Patent Application
20210317540
The present disclosure is in the technical field of DNA based pathogen and plant analysis. More particularly, the present disclosure is in the technical field of pathogen analysis for plant, agriculture, food and water material using a multiplex assay and a 3-dimensional lattice microarray technology for immobilizing nucleic acid probes.
Several studies have indicated that fungal contaminants are routinely isolated from cannabis plants. In 2000, researchers documented the link between marijuana and heavy contamination by fungal spores (2). In 2017, researchers evaluated 20 cannabis plant samples in the California market contaminated with over 4,000 different fungal taxonomic classifications, including several opportunistic pathogenic fungal agents (Mucor, Aspergillus, Cryptococcus)(3). It is estimated that between 10-20% of cannabis flower fail testing requirements for TYMC (4,5). This calls for superior testing methods for fungal contaminants in plants in general, and cannabis in particular that are rapid and accurate.
Current techniques used to identify microbial pathogens rely upon established clinical microbiology monitoring. Pathogen identification is conducted using standard culture and susceptibility tests. These tests require a substantial investment of time, effort, cost as well as labile products. Current techniques are not ideal for testing large numbers samples. Culture-based testing is fraught with inaccuracies which include both false positives and false negatives, as well as unreliable quantification of colony forming units (CFUs). There are issues with the presence of viable but non-culturable microorganisms which do not show up using conventional culture methods. Certain culture tests are very non-specific in terms of detecting both harmful and harmless species which diminishes the utility of the test to determine if there is a threat present in the sample being tested.
In response to challenges including false positives and culturing of microorganisms, DNA-based diagnostic methods such as polymerase chain reaction (PCR) amplification techniques were developed. To analyze a pathogen using PCR, DNA is extracted from a material prior to analysis, which is a time-consuming and costly step.
In an attempt to eliminate the pre-analysis extraction step of PCR, Colony PCR was developed. Using cells directly from colonies from plates or liquid cultures, Colony PCR allows PCR of bacterial cells without sample preparation. This technique was a partial success but was not as sensitive as culture indicating a possible issue with interference of the PCR by constituents in the specimens. Although this possible interference may not be significant enough to invalidate the utility of the testing performed, such interference can be significant for highly sensitive detection of pathogens for certain types of tests. Consequently, Colony PCR did not eliminate the pre-analysis extraction step for use of PCR, especially for highly sensitive detection of pathogens.
It is known that 16S DNA in bacteria and the ITS2 DNA in yeast or mold can be PCR amplified, and once amplified can be analyzed to provide information about the specific bacteria or specific mold or yeast contamination in or on plant material. Further, for certain samples such as blood, fecal matter and others, PCR may be performed on the DNA in such samples absent any extraction of the DNA. However, for blood it is known that the result of such direct PCR is prone to substantial sample to sample variation due to inhibition by blood analytes. Additionally, attempts to perform direct PCR analysis on plant matter have generally been unsuccessful, due to heavy inhibition of PCR by plant constituents.
Over time, additional methods and techniques were developed to improve on the challenges of timely and specific detection and identification of pathogens. Immuno-assay techniques provide specific analysis. However, the technique is costly in the use of chemical consumables and has a long response time. Optical sensor technologies produce fast real-time detection but such sensor lack identification specificity as they offer a generic detection capability as the pathogen is usually optically similar to its benign background. Quantitative Polymerase Chain Reaction (qPCR) technique is capable of amplification and detection of a DNA sample in less than an hour. However, qPCR is largely limited to the analysis of a single pathogen. Consequently, if many pathogens are to be analyzed concurrently, as is the case with plant, agriculture, food and water material, a relatively large number of individual tests are performed in parallel.
Biological microarrays have become a key mechanism in a wide range of tools used to detect and analyze DNA. Microarray-based detection combines DNA amplification with the broad screening capability of microarray technology. This results in a specific detection and improved rate of process. DNA microarrays can be fabricated with the capacity to interrogate, by hybridization, certain segments of the DNA in bacteria and eukaryotic cells such as yeast and mold. However, processing a large number of PCR reactions for downstream microarray applications is costly and requires highly skilled individuals with complex organizational support. Because of these challenges, microarray techniques have not led to the development of downstream applications.
It is well known that DNA may be linked to a solid support for the purposes of DNA analysis. In those instances, the surface-associated DNA is generally referred to as the “Oligonucleotide probe” (nucleic acid probe, DNA probe) and its cognate partner to which the probe is designed to bind is referred to as the Hybridization Target (DNA Target). In such a device, detection and-or quantitation of the DNA Target is obtained by observing the binding of the Target to the surface bound Probe via duplex formation, a process also called “DNA Hybridization” (Hybridization).
Nucleic acid probe linkage to the solid support may be achieved by non-covalent adsorption of the DNA directly to a surface as occurs when a nucleic acid probe adsorbs to a neutral surface such as cellulose or when a nucleic acid probe adsorbs to cationic surface such as amino-silane coated glass or plastic. Direct, non-covalent adsorption of nucleic acid probes to the support has several limitations. The nucleic acid probe is necessarily placed in direct physical contact with the surface thereby presenting steric constraints to its binding to a DNA Target as the desired (bound) Target-Probe complex is a double helix which can only form by wrapping of the Target DNA strand about the bound Probe DNA: an interaction which is fundamentally inhibited by direct physical adsorption of the nucleic acid probe upon the underlying surface.
Nucleic acid probe linkage may also occur via covalent attachment of the nucleic acid probe to a surface. This can be induced by introduction of a reactive group (such as a primary amine) into the Probe then covalent attachment of the Probe, through the amine, to an amine-reactive moiety placed upon the surface: such as an epoxy group, or an isocyanate group, to form a secondary amine or a urea linkage, respectively. Since DNA is not generally reactive with epoxides or isocyanates or other similar standard nucleophilic substitutions, the DNA Probe must be first chemically modified with “unnatural” ligands such as primary amines or thiols. While such chemistry may be readily implemented during oligonucleotide synthesis, it raises the cost of the DNA Probe by more than a factor of two, due to the cost associated with the modification chemistry. A related UV crosslinking based approach circumvents the need for unnatural base chemistry, wherein Probe DNA can be linked to the surface via direct UV crosslinking of the DNA, mediated by photochemical addition of thymine within the Probe DNA to the amine surface to form a secondary amine adduct. However, the need for high energy UV for efficient crosslinking results in substantial side reactions that can damage the nucleic acid probe beyond use. As is the case for adsorptive linkage, the covalent linkages possible between a modified nucleic acid probe and a reactive surface are very short, in the order of less than 10 rotatable bonds, thereby placing the nucleic acid probe within 2 nm of the underlying surface. Given that a standard nucleic acid probe is >20 bases in length (>10 nm long) a Probe/linker length ratio >10/1 also provides for destabilizing inhibition of the subsequent formation of the desired Target-Probe Duplex.
Previous Attempts at addressing these problems have not met with success. Attachment of nucleic acid probes to surfaces via their entrapment into a 3-Dimensional gel phase such as that created by polymerizing acrylamide and polysaccharides among others have been problematic due to the dense nature of the gel phases. While the pore size (about 10 nm) in these gels permit entrapment and/or attachment of the nucleic acid probes within the gel, the solution-phase DNA Target, which is typically many times longer than the nucleic acid probe, is blocked from penetrating the gel matrix thereby limiting use of these gel phase systems due to poor solution-phase access to the Target DNA.
Thus, the prior art is deficient in methods of DNA based fungal pathogen analysis that interrogates a multiplicity of samples, uses fewer chemical and labile products, reduces processing steps and provides faster results while maintaining accuracy, specificity and reliability. The present invention fulfills this long-standing need and desire in the art.
