Patent Application
20240287544
The application contains a Sequence Listing which has been submitted electronically in .XML format and is hereby incorporated by reference in its entirety. Said .XML copy, created on Apr. 22, 2024, is named “065095.005US1.xml” and is 363,048 bytes in size. The sequence listing contained in this .XML file is part of the specification and is hereby incorporated by reference herein in its entirety.
The invention is generally related to the field of vaccination, and more particularly to compositions and methods of using modified PIV5 vaccine vectors such as PIV5W3AΔSH or PIV5W3AΔSH with P/V gene mutation (CVB) for modulating immune responses in a subject having or susceptible to infectious agents such as RSV and SARS-CoV-2.
Parainfluenza virus type 5 (Parainfluenza virus 5, PIV5) belongs to the family Paramyxoviridae and the genus Rubulavirus which also includes mumps virus, and its genome is negative single strand RNA with a length of 15246 nt. The genome full-length structure of PIV5 is 3′-Leader-NP-V/P-M-F-SH-HN-L-Trailer-5′, namely, from 3′end to 5′ end, Nucleocapsid Protein (NP), V protein/phosphorylated protein (P), Matrix protein (M), Fusion protein (F), Small hydrophobic protein (SH), Hemagglutinin-neuraminidase protein (HN) and polymerase protein (Large protein, L) are encoded in sequence. Wherein, the V protein and the SH protein are non-structural proteins.
PIV5 is an excellent viral vector for vaccine development, and research on PIV5 recombinant vaccines is underway. In recent years, researchers have continuously explored the feasibility of using PIV5 as a vaccine vector. A common approach is to insert a protective antigen gene from a virus or bacteria into PIV5, and to express the inserted foreign gene by replication and translation of PIV5 vector. Given that PIV5 can infect respiratory tract without causing any illness, researchers often take advantage of this and focus on controlling certain respiratory viral infections. Therefore, the deep research on the molecular biological characteristics, the replication mechanism and the like of the virus is beneficial to the comprehensive and thorough understanding of the PIV5, so that a foundation is laid for the research on the PIV5 as a genetic engineering vaccine vector and the gene function research of the virus. However, there remains a need for more potent and high yield PIV5 vaccine vectors.
Thus, the disclosure provided herein provides a more potent and high yield PIV5 CVB backbone which contains the P/V gene S156N or S157F mutation, and the generation of new SARS-CoV-2 CVB-vectored vaccines for intranasal immunization. The phosphoprotein (P) protein can be phosphorylated at serine residues at positions 36, 126, and 157 and a threonine residue at position 286. In addition, host cell Polo-like kinase 1 (PLK1) can phosphorylate a serine residue at position 308. Mutation of the serine residues to alanine residues at either position 157 or 308 prevents phosphorylation at these residues significantly enhancing the activity of the vRdRP in mini-genome assays and the replication of recombinant viruses that bear these mutations. The mutation at residue 156 and 157 are hypothesized to upregulate viral transcription and replication, improving vaccine virus yield. The change in the amino acids 155-159 TSSPI motif of the PIV5 P protein will change virus phenotype and growth property in vitro and in vivo.
In accordance with the purpose(s) of this invention, as embodied and broadly described herein, this invention, in one aspect, relates to a modified PIV5 (termed CVB) viral expression vector comprising a PIV5 W3A viral genome having a mutations at amino acid residue S157 or S156 of the P/V gene and a deletion of the small hydrophobic (SH) gene of the PIV5 W3A viral genome. This modified CVB backbone has been shown to grow better in cell culture such as in serum-free Vero cells and be more immunogenic, such as in the cotton rat animal model. The modified CVB backbone can be used as an effective vaccine platform.
In some embodiments, the mutation at amino acid residue S157 or S156 comprises the substitution of serine (S) with an amino acid residue selected from a group consisting of alanine (A), cysteine (C), aspartic acid (D), glutamic acid (E), phenylalanine (F), glycine (G), histidine (H), isoleucine (I), lysine (K), leucine (L), methionine (M), asparagine (N), proline (P), glutamine (Q), arginine (R), selenocysteine (U), valine (V), tryptophan (W), and tyrosine (Y). In one embodiment, the amino acid substitution at amino acid residue S157 comprises a substitution of serine (S) to phenylalanine (F) or S156 comprises a substitution of serine (S) to asparagine (N).
In further embodiments, the SH gene has a deletion of the SH open reading frame or a deletion of an entire SH gene transcript unit.
In one embodiment, the CVB viral expression vector expresses a heterologous polypeptide comprising a viral antigen selected from a group consisting of SARS-CoV-2, RSV or other viral or bacterial antigens. In another embodiment, the PIV5 genome has a heterologous nucleic acid sequence with at least 98% sequence identity to SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 and wherein the viral expression vector expresses a heterologous polypeptide comprising a coronavirus spike (S) and/or nucleocapsid (N) proteins, RSV-F proteins, or viral or bacterial antigens.
