCGA)) and a final library clean up. The generated libraries are compatible with NGS platforms (e.g., Illumina sequencing) and can be spiked into sequencing runs with other libraries. This reduces sequencing associated costs and complexity compared to the sciMET protocol, which requires custom sequencing primers and read lengths.
In one embodiment, MspI digestion and adapter ligation to form adapter-bound DNA fragments is replaced by using a transposase to generate DNA fragments having adapters at their termini. In some embodiments, the transposase is Tn5. This is then followed by bisulfite conversion, Klenow exo− mediated linear amplification, and additional PCR amplification similar to that described above (
The libraries generated by the present invention can be sequenced using any sequencing platform known in the art. Such technologies at present include, but are not limited to, chain-termination sequencing (Sanger Sequencing), Maxam-Gilbert sequencing, shotgun sequencing, single-molecule real-time sequencing, pyrosequencing, sequencing by synthesis, sequencing by ligation (SOLiD sequencing), nanopore sequencing, and massively parallel signature sequencing. However, it should be understood that any method that is now known or will be developed or otherwise known in the future, is contemplated for use in the present invention. In some embodiments, the sequencing platform is a next generation sequencing (NGS) platform. In some embodiments, the sequencing platform is NovaSeq 6000, MiSeq, HiSeq 2500, or HiSeq 2000. A workflow for these platforms is provided in
Assays described herein are used to profile the methylation state of a sample (e.g., biological sample) comprising a polynucleotide (e.g., a polynucleotide derived from a single cell or a population of cells). Likewise, the assays may be used to assess a single cell type or a sample comprising multiple cell types. The cells may be derived from cells cultured in vitro or from cells derived directly from a biological sample, such as a biological sample from a subject to be tested. Samples comprising cells to be assayed using the methods disclosed herein can be obtained from a variety of biological sources (e.g., human or animal sources). In some embodiments, the sample is a tissue sample. In another embodiment, the biologic sample is a biologic fluid sample. Biological fluid samples include blood, blood serum, plasma, saliva, or any other biological fluid useful in the methods of the invention. In some embodiments, the sample is a paraffin embedded sample (e.g., paraffin embedded tissue) or a formalin fixed paraffin embedded tissue sample. These types of samples can suffer from DNA degradation, but are routinely collected in clinical settings. Because the methods robust in the face of degradation of DNA, in some embodiments the sample or nucleic acid molecule inputs are degraded b/c it's robust in the face of degradation of DNA. In some embodiments, intact nuclei can be isolated from fixed tissue (or other samples) for use in the methods described herein. In some embodiments, the sample comprises cell free nucleic acid, such as, but not limited to, cell free tumor nucleic acid and cell free fetal nucleic acid. In some embodiments, the sample comprises tissue biopsies, blood draws, buccal swabs, hair, sweat, skin, semen, and mucus. In some embodiments, the sample comprises cells from a subject, for example, circulating tumor cells, blood cells, or skin cells. In some embodiments, the template nucleic acid molecule is isolated or purified before amplification. Methods of isolating and purifying nucleic acids are well known in the art.
The present invention provides adapters and primers. The barcoded adapters may comprise DNA, RNA, nucleotide analogs or a combination thereof. In one embodiment, an adapter of the present invention is a double-stranded asymmetric adapter molecule comprising a hemi-methylated region (i.e., the top strand is methylated or partially methylated but the bottom strand is not), a C-depleted cell barcode, and an overhang. In some embodiments, the hemi-methylated region comprises a nucleic acid sequence that is used in a next generation sequencing platform (e.g., Illumina). By being hemi-methylated, the adapter is resistant to MspI digestion.
In one embodiment, at least one free end of a cleaved polynucleotide (e.g., DNA) is ligated to a barcoded adapter. The barcoded adapter facilitates further amplification and sequencing of the fragmented polynucleotide (e.g., DNA). The barcode in turn is unique to each individual cell, thereby preserving the origin of the cleaved DNA. All cleaved DNA may be pooled. The presence of the barcode allows the DNA to be mapped back to a particular cell or cell population.
The C-depleted barcode allows tracking of sequencing data generated from an individual cell. In some embodiments, the C-depleted barcode is between 5 and 25 bp. For example, the C-depleted barcode can be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 bp. In some embodiments, the C-depleted barcode is less than 5 bp. In some embodiments, the C-depleted barcode is greater than 25 bp.
The overhang present in the adapter molecule allows the adapter molecule to hybridize with digested DNA. In some embodiments, the overhang comprises between 1-5 nucleotides.
In some embodiments, the adapter molecules of the present invention comprise at least a partial sequencing primer binding site. In some embodiments, the partial sequencing primer binding site is proximate to a barcode sequence. In certain example embodiments, a spacer of 1 to 20 nucleotides in length may be located between the sequencing primer binding site and the barcode. In certain example embodiments, the spacer may function as a unique molecular identifier (UMI). The UMI enables further differentiation between any two distinct adapter ligation events that may occur at a cleavage site in the DNA from two different cells. In other example embodiments, the first portion of the second read sequencing primer binding site may be located directly adjacent to the barcode sequence. The barcode is a short sequence of nucleotides (e.g. DNA, RNA, or nucleotide analog), for example, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 nucleotides. In certain example embodiments, the barcode is eight nucleotides in length. In one embodiment, the sequence is present at the terminus being ligated to digested DNA.
In some embodiments, the hemi-methylated double-stranded adapter comprises a label on the 3′ end of the non-methylated strand. For example, in some embodiments, the adapter has a label or a first member of a binding pair that can interact with another molecule (e.g., a capture molecule or a second member of a binding pair). In some embodiments, the first member of a binding pair A nonlimiting example of a label or a first member of a binding pair that can be used in the present invention is biotin. Because of its affinity for streptavidin, nucleic acid molecules comprising biotin labeled adapters can be bound to streptavidin (see
In some embodiments, post-bisulfite conversion amplification reactions can be primed with nucleic acid molecules comprising a sequence complementary to a sequence of the bisulfite converted DNA and a tag sequence. In some embodiments, the tag sequence can be used as a binding site for subsequent amplification or sequencing primers. In some embodiments, the tag comprises a partial SBS3 nucleic acid sequence. In some embodiments, the tag sequence comprises between 10 and 25 bp. In some embodiments, the tag sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 bp. In some embodiments, the tag sequence is less than 10 bp. In some embodiments, the tag sequence is greater than 25 bp.
