Patent Application
20230272464
Nucleic acid polymerization plays a major role in biology and living systems, including DNA replication, RNA transcription, reverse transcription and genetic information storage. Biotechnology and disease diagnostics also rely on DNA and RNA synthesis with high fidelity and specificity.
This summary is provided to introduce a selection of concepts in a simplified form that are further described below in the detailed description. This summary is not intended to identify required or essential features of the claimed subject matter. Nor is this summary intended to be used to limit the scope of the claimed subject matter.
Certain aspects disclosed herein are directed to DNA polymerization, and the incorporation of different functionalities into DNA, such as modified nucleotides with derivatized nucleobases, sugars and phosphates disclosed herein. In certain aspects disclosed herein, DNA polymerase recognition of these selenium-modified dNTPs can lead to enzymatic extension and/or polymerization reactions with improved specificity. In certain aspects disclosed herein, reverse transcriptase recognition of these selenium-modified dNTPs can lead to enzymatic reactions with improved specificity. Certain aspects disclosed herein are directed to RNA polymerization, and the incorporation of different functionalities into RNA, such as modified nucleotides with derivatized nucleobases, sugars and phosphates disclosed herein. In certain aspects disclosed herein, RNA polymerase recognition of these selenium-modified NTPs can lead to enzymatic reactions with improved specificity.
In some aspects, the invention disclosed herein is directed to an enzymatic process for forming a nucleic acid product mixture. Such processes can comprise annealing a primer or promoter sequence to a template sequence, and extending the primer sequence or synthesizing the nucleic acid product in the presence of an extension or polymerase enzyme and a nucleotide mixture comprising at least one modified nucleotide to form a modified nucleic acid. In certain aspects, an amount of nonspecific nucleic acid products in the product mixture can be less than that of an otherwise identical process using an analogous native nucleotide.
In other aspects, the invention disclosed herein is directed to a reagent mixture for conducting nucleic acid extension and/or polymerization reactions, the mixture comprising a DNA or RNA primer sequence, a DNA template sequence, a DNA polymerase enzyme, and a nucleotide mixture. In certain aspects, the nucleotide mixture can comprise Se-modified nucleotide(s) and/or S-modified nucleotide(s) selected from the group consisting of dATPαSe, dCTPαSe, dGTPαSe, TTPαSe (or dTTPαSe), dUTPαSe, 2-Se-TTP (or 2-Se-dTTP), 2-Se-dUTP, 2-Se-TTPαSe (or 2-Se-dTTPαSe), 2-Se-dUTPαSe, dATPαS, dCTPαS, dGTPαS, TTPαS (or dTTPαS), dUTPαS, 2-S-TTP (or 2-S-dTTP), 2-S-dUTP, 2-S-TTPαS (or 2-S-dTTPαS) and 2-S-dUTPαS, and non-analogous native nucleotide(s) selected from the group consisting of dATP, dCTP, dGTP, TTP (or dTTP) and dUTP. In other aspects, the invention disclosed herein is directed to a reagent mixture for conducting nucleic acid synthesis reactions, the mixture comprising a DNA promoter sequence, a DNA template sequence, a RNA polymerase enzyme, and a nucleotide mixture. In certain aspects, the nucleotide mixture can comprise Se-modified nucleotide(s) and/or S-modified nucleotide(s) selected from the group consisting of ATPαSe, CTPαSe, GTPαSe, UTPαSe, rTTPαSe, 2-Se-UTP, 2-Se-rTTP, 2-Se-UTPαSe, 2-Se-rTTPαSe, ATPαS, CTPαS, GTPαS, UTPαS, rTTPαS, 2-S-UTP, 2-S-rTTP, 2-S-UTPαS and 2-S-rTTPαS, and non-analogous native nucleotide(s) selected from the group consisting of ATP, CTP, GTP, UTP and rTTP. In other aspects, the invention disclosed herein is directed to a reagent mixture for conducting nucleic acid extension and/or synthesis reactions, the mixture comprising a DNA or RNA primer sequence, a RNA template sequence, a reverse transcriptase enzyme, and a nucleotide mixture. In certain aspects, the nucleotide mixture can comprise Se-modified nucleotide(s) and/or S-modified nucleotide(s) selected from the group consisting of dATPαSe, dCTPαSe, dGTPαSe,TTPαSe (or dTTPαSe), dUTPαSe, 2-Se-TTP (or 2-Se-dTTP), 2-Se-dUTP, 2-Se-TTPαSe (or 2-Se-dTTPαSe), 2-Se-dUTPαSe, dATPαS, dCTPαS, dGTPαS, TTPαS (or dTTPαS), dUTPαS, 2-S-TTP (or 2-S-dTTP), 2-S-dUTP, 2-S-TTPαS (or 2-S-dTTPαS) and 2-S-dUTPαS, and non-analogous native nucleotide(s) selected from the group consisting of dATP, dCTP, dGTP, TTP (or dTTP) and dUTP. The following 2-Se-pyrimidine triphosphates and 2-S-pyrimidine triphosphates represent non-limiting embodiments of the modified nucleotides disclosed herein:
Other aspects of the invention disclosed herein are directed to selenium- or sulfur-modified nucleotide selected from the group consisting of 3′-O-N3-dATPαSe, 3′-O-N3-dCTPαSe, 3′-O-N3-dGTPαSe,3′-O-N3-dTTPαSe, ddCTPαSe-N3-Bodipy-FL-510, ddUTPαSe-N3-R6G, ddATPαSe-N3-ROX, ddGTPαSe-N3-Cy5, 3′-O-N3-dATPαS, 3′-O-N3-dCTPαS, 3′-O-N3-dGTPαS, 3′-O-N3-dTTPαS, 3′-O-N3-dUTPαS, ddCTPαS-N3-Bodipy-FL-510, ddUTPαS-N3-R6G, ddATPαS-N3-ROX, ddGTPαS-N3-Cy5. Reagent mixtures comprising Se-modified or S-modified sequencing nucleotides are also disclosed herein, and can comprise a primer sequence, a template sequence, a polymerase enzyme, any Se-modified or S-modified sequencing nucleotide disclosed herein, and non-analogous native nucleotides.