In one embodiment, the coronavirus S protein is a coronavirus S protein of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), a variant of interest or a variant of concern of SARS-CoV-2 and the coronavirus N protein is the coronavirus N protein of SARS-CoV-2, a variant of interest or a variant of concern of SARS-CoV-2. In some embodiment, the coronavirus S protein is the coronavirus S protein of a SARS-CoV-2 Wuhan strain, a SARS-CoV-2 beta variant, a SARS-CoV-2 gamma variant, a SARS-CoV-2 delta variant, or a SARS-CoV-2 omicron variant and the coronavirus N protein is the coronavirus N protein of a SARS-CoV-2 Wuhan strain, a SARS-CoV-2 beta variant, a SARS-CoV-2 gamma variant, a SARS-CoV-2 delta variant, or a SARS-CoV-2 omicron variant. In some embodiments, the SARS-CoV-2 omicron variant is SARS-CoV-2 Omicron BA.1 or SARS-CoV-2 Omicron BA.5, BQ1 or XBB1 or any future emerging variants.
In one embodiment, the coronavirus S protein comprises the coronavirus S protein of SARS-CoV-2 and wherein the cytoplasmic tail of the coronavirus S protein has been replaced with the cytoplasmic tail of the fusion (F) protein of CVB.
In one embodiment, the PIV5 W3A viral genome comprises open reading frame deletion mutations of the SH gene and the S gene of SARS-CoV-2 Wuhan strain is inserted between the PIV5 hemagglutinin (HN) and polymerase (L) genes of CVB.
In some embodiments, the entire SH gene transcript unit of PIV5 W3A viral genome is deleted and the S gene of the SARS-CoV-2 Wuhan strain is placed between the HN and L genes of CVB.
In some embodiments, the N gene of SARS-CoV-2 Wuhan strain is inserted to replace the SH gene of PIV5, and the S gene of SARS-CoV-2 Wuhan strain is inserted between the HN and L genes of CVB.
In some embodiments, the N gene of SARS-CoV-2 Wuhan strain is inserted to replace the SH gene of PIV5, and the S gene of SARS-CoV-2 Omicron BA.1 variant is inserted between the HN and L genes of CVB
In some embodiments, the S gene of SARS-CoV-2 Omicron BA.5 variant is inserted between the HN and L genes of CVB.
In some embodiments, the S gene of SARS-CoV-2 Omicron BA.5 variant is inserted between the HN and L genes and the N gene of SARS-CoV-2 Wuhan strain is inserted to replace the SH gene of CVB.
In some embodiments, the PIV5 F and HN genes are deleted and wherein the S gene of SARS-CoV-2 Wuhan strain is between M and L genes of CVB.
In some embodiments, the N gene of the SARS-CoV-2 Wuhan strain is inserted between F and HN, and the S gene of the SARS-CoV-2 Wuhan strain is inserted between the HN and L genes of CVB.
In some embodiments, the M gene from the SARS-CoV-2 Wuhan strain is inserted between F and HN, and the S gene of the SARS-CoV-2 Wuhan strain is inserted between HN and L of CVB.
In some embodiments, the M gene from the SARS-CoV-2 Wuhan strain is inserted after F of PIV5, the E gene from the SARS-CoV-2 Wuhan strain inserted between the M gene of SARS-CoV-2 and HN, and the S gene of SARS-CoV-2 Wuhan strain is inserted between HN and L of CVB.
In some embodiments, the M gene from the SARS-CoV-2 Wuhan strain is inserted after F of PIV5, the N gene from the SARS-CoV-2 Wuhan strain is inserted between the M gene and the E gene of SARS-CoV-2, the E gene from the SARS-CoV-2 Wuhan strain inserted between the N gene of SARS-CoV-2 and HN, and the S gene of SARS-CoV-2 Wuhan strain is inserted between HN and L of CVB.
In some embodiments, the F gene from respiratory syncytial virus (RSV) is inserted between the SH and HN genes of CVB backbone.
In one embodiment, a viral particle comprises the viral expression vector.
In another aspect, the invention relates to a composition comprising a CVB viral expression vector having a nucleic acid sequence with at least 98% sequence identity to SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 and wherein the viral expression vector expresses a heterologous polypeptide comprising a coronavirus spike (S) and/or nucleocapsid (N) proteins. In one embodiment, the heterologous coronavirus spike (S) and nucleocapsid (N) proteins are expressed in a cell by contacting the cell with the composition.
In yet another aspect, the invention relates to a method of inducing an immune response in a subject having or at risk of having SARS-COV-2, RSV or other viral or bacterial infections, the method comprising administering the composition of to the subject, wherein the immune response comprises a humoral immune response and/or a cellular immune response.
Additional advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. The advantages of the invention will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. In one embodiment, the subject is vaccinated against COVID-19, RSV or other viral or bacterial infections the method comprising administering the composition to the subject, wherein the composition is administered intranasally, intramuscularly, topically, or orally. The method further comprises administering a PIV5 booster vaccine composition comprising a viral expression vector or a viral particle having a PIV5 genome comprising a heterologous nucleic acid sequence with at least 98% sequence identity to SEQ ID NOs: 27, 28, 29, 30, 31, 32, or 33, wherein said subject has previously received a primary vaccination against SARS-COV-2, RSV or other viral or bacterial infections.
The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate (one) several embodiment(s) of the invention and together with the description, serve to explain the principles of the invention.
The present invention may be understood more readily by reference to the following detailed description of preferred embodiments of the invention and the Examples included therein and to the Figures and their previous and following description.
To facilitate an understanding of the principles and features of the various embodiments of the disclosure, various illustrative embodiments are explained herein. Although exemplary embodiments of the disclosure are explained in detail, it is to be understood that other embodiments are contemplated. Accordingly, it is not intended that the disclosure is limited in its scope to the details of construction and arrangement of components set forth in the description or examples. The disclosure is capable of other embodiments and of being practiced or carried out in various ways.