In certain example embodiments, the adapter may comprise one or more modifications that increase adapter stability and/or resistance to degradation. In certain example embodiments, the modifications may be made to one or more terminal bases of the adapter on the 3′ end, the 5′ end, or both. In one example embodiments, the one or more modifications may be made to the first, second, third, and/or fourth terminal bases of the adapter on the 3′ or 5′ end of the sense or antisense strand. In certain example embodiments, the one or more modifications are made to the backbone linkages between the first and second terminal bases; the first, second, and third terminal bases; the first, second, third, and fourth terminal bases; or the first, second, third, fourth, and fifth terminal bases of the adapter on the 3′ or 5′ end of the sense or antisense strand of the adapter. In certain example embodiments, the one or more modifications comprise phosphorothioate linkages between the terminal bases on the 3′ or 5′ end of the sense or antisense strand. In one example embodiment, the one or more modifications comprise phosphorothioate linkages between the first and second terminal bases; the first, second, and third terminal bases; the first, second, third, and fourth terminal bases; or the first, second, third, fourth, and fifth terminal bases of the adapter on the 3′ or 5′ end of the sense or antisense strand. In one example embodiment, the one or more modifications comprise phosphorothioate linkages between the first and second terminal bases; the first, second, and third terminal bases; the first, second, third, and fourth terminal bases; or the first, second, third, fourth, and fifth terminal bases of the adapter on the 3′ end of the sense strand. In certain example embodiments, the modifications described in the immediately preceding sentence are further combined with phosphorothioate linkages between the first and second terminal bases; the first, second, and third terminal bases; the first, second, third, and fourth terminal bases; or the first, second, third, fourth, and fifth terminal bases of the adapter on the 5′ end of the antisense strand.
The amplification promoter is located proximate to at least the partial sequencing primer binding site. As used herein, “sequencing primer binding site” refers to a region comprising a nucleotide sequence complementary to a nucleotide sequence of a sequencing primer and to which the sequencing primer can hybridize to initiate a sequencing read. Thus, the nucleotide sequence of the sequencing primer used will dictate the sequence of the partial sequencing primer binding site on the adapter. In certain example embodiments, a spacer of 1 to 8 nucleotides in length may be located between the amplification promoter and the partial sequencing primer binding site. In certain other example embodiments, the amplification promoter and the partial sequencing primer binding site are directly adjacent to one another. In certain example embodiments, the partial sequencing primer binding site comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides complementary to a sequencing primer. In certain example embodiments, the partial sequencing primer binding site is a first read sequencing primer binding site. In certain example embodiments, the first read sequencing primer binding site is a SBS3 primer binding site. In certain other example embodiments, the sequencing primer binding site is a second read sequencing primer binding site. In certain example embodiments, the second read sequencing primer binding site is a SBS12 sequencing primer binding site. The SBS3 and SBS12 sequencing primers are provided as example only and binding sites based on other suitable sequencing primers may be used.
In some embodiments, libraries of amplified nucleic acid sequences are generated. The amplified DNA is sequenced using a suitable sequencing technology, such as a next generation sequencing method. The resulting sequencing data is then demultiplexed based on the one or more barcodes. For example, if an assay specific barcode is incorporated as described above, the sequence data may be demultiplexed based on the assay barcode such that all sequences detected as having a particular nucleosomal DNA modification are grouped first. The sequencing data may then be further grouped according to the origin specific barcode to identify all nucleosomal DNAs having a particular nucleosomal modification and originating from the same cell or cell population and any perturbations that may have been applied to the cell or cell population prior to conducting the assay.
Such library creation can require additional primers. For example, a library primer can comprise a nucleic acid sequence that is complementary to the tag sequence or the hemi-methylated sequence discussed above. In some embodiments, a forward library primer and a reverse library primer bind to the tag sequence and the hemi-methylated sequence, respectively, or vice versa. In some embodiments, the library primer can comprise a PCR barcode, a P7 or a P5 nucleic acid sequence, or combination thereof. The PCR barcode can reside on a library primer that also has the P7 or P5 nucleic acid. The PCR barcode, in some embodiments, resides 3′ to the P5 or P7 nucleic acid sequence.
In some embodiments where a transposase is used to break up genomic DNA and attach asymmetric adapters to the DNA, the adapter comprises a 20 bp cytosine-depleted linker. In some embodiments, the adapter comprises a 34 bp Nextera B sequence having a Tn5 binding site. In some embodiments, a Nextera B sequence is GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG.
The adapters and primers described herein can be used on next-generation sequencing platforms. Additionally, substituting primers used in one platform for primers used in another platform is well within the reach of one skilled in the art.
The present invention provides methods for detecting differentially methylated regions in a genome. Differentially methylated regions between hepatocellular carcinomas and matched normal cells occur in promoters and enhancers (
The methods of the present invention are uniquely suited to identify and characterize enhancer methylation. The protocol combines pre-bisulfate adapter tagging with a hexamer based amplification that allows multiplexing. In some embodiments, the cells are sorted into reaction vessels. For example, in some embodiments, a reaction vessel is a well, droplet, tube, or microfluidic chamber. In some embodiments, cells are first sorted into lysis reactions (such as a 96-well plate pre-filled with lysis reagents (
In some embodiments, double stranded, methylated adapters along with the MspI restriction enzyme, and a ligase (e.g., T4 ligase) are added to the lysed cells. In some embodiments, the ligation and the digestion reactions occur simultaneously (
The resulting barcoded nucleic acids derived from single cells can be pooled. In some embodiments, one strand of the adapter molecule will be labeled such that it and its associated nucleic acid can be immobilized. In some embodiments, the adapter molecule will have a biotin label, which will bind to streptavidin beads. The streptavidin-bound nucleic acids can then be subjected to bisulfite conversion (e.g., using the Zymo Lightning Kit) (
The amplified nucleic acid molecules can be purified (e.g., solid phase reversible immobilization (SPRI) purified, such as with biotin and streptavidin). The purified nucleic acid molecules can then be further amplified to generate a library. In some embodiments, more than one amplification reaction is used to prepare the library (
In another aspect of the present invention, a method is provided for detecting methylation in a cell, wherein the genomic DNA is fragments by a transposase enzyme inserting an adapter molecule (
The present invention is well-suited for droplet based chemistry. Using droplet based chemistry can reduce costs and allow integration of the method into microfluidic platforms.