Both the foregoing summary and the following detailed description provide examples and are explanatory only. Accordingly, the foregoing summary and the following detailed description should not be considered to be restrictive. Further, features or variations may be provided in addition to those set forth herein. For example, certain aspects and embodiments may be directed to various feature combinations and sub-combinations described in the detailed description.
To define more clearly the terms used herein, the following definitions are provided. Unless otherwise indicated, the following definitions are applicable to this disclosure. If a term is used in this disclosure but is not specifically defined herein, the definition from the IUPAC Compendium of Chemical Terminology, 2nd Ed (1997), can be applied, as long as that definition does not conflict with any other disclosure or definition applied herein, or render indefinite or non-enabled any claim to which that definition can be applied. To the extent that any definition or usage provided by any document incorporated herein by reference conflicts with the definition or usage provided herein, the definition or usage provided herein controls.
Herein, features of the subject matter can be described such that, within particular aspects and/or embodiments, a combination of different features can be envisioned. For each and every aspect, and/or embodiment, and/or feature disclosed herein, all combinations that do not detrimentally affect the designs, processes, and/or methods described herein are contemplated with or without explicit description of the particular combination. Additionally, unless explicitly recited otherwise, any aspect, and/or embodiment, and/or feature disclosed herein can be combined to describe inventive features consistent with the present disclosure.
Regarding claim transitional terms or phrases, the transitional term “comprising,” which is synonymous with “including,” “containing,” “having,” or “characterized by,” is open-ended and does not exclude additional, unrecited elements or method steps. The transitional phrase “consisting of” excludes any element, step, or ingredient not specified in the claim. The transitional phrase “consisting essentially of” limits the scope of a claim to the specified materials or steps and those that do not materially affect the basic and novel characteristics of the claimed invention. A “consisting essentially of” claim occupies a middle ground between closed claims that are written in a “consisting of” format and fully open claims that are drafted in a “comprising” format. Absent an indication to the contrary, describing a composition or method as “consisting essentially of” is not to be construed as “comprising,” but is intended to describe the recited element that includes materials or steps which do not significantly alter the composition or method to which the term is applied. For example, a nucleotide mixture consisting essentially of a Se-modified nucleotide can include impurities typically present in a commercially produced or commercially available sample of the Se-modified nucleotide. When a claim includes different features and/or feature classes (for example, a process step, reagent process features, and/or reagent stream features, among other possibilities), the transitional terms comprising, consisting essentially of, and consisting of apply only to the feature class to which it is utilized, and it is possible to have different transitional terms or phrases utilized with different features within a claim. For example, a process can comprise several recited steps (and other non-recited steps), but utilize a reagent mixture consisting of specific components; alternatively, consisting essentially of specific components; or alternatively, comprising the specific components and other non-recited components. While compositions and processes are described in terms of “comprising” various components or steps, the compositions and methods can also “consist essentially of” or “consist of” the various components or steps, unless specifically stated otherwise. For example, a nucleotide mixture consistent with certain embodiments of the present invention can comprise; alternatively, consist essentially of; or alternatively, consist of; a Se-modified nucleotide.
The terms “a,” “an,” and “the” are intended to include plural alternatives, e.g., at least one, unless otherwise specified. For instance, the disclosure of “a Se-modified nucleotide” is meant to encompass one, or mixtures or combinations of more than one, Se-modified nucleotide, unless otherwise specified.
For any particular compound or group disclosed herein, any name or structure presented is intended to encompass all conformational isomers, regioisomers, and stereoisomers that can arise from a particular set of substituents, unless otherwise specified. For example, a general reference to α-P-seleno-deoxyadenosinetriphosphate (ATPαSe) includes both the Rp and Sp diastereomers of the selenium modified nucleotide. The name or structure also encompasses all enantiomers, diastereomers, and other optical isomers whether in enantiomeric or racemic forms, as well as mixtures of stereoisomers, as would be recognized by a skilled artisan, unless otherwise specified.
As used herein, the term “native nucleotide” refers to a nucleotide that is analogous to a related modified nucleotide except for the specific modification of the modified nucleotide. Thus, in certain aspects, each modified nucleotide can have an analogous native nucleotide, and vice versa. Moreover, a modified nucleotide may have any number of non-analogous native nucleotides where the specific modification present in the modified nucleotide is not present in a complementary nucleotide. For instance, aspects comprising a modified nucleotide of dATPαSe can comprise dATP as an analogous native nucleotide lacking the α-phosphoseleno modification, and also may comprise dCTP, dGTP, and/or dTTP as non-analogous native nucleotides.
Similarly, the term “native nucleic acid” refers to a nucleic acid that is identical to a related modified nucleic acid except for the specific modification present in a modified nucleic acid. In certain aspects, native nucleic acids can be entirely comprised of native nucleotides. In certain aspects, a native nucleotide may refer to a naturally occurring nucleotide such as dATP, dCTP, and the like. Alternatively, a native nucleotide may refer to a synthetic nucleotide. In either case, the term native nucleotide is meant to represent an analog to the modified nucleotide prior to, or lacking the specific modification in the modified nucleotide to which it refers. Thus, in this sense, each native nucleotide disclosed herein can be related to an analogous modified nucleotide by a particular modification, and not restricted to any particular nucleotide, naturally-occurring or otherwise. Thus, native nucleotides may refer to nucleotides having modifications to the base, sugar, or phosphate chain of the nucleotide. It follows that “modified nucleotides” may also be defined herein relative to a native nucleotide base state. For any aspects herein where the relationship between modified nucleotide and its native nucleotide may not be explicit, the modified nucleotide can generally encompass any modifications disclosed herein. For instance, in certain aspects the modified nucleotide can differ from its analogous native nucleotide by the presence of a selenium atom at the α-phosphate group as opposed to the native nucleotide having an oxygen in the same position.
Further, the term “naturally-occurring nucleotide” refers to nucleotides having chemical structures identical to those commonly found in nature (e.g., DNA and RNA nucleotides) and is not restricted to any particular source of the nucleotide. For instance, naturally-occurring nucleotides as contemplated herein may be isolated from a natural source, or alternatively may be synthesized by common chemical procedures, where convenient. In this manner, references to naturally occurring nucleotides herein refer to the chemical structure of the nucleotide, and not its source or chemical preparation.