The present invention is directed to a method of quantitating a fungus in a plant. A sample is obtained from the plant, total nucleic acids are isolated, and an asymmetric PCR amplification reaction performed using at least one fluorescent labeled primer pair in which one of the primers is unlabeled, to obtain at least one fluorescent labeled fungal amplicon. The amplicons are hybridized to a plurality of nucleic acid probes each attached at a specific position on a solid microarray support. The sequence in the nucleic acid probes corresponding to sequence determinants in the fungus. The microarray is washed and imaged to detect at least one fluorescent signal from the hybridized fluorescent labeled fungal amplicons. An intensity is the calculated for the fluorescent signal, which correlates with a quantity of fungus in the sample. The present invention is also directed to a related method where total DNA is isolated from the isolated total nucleic acids and the asymmetric PCR amplification reaction performed on the total DNA.
The present invention is also directed to a method of quantitating at least one fungus in an agricultural product. A sample of the agricultural product is obtained, and total nucleic acids are isolated. An asymmetric PCR amplification reaction performed on the total nucleic acid using at least one fluorescent labeled primer pair in which one of the primers is unlabeled, to obtain at least one fluorescent labeled fungal amplicon. The amplicons are hybridized to a plurality of nucleic acid probes each attached at a specific position on a solid microarray support. The sequence in the nucleic acid probes corresponding to sequence determinants in the fungus. The microarray is washed and imaged to detect at least one fluorescent signal from the hybridized fluorescent labeled fungal amplicons. An intensity is the calculated for the fluorescent signal, which correlates with a with a quantity of fungus in the sample. The present invention is also directed to a related method where total DNA is isolated from the isolated total nucleic acids and the asymmetric PCR amplification reaction performed on the total DNA.
The present invention is further directed to a customizable kit comprising the solid support, a plurality of fluorescent labeled bifunctional polymer linkers, solvents and instructions for fabricating the microarray using a plurality of custom designed nucleic acid probes relevant to an end user.
These and other features, aspects, and advantages of the embodiments of the present disclosure will become better understood when the following detailed description is read with reference to the accompanying drawings in which like characters represent like parts throughout the drawing, wherein:
As used herein, the term “a” or “an” when used in conjunction with the term “comprising” in the claims and/or the specification may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.” Some embodiments of the invention may consist of or consist essentially of one or more elements, method steps, and/or methods of the invention. It is contemplated that any method described herein can be implemented with respect to any other method described herein.
As used herein, the term “or” in the claims is used to mean “and/or” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and “and/or.”
As used herein, “comprise” and its variations, such as “comprises” and “comprising,” will be understood to imply the inclusion of a stated item, element or step or group of items, elements, or steps but not the exclusion of any other item, element or step or group of items, elements, or steps unless the context requires otherwise. Similarly, “another” or “other” may mean at least a second or more of the same or different claim element or components thereof.
In one embodiment of this invention, there is provided a method for quantitating a fungus on a plant, comprising obtaining a sample from the plant; isolating total nucleic acids from the sample; performing on the total nucleic acids an asymmetric PCR amplification reaction using at least one fluorescent labeled primer pair comprising an unlabeled primer, and a fluorescently labeled primer, selective for a target nucleotide sequence in the fungus to generate at least one fluorescent labeled fungal amplicon; hybridizing the fluorescent labeled fungal amplicons to a plurality of nucleic acid probes each having a sequence corresponding to a sequence determinant in the fungus, each of said nucleic acid probes attached at a specific position on a solid microarray support; washing the microarray at least once; imaging the microarray to detect at least one fluorescent signal from the hybridized fluorescent labeled fungal amplicons; and calculating an intensity of the fluorescent signal, said intensity correlating with a quantity of the fungus in the sample, thereby quantitating the fungus on the plant.
In this embodiment, the plant is a cannabis or a hemp or a product produced thereof. For example, the product is an oil such as cannabidiol produced from cannabis and hemp.
In this embodiment, the fungus is any fungus capable of infecting the plants including, but not limited to a yeast, a mold, an Aspergillus species and a Penicillium species.
In this embodiment, an asymmetric PCR amplification is performed on the total nucleic acids using at least one fluorescent labeled primer pair. Each of the fluorescent labeled primer pairs comprise an unlabeled primer, and a fluorescently labeled primer, selective for a target nucleotide sequence in the fungus. In this embodiment, the fluorescently labeled primer in about 4-fold to about 8-fold excess of the unlabeled primer whereby, upon completion of the reaction, the fluorescently labeled amplicon will be primarily single stranded (that is, the reaction is a type of “asymmetric PCR”). In this embodiment, the fluorescent labeled primer pairs have forward (odd numbers) and reverse (even number) sequences shown in SEQ ID: 13-16, 31-34, 133-135 (Table 6). Commercially enzymes and buffers are used in this step. Also, any fluorescent label may be used, including, but not limited to a CY3, a CY5, SYBR Green, a DYLIGHT DY647, a ALEXA FLUOR 647, a DYLIGHT DY547 and a ALEXA FLUOR 550.
Further in this embodiment, the fluorescent labeled fungal amplicons generated are hybridized to a plurality of nucleic acid probes. The nucleic acid probes have a sequence corresponding to sequence determinants in the fungus and have sequences SEQ ID NOS: 86-126 (Table 4) and 136-140 (Table 9). The nucleic acid probes are attached to a solid microarray support. The solid support is any microarray including but not limited to a 3-dimensional lattice microarray.
Further in this embodiment, after hybridization, unhybridized amplicons are removed by washing the microarray. Washed microarrays are imaged to detect a fluorescent signal corresponding to the fluorescent labeled fungal amplicons. Further in this embodiment, an intensity for the fluorescent signal is calculated. The calculated intensity is correlated with the number of fungus specific genomes in the sample, thereby quantitating the fungus in the sample. Based on analysis of fungus-free samples, an experimentally determined intensity threshold is established for the hybridization to each probe on the microarray, such that a fluorescent intensity above that threshold signifies the presence of fungus, while fluorescence intensities below the threshold signifies that fungus was not detected. Also, the fluorescence intensity correlates with a quantity of the fungus in the sample.
Further to this embodiment, the method comprises isolating total DNA after the isolating step and further performing the asymmetric PCR amplification on the total DNA as described above.
In another embodiment of this invention, there is provided a method for quantitating at least one fungus in an agricultural product, comprising obtaining a sample of the agricultural product; isolating total nucleic acids from the sample; performing on the total nucleic acids an asymmetric PCR amplification reaction using at least one fluorescent labeled primer pair comprising an unlabeled primer, and a fluorescently labeled primer, selective for a target nucleotide sequence in the at least one fungus to generate at least one fluorescent labeled fungal amplicon; hybridizing the fluorescent labeled fungal amplicons to a plurality of nucleic acid probes each having a sequence corresponding to a sequence determinant in the fungus, each of said nucleic acid probes attached at a specific position on a solid microarray support; washing the microarray at least once; imaging the microarray to detect at least one fluorescent signal from the hybridized fluorescent labeled fungal amplicons, and calculating an intensity of the fluorescent signal, the intensity correlating with a quantity of the fungus in the sample, thereby quantitating the at least one fungus in the agricultural product.
In this embodiment, the plant is a cannabis or a hemp or a product produced thereof. For example, the product is an oil such as cannabidiol produced from cannabis and hemp.
In this embodiment, the fungus is any fungus capable of infecting the plants including, but not limited to a yeast, a mold, an Aspergillus species and a Penicillium species.
In this embodiment, an asymmetric PCR amplification is performed on the total nucleic acids using at least one fluorescent labeled primer pair. Each of the fluorescent labeled primer pairs comprise an unlabeled primer, and a fluorescently labeled primer, selective for a target nucleotide sequence in the fungus. In this embodiment, the fluorescently labeled primer in about 4-fold to about 8-fold excess of the unlabeled primer whereby, upon completion of the reaction, the fluorescently labeled amplicon will be primarily single stranded (that is, the reaction is a type of “asymmetric PCR”). In this embodiment, the fluorescent labeled primer pairs have forward (odd numbers) and reverse (even number) sequences shown in SEQ ID: 13-16, 31-34, 133-135 (Table 6). Commercially enzymes and buffers are used in this step. Also, any fluorescent label may be used, including, but not limited to a CY3, a CY5, SYBR Green, a DYLIGHT DY647, a ALEXA FLUOR 647, a DYLIGHT DY547 and a ALEXA FLUOR 550.