The present invention provides methods and compositions for detecting methylation profiles of cells that are correlated with a disease and can be used to identify subjects with high probability of having or developing the disease. Detection of an alteration relative to a normal, reference sample can be used as a diagnostic indicator of a disease (e.g., cancer). In some embodiments, altered methylation of a particular gene is correlated with a particular disease. In some embodiments, the disease detected by the assay is a cancer. In some embodiments, the cancer is acute myeloid leukemia, glioma, or a chondrosarcoma. In some embodiments, the disease is Lynch Syndrome, an inherited disease resulting primarily in colorectal cancer. In some embodiments, the disease is age related clonal hematopoiesis (ARCH; also called clonal hematopoiesis of indeterminate potential (CHIP)), which is characterized by the gradual clonal expansion of hematopoietic stem and progenitor cells (HSPC) carrying recurrent disruptive genetic variants in individuals without a diagnosis of hematologic malignancy. This is usually diagnosed with sequencing of mutational rate, but could potentially benefit from methyl information of rare populations. In some embodiments the disease is an imprinting disease (e.g., Angelman syndrome (AS), Prader-Willi syndrome (PWS), and the like). Currently, imprinting diseases are diagnosed based on observable symptoms or by sequencing loci associated with a suspected disease. The present invention provides an additional means for diagnosing (or confirming a diagnosis) of an imprinting disease.
The present invention features diagnostic assays for the detection of a disease or the propensity to develop such a condition. In one embodiment, the level of methylation is measured on at least two separate occasions and an increase in the level is an indication of disease progression or regression. In some instances, the level of demethylation increases or the level of methylation decreases over time. The level of methylation in a cell of a subject having a disease or condition or susceptible to develop the disease or condition may be altered by as little as 10%, 20%, 30%, or 40%, or by as much as 50%, 60%, 70%, 80%, or 90% or more relative to the level of methylation in a normal control.
The diagnostic methods described herein can be used to provide a diagnosis individually or to confirm the results of another diagnostic method. Additionally, the methods described herein can be used with any other diagnostic method described herein for a more accurate diagnosis of the presence or severity of a disease.
A methylation profile may be obtained from a subject sample and compared to a reference profile obtained from a reference population, enabling classifying the subject as belonging to or not belonging to the reference population. The correlation of a methylation profile to a disease diagnosis may consider the presence or absence of methylation in test and control samples. The correlation may consider both factors when making a disease status determination.
The invention also provides for methods where methylation profiles are measured before and after subject management. In these cases, the methods are used to monitor the status of the cancer, e.g., a response to treatment, regression, remission, or progression of the disease.
The methylation profiles generated using the methods of the present invention have uses other than just diagnostic. In some embodiments, they can be used in monitoring responses to therapy. In another embodiment, the profiles can be used to study the regulatory regions of a gene associated with a disease. In some embodiments, the methylation profiles generated by the methods disclosed herein are useful in determining the status or stage of a subject's disease. A methylation profile generated for a subject sample using the methods described herein is compared with the methylation profile of a control sample, wherein differences in the levels or amounts of methylation distinguishes disease status from disease-free status. The techniques can be adjusted, as is well understood in the art, to increase the sensitivity or specificity of the diagnostic assay.
While methylation of a particular region or gene in the genome can be a useful diagnostic, in some instances, a combination of methylated genes or regions provides greater predictive value than a methylation profile of a single gene or region. Detection of the presence or absence of methylation at a plurality of genes or regions in a sample can decrease false positives and false negative diagnoses, while increasing the occurrence of true positives and true negatives.
In another embodiment, kits and compositions are provided that advantageously allow for the detection of methylation in a subject sample (e.g., blood, biopsy, urine, or saliva). In one embodiment, the kit includes a composition comprising reagents for performing an amplification reaction and/or a bisulfate conversion, including adapters as described herein. In some embodiments, the reagents include hemi-methylated adapters, a buffer, MspI or other methylation insensitive restriction enzyme that cuts at cytosines, and/or a polymerase. A non-exhaustive list of methylation insensitive restriction enzyme includes, but is not limited to, MspI, ScaI, BamHI, HindIII, NotI, and SpeI. In some embodiments, the kit comprises a sterile container which contains the amplification reaction reagents; such containers can be boxes, ampoules, bottles, vials, tubes, bags, pouches, blister-packs, or other suitable container forms known in the art. Such containers can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding amplification reagents.
In another embodiment, the kit includes a composition comprising reagents for performing a sequencing reaction, including nucleic molecules that can specifically bind to an adapter as described above. The reagents, in some embodiments, include nucleotides, labeled nucleotides, a buffer, and any other reagent necessary for performing a next-generation sequencing reaction (e.g., on the Illumina platform). In some embodiments, the kit comprises a sterile container which contains the amplification reaction reagents; such containers are described above. In some embodiments, the kit comprises compositions for amplification and sequencing as described above. Kits may also include instructions for performing the reactions.
The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are well within the purview of the skilled artisan. Such techniques are explained fully in the literature, such as, “Molecular Cloning: A Laboratory Manual”, second edition (Sambrook, 1989); “Oligonucleotide Synthesis” (Gait, 1984); “Animal Cell Culture” (Freshney, 1987); “Methods in Enzymology” “Handbook of Experimental Immunology” (Weir, 1996); “Gene Transfer Vectors for Mammalian Cells” (Miller and Calos, 1987); “Current Protocols in Molecular Biology” (Ausubel, 1987); “PCR: The Polymerase Chain Reaction”, (Mullis, 1994); “Current Protocols in Immunology” (Coligan, 1991). These techniques are applicable to the production of the polynucleotides and polypeptides of the invention, and, as such, may be considered in making and practicing the invention. Particularly useful techniques for particular embodiments will be discussed in the sections that follow.
The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the assay, screening, and therapeutic methods of the invention, and are not intended to limit the scope of what the inventors regard as their invention.