The term “about” means that amounts, sizes, formulations, parameters, and other quantities and characteristics are not and need not be exact, but can be approximate and/or larger or smaller, as desired, reflecting tolerances, conversion factors, rounding off, measurement errors, and the like, and other factors known to those of skill in the art. In general, an amount, size, formulation, parameter or other quantity or characteristic is “about” or “approximate” whether or not expressly stated to be such. The term “about” also encompasses amounts that differ due to different equilibrium conditions for a composition resulting from a particular initial mixture. Whether or not modified by the term “about,” the claims include equivalents to the quantities. The term “about” can mean within 10% of the reported numerical value, preferably within 5% of the reported numerical value.
Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the invention, the typical methods and materials are herein described.
All publications and patents mentioned herein are incorporated herein by reference. The publications and patents mentioned herein can be utilized for the purpose of describing and disclosing, for example, the constructs and methodologies that are described in the publications, which might be used in connection with the presently described invention. The publications discussed throughout the text are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention.
Applicants reserve the right to proviso out or exclude any individual members of any such group, including any sub-ranges or combinations of sub-ranges within the group, that can be claimed according to a range or in any similar manner, if for any reason Applicants choose to claim less than the full measure of the disclosure, for example, to account for a reference that Applicants may be unaware of at the time of the filing of the application. Further, Applicants reserve the right to proviso out or exclude any individual substituents, analogs, compounds, ligands, structures, or groups thereof, or any members of a claimed group, if for any reason Applicants choose to claim less than the full measure of the disclosure, for example, to account for a reference that Applicants may be unaware of at the time of the filing of the application.
The invention disclosed herein is directed generally to processes for the enzymatic extension and/or synthesis of nucleic acid sequences. Such processes can incorporate the modified nucleotides to form nucleic acid sequences with improved product quality, fidelity and specificity. Reagent mixtures comprising modified nucleotides are also contemplated herein. Certain aspects are directed to modified sequencing nucleotides.
Generally, the modified nucleotides disclosed herein are modified with reference to an analogous native nucleotide. In certain aspects, the modified nucleotides may differ from the analogous native nucleotide by substitution of one or more atoms of the native nucleotide with an atom having a larger atomic radius. In some aspects, the substitute atom can be within the same Periodic Group as the atom of the native nucleotide. For instance, an oxygen atom of a naturally-occurring nucleotide can be replaced with sulfur, or alternatively selenium. Alternatively, a carbon atom of the naturally-occurring nucleotide may be substituted with a silicon atom, or a nitrogen atom of the naturally-occurring nucleotide may be substituted by a phosphorus atom. Modified nucleotides having multiple substitutions of atoms are also contemplated herein.
Native nucleotides subject to the modifications disclosed herein can be either a naturally-occurring nucleotide or a derivatized nucleotide, and can be produced or isolated from either synthetic or natural sources. For instance, native nucleotides contemplated herein can include DNA nucleotides (dATP, dGTP, dCTP, TTP (or dTTP) and dUTP) and RNA nucleotides (ATP, GTP, CTP, UTP and rTTP). Each of these naturally occurring nucleotides may be modified at any position, where the modification is effective to improve the enzymatic extension and/or polymerization processes disclosed below.
Modified nucleotides contemplated herein can be modified at any position compared to an analogous native nucleotide, including within a phosphate group, the sugar, the base, or any combination thereof. Thus, in certain aspects, the modified nucleotide can be dATPαS, dCTPαS, dGTPαS, TTPαS (or dTTPαS), dUTPαS, 2-S-TTP (or 2-S-dTTP), 2-S-dUTP, 2-S-TTPαS (or 2-S-dTTPαS) and 2-S-dUTPαS, ATPαS, CTPαS, GTPαS, UTPαS, rTTPαS, 2-S-UTP and 2-S-rTTP, 2-S-UTPαS and 2-S-rTTPαS. Alternatively, the modified nucleotide can comprise an α-phosphoseleno group. In such aspects, the modified nucleotide can be dATPαSe, dCTPαSe,dGTPαSe,TTPαSe (or dTTPαSe), dUTPαSe, 2-Se-TTP (or 2-Se-dTTP), 2-Se-dUTP, 2-Se-TTPαSe (or 2-Se-dTTPαSe), 2-Se-dUTPαSe, ATPαSe, CTPαSe, GTPαSe, UTPαSe, rTTPαSe, 2-Se-UTP, 2-Se-rTTP, 2-Se-UTPαSe, 2-Se-rTTPαSe. Modifications of a native nucleotide at its sugar ring are also contemplated herein, and thus modified nucleotides of this disclosure can include 2′-S-ATP, 2′-S-CTP, 2′-S-GTP, 2′-S-TTP, 2′-S-dUTP, 2′-Se-ATP, 2′-Se-CTP, 2′-Se-GTP, 2′-Se-TTP and 2′-Se-dUTP. Modified nucleotides comprising modifications to the phosphate, sugar ring, and/or base as disclosed within U.S. Pat. Nos. 7,592,446, 7,982,030, and 8,354,524 are also contemplated herein, each of which is incorporated herein by reference in its entirety. Alternatively, modified nucleotides contemplated herein can include substitutions of any phosphorus atom in the phosphate group for a silicon atom.
Alternatively, or additionally, the modified nucleotide may comprise a modification to the base of an analogous native nucleotide. Thus, in aspects where the native nucleotide is a naturally-occurring DNA or RNA nucleotide, the modified nucleotide can be modified to include a sulfur or selenium atom at the 2-position of a thymine, uracil, or cytosine base, as in 2-S-dCTP, 2-S-CTP, 2-S-dUTP, 2-S-UTP, 2-S-TTP, 2-S-rTTP, 2-Se-dCTP, 2-Se-CTP, 2-Se-dUTP, 2-Se-UTP, 2-Se-TTP, or 2-Se-rTTP. Alternatively, or additionally, the thymine or uracil base can be modified at the 4-position, as shown in the Examples below.