Further in this embodiment, the fluorescent labeled fungal amplicons generated are hybridized to a plurality of nucleic acid probes. The nucleic acid probes have a sequence corresponding to sequence determinants in the fungus and have sequences SEQ ID NOS: 86-126 (Table 4) and 136-140 (Table 9). The nucleic acid probes are attached to a solid microarray support. The solid support is any microarray including but not limited to a 3-dimensional lattice microarray.
Further in this embodiment, after hybridization, unhybridized amplicons are removed by washing the microarray. Washed microarrays are imaged to detect a fluorescent signal corresponding to the fluorescent labeled fungal amplicons. Further in this embodiment, an intensity for the fluorescent signal is calculated. The calculated intensity is correlated with the number of fungus specific genomes in the sample, thereby quantitating the at least one fungus in the agricultural product. Based on analysis of fungus-free samples, an experimentally determined intensity threshold is established for the hybridization to each probe on the microarray, such that a fluorescent intensity above that threshold signifies the presence of fungus, while fluorescence intensities below the threshold signifies that fungus was not detected. Also, the fluorescence intensity correlates with a quantity of the fungus in the sample.
Further to this embodiment, the method comprises isolating total DNA after the isolating step and further performing the asymmetric PCR amplification on the total DNA as described above.
Described herein is a method for detecting a fungus in a plant sample such as for example a cannabis, or a plant product such as for example a cannabidiol. Total nucleic acids or total DNA is isolated, and an asymmetric PCR amplification reaction performed to generate fluorescent labeled fungal amplicons. The fluorescent labeled fungal amplicons are hybridized to nucleic acid probes attached to a microarray. This method allows positive hybridization signals to be validated on each sample tested based on internal “mismatched” and “sequence specific” controls. The method steps may be performed concurrently, performed in a single assay, which is beneficial since it enables streamlined detection of fungus in a single assay. The method may be employed to detect any fungus in the plant or plant product.
In the embodiments described above, the microarray is made of any suitable material known in the art including but not limited to borosilicate glass, a thermoplastic acrylic resin (e.g., poly(methyl methacrylate-VSUVT) a cycloolefin polymer (e.g. ZEONOR 1060R), a metal including, but not limited to gold and platinum, a plastic including, but not limited to polyethylene terephthalate, polycarbonate, nylon, a ceramic including, but not limited to TiO2, and Indium tin oxide (ITO) and engineered carbon surfaces including, but not limited to graphene. A combination of these materials may also be used. The solid support has a front surface and a back surface and is activated on the front surface by chemically activatable groups for attachment of the nucleic acid probes. In this embodiment, the chemically activatable groups include but are not limited to epoxysilane, isocyanate, succinimide, carbodiimide, aldehyde and maleimide. These materials are well known in the art and one of ordinary skill in this art would be able to readily functionalize any of these supports as desired. In a preferred embodiment, the solid support is epoxysilane functionalized borosilicate glass support.
The nucleic acid probes are attached either directly to the microarray support, or indirectly attached to the support using bifunctional polymer linkers. In this embodiment, the bifunctional polymer linker has a top domain and a bottom end. On the bottom end is attached a first reactive moiety that allows covalent attachment to the chemically activatable groups in the solid support. Examples of first reactive moieties include but are not limited to an amine group, a thiol group and an aldehyde group. In one aspect the first reactive moiety is an amine group. On the top domain of the bifunctional polymer linker is provided a second reactive moiety that allows covalent attachment to the oligonucleotide probe. Examples of second reactive moieties include but are not limited to nucleotide bases like thymidine, adenine, guanine, cytidine, uracil and bromodeoxyuridine and amino acid like cysteine, phenylalanine, tyrosine glycine, serine, tryptophan, cystine, methionine, histidine, arginine and lysine. The bifunctional polymer linker may be an oligonucleotide such as OLIGOdT, an amino polysaccharide such as chitosan, a polyamine such as spermine, spermidine, cadaverine and putrescine, a polyamino acid, with a lysine or histidine, or any other polymeric compounds with dual functional groups which can be attached to the chemically activatable solid support on the bottom end, and the nucleic acid probes on the top domain. Preferably, the bifunctional polymer linker is OLIGOdT having an amine group at the 5′ end.
In this embodiment, the bifunctional polymer linker may be unmodified with a fluorescent label. Alternatively, the bifunctional polymer linker has a fluorescent label attached covalently to the top domain, the bottom end, or internally. The second fluorescent label is different from the fluorescent label in the fluorescent labeled primers. Having a fluorescent label (fluorescent tag) attached to the bifunctional polymer linker is beneficial since it allows the user to image and detect the position of the individual nucleic acid probes (“spot”) printed on the microarray. By using two different fluorescent labels, one for the bifunctional polymer linker and the second for the amplicons generated from the fungal DNA being queried, the user can obtain a superimposed image that allows parallel detection of those nucleic acid probes which have been hybridized with amplicons. This is advantageous since it helps in identifying the fungus comprised in the sample using suitable computer and software, assisted by a database correlating nucleic acid probe sequence and microarray location of this sequence with a known DNA signature in fungi. Examples of fluorescent labels include, but are not limited to CY5, DYLIGHT DY647, ALEXA FLUOR 647, CY3, DYLIGHT DY547, or ALEXA FLUOR 550. The fluorescent labels may be attached to any reactive group including but not limited to, amine, thiol, aldehyde, sugar amido and carboxy on the bifunctional polymer linker. In one aspect, the bifunctional polymer linker is CY5-labeled OLIGOdT having an amino group attached at its 3′terminus for covalent attachment to an activated surface on the solid support.
Further in this embodiment, when the bifunctional polymer linker is also fluorescently labeled a second fluorescent signal image is detected in the imaging step. Superimposing the first fluorescent signal image and second fluorescent signal image allows identification of the fungus by comparing the sequence of the nucleic acid probe at one or more superimposed signal positions on the microarray with a database of signature sequence determinants for a plurality of fungal DNA. This embodiment is particularly beneficial since it allows identification of more than one type of fungus in a single assay.
QuantX TYM enables quantitating fungus in plants or plant products. The microarray has the capacity to test for multiple fungus and/or multiple plants and/or plant products in parallel. The testing may be performed in triplicate along with a panel of controls as needed, enabling rapid and reliable quantitation of fungus from multiple plant samples.
The following examples are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion. One skilled in the art will appreciate readily that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those objects, ends and advantages inherent herein. Changes therein and other uses which are encompassed within the spirit of the invention as defined by the scope of the claims will occur to those skilled in the art.
The present invention teaches a way to link a nucleic acid probe to a solid support surface via the use of a bifunctional polymeric linker. The nucleic acid probe can be a PCR amplicon, synthetic oligonucleotides, isothermal amplification products, plasmids or genomic DNA fragment in a single stranded or double stranded form. The invention can be sub-divided into two classes, based on the nature of the underlying surface to which the nucleic acid probe would be linked.
Covalent Microarray System with Activated Solid Support.
The covalent attachment of any one of these nucleic acid probes does not occur to the underlying surface directly, but is instead mediated through a relatively long, bi-functional polymeric linker that is capable of both chemical reaction with the surface and also capable of efficient UV-initiated crosslinking with the nucleic acid probe. The mechanics of this process is spontaneous 3D self assembly and is illustrated in
(a) an unmodified nucleic acid probe 3 such as an oligonucleotide, PCR or isothermal amplicon, plasmid or genomic DNA;
(b) a chemically activatable surface 1 with chemically activatable groups (designated “X”) compatible for reacting with a primary amine such as. epoxysilane, isocyanate, succinimide, carbodiimide, aldehyde.
(c) bifunctional polymer linkers 2 such as a natural or modified OligodT, amino polysaccharide, amino polypeptide suitable for coupling to chemically activatable groups on the support surface, each attached with a fluorescent label 4; and
(d) a solvent comprising water and a high boiling point, water-miscible liquid such as glycerol, DMSO or propanediol (water to solvent ratio between 10:1 and 100:1).