CpG methylation contributes to the stability and transcriptional regulation of mammalian genomes. CpG density is bimodal, depleted from most of the genome, with the exception of high density CpG islands that are frequently promoter-associated. DNA methylation at promoter-associated CpG islands is associated with gene silencing and intricately regulated to guide complex biological processes such as embryogenesis, aging, and tumorigenesis. Beyond promoters, DNA methylation patterns at genomic regulatory elements have been implicated in determining cell identity and chromatin structure, especially at enhancers and CTCF regions. Comprehensive profiling of DNA methylation is important to understand cell state dynamics.
The gold standard method for reading CpG methylation is to convert unmethylated cytosines to uracil with bisulfite treatment prior to sequencing. Whole genome bisulfite sequencing (WGBS) provides coverage of the entire genome, but is inefficient because vast CpG-depleted regions consume sequencing capacity. In contrast, reduced representation bisulfite sequencing (RRBS) uses restriction digest to enrich for CpG dense regions and thus provides high coverage of a fraction of the genome at reduced sequencing cost. However, RRBS lacks coverage of enhancer regions and CTCF binding sites that are outside of CpG islands. Methylation arrays that capture established regions of interest, typically promoters and CpG islands, may not be ideal for profiling regulatory elements, which are of high interest. The disclosure presents a novel strategy for profiling DNA methylation across promoters, enhancers and CTCF sites that is efficient and compatible with low input samples and single cells.
An enhancer enriching methylation assay that allowed for enhancer methylation profiling at single cell resolution is described. Viable cells, counterstained with propidium iodide, were sorted into wells of a 96 well plate preloaded with lysis buffer (
A biotin label on the 3′ end of the bottom strand of the adapter enabled streptavidin bead capture of all adapters and covalently attached top strands. The beads were then combined from different wells and volume adjusted. Pooled beads bound by biotinylated adapters were resuspended and placed in bisulfite conversion reagent. This involved heat denaturing the DNA double helix, thereby freeing ligated fragments from streptavidin beads. Elution from the beads was used for the remainder of the bisulfite conversion (Zymo Lightning Kit).
Randomly annealing hexamers were used to adapt the 3′ end of DNA fragments and create a complementary second strand for bisulfite converted template, using the Klenow enzyme. A solid phase reversible immobilization (SPRI) cleanup was followed by PCR amplification with P7 and P5 barcodes (e.g., P7 (CAAGCAGAAGACGGCATACGAGAT) and P5 (AATGATACGGCGACCACCGA)) and a final library clean up. The generated libraries were compatible with NGS platforms (e.g., Illumina sequencing) and could be spiked into sequencing runs with other libraries. This reduces sequencing associated costs and complexity compared to the sciMET protocol, which requires custom sequencing primers and read lengths.
More specifically, the assay combined adapter tagging prior to bisulfite conversion with hexamer-based amplification that allows multiplexing. The adapter comprised an asymmetrical double-stranded DNA molecule comprising a partial SBS12 sequence, methylated upper strand (28 bp) and unmethylated lower strand, an 8 bp cell barcode, and a 2 bp overhang extending from the 5′ end of the lower strand. The 3′ end of the lower strand was biotinylated (
Genomic DNA was digested with MspI in the presence of the adapter and T4 ligase, ATP, and Cutsmart buffer in a 3 μL reaction volume on a 96-well plate (
25 μL of eluted bisulfite converted DNA was included in a linear amplification reaction comprising 0.4 mM dNTPs, 2 μM hexamer fused to a partial SBS3 sequencing primer, and NEB Buffer 2.1. The reaction was heated to 95° C. for 45 seconds and flash cooled on ice. 50 units of Klenow exo− was added to the reaction and incubated at 4° C. for 5 minutes followed by increasing the reaction temperature 1° C. every 15 seconds until the temperature was 37° C. The reaction was incubated at 37° C. for 1.5 hours and heat deactivated at 95° C. for 45 seconds (
Referring to
This method captured more enhancers than reduced-representation bisulfite sequencing (RRBS). Referring to
To determine if the assay was sensitive to low levels of starting materials, three different amounts (1,000 cells, 10 ng, and 100 cells) of three different cell lines (HL60, Kasumi, and OCI-AML3) were used as starting materials for the methylation assay. The assay was performed according to the protocol described in Example 1. Principal Component Analysis (PCA) of the sequencing data (
Barcodes are used in the methods of the present invention to identify the source of each sequencing read. This allows one to distinguish between different samples, such as cells derived from different sources. To confirm that the barcodes identify the proper source, human and mouse cells were subjected to the assay described in Example 1, and the cells were mixed. The adapters used with the human cells had different barcodes than those used with mouse cells. The number of mouse and human reads sequenced from each barcode were plotted. Referring to
Methylation was assessed in two human cell lines, GM12878 and K562 using the assay described in Example 1. 100 CpG non-overlapping windows were used to generate methylation profiles for the cell lines. Two independent data sets generated from the assay were assessed along with RRBS bulk data using Principal Component Analysis. The methylation profiles for GM12878 cells cluster together with the methylation profiles for the K562 cell (
To further validate the methylation assay of Example 1, methylation profiles were generated for normal bone marrow cells lines and AML cell lines. These cell lines were chosen based on tumor methylation analyses. The AML cell lines included OCI-AML3, which harbor NPM1 and DNMT3A mutations and wild type FLT3; HL60, which is hypotetraploid, and Kasumi, which exhibits CEPBA inactivation and RUNX1-RUNX1T1 translocation. As shown in
The assay described in Example 1 was used to identify differential promoter methylation in these cell lines. 1030 promoters comprising CpG islands were identified that had cell line specific methylation profiles. Over 8,000 non-CpG island promoters, about 13,500 unmethylated CpG island promoters, and about 2,000 methylated CpG island promoters did not exhibit differential promoter methylation (
The assay exhibited higher coverage over accessible regions compared to other methodologies (e.g., DNase I hypersensitivity sequencing (DHS-seq), CTCF chromatin immunoprecipitation sequencing (ChIP-seq), CTCF motif, Illumina 450K Methylation Array, and RRBS) (
Individual cell methylation profiles may be distinct from a bulk methylation profile of a population of cells. For example, blood or bone marrow, as well as other bodily fluids and tissues, may comprise many different cell types (e.g., B cells, T cells, and the like). Additionally, single cells of the same type (e.g., B cells) may have different methylation profiles. For example, a cell having a mutation in IDH (a demethylase inhibitor), may have a different methylation profile than other cells of the same type that have wild type IDH. Thus, the present invention allows interrogation of single cells as well as interrogation of populations of cells.