Modified nucleotides having additional or alternative substitutions of heteroatoms at the nucleotide base are also contemplated herein. In still further aspects, modified nucleotides can comprise substitutions of atoms on non-naturally occurring nucleotides. In such aspects, the native nucleotide may be the same or different from a naturally occurring nucleotide at any combination of the phosphate, sugar ring, or base. For instance, sequencing nucleotides often can have a modified base structure to incorporate an optically active chemical moiety (e.g., a fluorescent group). For instance, sequencing nucleotides often can have a modified gamma-phosphate or gamma-phosphate structure for cleaving and offering a signal as an optically active chemical moiety (e.g., a fluorescent group). For instance, sequencing nucleotides often can have a modified sugar structure to incorporate, at each cycle of extension, one nucleotide with a chemically protecting moiety (e.g., a protecting 3′-CH2-N3 group) to allow single nucleotide incorporation at each cycle of extension. Optically active chemical moieties often can be incorporated into the sequencing nucleotide by direct modification to the base structure, or more commonly, by a linking group between the base and the optically active moiety. In certain aspects, the sequencing nucleotides may incorporate an optically active moiety with or without disrupting the ability of a polymerase enzyme to incorporate the sequencing nucleotide in a nucleic acid sequence during an enzymatic extension and/or synthesis of the nucleic acid. Modified sequencing nucleotides contemplated herein may be advantageously modified at the phosphate group, to preserve the structure of the optical moiety, linking group and base of the native sequencing model, while achieving the features of the processes described herein.
Thus, modified sequencing nucleotides contemplated herein can comprise a substitution of a heteroatom of the α-phospho group. In certain aspects, the modified sequencing nucleotide can comprise an α-phosphothio modification, an α-phosphoseleno modification, or combinations thereof. Thus, modified sequencing compounds contemplated herein can be selected from any of 3′-O-N3-dATPαSe, 3′-O-N3-dCTPαSe, 3′-O-N3-dGTPαSe, 3′-O-N3-dTTP, ddCTPαSe-N3-Bodipy-FL-510, ddUTPαSe-N3-R6G, ddATPαSe-N3-ROX, ddGTPαSe-N3-Cy5, 3′-O-N3-dATPαS, 3′-O-N3-dCTPαS, 3′-O-N3-dGTPαS, 3′-O-N3-dTTPαS, ddCTPαS-N3-Bodipy-FL-510, ddUTPαS-N3-R6G, ddATPαS-N3-ROX, ddGTPαS-N3-Cy5, or combinations thereof, as represented by the following structures.
Generally, the processes disclosed herein may use any of the modified nucleotides described above (independently, or as part of reagent mixtures described below) to enzymatically extend and/or synthesize nucleic acid sequences. Such enzymatic extension and polymerization processes are not limited to any particular process or function, and generally can be any process that incorporates a nucleotide within a partial nucleotide sequence to extend the sequence and/or synthesize a nucleic acid. In certain aspects, the enzymatic process contemplated herein can be a cDNA synthesis, a PCR amplification, an isothermal amplification, or a nucleic acid sequencing process.
In certain aspects, the processes disclosed herein can comprise an annealing step to allow a primer or promoter nucleic acid sequence to bind to a template sequence, followed by an extending and/or synthesizing step to extend the primer sequence and/or synthesize nucleic acid to incorporate any modified nucleotide disclosed herein within to form a modified nucleic acid. In certain aspects, the template sequence can be the sequence targeted for replication, amplification, sequencing, etc., and the primer sequence can be a small fragment of a complementary nucleic acid sequence able to bind the template sequence and allow an extension and/or synthesis enzyme to extend the primer sequence or synthesize a nucleic acid. In other aspects, the process can further comprise a denaturation step to denature the modified nucleic acid and allow additional annealing and extending steps. In such embodiments, any number of cycles suitable to serve the purpose of the particular process is contemplated herein. Certain processes contemplated herein may have a number of cycles in a range from about 2 to about 100, from about 15 to about 75, from about 20 to about 60, or from about 20 to about 40. Similarly, processes contemplated herein may comprise at least 3 cycles, at least 5 cycles, at least 10 cycles, or at least 20 cycles.
Conditions of each step of the processes are also not limited to any particular temperature, pressure, solvent, reaction time, etc. and generally can be conducted under any conditions suitable for the particular processes. Moreover, the processes can be conducted in the presence of any reagent mixture, nucleotides, polymerization enzymes, or combinations thereof described herein or that may be suitable to complete the process. For instance, in certain aspects, the annealing and extending or synthesizing steps independently can be conducted in any reagent mixture disclosed herein suitable for the conditions of the process. The reagent mixture can be the same or different in any of the steps of the process.
Similarly, the temperature of any step can be any that are suitable to conduct the particular step or the process as a whole. In certain aspects, a temperature of the annealing step can be in a range from about 10° C. to about 60° C., from about 20° C. to about 50° C., or from about 25° C. to about 40° C. Likewise, the temperature of the extending step can be in any suitable range, and in a range from about 20° C. to about 90° C., from about 30° C. to about 70° C., or from about 40° C. to about 60° C. Denaturation steps may be conducted at somewhat higher temperatures to ensure the binding interactions between complementary strands are completely dissociated, for instance in a range from about 40° C. to about 100° C., or from about 60° C. to about 90° C.
In certain aspects, an amount of error-free modified nucleic acid present in the crude product mixture can be higher than that for an analogous process using only native nucleotides. For instance, an amount of misincorporation of the modified nucleotide during the extending or synthesizing step can be less than that of an otherwise identical process using a native nucleotide. While not being bound by theory, it is believed that modifications to nucleotides through substitution of an atom in the native nucleotide with an atom having a larger atomic radius (e.g., substituting oxygen with selenium) may improve the fidelity of the extension and polymerization enzyme by reducing the amount of nucleotides that are misincorporated into nucleic acid during the extending or synthesizing step. In certain aspects, an error rate of the extension and/or polymerization enzyme can be less than about 1 per 105 base pairs, less than about 1 per 106 base pairs, less than about 1 per 107 base pairs, or less than about 1 per 108 base pairs.