Table 1 shows examples of chemically activatable groups and matched reactive groups on the bifunctional polymer linker for mere illustration purposes only and does not in any way preclude use of other combinations of matched reactive pairs.
When used in the present invention, the chemically activatable surface, bifunctional polymer linkers and unmodified nucleic acid probes are included as a solution to be applied to a chemically activated surface 4 by ordinary methods of fabrication used to generate DNA Hybridization tests such as contact printing, piezo electric printing, ink jet printing, or pipetting.
Microarray fabrication begins with application of a mixture of the chemically activatable surface, bifunctional polymer linkers and unmodified nucleic acid probes to the surface. The first step is reaction and covalent attachment of the bifunctional linker to the activated surface (
In the second step, the water in the solvent is evaporated to concentrate the DNA and bifunctional linker via evaporation of water from the solvent (
In the third step, the terminal Thymidine bases in the nucleic acid probes are UV crosslinked to the bifunctional linker within the evaporated surface (
Microarray System with Unmodified Solid Support for Non-Covalent Attachment
In this microarray system, attachment of the nucleic acid probes does not occur to the underlying surface directly, but is instead mediated through a relatively long, bi-functional polymeric linker that binds non-covalently with the solid support, but covalently with the nucleic acid probes via UV-initiated crosslinking. The mechanics of this process is spontaneous 3D self assembly and is illustrated in
(1) an unmodified nucleic acid probe 3 such as an oligonucleotide, PCR or isothermal amplicon, plasmid or genomic DNA;
(2) an unmodified solid support 1;
(3) bifunctional polymer linkers 2 such as OligodT or a amino polysaccharide, amino polypeptide, that inherently have or are modified to have functional groups (designated “R”) compatible for adsorptive binding to the solid support, each having a fluorescent label 4; and
(4) a solvent comprising water and a high boiling point, water-miscible liquid such as glycerol, DMSO or propanediol (water to solvent ratio between 10:1 and 100:1);
Table 2 shows examples of unmodified support surfaces and matched absorptive groups on the bifunctional polymer linker for mere illustration purposes only and does not in any way precludes the use of other combinations of these.
When used in the present invention, components 1-3 are included as a solution to be applied to the solid support surface by ordinary methods of fabrication used to generate DNA Hybridization tests such as contact printing, piezo electric printing, ink jet printing, or pipetting.
Microarray fabrication begins with application of a mixture of the components (1)-(3) to the surface. The first step is adsorption of the bifunctional linker to the support surface (
In the second step, the water in the solvent is evaporated to concentrate the DNA and bifunctional linker via evaporation of water from the solvent (
In the third step, the terminal Thymidine bases in the nucleic acid probes are UV crosslinked to the bifunctional linker within the evaporated surface (
Although such non-covalent adsorption described in the first step is generally weak and reversible, when occurring in isolation, in the present invention it is taught that if many such weak adsorptive events between the bifunctional polymeric linker and the underlying surface occur in close proximity, and if the closely packed polymeric linkers are subsequently linked to each other via Thymidine-mediated photochemical crosslinking, the newly created extended, multi-molecular (crosslinked) complex will be additionally stabilized on the surface, thus creating a stable complex with the surface in the absence of direct covalent bonding to that surface.
The present invention works very efficiently for the linkage of synthetic oligonucleotides as nucleic acid probes to form a microarray-based hybridization device for the analysis of microbial DNA targets. However, it is clear that the same invention may be used to link PCR amplicons, synthetic oligonucleotides, isothermal amplification products, plasmid DNA or genomic DNA fragment as nucleic acid probes. It is also clear that the same technology could be used to manufacture hybridization devices that are not microarrays.
DNA nucleic acid probes were formulated as described in Table 3, to be deployed as described above and illustrated in
Cannabis ITS1 DNA
Cannabis ITS1 DNA
Cannabis ITS1 DNA
Aspergillus
fumigatus 1
Aspergillus flavus 1
Aspergillus niger 1
Botrytis spp.
Fusarium spp.
Alternaria spp
Rhodoturula spp.
Penicillium paxilli
Penicillium oxalicum
Penicillium spp.
Candida spp.
Candida spp.
Stachybotrys spp
Trichoderma spp.
Cladosporium spp.
Podosphaera spp.
Listeria spp.
Aeromonas spp.
Staphylococcus
aureus 1
Campylobacter spp.
Pseudomonas
Clostridium spp.
Escherichia coli/
Shigella 1
Salmonella enterica/
Enterobacter 1
The set of 48 different probes of Table 4 were formulated as described in Table 3, then printed onto epoxysilane coated borosilicate glass, using an Gentics Q-Array mini contact printer with Arrayit SMP pins, which deposit about 1 nL of formulation per spot. As described in
Using the 3-dimensional lattice microarray system for DNA analysis
Harvesting Pathogens from plant surface comprises the following steps:
1) Wash the plant sample or tape pull in 1× phosphate buffered saline (PBS);
2) Remove plant material/tape;
3) Centrifuge to pellet cells & discard supernatant;
4) Resuspend in PathogenDx (PathogenDX, Inc.) Sample Prep Buffer pre-mixed with Sample Digestion Buffer;
5) Heat at 55° C. for 45 minutes;
6) Vortex to dissipate the pellet;
7) Heat at 95° C. for 15 minutes; and
8) Vortex and centrifuge briefly before use in PCR.
The sample used for amplification and hybridization analysis was a Cannabis flower wash from a licensed Cannabis lab. The washed flower material was then pelleted by centrifugation. The pellet was then digested with proteinaseK, then spiked with a known amount of Salmonella DNA before PCR amplification.
The Salmonella DNA spiked sample was then amplified with PCR primers (P1-Table 5) specific for the 16S region of Enterobacteriaceae in a tandem PCR reaction to first isolate the targeted region (PCR Reaction #1) and also PCR primers (P1-Table 5) which amplify a segment of Cannabis DNA (ITS) used as a positive control.
The product of PCR Reaction #1 (1 μL) was then subjected to a second PCR reaction (PCR Reaction #2) which additionally amplified and labelled the two targeted regions (16S, ITS) with green CY3 fluorophore labeled primers (P2-Table 5). The product of the PCR Reaction #2 (50 μL) was then diluted 1-1 with hybridization buffer (4×SSC+5×Denhardt's solution) and then applied directly to the microarray for hybridization.
Cannabis ITS1 1 ° FP*- TTTGCAACAGCAGAACGACCCGTGA
Cannabis ITS1 1 ° RP*- TTTCGATAAACACGCATCTCGATTG
Cannabis ITS1 2 ° FP- TTTCGTGAACACGTTTTAAACAGCTTG
Cannabis ITS1 2 ° RP- (Cy3)TTTTCCACCGCACGAGCCACGCGAT
Because the prior art method of microarray manufacture allows DNA to be analyzed via hybridization without the need for pre-treatment of the microarray surface, the use of the microarray is simple, and involves 6 manual or automated pipetting steps.
1) Pipette the amplified DNA+binding buffer onto the microarray
2) Incubate for 30 minutes to allow DNA binding to the microarray (typically at room temperature, RT)
3) Remove the DNA+binding buffer by pipetting
4) Pipette 50 uL of wash buffer onto the microarray (0.4×SSC+0.5×Denhardt's) and incubate 5 min at RT.
5) Remove the wash buffer by pipetting
6) Repeat steps 4 and 5
7) Perform image analysis at 532 nm and 635 nm to detect the probe spot location (532 nm) and PCR product hybridization (635 nm).
Image Analysis was performed at two wavelengths (532 nm and 635 nm) on a raster-based confocal scanner: GenePix 4000B Microarray Scanner, with the following imaging conditions: 33% Laser power, 400PMT setting at 532 nm/33% Laser Power, 700PMT setting at 635 nm.