The assay was used to generate bulk methylation profiles of bone barrow cells and sorted cell types (e.g., hematopoietic stem cell (HSC)/progenitor cells (CD34+), monocytes (CD14+), and T cells (CD3+)).
Cells present in a bone marrow sample comprise many distinct cell populations (
The results reported herein above were obtained using the following materials and methods.
Reagents for the preparation of methylation libraries: MspI; T4 DNA Ligase; 10 mM ATP; 10× NEB Buffer 2.I; 10 mM dNTP mix; 2× KAPA HiFi U+ Master Mix.
All oligos were ordered from IDT. Custom adapters were designed with a methylated top strand and biotinylated bottom strand. An 8 bp C-depleted barcode precedes the MspI cut site. These paired adaptors are listed in Table 1. A random hexamer oligo is used for the Klenow extension. Oligos for the final library PCR for compatibility with Illumina were generously provided by Peter van Galen.
Normal human bone marrow cells were stained for cell surface markers for 20 minutes on ice. Antibodies used and concentrations are provided in Table 2.
Flow Sorting
Cell lines (1-5 million) were counterstained with 1:1000 μL of propidium iodide in PBS and sorted in Sony SH800 sorter. Viable single cells were gated and used for sorting into 96 well plates.
Normal human bone marrow was collected and stored in liquid nitrogen. Frozen bone marrow was thawed in 37° C. water bath and transferred to a 15-mL conical. 9 mL of thawing medium (RPMI 50% FBS, P/S) was added slowly over 3-5 minutes while carefully agitating tube. The resuspended cells were spun at 300 Relative Centrifugal Force (rcf) for 5 minutes and then resuspended in 1 mL of RPMI(+10% FBS, P/S). Viable cells were counted and cells were aliquoted.
Unstained and PI only controls were generated with 50-100K cells. Antibody controls were created with 100 μL of beads and 1 μL of each of the 3 antibodies used in the experiment. The remaining cells were spun and resuspended at 1-5 million cells/mL in PBS+2% FBS. All 3 antibodies were added at concentrations listed in table 1.3 and incubated on ice for 20 minutes. Then the cells were spun down and washed in 4 mL of PBS+2% FBS and finally resuspended in PBS and 2% FBS with PI (1:2000) at 1-5 million cells per mL and sorted on a Sony SH800 Sorter. The antibody-bead controls were used for manual compensation.
The goal in lysing the cells was to isolate all DNA and remove any representation bias towards open chromatin. Starting the protocol with nuclei or with cells was considered. Isolating nuclei first would make the method easy to apply to frozen tissues as well as paraffin blocks of tissue. Thus, the Zymo Nuclei Isolation Kit was used to recover nuclei and sort nuclei into wells. The wells contained 3 μL of proK, 10% SDS, and 100 mM NaCl.
The advantage of an input of cells is the ability to sort according to cell surface markers. The effectiveness of cellular lysis using Tris to generate an ATAC library was tested. Cells lysed using that described in the LIANTI method, they showed no enrichment for open chromatin typical of ATAC libraries
A DNA methylation assay was designed with expanded coverage. The method included promoters, enhancers, and other regulatory elements that allow multiplexing and analysis of low-input samples. The method enriched CpG-containing regions for efficiency, but was not limited to CpG island promoters. Reduced representation bisulfite sequencing (RRBS) enriched CpG dense loci by purifying short genomic fragments after restriction by the methylation-insensitive enzyme MspI (cuts CCGG). Thus, reduced representation bisulfite sequencing (RRBS) captured fragments flanked by two proximate MspI sites (40-220 bases) on both ends. It was tested whether a procedure that also captured sequences flanked by a single MspI site could expand functional element coverage. In-silico analysis indicated that such a method can capture significantly more CpG dinucleotides: considering all CpGs within 300 bases of an MspI site, the method can theoretically cover 14.8 million CpGs or 50.5% of all CpGs in the human genome, compared to 11.8% of CpGs covered by reduced representation bisulfite sequencing (RRBS) (
This strategy was implemented in the following experimental design. First, a one-step incubation was optimized that combined MspI restriction and ligation of the restricted genomic fragments to adapters containing sample-identifying barcodes (
Libraries were generated from 10 ng of purified genomic DNA from K562 cells and technical replicate libraries were sequenced to ˜40 million paired-end reads (
Next, the extended representation bisulfite-sequencing method (expanded representation bisulfite sequencing (XRBS)) was compared to whole genome bisulfite sequencing (WGBS) and reduced representation bisulfite sequencing (RRBS).