In describing the exemplary embodiments, specific terminology will be resorted to for the sake of clarity. As used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural references unless the context clearly dictates otherwise. For example, reference to a component is intended also to include composition of a plurality of components. References to a composition containing “a” constituent is intended to include other constituents in addition to the one named.
Ranges may be expressed herein as from “about” or “approximately” or “substantially” one particular value and/or to “about” or “approximately” or “substantially” another particular value. When such a range is expressed, other exemplary embodiments include from the one particular value and/or to the other particular value.
Similarly, as used herein, “substantially free” of something, or “substantially pure”, and like characterizations, can include both being “at least substantially free” of something, or “at least substantially pure”, and being “completely free” of something, or “completely pure.”
The terms “patient”, “individual”, “subject”, and “animal” are used interchangeably herein and refer to mammals, including, without limitation, human and veterinary animals (e.g., cats, dogs, cows, horses, sheep, pigs, etc.) and experimental animal models. In a preferred embodiment, the subject is a human.
As described herein, the term “vaccinating” designates typically the sequential administration of one or more antigens to a subject, to produce and/or enhance an immune response against the antigen(s). The sequential administration includes a priming immunization followed by one or several boosting immunizations.
Within the context of the present invention, the term “pathogen” refers to any agent that can cause a pathological condition. Examples of “pathogens” include, without limitation, cells (e.g., bacteria cells, diseased mammal cells, cancer mammal cells), fungus, parasites, viruses, prions or toxins. Preferred pathogens are infectious pathogens. In a particular embodiment, the infectious pathogen is a virus, such as the coronaviruses.
An antigen, as used therein, designates any molecule which can cause a T-cell or B-cell immune response in a subject. An antigen specific for a pathogen is, typically, an element obtained or derived from said pathogen, which contains an epitope, and which can cause an immune response against the pathogen. Depending on the pathogenic agent, the antigen may be of various nature, such as a (poly)peptide, protein, nucleic acid, lipid, cell, etc. Live weakened forms of pathogens (e.g., bacteria, viruses), or killed or inactivated forms thereof may be used as well, or purified material therefrom such as proteins, peptides, lipids, etc. The antigen may be naturally-occurring or artificially created. It may be exogenous to the treated mammal, or endogenous (e.g., tumor antigens). The antigen may be produced by techniques known per se in the art, such as for instance synthetic or recombinant technologies, or enzymatic approaches.
In a particular embodiment, the antigen is a protein, polypeptide and/or peptide. The terms “polypeptide”, “peptide” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues. The terms also apply to amino acid polymers in which one or more amino acid residues may be modified or non-naturally occurring residues, such as an artificial chemical mimetic of a corresponding naturally occurring amino acid. It should be understood that the term “protein” also includes fragments or variants of different antigens, such as epitope-containing fragments, or proteins obtained from a pathogen and subsequently enzymatically, chemically, mechanically or thermally modified.
A “therapeutically effective amount” means the amount of a compound (e.g., a CVB-based composition as described herein) that, when administered to a subject for treating a state, disorder or condition, is sufficient to effect such treatment. The “therapeutically effective amount” will vary depending on the compound or bacteria administered as well as the disease and its severity and the age, weight, physical condition and responsiveness of the mammal to be treated.
The phrase “pharmaceutically acceptable”, as used in connection with compositions of the disclosure, refers to molecular entities and other ingredients of such compositions that are physiologically tolerable and do not typically produce untoward reactions when administered to a mammal (e.g., a human). Preferably, as used herein, the term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in mammals, and more particularly in humans.
The term “pharmaceutically acceptable composition” as used herein refers to a composition comprising at least one compound as disclosed herein formulated together with one or more pharmaceutically acceptable carriers.
The term “administration” refers to the introduction of an amount of a predetermined substance into a patient by a certain suitable method. The composition disclosed herein may be administered via any of the common routes, as long as it is able to reach a desired tissue, for example, but is not limited to, inhaling, intraperitoneal, intravenous, intramuscular, subcutaneous, intradermal, oral, topical, intranasal, intrapulmonary, or intrarectal administration. However, since peptides are digested upon oral administration, active ingredients of a composition for oral administration should be coated or formulated for protection against degradation in the stomach.
The term “dose” means a single amount of a compound or an agent that is being administered thereto; and/or “regimen: which means a plurality of pre-determined doses that can be different in amounts or similar, given at various time intervals, which can be different or similar in terms of duration. In some embodiments, a regimen also encompasses a time of a delivery period (e.g., agent administration period, or treatment period). Alternatively, a regimen is a plurality of predetermined plurality pre-determined vaporized amounts given at pre-determined time intervals.
The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Alternatively, the carrier can be a solid dosage form carrier, including but not limited to one or more of a binder (for compressed pills), a glidant, an encapsulating agent, a flavorant, and a colorant. Suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences” by E. W. Martin.
The terms “treat” or “treatment” of a state, disorder or condition include: (1) preventing or delaying the appearance of at least one clinical or sub-clinical symptom of the state, disorder or condition developing in a subject that may be afflicted with or predisposed to the state, disorder or condition but does not yet experience or display clinical or subclinical symptoms of the state, disorder or condition; or (2) inhibiting the state, disorder or condition, i.e., arresting, reducing or delaying the development of the disease or a relapse thereof (in case of maintenance treatment) or at least one clinical or sub-clinical symptom thereof; or (3) relieving the disease, i.e., causing regression of the state, disorder or condition or at least one of its clinical or sub-clinical symptoms. The benefit to a subject to be treated is either statistically significant or at least perceptible to the patient or to the physician.