Thus, the amount of modified nucleic acids in the product mixture that are not complementary to the template sequence can be less than about 10%, less than about 5%, less than about 3%, less than about 2%, less than about 1%, less than about 0.5%, or less than about 0.1%, due to the increased fidelity of the processes disclosed herein. As any such non-complementary sequences can have similar molecular weights, separation of such sequences from the product mixture can be impractical. Thus, improving the fidelity by processes disclosed herein may also improve the purity of any subsequent isolated product.
Inserting a phosphorothioate linkage near the 3′ end of primer can inhibit mis-priming between primer with primer or template, so it has been used in DNA amplification (such as PCR), for higher specificity and less nonspecific product. Even so, the application of phosphorothioated primer remains hindered by insufficient effect on nonspecific amplification and inconvenient preparation of diastereomerically-pure oligonucleotides. Surprisingly, the processes herein can demonstrate an amount of nonspecific byproducts in the product mixture due to mispriming of the primer sequence during the annealing step also may be reduced in the presence of modified nucleotides and reagent mixtures disclosed herein. Thus, an amount of the modified nucleic acid in the product mixture, relative to non-specific products (and prior to isolation) can be at least about 90%, at least about 95%, at least about 98 wt. %, at least about 99 wt. %, or at least about 99.5 wt. %. In other aspects, the amount of modified nucleic acid in the product mixture, relative to non-specific products, can be in a range from about 80 wt. % to about 99.99 wt. %, from about 90 wt. % to about 99 wt. %, or from about 95 wt. % to about 99 wt. %. Certain aspects may further comprise isolating the modified nucleic acid from the product mixture to form a purified modified nucleic acid. In certain aspects, the isolating step can include gel electrophoresis, or any other suitable method to isolate the target product from the product mixture.
In certain aspects, an extension and/or polymerization rate of the extension and/or polymerization enzyme with the modified nucleotide can be lower than that for the native nucleotide. In certain aspects, the extension and/or polymerization rate can be in any range disclosed herein (e.g., from about 1 base pairs/second to about 10,000 base pairs per second, from about 1000 to about 8000 base pairs per second, from about 2000 to about 6000 base pairs per second, from about 3000 to about 5000 base pairs per second). While not being bound by theory, the substitution of an atom having a larger atomic radius may contribute to the observed reduction in extension and/or polymerization rate, and increases in fidelity and specificity. Surprisingly, processes that include α-phosphoseleno modified nucleotides may be particularly effective in reducing the extension and/or polymerization rate, without prolonging the time period necessary to complete extending or synthesizing steps of the process. Thus, in certain aspects the extension and/or polymerization rate of the extension and/or polymerization enzyme for the modified nucleotide can be any amount or percentage less than that relative to an extension and/or polymerization rate of the extension and/or polymerization enzyme for an analogous native nucleotide (e.g., about 90 %, about 80%, about 60%, about 50%, about 30%, about 20%, about 10% or about 1% less, or at least about 1 base pairs per second, at least about 500 base pairs per second, or at least about 1000 base pairs per second less).
Processes disclosed herein may further comprise an oxidizing or hydrolyzing step to convert the modified nucleic acid to the native nucleic acid. Oxidizing step may be conducted in the presence of an oxidant, and under any conditions suitable for the oxidation, for instance, within any reagent mixture or product mixture disclosed herein without further isolation. Oxidants that may be suitable can include hydrogen peroxide solutions (e.g. 3% H2O2). Moreover, the temperature of the oxidizing step is not particularly limited, and in certain aspects can be in a range from about 0 to about 100° C. Alternatively, the oxidation temperature can be in a range that allows the modified nucleic acid to be stable at room temperature, while being oxidized at relatively mild temperatures, for instance in a range from about 40° C. to 80° C., or from about 40° C. to 60° C.
Reagent mixtures disclosed herein generally are suitable for any of the processes described above, and can incorporate any of the modified nucleotides (and corresponding analogous and non-analogous native nucleotides) described above. In some aspects, reagent mixtures disclosed herein can comprise a primer or promoter sequence, a template sequence, an extension and/or polymerization enzyme, and a nucleotide mixture. However, the reagent mixture may also further comprise any number of additional elements that may facilitate the processes described above. For instance, the reagent mixture can comprise any number of diluents and/or buffers to facilitate the reaction. In certain aspects, the reagent mixture can comprise polar solvents such as water, alcohols, or both. Additionally, the reagent mixture also may comprise nonpolar solvents to facilitate a denaturing step. The reagent mixture also can comprise salts in any concentration suitable for any process disclosed herein.
Any concentration of the primer, promoter and template sequences may be suitable for the processes disclosed herein; however, in some aspects the primer or promoter sequence and template sequence independently can have a concentration of from about 1 yoctoM to about 1 mM. The primer sequence may consist of naturally-occurring nucleotides, or may comprise any amount of modified nucleotides described herein.
In certain processes, the length of the primer sequence may affect the amount of mispriming, as longer sequences may anneal to themselves during the annealing step leading to relatively short and non-complementary extended sequences. In contrast, shorter primer sequences may result in non-specific binding to a complementary sequence of the template strand, and also result in relatively short sequences. Thus, the length of the primer sequence in the reagent mixture may be process-dependent. In some aspects, the length of the primer sequence can be in a range from about 3 to about 100 bases, from about 10 to about 50 bases, or from about 10 to about 30 bases. Similarly, the length of the template sequence is not limited to any particular length, and can be any length generally suitable for the processes described herein. Thus, the length of the primer sequence in the reagent mixture may be process-dependent. In some aspects, the length of the primer sequence can be in a range from about 50 to about 10,000 bases, from about 100 to about 5,000 bases, or from about 100 to about 3,000 bases.