To evaluate coverage of functionally-relevant genomic regions, coverage and enrichment over elements such as CpG islands, gene promoters, enhancers, and CTCF binding sites were systematically compared. DNA methylation changes in each of these regions has been linked to transcriptional regulation. Genomic coverage of these elements was compared between expanded representation bisulfite sequencing (XRBS), whole genome bisulfite sequencing (WGBS) and reduced representation bisulfite sequencing (RRBS). For purposes of comparison, each dataset was downsampled to 10 billion base pairs of sequencing data (corresponding to 66.7 million 75 bp paired-end reads), and considered an element to be covered if all contained CpGs accumulated to ≥100-fold coverage. With these criteria, expanded representation bisulfite sequencing (XRBS) and reduced representation bisulfite sequencing (RRBS) respectively captured 83.5% and 72.0% of CpG islands (
Coverage of enhancers and CTCF binding sites was next considered. Not wishing to be bound by theory, DNA methylation over enhancers has been shown to negatively correlate with target gene expression. CTCF is a DNA-binding protein with roles in nuclear architecture. DNA methylation antagonizes CTCF binding at CTCF motifs, which are typically found in regions of moderate to low CpG density. When sequenced to saturation, expanded representation bisulfite sequencing (XRBS) provided at least 25-fold coverage for 38,211 enhancers and 18,059 CTCF sites, compared to 15,239 enhancers and 5,170 CTCF sites with reduced representation bisulfite sequencing (RRBS) (
To analyze how expanded representation bisulfite sequencing (XRBS) performs relative to other DNA methylation profiling technologies in more detail, DNA methylation was visualized around CTCF binding sites (
Expanded representation bisulfite sequencing (XRBS) was used to compare methylation patterns across biological samples. In addition to K562 cells, expanded representation bisulfite sequencing (XRBS) libraries were generated for three additional leukemia cell lines (Kasumi-1, OCI-AML3, and HL-60) from 10 ng of purified DNA, as well as 1,000 and 100 cells sorted directly into lysis buffer. Using low-coverage sequencing of ˜5 million paired-end reads per library (
To contextualize the extensive hypomethylation observed in K562 cells, public data for histone modifications (ChIP-seq) and chromosome topology (Hi-C) was overlaid. Three modifications were considered that mark active transcripts (H3K36me3), facultative heterochromatin (H3K27me3) or constitutive heterochromatin (H3K9me3). Examination of 100 kb-windows revealed that DNA methylation strongly correlated with the active H3K36me3 mark (r=0.74), but negatively correlated with the inactive H3K27me3 (r=−0.31) and H3K9me3 marks (r=−0.23;
In order to detect differential methylation across an isogenic system, cell lines were treated with 300 nM decitabine, which inhibits DNA methyltransferase enzymes through covalent entrapment on DNA (
Given the increased coverage of functional elements in expanded representation bisulfite sequencing (XRBS) (
It was next determined whether differential DNA methylation over enhancers could inform enhancer activity, using H3K27ac as a surrogate marker. 16,825 H3K27ac peaks from ChIP-seq datasets for K562 and OCI-AML3 cells were aggregated that were covered in an expanded representation bisulfite sequencing (XRBS) dataset. The majority of these enhancers were hypomethylated in both cell lines (90.3%), whereas 7.5% (n=1,268) and 2.1% (n=355) of enhancers were specifically hypomethylated in K562 and OCI-AML3 cells, respectively (
Finally, it was determined whether expanded representation bisulfite sequencing (XRBS) could detect differential CTCF binding. Not wishing to be bound by theory, CTCF binding often occurs in CpG sparse regions, but is antagonized by DNA methylation. Differential DNA methylation was evaluated over a merged set of CTCF binding sites from HL-60 and K562 cell lines that were covered in the expanded representation bisulfite sequencing (XRBS) data (n=7,629). A close correspondence was found between cell line-specific hypomethylation and CTCF binding (
Key features of expanded representation bisulfite sequencing (XRBS), such as early barcoding and pooled bisulfite conversion, were well-suited for single cell profiling. Multiple single cells were barcoded upfront and combined into a single bisulfite reaction. This could increase sensitivity and reduce variability introduced by bisulfite conversion.
Single cells from human (K562 and GM12878) and mouse (Yac1) cell lines were index sorted into a 96-well plate. In each well, DNA was restricted with MspI and ligated one of 24 cell-identifying barcoded biotinylated adapters (BC1 to BC24 of Table 3). The 96 reactions were then combined into four pools of 24 cells each, adapted fragments were captured on streptavidin beads, and bisulfite conversion was performed (
To evaluate cross contamination between cells or barcodes, mouse and human single cells were evaluated from the same bisulfite reaction. Alignment of single cell expanded representation bisulfite sequencing (XRBS) data to genomes from both species confirmed that barcode cross contamination was extremely rare (
In addition to gaining epigenetic and SNP information, single cell expanded representation bisulfite sequencing (XRBS) methylation profiles were used to determine genetic copy-number variations (CNVs) in the same single cells. A computational approach was developed that calculated the relative read coverage in 637 bins across the genome (see Materials and Methods for Examples 7 to 11). Comparing K562 cells to GM12878 cells (which show a predominantly normal karyotype), copy-number variations (CNVs) were detected in the single cell data that were consistent with bulk sequencing data (
A challenge in evaluating cell-to-cell variability of DNA methylation relates to the low coverage of single cell methylation data. This was addressed using expanded representation bisulfite sequencing (XRBS). It was found that 93.3±1.1% of CpGs sites covered in a given single K562 or GM12878 cell were also covered in at least one other cell. Average DNA methylation levels were similar across single cells of a given cell type (29.9±2.6%, 67.5±3.5% and 47.5±3.7% for K562, Yac1 and GM12878, respectively;
Single cell variability in DNA methylation across different chromatin states was investigated. Relative to global DNA methylation levels, it was found that H3K9me3-marked genomic regions were associated with the highest cell-to-cell variability. In contrast, H3K27me3-marked regions had lower cell-to-cell variability despite having similar average DNA methylation levels (
K562, HL-60, and Yac-1 were obtained from ATCC. OCI-AML3 was obtained from DSMZ. All cell lines were routinely tested for mycoplasma contamination and maintained in a 37° C. humidity-controlled incubator with 5.0% CO2. Cells were maintained in exponential phase growth by passaging every 3 to 4 days. Cells were grown in RPMI supplemented with 10% heat inactivated fetal bovine serum and 1% penicillin/streptomycin.
Cells were collected and washed in cold PBS twice and then the pellet was snap frozen in liquid nitrogen. DNA was harvested by thawing the cell pellets at room temperature and resuspending in PBS, as directed by the Qiagen DNA Mini Blood Kit (51104).
For experiments directly performed on sorted cells (1,000, 100, and single cell experiments), cells were counterstained with 1:1000 μL of propidium iodide in phosphate-buffered saline (PBS) and sorted in a Sony SH800 sorter. Viable cells were gated and used for sorting into 96 well plates preloaded with 3 μL of lysis buffer (40 mM Tris-Ac, 1 mM EDTA, and 1 mM DTT). Incubation at 75° C. for 30 minutes was followed by adding 0.5 μL of Qiagen Protease and a 4 hour incubation at 55° C. and a 30 minute incubation at 75° C. to inactivate the proteinase.