By “comprising” or “containing” or “including” is meant that at least the named compound, element, particle, or method step is present in the composition or article or method, but does not exclude the presence of other compounds, materials, particles, method steps, even if the other such compounds, material, particles, method steps have the same function as what is named.
As used herein, the term “parainfluenza virus 5” (PIV5) includes, for example and not limitation, strains KNU-11, CC-14, D277, 1168-1, and 08-1990. Non-limiting examples of PIV5 genomes are listed in GenBank Accession Nos. NC_006430.1, AF052755.1, KC852177.1, KP893891.1, KC237065.1, KC237064.1 and KC237063.1, which are hereby incorporated by reference.
As used herein, the term “expression” refers to the process by which polynucleic acids are transcribed into mRNA and translated into peptides, polypeptides, or proteins. If the polynucleic acid is derived from genomic DNA, expression may, if an appropriate eukaryotic host cell or organism is selected, include splicing of the mRNA. In the context of the present invention, the term also encompasses the yield of the F gene mRNA and F proteins achieved following expression thereof.
As used herein, the term “F protein” or “Fusion protein” or “F protein polypeptide” or “Fusion protein polypeptide” refers to a polypeptide or protein having all or part of an amino acid sequence of an RSV Fusion protein polypeptide. Numerous RSV Fusion and Attachment proteins have been described and are known to those of skill in the art. WO/2008/114149, which is herein incorporated by reference in its entirety, sets out exemplary F and G protein variants (for example, naturally occurring variants).
As used herein, the term “combination” of a CVB-based composition as described herein and at least a second pharmaceutically active ingredient means at least two, but any desired combination of compounds can be delivered simultaneously or sequentially (e.g., within a 24-hour period). It is contemplated that when used to treat various diseases, the compositions and methods of the present disclosure can be utilized with other therapeutic methods/agents suitable for the same or similar diseases. Such other therapeutic methods/agents can be co-administered (simultaneously or sequentially, in any order) to generate additive or synergistic effects. Suitable therapeutically effective dosages for each agent may be lowered due to the additive action or synergy. Also, two or more embodiments of the disclosure may be also co-administered to generate additive or synergistic effects.
The term “coronavirus” refers to a group of related RNA viruses that cause diseases in mammals and birds. In humans, these viruses cause respiratory tract infections that can range from mild to lethal. Mild illnesses include some cases of the common cold (which is caused also by certain other viruses, predominantly rhinoviruses), while more lethal varieties can cause SARS, MERS, and COVID-19. There are presently no vaccines or antiviral drugs to prevent or treat human coronavirus infections.
The term “SARS” or “severe acute respiratory syndrome” refers to a viral respiratory disease of zoonotic origin that surfaced in the early 2000s caused by severe acute respiratory syndrome coronavirus (SARS-CoV or SARS-CoV-1), the first-identified strain of the SARS coronavirus species severe acute respiratory syndrome-related coronavirus (SARS-CoV). The syndrome caused the 2002-2004 SARS outbreak. In 2019, its successor, the related virus strain Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2), was discovered. The term “Covid-19” or “Coronavirus disease 2019” refers to a severe acute respiratory syndrome (SARS) caused by a virus known as SARS-Coronavirus 2 (SARS-CoV-2).
The mention of one or more method steps does not preclude the presence of additional method steps or intervening method steps between those steps expressly identified. Similarly, it is also to be understood that the mention of one or more components in a composition does not preclude the presence of additional components than those expressly identified.
The materials described as making up the various elements of the disclosure are intended to be illustrative and not restrictive. Many suitable materials that would perform the same or a similar function as the materials described herein are intended to be embraced within the scope of the disclosure. Such other materials not described herein can include, but are not limited to, for example, materials that are developed after the time of the development of the disclosure.
Respiratory syncytial virus (RSV) is a member of the genus Pneumoviridae. Human RSV (HRSV) is the leading cause of severe lower respiratory tract disease in young children and is responsible for considerable morbidity and mortality in humans. RSV is also recognized as an important agent of disease in immunocompromised adults and in the elderly. Due to incomplete resistance to RSV in the infected host after a natural infection, RSV may infect multiple times during childhood and adult life.
This virus has a genome comprised of a single strand negative-sense RNA, which is tightly associated with viral protein to form the nucleocapsid. The viral envelope is composed of a plasma membrane derived lipid bilayer that contains virally encoded structural proteins. A viral polymerase is packaged with the virion and transcribes genomic RNA into mRNA. The RSV genome encodes three transmembrane structural proteins, F, G, and SH, two matrix proteins, M and M2, three nucleocapsid proteins N, P, and L, and two nonstructural proteins, NS1 and NS2.
Fusion of HRSV and cell membranes is thought to occur at the cell surface and is a necessary step for the transfer of viral ribonucleoprotein into the cell cytoplasm during the early stages of infection. This process is mediated by the fusion (F) protein, which also promotes fusion of the membrane of infected cells with that of adjacent cells to form a characteristic syncytia, which is both a prominent cytopathic effect and an additional mechanism of viral spread. Accordingly, neutralization of fusion activity is important in host immunity. Indeed, monoclonal antibodies developed against the F protein have been shown to neutralize virus infectivity and inhibit membrane fusion (Calder et al., 2000, Virology 271: 122-131).