Generally, the reagent mixture can comprise any number or combination of modified and native nucleotides described above, such as may be suitable to extend a primer sequence to the length of a template sequence, or facilitate any process disclosed herein. In certain aspects, the reagent mixture can comprise a mixture of naturally-occurring (native) nucleotides, and any relative or absolute amount of analogous modified nucleotides. The reagent mixture can comprise a single modified nucleotide, with or without an analogous native nucleotide. In some aspects, the reagent mixture also can comprise any number of non-analogous native nucleotides (e.g., one, two, three, four, five, etc.), and in any nucleotide concentration disclosed herein. In mixtures comprising an analogous native nucleotide, the molar ratio of modified nucleotide analogous native nucleotide is not limited to any particular amount, and may be any minimal amount suitable to facilitate the processes described herein. For instance the molar ratio of modified nucleotide:analogous native nucleotide can be in a range from 1:100 to 10:1, from 1:10 to 10:1, from 1:5 to 5:1, or from 1:2 to 10:1, or analogous native nucleotide may not even be included in the reagent mixture. In other aspects, more than one modified nucleotide can be present in any amount or ratio relative to the analogous native nucleotide disclosed herein (e.g., in the absence of the analogous native nucleotide, in a molar ratio from 1:100 to 10:1, etc.), or analogous native nucleotide may not even be included in the reagent mixture.
In certain aspects the reagent mixture can comprise a single modified nucleotide and three non-analogous native nucleotides. Alternatively, the reagent mixture can comprise two modified nucleotides and two non-analogous native nucleotides. In other aspects, the reagent mixture can comprise three modified nucleotides and one non-analogous native nucleotides. In still other aspects, the reagent mixture can comprise four modified nucleotides in the absence of a native nucleotide. In other aspects, the reagent mixture can comprise four naturally-occurring nucleotides and any number of modified nucleotides (e.g., 1, 2, 3, 4, etc.), each in any concentration or molar ratio disclosed herein.
Concentrations of nucleotides in the reagents mixtures disclosed herein are not limited to any particular amount, and can be in any amount suitable for processes disclosed herein. In certain aspects, each nucleotide (e.g., modified, naturally-occurring, native, sequencing, etc.) can have a concentration in any reagent mixture disclosed herein in a range from about 1 nM to about 100 mM, from about 10 nM to about 100 mM, from about 10 nM to about 10 mM, from about 1 µM to about 500 µM, or from about 50 µM to about 300 µM.
Nucleotide concentrations suitable for reagent mixtures and processes disclosed herein can depend, at least in part, on the nature of the extension and/or polymerization enzyme. As stated above, the extension and/or polymerization enzyme is not limited to any particular enzyme, and may be any that is capable of extending a primer sequence annealed to a template strand during the extending step of any process disclosed herein. For instance, in certain aspects the extension and/or polymerization enzyme may be a mammalian (e.g., human) enzyme, a bacterial enzyme, or fragments and combinations thereof. In certain aspects, the extension and/or polymerization enzyme can comprise a DNA polymerase, a RNA polymerase, a reverse transcriptase, or fragments and/or combinations thereof. In other aspects, the extension and/or polymerization enzyme can be human DNA polymerase I, Klenow fragment, or Bst polymerase.
The invention is further illustrated by the following examples, which are not to be construed in any way as imposing limitations to the scope of this invention. Various other aspects, embodiments, modifications, and equivalents thereof which, after reading the description herein, can suggest themselves to one of ordinary skill in the art without departing from the spirit of the present invention or the scope of the appended claims.
2′-deoxynucleoside 5′-(alpha-P-seleno)-triphosphate (dNTPαSe) was synthesized via the protection-free one-pot strategy reported in. The native nucleoside (1 mmol), tributylammonium pyrophosphate (945 mg, 2 mmol, 2 equivalents) and 3H-1, 2-benzothiaselenol-3-one (BTSe, 435 mg, 2 mmol, 2 equiv) were dried in separate flasks under high vacuum for 1 h. DMF (1.5 mL) and tributylamine (TBA, 3.0 mL) were added to the pyrophosphate as a solvent. Anhydrous 2-chloro-4H-1,3,2-benzodioxaphosphorin-4-one (405 mg, 2 mmol, 2 equiv) dissolved in DMF (3.0 mL) was then injected into the pyrophosphate solution. This reaction mixture was stirred under argon at room temperature for 60 min and then injected into the flask containing the dried native nucleoside dissolved (thymidine and deoxycytidine were dissolved in 1.5 mL DMF; deoxyadenosine was dissolved in a mixed solvent of 1.0 mL DMF and 1.5 mL DMSO, and deoxyguanosine was dissolved in 3.0 mL DMSO). 3H-1,2-benzothiaselenol-3-one (BTSe) dissolved in dioxane (2.5 mL) was then injected to the reaction mixture and stirred at room temperature for 1h. Water (approximately twice the volume of the reaction solution) was then added to the reaction mixture, and stirred at room temperature for 2 h. Impurities in the crude product mixture were removed with ethanol/NaCl precipitation in the presence of fresh DTT (2 mM).
Crude products were further purified by RP-HPLC over an Ultimate XB-C18 column (10 µm, 30×250 mm, form Welch, China). Samples were eluted (15 mL/min) with a linear gradient from 90% Buffer A (20 mm triethylammonium acetate (TEAAc), pH 6.6) and 10% Buffer B (50% acetonitrile in water, 20 mm TEAAc, pH 6.6) to 20% Buffer B over 50 min. The purified Se-modified nucleotide diastereomers were lyophilized and re-dissolved separately in a small amount of a solution of 10 mM tris(hydroxymethyl)aminomethane/HCl (Tris-HCl, pH 7.5) and 20 mM of DTT and stored at -80° C. The synthesized Se-modified nucleotides (6) were analyzed by RP-HPLC (
All synthesized Se-modified nucleotides were analyzed by HR-MS, 1H-NMR, 13C-NMR, and 31P-NMR, as shown in the tables below.