Adapters consisting of a methylated top strand and biotinylated bottom strand were resuspended in Tris EDTA (TE) buffer at 100 μM, and annealed prior to use. All adapters and primers described herein were obtained from IDT. Briefly, annealing of adapters involved combining equimolar volumes of each adapter and heating to 95° C. 5 mins, followed by slow cooling to 4° C. at a rate of 0.1° C./sec. The methylated top strand contained a partial SBS12 sequence followed by an 8 base pair C-depleted barcode (top strand: 5′-/5SpC3/GG AGT T/iMe-dC/A GA/iMe-dC/ GTG TG/iMe-dC/ T/iMe-dC/T T/iMe-dC//iMe-dC/ GAT /iMe-dC/TD DDD D-3′). The biotinylated bottom strand complemented the methylated top strand with an additional two base pairs at the 5′ end (5′-CG-3′) complementary to the sticky end left by the MspI enzyme (bottom strand: 5′-CGH HHH HHH HAG ATC GGA AGA GCA CAC GTC TGA ACT CC/3Bio/-3′). The barcode sequences used in this study are described in Supplementary Table 3. The 5′ end of the bottom strand was left unphosphorylated, which prevented the formation of a covalent bond to the 3′-OH of a digested DNA fragment. The final ligation product of an adapter to an MspI-digested DNA fragment therefore had a nick between the biotinylated bottom strand adapter and the DNA fragment, facilitating efficient release from streptavidin beads during bisulfite conversion.
3 μL of digestion and ligation reagents were added to each well, which held 3 μL of either purified DNA or lysis buffer containing sorted cells. The final reaction contained 10 U MspI enzyme (NEB R0106M), 800 U T4 DNA ligase (NEB M0202M), 1.5 mM ATP (NEB P0756L), 10 nM annealed barcoded adapter, and 1× CutSmart Buffer that was compatible with both MspI restriction enzyme and T4 DNA ligase. The reaction was incubated for 2 hours at 37° C. and 1 hour at 22° C., followed by 4° C. hold. Both digestion of the DNA with MspI and ligation to double stranded adapters occurred concurrently. Adapter sequences were designed such that adapter ligation to digested DNA ends did not result in a new MspI restriction site. When digestion and ligation occurred simultaneously, the equilibrium shifted from intramolecular ligations (between two MspI digested DNA fragments) to intermolecular ligations (MspI DNA and adapter). Adapters were designed with an overhang in order to obviate a fill-in and A-tailing step used in many reduced representation bisulfite sequencing (RRBS) library preparation protocols.
C1 streptavidin beads (Thermo Fisher 65001) were washed with 1× Bind & Wash (B&W) buffer three times according to the kit instructions. Beads were resuspended in 2× B&W buffer and 10 μL were distributed to each reaction. The beads were incubated with barcoded samples on a rotator at room temperature for 15 minutes. For multiplexed single cell libraries, the beads from 24 distinctly barcoded wells were combined and placed in an Eppendorf tube. Using a magnet the beads were separated from the solution containing enzymes and resuspended in 20 μL of water. Resuspended beads were then added to 130 μL of conversion reagent for the bisulfite conversion.
Bisulfite conversion was performed directly on DNA bound to streptavidin beads, using the Zymo DNA Methylation Lightning Kit (D5046) according to the manufacturer's instructions with the following modification: After the initial conversion reaction at 98° C., the reactions were transferred to an Eppendorf tube and the streptavidin beads were pelleted through centrifugation at 4° C. for 10 mins at 16,000 rcf. The supernatant, containing single-stranded, bisulfite-converted DNA with a 5′ barcoded methylated adapter, was separated from the beads and processed further. Bisulfite converted DNA was eluted in 26 μL of water.
Bisulfite converted single stranded DNA was mixed with 1× NEB Buffer 2.1, 0.4 mM dNTP mix, and 2 μM random hexamer primer (5-TAC ACG ACG CTC TTC CGA TCT NNN NNN-3′). The solution was heated at 95° C. for 45 seconds and then transferred immediately to ice. 1 μL of Klenow enzyme (Enzymatics P7010-HC-L), which has strand displacing activity, was added to each reaction. Hexamer base pairing was mediated through a gradual increase in temperature from a 4° C. incubation and an incremental increase in temperature to 37° C. at a rate of 1° C. per second. Multiple hexamers could bind during this step. Klenow enzyme extended the hexamer primer generating the second strand during a 37° C. incubation for 1.5 hours. Because of the strand displacing activity, the hexamer bound farthest from the MspI site was extended and displaced other shorter hexamer extension products. This resulted in a linear amplification, with single stranded products as well as a double stranded fragment of the longest extension product. A 1× solid phase reversible immobilization (SPRI) was used to remove excess hexamer primer and was eluted in 12 μL of water. 10.5 μL of the elute was used for the final library polymerase chain reaction (PCR). Library fragment size distribution was 150 to 600 basepairs and peaked around 300 base pairs.
A final library amplification was carried out with 2× KAPA HiFi U+ mix (Kapa KK2801) and 0.4 μM P5 and P7 PCR primers with 6+14 cycles. 98° C. 1 min; 6× (98° C. 20 sec, 58° C. 30 sec, 72° C. 1 min); 16× (98° C. 20 sec, 65° C. 30 sec, 72° C. 1 min); 72° C. 3 min; 4° C. hold. 1× solid phase reversible immobilization (SPRI) was used to clean up excess library primers. The following primer sequences were used: P7 primer with i7 index: 5-CAA GCA GAA GAC GGC ATA CGA GAT-i7-GTG ACT GGA GTT CAG ACG TGT GC TCT T-3′; P5 primer without i5 index: 5′-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GAC GCT CTT CCG ATC T-3′; P5 primer with i5 index: 5′-AAT GAT ACG GCG ACC ACC GAG ATC TCA C-i5-AC ACT CTT TCC CTA CAC GAC GCT CTT CCG ATC T-3′. Index sequences used in this study are provided in Table 4.
Influence of decitabine treatment on viability of Kasumi, HL-60, and OCI-AML3 cells was evaluated through a drug dose response curve. Cells were plated and treated for 5 days with half-log concentrations ranging from 10 nM to 3 μM of decitabine. 30,000 Kasumi cells, 10,000 HL60 cells, and 50,000 OCI-AML3 cells were seeded per well of a 96 well plate based on the recommended seeding density of each cell line. The total volume was 100 μL after drug treatment on day 0. At day 3, cells were imaged and an additional 50 μL of 1× drug in RPMI (Roswell Park Memorial Institute) culture media was added and mixed with the cells. At day 5, 50 μL of CellTiter-Glo® reagent was added, followed by an 8 minute incubation on a rotator at room temperature. Luminescence was imaged using a plate reader and data was plotted using PRISM 2.14.