The F protein of RSV shares structural features and limited, but significant amino acid sequence identity with F glycoproteins of other paramyxoviruses. It is synthesized as an inactive precursor of 574 amino acids (F0) that is cotranslationally glycosylated on asparagines in the endoplasmic reticulum, where it assembles into homo-oligomers. Before reaching the cell surface, the F0 precursor is cleaved by a protease into F2 from the N terminus and F1 from the C terminus. The F2 and F1 chains remain covalently linked by one or more disulfide bonds.
CPI-RSV-F is a parainfluenza virus (PIV5) based RSV vaccine expressing the RSV F protein, is provided herein as prophylactic intranasal vaccines to prevent RSV infection and serious complications associated with RSV infection. CPI-RSV-F was designed to induce immune responses to the F protein of RSV, which is the main antigenic protein that is highly conserved between the RSV subgroups A and B. Anti-F antibodies inhibit virus entry into host cells and RSV F is a proven vaccine target based on the efficacy data from the commercial product palivizumab (RSV F monoclonal antibody). W3AΔSH-RSV-F and CVB-RSV are modified RSV vaccine, their backbone difference from the CPI-RSV-F is summarized in Figure. 1.
The disclosure provides CPI-RSV-F, W3AΔSH-RSV-F and CVB-RSV compositions, systems and methods for their use in multiple applications including functional genomics, drug discovery, target validation, protein production (e.g., therapeutic proteins, vaccines, monoclonal antibodies), gene therapy, and therapeutic treatments such as cancer therapy.
The disclosure provides CPI-RSV-F, W3AΔSH-RSV-F and CVB-RSV compositions, systems and methods for their use in multiple applications including functional genomics, drug discovery, target validation, protein production (e.g., therapeutic proteins, vaccines, monoclonal antibodies), gene therapy, and therapeutic treatments such as cancer therapy.
Previously published studies based on W3A strain of PIV5 construct engineered to express RSV-F protein included immunogenicity and challenge studies in mice, cotton rats and African green monkeys (1,2,3). As part of these studies, permissiveness for PIV5 replication was confirmed in cotton rats and African monkeys (1, 2). In addition, the following studies were performed: 1) compared vector constructs based on CPI vs. W3A PIV5 strain; 2) compared vaccine constructs expressing RSV pre-fusion versus wt F-protein in place of PIV5 SH gene (ΔSH) or inserted between PIV5 SH and NH (SH-NH) or between HN and L (HN-L). These studies led to the selection of CPI-RSV-F (CPI-RSV-F), containing the full length of RSV F-protein inserted between SH and HN gene for use in the initial human studies.
In addition, the protective efficacy of CPI-RSV-F vaccine has been evaluated in RSV challenge studies conducted in mice and cotton rats. Immunization with a single intranasal dose protected animals from RSV infection based on significantly reduced RSV viral titers observed in lung and nasal washes of immunized animals compared to controls.
More recent preclinical proof of concept studies conducted with the vaccine vector construct CPI-RSV-F included immunogenicity and challenge studies conducted by Blue Lake Biotechnology Inc. in mice and African green monkeys. In addition, preclinical data from a NIH sponsored study of the CPI-RSV-F construct in a cotton rat challenge study are summarized herein. The CPI-RSV-F vaccine used in these more recent non-clinical studies used a prior vaccine vector construct (rescued from BHK cells) that is the same as the vector construct used for clinical lot material (rescued from 293/Vero cells), and similarly produced using serum-free Vero cells as the substrate and formulated with sucrose phosphate glutamate (SPG) buffer. These non-clinical studies included the control (PIV5 W3A strain with SH gene deleted, W3AΔSH-RSV-F, engineered to express RSV F protein) as an active comparator.
In summary, the non-clinical studies in various animal models have demonstrated the ability of CPI-RSV-F, W3AΔSH-RSV-F and CVB-RSV to induce RSV F specific immune responses, as observed by F-specific antibody and cell mediated immune responses following a single intranasal dose. All of these vaccine candidates were well tolerated in these animal models and no indication of sensitization following vaccination.
i. Studies in Mice and Cotton Rats, and Monkeys with Related W3A PIV5 Vector Expressing RSV F Protein
PIV5 (W3A)-RSV-F and RSV-G protein study in Balb c mice: In this study Balb/c mice received a single intranasal dose of W3A-RSV-F (106 PFU dose in 50 μl) followed by RSV challenge. The PIV5 W3A vaccine vector construct in this study consisted of wild type RSV F protein inserted into the PIV5 HN and L intergenic regions. A single intranasal dose resulted in IgG2a/IgG1 RSV responses similar to that observed after wild-type RSV A2 infection at Day 21 after immunization.
PIV5 (W3A) expressing wild-type or Prefusion RSV F protein challenge study in mice and cotton rats: This study evaluated PIV5 vectored vaccines that were improved by changing location of F-protein insertion (inserted at SH-HN junction of PIV5 or replacing the SH with the RSV F protein gene). In addition, this study evaluated both the wild type (wt) F-protein or a prefusion conformation F-protein (pF).
Mice were immunized intranasally with single dose of W3AΔSH-RSV-F (RSV F protein gene inserted at deleted SH region of PIV5) expression wild type F protein or prefusion stabilized RSV F mutant (W3AΔSH-RSV-pF) or improved vector W3AΔSH-RSV-F or W3A-RSV-pF SH-HN (the F-protein gene inserted at the SH-HN junction) at 1×106 PFU. The study groups were as follows (Table 2).