PCR reactions is utilized to support the needed DNA amplification. In general, such PCR amplification is performed in series: a first pair of PCRs, with the suffix “P1” in
Table 7 displays representative oligonucleotide sequences which are used as microarray probes in an embodiment for DNA microarray-based analysis of bacterial 16S locus as described in
Table 9 displays representative oligonucleotide sequences which are used as microarray probes in an embodiment for DNA microarray-based analysis of eukaryotic pathogens (fungi, yeast & mold) based on their ITS2 locus as described in
Table 10 displays representative oligonucleotide sequences which are used as microarray probes in an embodiment for DNA microarray-based analysis of Cannabis at the ITS1 locus (Cannabis spp.).
Escherichia coli/Shigella 1
Escherichia coli/Shigella 2
Escherichia coli/Shigella 3
Bacillus spp. Group1
Bacillus spp. Group2
Campylobacter spp.
Chromobacterium spp.
Citrobacter spp. Group1
Clostridium spp.
Aeromonas
salmonicida/hydrophilia
Aeromonas spp.
Alkanindiges spp.
Bacillus pumilus
Hafnia spp.
Klebsiella oxytoca
Klebsiella pneumoniae
Legionella spp.
Listeria spp.
Panteoa agglomerans
Panteoa stewartii
Pseudomonas aeruginosa
Pseudomonas cannabina
Pseudomonas spp. 1
Pseudomonas spp. 2
Pseudomonas spp. 3
Salmonella bongori
Salmonella
enterica/Enterobacter 1
Salmonella
enterica/Enterobacter 2
Salmonella
enterica/Enterobacter 3
Serratia spp.
Staphylococcus aureus 1
Staphylococcus aureus 2
Streptomyces spp.
Vibrio spp.
Xanthamonas spp.
Yersinia pestis
Alternaria spp.
Aspergillus flavus 1
Aspergillus flavus 2
Aspergillus
fumigatus 1
Aspergillus
fumigatus 2
Aspergillus
nidulans
Aspergillus niger 1
Aspergillus niger 2
Aspergillus niger 3
Aspergillus terreus
Blumeria
Botrytis spp
Candida albicans
Candida spp.
Candida spp.
Chaetomium spp.
Cladosporium spp
Erysiphe spp.
Fusarium
oxysporum
Fusarium spp
Golovinomyces
Histoplasma
capsulatum
Isaria spp.
Monocillium spp.
Mucor spp.
Myrothecium spp.
Oidiodendron spp.
Penicillium
oxalicum
Penicillium paxilli
Penicillium spp
Phoma/Epicoccum
Podosphaera spp
Podosphaera spp.
Pythium
oligandrum
Rhodoturula spp
Stachybotrys spp
Trichoderma spp
Golovinomyces
Mucor spp.
Aspergillus terreus
Podosphaera spp.
Table 11 displays representative oligonucleotide sequences which are used as microarray probes in an embodiment for DNA microarray-based analysis of bacterial pathogens (stx1, stx2, invA, tuf) and for DNA analysis of the presence host Cannabis at the ITS1 locus (Cannabis spp.). It should be noted that this same approach, with modifications to the ITS1 sequence, could be used to analyze the presence of other plant hosts in such extracts.
Cannabis ITS1
Cannabis ITS1
Cannabis ITS1
Cannabis ITS1
The data of
Tables 12A and 12B show a collection of representative microarray hybridization data obtained from powdered dry food samples with no enrichment and 18-hour enrichment for comparison. The data shows that bacterial microbes were successfully detected on the microarrays of the present invention without the need for enrichment.
If fresh leaf, flower, stem or root materials from fruit and vegetables are also washed in a water solution in that same way (when fresh, or after drying and grinding or other types or processing, then the present combination of RSG and microarray analysis would be capable of recovering and analyzing the DNA complement of those microbes in those other plant materials.
At least two methods of sample collection are possible for fruit and vegetables. One method is the simple rinsing of the fruit, exactly as described for Cannabis, above. Another method of sample collection from fruits and vegetables is a “tape pull”, wherein a piece of standard forensic tape is applied to the surface of the fruit, then pulled off. Upon pulling, the tape is then soaked in the standard wash buffer described above, to suspend the microbes attached to the tape. Subsequent to the tape-wash step, all other aspects of the processing and analysis (i.e., raw sample genotyping, PCR, then microarray analysis) are exactly as described above.
Escherichia
coli/Shigella spp.
S. enterica/
enterobacter spp.
Bacillus spp.
Pseudomonas
Escherichia
coli/Shigella spp.
S. enterica/
enterobacter spp.
Bacillus spp.
Pseudomonas
The data of Tables 13-15 demonstrates that simple washing of the fruit and tape pull sampling of the fruit generate similar microbial data. The blueberry sample is shown to be positive for Botrytis, as expected, since Botrytis is a well-known fungal contaminant on blueberries. The lemon sample is shown to be positive for Penicillium, as expected, since Penicillium is a well-known fungal contaminant for lemons.
Botrytis spp. 1
Botrytis spp. 2
Penicillium spp. 1
Penicillium spp. 2
Fusarium spp. 1
Fusarium spp. 2
Mucor spp. 1
Mucor spp. 2
The data embodied in
Botrytis spp. 1
Botrytis spp. 2
Penicillium spp. 1
Penicillium spp. 2
Fusarium spp. 1
Fusarium spp. 2
Mucor spp. 1
Mucor spp. 2
Table 16 shows embodiments for the analysis of environmental water samples/specimens. The above teaching shows by example that unprocessed leaf and bud samples in Cannabis and hops may be washed in an aqueous water solution, to yield a water-wash containing microbial pathogens which can then be analyzed via the present combination of Raw Sample Genotyping (RSG) and microarrays. If a water sample containing microbes were obtained from environmental sources (such as well water, or sea water, or soil runoff or the water from a community water supply) and then analyzed directly, or after ordinary water filtration to concentrate the microbial complement onto the surface of the filter, that the present combination of RSG and microarray analysis would be capable of recovering and analyzing the DNA complement of those microbes.
The data embodied in Table 16 were obtained from 5 well-water samples (named 2H, 9D, 21, 23, 25) along with 2 samples of milliQ laboratory water (obtained via reverse osmosis) referred to as “Negative Control”. All samples were subjected to filtration on a sterile 0.4 um filter. Subsequent to filtration, the filters, with any microbial contamination that they may have captured, were then washed with the standard wash solution, exactly as described above for the washing of Cannabis and fruit. Subsequent to that washing, the suspended microbes in wash solution were then subjected to exactly the same combination of centrifugation (to yield a microbial pellet) then lysis and PCR of the unprocessed pellet-lysate (exactly as described above for Cannabis), followed by PCR and microarray analysis, also as described for Cannabis.
Botrytis spp.
Alternaria spp.
Penicillium spp.
Podosphaera spp.
Escherichia coli specific gene
Salmonella specific gene
Bacillus spp.
Pseudomonas spp.
Escherichia coli/Shigella spp.
Salmonella
enterica/enterobacter spp.
Trichoderma spp.
Escherichia coli
Escherichia coli/Shigella spp.
Salmonella enterica
Salmonella enterica
The data seen in Table 16 demonstrate that microbes collected on filtrates of environmental water samples can be analyzed via the same combination of raw sample genotyping, then PCR and microarray analysis used for Cannabis and fruit washes. The italicized elements of Table 16 demonstrate that the 5 unprocessed well-water samples all contain aerobic bacteria and bile tolerant gram-negative bacteria. The presence of both classes of bacteria is expected for unprocessed (raw) well water. Thus, the data of Table 16 demonstrate that this embodiment of the present invention can be used for the analysis of environmentally derived water samples.
The above teaching shows that unprocessed leaf and bud samples in Cannabis and hops may be washed in an aqueous water solution to yield a water-wash containing microbial pathogens which can then be analyzed via the present combination of RSG and microarrays. The above data also show that environmentally-derived well water samples may be analyzed by an embodiment. Further, if a water sample containing microbes were obtained from industrial processing sources (such as the water effluent from the processing of fruit, vegetables, grain, meat) and then analyzed directly, or after ordinary water filtration to concentrate the microbial complement onto the surface of the filter, that the present combination of RSG and microarray analysis would be capable of recovering and analyzing the DNA complement of those microbes.