1H-NMR chemical shifts (δ, ppm) of dNTPαSe analogs in D2O
13C-NMR chemical shifts (δ, ppm) of dNTPαSe analogs in D2O
31P-NMR chemical shifts (δ, ppm) of dNTPαSe analogs in D2O
DNA polymerase extension and/or polymerization reactions with each Se-modified nucleotide diastereomer were performed with a 5′-FAM-labeled primer (DNA primer, 0.5 µM) and a template (DNA template, 0.5 µM), DNA polymerase [DNA polymerase I (DNA Pol I, 0.04 U/µL, NEB), Klenow Fragment (Klenow, 0.2 U/µL, NEB) or Bst Large Fragment (Bst, 0.3 U/µL, NEB)] and dNTPs (125 µM for DNA Pol I reactions, 15 µM for Klenow and Bst reactions). The reaction mixtures were incubated at 37° C. for 60 min, then equal volume of denaturing dye solution with 8 M urea was added into each tube. Complete termination was performed with an incubation in dry bath at 95° C. for 10 min. The products were analyzed by urea-denaturing polyacrylamide gel electrophoresis (Urea-PAGE) and imaging by FAM fluoresce, and compared to a DNA synthetic product. Results are shown in
As shown in
Moreover, the presence of diastereomer II of the modified mucleotides did not inhibit the DNA polymerases. As shown in
The reactions were performed with DNA primer (1 µM, final concentration), DNA template (0.7 µM), Bst (0.04 U/µL, NEB), a mixture of three native nucleotides and one Se-modified nucleotide (50 µM for each) and 1×Bst buffer (20 mM Tris-HCl, 10 mM (NH4)2SO4, 10 mM KCl, 2 mM MgSO4, 0.1% Triton X-100 and 5 mM DTT) at 15 second intervals ranging from 0-180 sec, each at 55° C. Comparative examples were conducted for each template using only native nucleotides. The reactions were analyzed by denatured or native polyacrylamide gel electrophoresis and imaged by FAM-primer fluoresce (
As shown in
In addition to increased fidelity, the reduced polymerization rate for Se-modified nucleotides was shown to reduce non-specific extension products in the polymerization reactions. The reactions using Se-modified nucleotides to inhibit non-specific DNA primer extension were performed with DNA primer (2 µM, final concentration), DNA template (2 µM), Bst (0.5 U/µL, NEB) and native and/or Se-modified nucleotides (200 µM each). Extension and polymerization in the absence of DNA template were conducted at temperatures ranging from 20-60° C. (20, 30, 40, 50 and 60° C.,
As shown in
Surprisingly, substitution with multiple Se-modified nucleotides completely prevented non-specificity, without significant loss synthetic efficiency. DNA polymerase was still functional, even all four native nucleotides were replaced with Se-modified nucleotides, and the yield remained the same. Obviously, the Se-modified nucleotides provide much higher specificity in DNA primer extension and polymerization than their native counterparts.
To monitor the PCR amplification with Se-modified nucleotide substrates and/or Se-DNA templates, we first prepared Se-modified DNA by using Se-modified nucleotides, a native template DNA (SEQ ID NO: 8; 5′-acgacgttgtaaaacgacggccagtgaattcgagctcggtacccggggatcctctagagtcgacctgcaggcatgcaagcttggcgtaatc atgg-tcat-3′), and a Primer T (SEQ ID NO: 9; 5′-aatttcacacaggaaacagctatgaccatgattacgcc-3′). The polymerized Se-DNA was purified on urea-PAGE gel (12.5%) and the purified Se-DNA was used as the template for 30 cycles of PCR amplification with Se-modified and/or native nucleotide substrates (0.2 mM for each), 0.6 µM primers, 0.15 U/µl Taq DNA polymerase and 2 mM Mg2+. Then we performed sequencing with both forward and reversed primers. The results shown in
Oxidation of Se-DNA with hydrogen peroxide yielded the corresponding native DNA. Single-stranded native DNA and Se-modified DNAs were prepared via an exponential amplification reaction (EXPAR). The two resulting DNA sequences were purified by PAGE and desalted by C18 cartridges (Sep-Pac Vac, Waters Co.). Then the Se-DNA was treated, with 3% fresh H2O2 for deselenization at room temperature for 24 hours, or alternatively, at 50° C. for 2 hours. The resulted samples were analyzed by ESI-MS. The sequence of the single-stranded Se-DNA is SEQ ID NO: 10; 5′-d(pApGpTpApCpTpApGpApTpGpTpGpApGpApCpApTpC), containing dC-phosphoroselenoate. Se-DNA molecular formula: C197H247N79O116P20Se3, [M-H+]-:6432.8 (calc.); fully-deselenized Se-DNAs (corresponding native DNA) molecular formula: C197H247N79O119P20, [M-3Se+3O-H+]-: 6243.1 (calc.). A: Overlapped MS profiles of Se-DNAs treated with and without H2O2 at room temperature for 24 h (profiles in red and gray, respectively) and observed mass are 6431.9 (6432.8, calc.) and 6433.3 (6432.8, calc.), respectively; B: Overlapped MS profiles of Se-DNAs treated with and without H2O2 at 50° C. for 2 h (profiles in red and gray, respectively) and observed mass are 6431.9 (6432.8, calc.) and 6243.1 (6245.2, calc.), respectively. As apparent from
As further non-limiting examples, dNTPαS were prepared as disclosed in Caton-Williams, J.; Fiaz, B.; Hoxhaj, R.; Smith, M.; Huang, Z., Convenient synthesis of nucleoside 5′-(α-P-thio)triphosphates and phosphorothioate nucleic acids (DNA and RNA). J Science China Chemistry 2012, 55 (1), 80-89, which is hereby incorporated herein in its entirety by reference. Again, diastereomers of each dNTPαS were evaluated separately with DNA polymerase, Klenow fragment, and Bst polymerase, and it was found that the dNTPαS I diastereomers were efficiently recognized by the extension and/or polymerization enzymes, while the dNTPαS II diastereomers were not recognized by the enzymes.
Surprisingly, as for dNTPαSe nucleotides discussed above, the dNTPαS nucleotides exhibited a delayed incorporation into the primer sequence by Bst polymerase compared with the naturally occurring native nucleotides, as shown in
To study the suppression of nonspecific amplification in the present and absence of template or/and primer, we designed primer extension with/without template or/and primer, since primers can use each other as nonspecific templates, thereby generating nonspecifically extended by-products, such as primer dimers and background-synthesized DNA by-products. In the absence of template or primer, it was observed that nonspecific DNA extensions occurred, indicated by formation of multiple by-products (
To verify the nonspecific amplification inhibition effect of S-dNTP at various paring conditions, we designed primer extension (
Compared to Bst DNA polymerase, Taq DNA polymerase is used much more widely, such as in polymerase chain reaction (PCR). In PCR reactions amplifying plasmid (
To test universality of suppression effect of dNTPαS I on nonspecific product, we checked 5 new pairs of primers (primer pair a, b, c, d, e) and 3 types of templates (plasmid, total human cDNA and human genome) with native dNTPs or S-modified dNTPs (
Modified nucleotides having Se (or S) modifications at the 2-position of the thymine base were prepared according the procedures described below.