For expanded representation bisulfite sequencing (XRBS) profiles, HL-60 and OCI-AML3 cells were treated with 300 nM decitabine in 6 well plates. Cells were harvested after 5 days and gDNA was extracted using Qiagen DNA Mini Blood Kit (51104). 10 ng of gDNA were used for each library preparation.
All libraries were sequenced using the Illumina NextSeq 500 platform according to manufacturer's instructions. Paired-end data was generated using either 2×36 or 2×75 sequencing cycles, and split by single-index or dual-index library barcodes using bcl2fastq. The 8 bp sample barcode was located at the beginning of read 2, which was mostly C-to-T converted. The 6 bp random hexamer sequence was located at the beginning of read 1, which was mostly G-to-A converted. Fastq files were first split by expected sample barcodes, allowing for one mismatch. For libraries that contained only a single sample barcode, two mismatches were allowed. For two sequencing runs that showed poor read quality at the beginning of read 2 due to low sequence complexity, all reads for a given library barcode were included. Sample barcode and random hexamer sequence were trimmed from read 1 and read 2, and appended to the read identifier. Subsequently read 1 and read 2 were swapped to ensure compatibility with downstream analysis tools. Resulting fastq files, which are incorporated herein in their entirety by reference for all purposes, were uploaded to GEO/SRA (GSE149954, token: azujmeaezxqdxgr).
Before alignment, primer dimers were filtered using Cutadapt version 2.7 and the following parameters:--discard -a GCTCTTCCGATCT. Short read pairs were trimmed using TrimGalore version 0.6.5 and the following parameters: --paired --illumina --nextseq 20. Trimmed sequencing reads were then aligned to an in-silico bisulfate-converted reference genome (hg38 and mm10) using methylCtools version 1.0.0 and bwa mem version 0.7.17. Sorted alignments were further processed to only maintain uniquely mapped read pairs with a mapping score ≥1, that were mapping to an MspI cut site, and that had an insert size between 20 bp and 600 bp. Putative PCR duplicates were removed by considering the outer mapping position of both paired-end reads, as well as the random hexamer sequence that was trimmed prior to alignment and functioned as a unique molecular identifier (UMI). For library complexity analysis, alignments were downsampled prior to this step. DNA methylation calling was performed using methylCtools bcall and the --trimPE parameter. DNA methylation values, which are incorporated herein by reference for all purposes, were deposited on GEO (GSE149954, token: azujmeaezxqdxgr).
All downstream analyses were performed in R (version 3.6.2), making extensive use of the data.table and GenomicRanges packages. For many analyses, average DNA methylation values within genomic regions were used. Regions included CpG islands, promoters (1 kb up- and downstream of all transcription start sites of protein-coding genes), enhancers and CTCF binding sites (Encyclopedia of DNA Elements (ENCODE) narrowPeak files), and genomic 100 kb-windows. Average methylation values within these regions were calculated by summarizing calls for methylated and unmethylated CpGs across the entire region, and then calculating a single beta-value. For 100 kb-windows, CpGs within islands were not included. Minimum coverage thresholds were applied as indicated. Similarly, average methylation values were calculated for each genomic bin when visualized as heatmaps (genomic regions were separated in 100 equally-sized bins). Differential DNA methylation analysis was performed by sorting regions according to their difference in average methylation values (for enhancers and CTCF binding sites) or by applying a threshold (0.5) on the difference between the average methylation values of one cell line to the average of the other three cell lines (for promoters).
Whole-bisulfite sequencing data (whole genome bisulfite sequencing (WGBS)) and reduced-representation bisulfite sequencing data (reduced representation bisulfite sequencing (RRBS)) was downloaded as raw fastq files and processed similar to expanded representation bisulfite sequencing (XRBS) datasets to allow for a direct comparison. Hi-C datasets were downloaded as hic files and processed using Juicer tools to generate eigenvectors at 100 kb resolution. For comparison to Hi-C eigenvectors, other datasets were converted to the hg19 assembly using the liftOver tool. All other analyses were performed using the hg38 assembly.
Single-nucleotide polymorphisms (SNPs) were identified that were homozygous for different alleles in K562 and GM12878 cell lines. For this purpose, Illumina Infinium Omni5Exome-4 data was obtained from Encyclopedia of DNA Elements (ENCODE) and allele frequencies were calculated using the GenomeStudio software. 153,326 SNPs were identified that distinguished the two cell lines (allele frequency smaller 0.15 or larger 0.85, shown in
An approach was developed that uses read coverage at MspI restriction sites to estimate copy-number variations (CNVs) in single cells. For this purpose, genomic bins were generated based on the combined read coverage of the predominantly copy-number neutral GM12878 cells (32 cells). Each chromosome was separated into bins that each had a combined coverage of ˜10,000 reads. Across all chromosomes, a total of 637 bins were generated. Read coverage within bins was then quantified for each single cell from the K562 and GM12878 cell lines relative to the exact combined coverage in GM12878 cells. Individual copy-number variation (CNV) profiles were further normalized by the total read coverage in each single cell (shown in
From the foregoing description, it will be apparent that variations and modifications may be made to the invention described herein to adopt it to various usages and conditions. Such embodiments are also within the scope of the following claims.
The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or subcombination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.
All patents and publications mentioned in this specification are herein incorporated by reference to the same extent as if each independent patent and publication was specifically and individually indicated to be incorporated by reference.
This application is a continuation application, pursuant to 35 U.S.C. § 111(a) of PCT International Application No. PCT/US2020/060470, filed Nov. 13, 2020 designating the United States and published in English, which claims the benefit of and priority to U.S. Provisional Application No.: 62/934,802, filed Nov. 13, 2019, the entire contents of each of which are incorporated herein by reference in their entirety.
This invention was made with government support under Grant Nos. CA216873 and GM007753 awarded by the National Institutes of Health. The government has certain rights in the invention.
| Number | Date | Country | |
|---|---|---|---|
| 62934802 | Nov 2019 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | PCT/US2020/060470 | Nov 2020 | US |
| Child | 17743041 | US |