Further, if an air sample containing microbes as an aerosol or adsorbed to airborne dust were obtained by air filtration onto an ordinary air-filter (such as used in the filtration of air in an agricultural or food processing plant, or on factory floor, or in a public building or a private home) that such air-filters could then be washed with a water solution, as has been demonstrated for plant matter, to yield a microbe-containing filter eluate, such that the present combination of Raw Sample Genotyping (RSG) and microarray analysis would be capable of recovering and analyzing the DNA complement of those microbes.
While the foregoing written description of an embodiments enables one of ordinary skill to make and use what is considered presently to be the best mode thereof, those of ordinary skill will understand and appreciate the existence of variations, combinations, and equivalents of the specific embodiment, method, and examples herein. The present disclosure should therefore not be limited by the above described embodiments, methods, and examples, but by all embodiments and methods within the scope and spirit of the present disclosure.
PathogenDx QuantX assay for the detection of fungal contaminants in plants.
Probability of Detection (POD): The proportion of positive analytical outcomes for a qualitative method for a given matrix at a given analyte level or concentration. POD is concentration dependent. Several POD measures can be calculated; PODR (reference method POD), PODC (confirmed candidate method POD), PODCP (candidate method presumptive result POD) and PODCC (candidate method confirmation result POD).
Difference of Probabilities of Detection (dPOD): Difference of probabilities of detection is the difference between any two POD values. If the confidence interval of a dPOD does not contain zero, then the difference is statistically significant at the 5% level.
Microarray: A laboratory tool used to detect the expression of thousands of genes at the same time. DNA microarrays are 96-well plates that are printed as a matrix of oligonucleotide probe “Spots” in defined positions, with each spot containing a known DNA sequence.
a) QuantX Sample Preparation Kit
b) PCR Master Mix
c) Hybridization and Analysis
a) SENSOSPOT Fluorescence Microarray Analyzer (Sensospot Milteny Imaging GmbH, Germany)
b) MiniAmp Thermocycler, PN A37834 (ThermoFisher Scientific)
c) PCR Plate Spinner Centrifuge, PN C2000 (Light Labs)
a) Cannabis flower (10 g). Mix 10 g of sample with 90 mL of PBS in a Whirl-Pak filter bag.
b) Perform a wash of the matrix by homogenizing for 10 sec.
c) Serially dilute the sample to the action level required for analysis (e.g. 1:1,000, 1:10,000, 1:100,000).
a) Transfer 1 mL of the PBS suspension into a clean 1.5 mL conical tube, then centrifuge tube at 50×g for 3 minutes to pellet the excess matrix material.
b) Transfer the supernatant to a clean 1.5 mL tube, being careful to avoid matrix material. Discard the matrix pellet.
c) Centrifuge samples at 14,000×g for 3 minutes to pellet the cells.
d) Decant the supernatant and retain the cell pellet. Remove as much supernatant as possible without disturbing the pellet. It may be necessary to remove excess with a pipette.
e) Add 35 μL of Lysis Buffer to each tube, vortex to dislodge the pellet and quick spin.
f) Heat Sample tubes at 95+1° C. for 10 minutes.
g) Remove the tubes from the heat, vortex and briefly centrifuge.
h) To each tube add 5 μL of Neutralization Buffer and vortex thoroughly to mix.
i) Sample buffer Mix (make fresh each time) is prepared as shown in Table 17 by adding volumes of Sample Digestion Buffer and Sample Prep Buffer based on the number of samples being prepared.
j) Add 25 μL of Sample Buffer Mix to each tube, vortex to mix.
k) Heat sample tubes at 55+1° C. for 45 minutes.
l) Vortex for 10 seconds and briefly centrifuge samples to bring the fluid to bottom of the tube.
m) Heat sample tubes at 95+1° C. for 15 minutes.
n) Perform the Promega ReliaPrep DNA Clean-Up and Concentration System protocol using the following instructions:
c) Samples are now ready for PCR. Vortex and briefly centrifuge the tubes before removing 2 μL for PCR.
PCR amplification
a) Thaw PCR Master Mix and Primer Set.
b) Thaw the Standard tube on the Sample Prep Area bench top.
a) Perform all steps in the Hybridization/Post PCR Area.
b) Before starting, thaw Buffer 2 at room temperature.
c) Prepare the Pre-hybridization Buffer and Hybridization Buffers in sterile tubes for the number of wells that will be hybridized as per Tables 20 and 21. The tables shown below have the volumes required to make one well. Multiply the reagent volumes by the number of wells to be run. Add extra wells to account for pipetting loss. Vortex briefly to mix.
d) Apply 200 μL of Molecular Biology Grade Water to each well while being careful to avoid contact with the array.
e) Aspirate and then again, dispense 200 μL of Molecular Biology Grade Water to each well and allow to sit covered in the Hybridization Chamber for 5 minutes before aspirating water from the plate.
f) Aspirate the water wash and add 200 μL of Pre-hybridization Buffer to each designated well of the PathogenDx plate without touching the pipette tip to the array surface. Close the Hybridization Chamber box lid.
g) Allow Pre-hybridization Buffer to stay on the arrays for 5 minutes; do not remove the plate from the Hybridization Chamber.
h) Briefly centrifuge the tubes or plate containing the Labeling PCR product.
i) Add 18 μL of Hybridization Buffer to each well of the Labeling PCR product for hybridization within the 96-well PCR plate or tubes, pipette up and down to mix. It is important that no cross-contamination occurs during this step. The PCR product and the Hybridization Buffer mix constitute the Hybridization Cocktail.
j) Aspirate the Pre-hybridization Cocktail from the arrays.
k) Immediately add 68 μL of the Hybridization Cocktail to each array being careful not to touch the array surface with the pipette tip. Ensure that the sample ID and location are recorded.
l) Close the Hybridization Chamber lid.
m) Allow to hybridize for 30 minutes at room temperature in the Hybridization Chamber.
Post hybridization PathogenDx slide processing
a) Prepare Wash buffer according to the number of wells to be used (Table 22). Washing must be performed according to the protocol to ensure detectable signal and adequate washing to prevent elevated background signals.
b) Aspirate the Hybridization Cocktail from the slides.
c) Add 200 μL of Wash Buffer to each array, then aspirate.
d) Add 200 μL of Wash Buffer a second time to each array, close the Hybridization Chamber lid and allow buffer to remain on the slides for 10 minutes.
e) Aspirate the Wash Buffer.
f) Perform a final wash by dispensing and aspirating 200 μL of Wash Buffer, aspirate immediately.
g) Following the last aspiration step, remove the slides from the Hybridization Chamber.
h) Dry the plate using the plate centrifuge for 1 minute.
i) Prior to scanning, clean the back of the glass microarray with lens paper or Kim wipe (never use paper towels which leave an excess of fibers and interferes with scanning).
j) PathogenDx plates should be placed back into a moisture barrier bag with desiccant until scanning may be performed in order to protect the arrays from light. Plates should be scanned within two weeks of hybridization.
Scanning conditions and Data Acquisition
a) Access the Sensovation scanner desktop, select the application “Array Reader”.
b) Open the tray, select “Open Tray”.
c) Place the microarray into the tray oriented with the plate face up and aligned with A1 in the top left corner.
d) Close the tray, select “Close Tray”.
e) Select “Scan”.
f) From the dropdown menu for “Rack Layout” select the Full Slide (96 wells) PDx.
g) From the dropdown menu for assay layout, select “PathogenDx Assay 002”.
h) Click on the three dots icon to the right of “Scan Position”.
i) To scan a full plate, double click the asterisk at the top left of the plate image.
j) To scan a partial plate, click the desired wells or click on the column number.
k) Select the Blue Arrow to begin the scanning process.
l) While the plate is being scanned, select “Result overview” to review the images of the wells.
m) When the plate is finished scanning and the screen displays the digital image of a plate with all green wells, select the Red X to exit the scanning process.
n) Open the tray, select “Open Tray”.
o) Remove the microarray and store inside the moisture barrier bag with the desiccant packets.
p) Close the tray, select “Close Tray”.
q) Exit the Array Reader application, select “Exit”.
r) On the Sensovation Scanner desktop, select the folder “Scan Results”.
s) Locate the folder associated with your plate and rename the folder with the plate barcode number y scanning the barcode located either on the outside of the barrier bag or on the plate itself.
t) Submit the whole barcode labeled folder to Portal.
u) Refer to the Portal instructions for Analysis.
a) Data is analyzed automatically by the software.
b) Table 23 was used to determine the final interpretation.