Following immunization, both humoral and cell mediated immune responses were observed. The highest neutralizing antibody responses were detected with vaccine construct using the wt F protein. Also, vaccine constructs containing the wt F inserted prior to the HN junction with ΔSH seemed to be most immunogenic. The level of cell-mediated immune responses (based on IFN-gamma using ELISPOT) was similar between the various vaccine constructs.
Mice were challenged 28 days after immunization with RSV A2 to determine protective efficacy. Challenge virus was only obtained from one of five mice at day 4 post challenge in the W3AΔSH-RSV-F group with none of the mice in the other vaccination groups. In the PBS control group challenge virus was recovered from all mice.
A similar study was conducted in cotton rats which are more permissive to RSV infection. Rats were immunized with low dose of 103 PFU of the modified vectors (W3A-RSV-F (SH-HN), W3A-RSV-pF, W3AΔSH-RSV-F) containing wild type or perfusion stabilized F-protein (pF) or 102 PFU of W3AΔSH-RSV-pF.
Immune responses were observed in all groups including neutralizing antibody responses against RSV A Tracy strain (97% identical to RSV A/A2 strain). Similar to the mouse study, the groups immunized with vaccine constructs containing the wt F protein had higher antibody levels compared to the pF groups, with F insertion prior to the HN gene junction with ΔSH having the highest values (approx. titer of 128). The neutralization antibody titers to RSV/B/18537 were significantly lower than to RSV/A Tracy strain, only the W3A(SH-HN)-RSV-F and W3AΔSH-RSV-F groups had significant antibody levels (approx. titer of 8) detected. After RSV challenge on Day 28 with 1.21×105 PFU of RSV/A/Tracy, reduction in RSV viral load in nasal washes (1.4-1.66 Log10 reduction) and lung lavage fluid (2-3 Log10 reduction) was observed for all vaccine dose groups. The RSV challenge virus was recovered from all mice in the PBS control group (approx. 105 PFU per nasal wash, or 105 PFU/g lung wash).
Overall, these initial studies in the mouse and cotton rat models did not show evidence of the prefusion F-protein being more immunogenic and protective then the wild type F protein. Also, no difference was observed in the vector performance between ΔSH and the SH-HN insertion vector construct for the intranasal route.
Sigmovir Protocol #XV-131 Study report (Phan et al. 2017) challenge studies in cotton rat using intranasal and subcutaneous route: In a follow-on study (1, Phan et al. 2017) the efficacy, immunogenicity and safety of higher doses 105 and 106 PFU of W3A(SH-NH)-RSV-F and W3AΔSH-RSV-F were tested in a cotton rat challenge study evaluating two different routes intranasal (i.n.) and subcutaneous (s.c). This study also included a positive control for enhancement of disease (animals immunized with FI-RSV followed by RSV challenge and a positive control group consisting of animals that were pre-infected with RSV followed by RSV challenge. Animals in this study were challenged with RSV A2 on Day 49 followed by necropsy and histology 5 days later (Day 54). The study groups in this study were as follows (Table 3).
Immunogenicity: W3A(SH-HN)-RSV-F resulted in similar neutralizing antibody titer in 105 and 106 dose between i.n and s.c group. W3AΔSH-RSV-F vaccination induced slightly higher neutralizing antibody titers in i.n group compared to s.c group, with 106 dose resulting in a slightly higher titer, although it was not statistically significant.
Efficacy: W3A(SH-HN)-RSV-F resulted in complete protection in the lower respiratory tract by either i.n or s.c administration. Animals also had significantly lower viral loads in the upper respiratory tract.
W3A(SH-HN)-RSV-F vaccination resulted in complete protection in the lower respiratory tract by s.c administration and almost complete protection by i.n administration based on reduced titers (average titer of 103 PFU) observed in lung and nasal washes compared to control animals sham immunized with PBS (average titer of 105 PFU).
Safety: Lung sections from the different groups were examined for hallmarks of pulmonary inflammation: peribronchiolitis, perivasculitis, interstitial pneumonia, and alveolitis and scored for severity. The largest lesions were observed in the FI-RSV-immunized, RSV-challenged group (positive control group). Pulmonary changes were moderate in the groups immunized with W3A-RSV-F (SH-HN) or W3AΔSH-RSV-F (intranasally or subcutaneously), with levels below those observed in the RSV-immunized, RSV-challenged positive control group and similar to those in the PBS sham-immunized, RSV-challenged group.
Cytokine levels measured in lung tissues at 5 days post-challenge by quantitative real-time PCR (qPCR) were not indicative of potential of enhanced infection. The IL-4 mRNA level was significantly elevated only in the FI-RSV-vaccinated group, consistent with the histopathology results and the enhanced disease phenotype. IFNγ-mRNA levels were the highest in the sham-immunized and FI-RSV-immunized groups. IFN-mRNA levels were similarly low between groups immunized with the PIV5-based candidates and the RSV-immunized group. IL-2 mRNA levels were similar in all groups, but the average IL-2 level in the FI-RSV immunized group was significantly higher than that in the other groups.
After intranasal challenge of immunized mice with RSV A2 (106 PFU in 50 μl) at Day 28 after immunization, lung sections obtained at 4 days after challenge showed no exacerbation of lung lesions relative to RSV A2-immunized mice. Protective immunity was observed as assessed by viral load in lung tissues (n=5 mice per group).