One grams of dry compound 1 was dissolved in dry dichloromethane (DCM, 10 ml), followed by addition of toluene (5 ml). N,N-diisopropylethylamine (DIEA, 0.69 g) and iodomethane (0.76 g)was then added to the reaction mixture at room temperature. The reaction was monitored by thin layer chromatography (TLC) plate (10% methanol in dichloromethane, R∱= 0.4) and completed in 1h. Methanol (5 ml) was poured into the mixture and stirred for 5 minutes to quench the reaction. The organic phase was evaporated under reduced pressure, DCM (50 ml) was then added. The organic layer was washed once with ddH2O (50 ml) and then three times with Saturated sodium bicarbonate aqueous solution (50 ml). The organic phase was dried over anhydrous magnesium sulfate and evaporated under reduced pressure. The residue was purified by flash column chromatography (5% methanol in dichloromethane) and pure compound 2 was obtained in 89% yield.
A solution of NaSeH was generated by addition of absolute ethanol (5 ml) to selenium (0.41 g) and sodium borohydride (NaBH4, 0.25 g) at 0° C. The reaction was completed in 0.5 h and a clear solution was formed. The ethanolic solution was added to compound 2 (0.5 g) and the mixture was stirred overnight under argon. The reaction mixture was then concentrated under reduced pressure and ethyl acetate (5 ml) was added to the residue. The organic layer was washed with water three times (3 × 30 ml), and then dried over anhydrous magnesium sulfate. Purification was performed by flash column chromatography (5% methanol in dichloromethane) and the light yellow compound 3 was obtained in 83% yield.
Compound 3 (0.22 g) was added to a 10 ml round bottom flask, then 2 ml DCM was added to dissolve it, followed by addition of mercaptoethanol (0.2 g). Trichloroacetic acid (TCA) solution (10% TCA in DCM) was cautiously added dropwise until the mixture turned orange. Then the mixture was stirred for 10 minutes, and the reaction was monitored by TLC plate (10% methanol in dichloromethane, R∱ = 0.3). Wash the solid with DCM under vacuum filtration and the white compound 4 was obtained in 95% yield.
Tributyl ammonium pyrophosphate (170.4 mg) was added into a 25 mL round bottom flask and dried overnight. 2-chloro-4H-1,3,2-benzodioxin-4-one (33.3 mg) was put into a 5 ml round bottom flask and dried with a vacuum pump for 15 minutes. After argon replacement, 0.3 ml anhydrous DMF and 0.6 ml anhydrous tri-n-butylamine was added by a syringe to dissolve tributyl ammonium pyrophosphate under argon (Reagent 1). 2-chloro-4H-1,3,2-benzodioxin-4-one was dissolved in 0.6 ml anhydrous DMF .Then it was added into Reagent 1 with another syringe and stirred for 30 minutes under argon (Reagent 2). Compound 4 (52.3 mg) was dissolved in 0.3 ml anhydrous DMF and then moved into Reagent 2 by a new syringe. The reaction was stirring for 1h under argon (Reagent 3). Iodine (30 mg) was dissolved in 5 ml anhydrous DMF and then added to Reagent 3 dropwise until the mixture showed a bright yellow color that did not fade. Then the reaction was stirring for 0.5 h under argon. Triethylamine (54 mg) and degassed water (5 ml) were added to the mixture, and argon was used to protect the reaction for 1.5 h. DTT (50 ul) was added into the mixture by syringe to quench the reaction. After three times precipitation with ethanol, Purification was performed by HPLC and compound 5 was obtained in 12% yield. Compound 5, 2-Se-dTTP, was characterized by HPLC, HRMS, and 1H, 13C, and 31P NMR, according to
As shown in
Experiments to examine the misincorporation of 2-Se-TTP were conducted as follows. Broadly, enzymatic extension reactions were performed using each naturally occurring dNTP except dCTP, knowing that misincorporations of TTP in place of dCTP are commonly the cause of decreased fidelity in DNA replications. As shown in
To further confirm the application value of 2-Se-TTP in PCR, two different target fragments were designed, shown in
Now our biological experiments reveal that polymerase is able to recognize and utilize 2-Se-TTP, and with the incorporation of 2-Se-TTP in DNAs, the specificity of the base pair recognition is largely increased, which lead to more specific DNA bands in polymerase reactions. Consistently, our experimental results also indicate that the incorporation of 2-Se-TTP can indeed reduce the nonspecific amplification of bands in PCR, which providing a unique strategy for PCR optimization. Moreover, this 2-Se-TTP provides a brand-new approach for further investigating base-pair recognition and DNA polymerase replication, while this 2-Se-UTP provides a brand-new approach for further investigating base-pair recognition and RNA polymerization, opening new research opportunities for RNA polymerase transcription, reverse transcription, and mRNA translation.
Exploring further the potential of base modifications at the 2-position of thymine, analogous experiments were conducted using 2-S-TTP as a modified nucleotide with results shown in
The invention is described above with reference to numerous aspects and specific examples. Many variations will suggest themselves to those skilled in the art in light of the above detailed description. All such obvious variations are within the full intended scope of the appended aspects. Other aspects of the invention can include, but are not limited to, the following (aspects are described as “comprising” but, alternatively, can “consist essentially of” or “consist of”):
This application is a continuation of PCT International Patent Application No. PCT/US2020/028110, filed on 14 Apr. 2020, which claims priority to U.S. Provisional Pat. Application No. 62/835,240, filed Apr. 17, 2019, the disclosures of which are hereby incorporated by reference herein in their entirety.
| Number | Date | Country | |
|---|---|---|---|
| 62835240 | Apr 2019 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | PCT/US2020/028110 | Apr 2020 | WO |
| Child | 17502393 | US |