For samples that fail an action limit, confirm by streaking the test aliquot onto Dichloran Rose Bengal Chloramphenicol (DRBC) agar. DRBC plates should be incubated for 5-7 days at 25±1° C. Growth on the plate is confirmation that the sample is positive at that action limit level.
This validation study was conducted under the AOAC Research Institute Performance Tested Method (PTM) ERV program and the AOAC INTERNATIONAL Methods Committee Guidelines for Validation of Microbiological Methods for Food and Environmental Surfaces (6). The QuantX method was compared to plating on DRBC for the detection of total viable yeast and mold in cannabis flower at specific dilution thresholds. Inclusivity and exclusivity was also performed. The matrix study was performed by an independent laboratory, SV Laboratories (Kalamazoo, Mich.). The inclusivity and exclusivity analysis was performed by Q Laboratories (Cincinnati, Ohio).
Inclusivity Methodology. Inclusivity and exclusivity strains were evaluated to meet the requirements of the AOAC ERV PTM study protocol. For the ERV study, 50 strains of yeast and mold, and 30 exclusivity strains were evaluated. We are currently in the process of evaluating the remaining exclusive strains. Target strains were cultured in potato dextrose broth or on potato dextrose agar until appropriate growth was observed. After incubation, cultures were diluted in PBS to levels of 100-1000 CFU/mL. Exclusivity strains were cultured onto non-selective agar under optimal conditions for growth and tested undiluted.
A 1.0 mL aliquot from the diluted target or undiluted non-target culture were randomized, blind coded and analyzed by the QuantX method.
Of the additional inclusivity strains tested, all were correctly detected. All exclusivity cultures were non-detected. Tables 24 and 25 presents a summary of the results.
Kluyveromyces lactis
Saccharomyces kudriavzevii
Zygosaccharomyces bailii
Kloeckera species
Candida albicans
Candida lusitaniae
Candida tropicalis
Dekkera bruxellensis
Aureobasidium pullulans
Rhodotorula mucilaginosa
Cryptococcus neoformans
Debaromyces hansenii
Purpureocillium lilacinum
Yarrowia lipolytica
Wickerhamomyces anomala
Stemphylium species
Penicillium venetum
Paecilomyces marquandii
Scopulariopsis acremonium
Mucor hiemalis
Mucor circinelloides
Talaromyces pinophilus
Aspergillus fumigatus
Talaromyces flavus
Rhizopus stolonifera
Cladosporium halotolerans
Rhizopus oryzae
Cladosporium herbarum
Aspergillus aculeatus
Penicillium chrysogenum
Chaetomium globosum
Arthrinium aureum
Aspergillus brasilliensis
Aspergillus caesiellus
Curvularia lunata
Cryptococcus laurentii
Aspergillus terreus
Byssochlamys fulva
Penicillium rubens
Geotrichum candidum
Aspergillus flavus
Fusarium solani
Botrytis cinerea
Aspergillus niger
Aspergillus oryzae
Fusarium proliferatum
Fusarium oxysporum
Paecilomyces variotii
Geotrichum silvicola
Alternaria alternata
Acinetobacter baumanii
Aeromonas hydrophila
Burkholderia cepacia
Citrobacter braakii
Citrobacter farmeri
Edwardsiella tarda
Enterobacter cloacae
Escherichia coli
Hafnia alvei
Listeria monocytogenes
Pantoea agglomerans
Proteus mirabilis
Pseudomonas aeruginosa
Pseudomonas gessardii
Rahnella aquatilis
Stenotrophomonas maltophilia
Cannabis test portions were prepared from Steadfast Analytical Laboratory's inventory of retained samples from its Michigan-licensed grower, patient, and caregiver customers. The samples were screened for yeast and mold prior to the study, using a rapid automated enumeration method in order to prepare matrix batches at the target contamination levels of <1000, ˜1000, ˜10000, and ˜100000 CFU/g.
Using sterilized aluminum containers, individual samples that produced results within a specified contamination level were combined to produce four batches (control, low, medium and high). Batches were manually mixed in an aseptic manner until homogeneous.
For each contamination level, five replicates were quantified by spread plating aliquots of the samples onto DRBC agar. Plating results indicated that yeast and mold levels for the control, low, medium, and high batches prepared for analysis were 350, 890, 13000, and 100000 CFU/g, respectively.
Five replicate test portions at the control and high levels, and 20 replicate test portions at the low and medium levels, were tested. A fractional positive data set (25-75% of test portions positive) was required for at least one of the intermediate levels at a minimum of one test threshold. Individual 10 g test portions from each contamination level were prepared in sterile filter Whirl-Pak bags. Test portions were assigned identification tags following Michigan's Marijuana Regulatory Agency (MRA) seed-to-sale system for distribution and tracking, including blind coding the contamination level of the test portions. The individual samples were also assigned random sample numbers for reporting results to the AOAC Research Institute. A technician at the independent laboratory not involved in the coding process performed the analyses.
Each test portion was combined with 90 mL PBS. Test portions were homogenized by hand and further 1:100, 1:1000 and 1:10,000 dilutions prepared using PBS as the diluent. From the final 1:1000 and 1:10000 dilutions, 1 mL aliquots were analyzed by the QuantX method.
For confirmation, 10 μL aliquots of the dilutions evaluated were streaked to DRBC agar. Plates were incubated at 25±1° C. for 5-7 days after which they were examined for yeast or mold growth.
As per criteria outlined in Appendix J of the Official Methods of Analysis Manual and specified in the study protocol, fractional positive results were obtained for one of the dilution levels evaluated. Fractional positive data sets were obtained for the low level at the >1000 CFU/g test threshold. At this threshold, all control-level test portions produced negative results and all high-level test portions produced positive results.
Of the 100 data points encompassing all levels and test thresholds, there were seven instances of disagreement between presumptive and confirmed results: three low-level test portions at the >1000 CFU/g threshold were presumptive positive/confirmed negative, one medium-level test portion at the >1000 CFU/g threshold was presumptive positive/confirmed negative, one medium-level test portions at the >1000 CFU/g threshold were presumptive negative confirmed positive, and two high-level test portion at the >10000 CFU/g threshold was presumptive negative/confirmed positive.
The probability of detection (POD) was calculated for the candidate presumptive results, PODCP and the candidate confirmed results, PODCC, as well as the difference in the presumptive and confirmed results, dPODCP. The POD analysis between the QuantX assay presumptive and confirmed results indicated that there was not a statistically significant difference. A summary of POD analyses are presented in Table 26.
In the matrix study, the QuantX−Fungal assay successfully detected the target analyte from cannabis flower samples. The QuantX method demonstrated a high level of specificity in detecting the 50 inclusive organisms and no detection of the 30 exclusive organisms (Table 8 and 9). The POD statistical analysis in Table 10, indicated that the candidate method performance was identical to the reference method at low levels (320 CFU/g) but at the 890 CFU/g was statistically different than the reference method (95% CI −0.05, 0.35) with the candidate method detecting more positive samples. The two methods performed identical at the 13,000 CFU/g, both detecting 90% of the samples at the >1000 threshold and 0% at the >10,000 threshold. While it should be noted that the samples used in this study were held longer for analysis and may have resulted in the lower detection at the high level, the results of the QuantX and DRBC plating method align closely.