PIV5 (W3A) expressing RSV F or G protein challenge study in cotton rats and African green monkeys: This study evaluated PIV5 vectored RSV F protein in cotton rats and African green monkeys for replication, immunogenicity and efficacy of protection against RSV challenge. In this study, the F protein was inserted into the intergenic regions of PIV5 HN and L gene.
PIV5 replication permissiveness in cotton rats and African green monkeys: Cotton rats (n=4 per group) were inoculated intranasally with 1×105 PFU of PIV5 at volumes of 10 μl or 100 μl. Viral titers were observed in nose homogenates (up 1×104 PFU) at day 4 which cleared mostly by day 6. The larger inoculum volume (100 μl) resulted in observation of vaccine virus in the lungs of all the animals at day 6, which was only observed for one animal inoculated with the smaller volume of 10 μl.
To evaluate PIV5 permissiveness in African green monkeys, 60 animals were screened for anti-PIV5 antibodies and all were found to be negative. Animals (n=3 per group) were infected intranasally with 1×102 up to 1×108 PFU of PIV5 in 0.25 mL dose volume. Nasal wash and bronchoalveolar washes were assessed for virus shedding on days 3, 5, 7, 10 and 14. Virus was shed from both nose and lungs for up to 10-day period with peak replication at Day 5 for the dose as low as 1×102 PFU. This data demonstrates permissiveness of African green monkeys for PIV5.
Immunogenicity in cotton rats and African green monkeys after single dose W3A-RSV-F: Cotton rats were immunized intranasally with 1×103, 1×104, 1×105 and 1×106 PFU of W3A-RSV-F. At all dose levels, IgG antibody responses were noted at Day 28 with comparable responses per dose group. Neutralizing antibodies were observed in all dose group ranging from titer of 64 to 256. In addition, IgA responses in lung homogenates were observed in all dose groups at Day 21 post inoculation.
African green monkeys (PIV5 and RSV serum negative) received a single intranasal immunization with 1×104 or 1×106 PFU W3A-RSV-F. Sera obtained at Day 21 post inoculation showed high titers of F-specific antibody responses. In addition, neutralizing antibody responses were observed at Day 21 at low levels (52 in 1×106 PFU dose group). Nasal swabs obtained at 21 days post immunization showed significant levels of F-protein IgA responses. Cell mediated responses as assessed by gamma interferon showed low level responses in the 1×106 PFU dose group.
Protection in cotton rats (Study #131) and African green monkeys from RSV challenge: Cotton rats immunized intranasally with single dose ranging from 1×103 to 1×106 PFU W3A-RSV-F were challenged with RSV A2 strain at Day 28 after immunization. Protection was assessed by measuring viral loads in nose and lung tissues. Reduced viral loads were observed in a dose-dependent manner except for the 1×106 PFU group which showed higher levels relative to 1×103 PFU group but still reduced compared to control group. In the 1×105 dose group, no virus was detected in the lung and reduced titers (order of 3 log10) were observed in the nose.
African green monkeys immunized with 1×104 or 1×106 PFU W3A-RSV-F were challenged 28 days after immunization with RSV A2. Nasal and BAL samples were assessed for RSV viral load Days 3-14 after challenge. Immunization with W3A-RSV-F did not shorten virus shedding, however, peak viral RSV loads were reduced 10 to 100-fold in both dose groups, with the highest reduction observed in the 1×106 PFU dose group.
Responses to W3A-RSV-F in RSV exposed African green monkeys: Prior exposure to RSV did not interfere with ability to boost RSV neutralization antibody titers (50-fold increase) in African green monkeys (seroconverted by intranasal infection with RSV A2).
Lung pathology in W3A-RSV-F immunized cotton rats after RSV challenge: In animals immunized at Day 0 with dose 1×106 PFU PIV5-RSV-F and challenged at Day 49 with RSV A2, lungs obtained five days after challenge were blindly examined by histopathology for alveolitis, interstitial pneumonitis, perivasculitis, and peribroncholitis and compared to lungs obtained from control animals inoculated with Formalin-inactivated RSV. The scores of positive control animals inoculated with formalin-inactivated RSV were significantly higher than PBS control animals but not the scores of W3A-RSV-F animals (ANOVA paired t-test).
Parainfluenza virus 5 (PIV5), a negative-stranded RNA virus, is a member of the Rubulavirus genus of the family Paramyxoviridae which includes many important human and animal pathogens such as mumps virus, human parainfluenza virus type 2 and type 4, Newcastle disease virus, Sendai virus, HPIV3, measles virus, canine distemper virus, rinderpest virus and respiratory syncytial virus. PIV5 was previously known as Simian Virus-5 (SV5). Although PIV5 is a virus that infects many animals and humans, no known symptoms or diseases in humans have been associated with PIV5. Unlike most paramyxoviruses, PIV5 infect normal cells with little cytopathic effect. As a negative stranded RNA virus, the genome of PIV5 is very stable. As PIV5 does not have a DNA phase in its life cycle and it replicates solely in cytoplasm, PIV5 is unable to integrate into the host genome. Therefore, using PIV5 as a vector avoids possible unintended consequences from genetic modifications of host cell DNAs. PIV5 can grow to high titers in cells, including Vero cells which have been approved for vaccine production by WHO and FDA. Thus, PIV5 presents many advantages as a vaccine vector.