Thus, data from this study supports the product claim that the QuantX assay can detect total yeast and mold from cannabis flower at specific action thresholds used by state regulatory agencies. Data from the inclusivity and exclusivity analysis indicates the method is highly specific and can detect a wide range of target organisms and discriminate them from background organisms and near neighbors. The results obtained by the POD analysis of the method comparison study demonstrated that the candidate methods performance was not statistically different than that of the culture confirmation method.
aFrom aerobic viable yeast and mold plate count (DRBC).
bBased on dilution and volume of sample tested. A positive result indicates contamination above the test threshold level.
cN = Number of test portions.
dx = Number of positive test portions.
ePODCP = Candidate method presumptive positive outcomes divided by the total number of trials.
fPODCC = Candidate method confirmed positive outcomes divided by the total number of trials.
gdPODCP = Difference between the candidate method presumptive result and candidate method confirmed result POD values.
h95% CI = If the confidence interval of a dPOD does not contain zero, then the difference is statistically significant at the 5% level.
Detection of Fungus in a plant sample
The method described below shows the developed trendline used for mathematical modeling modifications to the Augury Software (Augury Technology, NY).
1 mL aliquots of A. nidulans (10{circumflex over ( )}5-10{circumflex over ( )}2) is transferred into a clean 1.5 mL tube and centrifuged (14,000×g for 3 minutes). The resulting supernatant from this step is decanted and the cell pellet retained. Lysis buffer (35 μl) is added to each tube, vortexed and heated at 95° C. for 10 min. The samples are removed from the heat source and centrifuged (2000×g for 5 seconds). To each tube, 5 μl of neutralization buffer is added and vortexed thoroughly to mix. Sample Buffer Mix (Table 17) is prepared and 25 μl added to each tube and vortexed to mix. The sample tubes are heated at 55° C. for 45 min to allow complete sample digestion. The samples are removed from the heat source and vortexed for 10 s. The sample tubes are then heated at 95° C. for 15 min.
Sample cleanup using RELIAPREP Kit
To each prepped lysate was added 32.5 μl of membrane binding solution and vortexed for 5 s. Isopropanol (97.54 of 100%) was added and vortexed for another 5 s. The sample was then loaded onto a RELIAPREP mini column seated in a collection tube, and centrifuged (10,000×g, 30 s). The contents in the collection tube were discarded, the column reseated into the collection tube and bound sample washed with 200 μL of Column Wash Solution (centrifuge at 10,000×g, 15 s). The contents were discarded, and the bound sample washed with 300 μL of Buffer B (centrifuge at 10,000×g, 15 s), repeating the wash one more with 300 μL of Buffer B. The contents were discarded, and the column centrifuged for 1 min to dry the column. The column was then transferred to a labelled Elution Tube, 154 of Nuclease-Free water or TE Buffer added and centrifuged for 30 s. Elution was repeated with an additional 154 of Nuclease Free Water or TE Buffer to maximize recovery.
Labeling PCR amplification
Reagents (PCR Master Mix, Primer Set, and High Standard) were thawed. The Low Standard was prepared by mixing 5 μl of the vortexed High Standard tube with 495 μl of Molecular Biology Grade Water and vortexed to mix. Table 18 was used as reference to calculate the appropriate reagent volumes needed based on the number of samples. All reagents (except Taq polymerase) were vortexed for 15 s and centrifuged (1000×g for 5 s). The indicated reagent volumes were mixed in a microfuge tube to prepare the Labeling PCR Master Mix. The PCR master mix was briefly vortexed and centrifuged (1000×g for 5 s). Amplification conditions were as shown in Table 19. The following primers were used—Forward primer SEQ ID NO:133, final concentration 50 nM) and Reverse primer (SEQ ID NO:134, 5′Cy3 labeled, final concentration 200 nM).
The Pre-hybridization Buffer and Hybridization Buffers were prepared in sterile tubes for the number of wells that will be hybridized (Tables 27 and 28) and vortexed to mix. The plate was placed in the Hybridization Chamber and the foil seal carefully removes from the wells to be hybridized. Molecular Biology Grade water (200 μL) was applied to each well, aspirated and another 200 μL of Molecular Biology Grade water added to each well. The plate was incubated in the Hybridization Chamber for 5 min and the water aspirated. Pre-hybridization Buffer (200 μL) was added to each designated well and allowed to sit covered in the Hybridization Chamber for 5 min. Hybridization Buffer (18 μL) was added to each well for hybridization within the 96-well PCR plate and pipetted up and down to mix. The Pre-hybridization Cocktail was aspirated from the array and the Hybridization Cocktail (68 μL) added immediately to each array. The plate was allowed to hybridize for 30 min at room temperature in the Hybridization Chamber. Wash Buffer was prepared (Table 29) and vortexed briefly to mix prior to adding (200 μl) to each array followed by aspirating immediately. Another 200 μL of Wash Buffer was added and incubated for 10 min. A final wash was performed by dispensing 200 μL of Wash Buffer and aspirating immediately. The plate was dried using a plate centrifuge for 5 min.
A. nidulans cells prepared at 105 down to 102 dilutions were run to establish a trendline for Augury software calculations. The high, medium, and low Total Yeast and Mold RFU values correspond to the CFU values in the cell curve data.
As the cannabis industry enters an era of acceptance at a national level, the methods developed by PathogenDx as disclosed in this invention are of direct relevance to cannabis testing at the national level. The suite of advanced testing and reporting technologies raises cannabis testing closer to the level of efficacy and standardization required of labs in other mainstream industries.
The one-step PCR for its QuantX fungal assay method described in this invention employs sample preparation step using RELIAPREP (Promega Corporation, WI). RELIAPREP shortens the assay process by consolidating the two-step PCR into a single PCR step, enabling results to be delivered in 4.5 hours instead of 6 hours, and helps concentrate the sample for improved sensitivity. Overall, the new methodology for preparing and analyzing cannabis improves assay reliability by reducing PCR inhibition and minimizing all types of dim signal.
Implementation of the expanded 96-well microarray format introduces to the cannabis industry a best practice commonly used in clinical labs. Instrumentation, reagents, and consumables are naturally fitted to a 96-well plate format for a higher level of efficiency, throughput, leading to economical scaling compared to prior 12-well formats. The methods described in this invention are supported by other improvements including, the industry-first foil-sealed wells that enable lab technicians to uncover only the wells needed to test samples received on that day or shift, thereby realizing significant cost savings from reduced waste of unused wells and test media. Moreover, the expanded microarray is made with higher quality glass that provides improved performance for both specificity and imaging accuracy.
To provide another level of granularity in test results reporting, PathogenDx is migrating from Dropbox to a custom PathogenDx Reporting Portal for cannabis compliance reporting. PathogenDx's intuitive, user-friendly portal drives customer ease and efficiency by reducing the number of steps necessary to obtain lab results and COAs. This also improves data visibility with multi-user access to real-time results tracking and prior history reports.
While the foregoing written description of an embodiments enables one of ordinary skill to make and use what is considered presently to be the best mode thereof, those of ordinary skill will understand and appreciate the existence of variations, combinations, and equivalents of the specific embodiment, method, and examples herein. The present disclosure should therefore not be limited by the above-described embodiments, methods, and examples, but by all embodiments and methods within the scope and spirit of the present disclosure.
The following references are cited herein.
This application is a continuation-In-part under 35 U.S.C. § 120 of pending application U.S. Ser. No. 15/916,062, filed Mar. 8, 2018, which is a continuation-in-part under 35 U.S.C. § 120 of non-provisional application U.S. Ser. No. 15/388,561, filed Dec. 22, 2016, now abandoned, which claims benefit of priority under 35 U.S.C. § 119(e) of provisional application U.S. Ser. No. 62/271,371, filed Dec. 28, 2015, now abandoned, all of which are hereby incorporated by reference in their entireties.
| Number | Date | Country | |
|---|---|---|---|
| 62271371 | Dec 2015 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 15916062 | Mar 2018 | US |
| Child | 17356139 | US | |
| Parent | 15388561 | Dec 2016 | US |
| Child | 15916062 | US |