A PIV5-based vaccine vector of the present invention may be based on any of a variety of wild type, mutant, or recombinant (rPIV5) strains. Wild type strains include, but are not limited to, the PIV5 strains W3A, WR (ATCC® Number VR-288™), canine parainfluenza virus strain 78-238 (ATCC number VR-1573) (Evermann et al., 1980, J Am Vet Med Assoc; 177:1132-1134; and Evermann et al., 1981, Arch Virol; 68:165-172), canine parainfluenza virus strain D008 (ATCC number VR-399) (Binn et al., 1967, Proc Soc Exp Biol Med; 126:140-145), MIL, DEN, LN, MEL, cryptovirus, CPI+, CPI−, H221, 78524, T1 and SER. See, for example, Chatziandreou et al., 2004, J Gen Virol; 85(Pt 10):3007-16; Choppin, 1964, Virology: 23:224-233; and Baumgartner et al., 1987, Intervirology; 27:218-223. Additionally, PIV5 strains used in commercial kennel cough vaccines, such as, for example, BI, FD, Merck, and Merial vaccines, may be used.
The PIV5 CPI strain vector backbone differs from that of PIV5 W3A strain vector as follows (
Previously, recombinant PIV5 viruses expressing foreign genes from numerous pathogens, including Influenza, Rabies, Respiratory Syncytial Virus, Tuberculosis, Burkholderia, and MERS-CoV, SARS-CoV-2 have been generated and tested as vaccine candidates (Li, Z., et al., J Virol, 87(1):354 (2013); Chen, Z., et al., J Virol, 87(6): 2986 (2013); Wang, D., et al., J Virol, 91(11) (2017); Chen, Z., et al., Vaccine, 33(51):7217 (2015); Lafontaine, E. R., et al., Vaccine X., 1:100002 (2018); Li, K., et al., mBio, 11(2) (2020); An et al., Sci Adv, July 2; 7, 2021). Because it actively replicates in the respiratory tract following intranasal immunization, PIV5-vectored vaccines can generate mucosal immunity that includes antigen-specific IgA antibodies and long-lived IgA plasma cells (Wang, D., et al., J Virol, 91(11) (2017). Xiao, P., et al., Front Immunol,. 12:623996 (2021)).
Provided herein is a modified PIV5 vector, CVB. The CVB backbone vector is immunogenic and can be used as an effective vaccine platform. The CVB backbone comprises mutations at amino acid residue S157 or S156 of the P/V gene, wherein a phosphorylation site is removed resulting in higher transcription activities thereby improving virus titer in cell culture.
In some embodiments, the mutation at amino acid residue S157 or S156 comprises the substitution of serine (S) with an amino acid residue selected from a group consisting of alanine (A), cysteine (C), aspartic acid (D), glutamic acid (E), phenylalanine (F), glycine (G), histidine (H), isoleucine (I), lysine (K), leucine (L), methionine (M), asparagine (N), proline (P), glutamine (Q), arginine (R), selenocysteine (U), valine (V), tryptophan (W), and tyrosine (Y). In one embodiment, the amino acid substitution at amino acid residue S157 comprises a substitution of serine (S) to phenylalanine (F) or S156 comprises a substitution of serine (S) to asparagine (N).
i. CVB Backbone
The CVB backbone nucleic acid sequence is provided herein:
Provided herein are the CVB-RSV-F genomic sequences.
The CVB-RSV-F nucleic acid sequence is provided herein:
The inserted RSV-F sequence is in the lowercase and the CVB sequence is in the uppercase.
The disclosure provides CVB-based SARS-CoV-2 compositions, systems and methods for their use in multiple applications including functional genomics, drug discovery, target validation, protein production (e.g., therapeutic proteins, vaccines, monoclonal antibodies), gene therapy, and therapeutic treatments such as cancer therapy.
With the present invention, constructs of the modified parainfluenza virus type-5 (PIV5) virus, CVB, expressing the SARS-CoV-2 envelope spike (S) and nucleocapsid (N) protein have been generated for use as vaccines against COVID. These constructs demonstrate effectiveness as vaccines, with single dose intranasal immunization inducing protective immunity in ferrets and cats.
Coronavirus disease 2019 (COVID-19) is a newly emerging infectious disease currently spreading across the world. It is caused by a novel coronavirus, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) (Zhu et al., 2020, N Engl J Med; 382:727-733). SARS-CoV-2 was first identified in Wuhan, China in December 2019, and has subsequently spread globally to cause the COVID-19 pandemic. The virus has infected more than 221 million persons world-wide, caused more than 4,574,000 deaths as of Sep. 8, 2021, and is poised to continue to spread in the absence of herd immunity. While vaccines and antibody therapies have been introduced worldwide, the emergence of multiple viral variants which are rapidly replacing the original virus identified in Wuhan has allowed for immune escape in vaccinated populations, presenting a need for improved vaccine efficacy.
SARS-CoV-2 is a single-stranded RNA-enveloped virus belonging to the ß coronavirus family (Lu et al., 2020, Lancet; 395:565-74). An RNA-based metagenomic next-generation sequencing approach has been applied to characterize its entire genome, which is 29,881 nucleotides (nt) in length (GenBank Sequence Accession MN908947) encoding 9860 amino acids (Chen et al., 2020, Emerg Microbes Infect; 9:313-9). Full-genome sequenced genomes available at GenBank include isolate 2019-nCoV WHU01 (GenBank accession number MN988668) and NC_045512 for SARS-CoV-2, both isolates from Wuhan, China, and at least seven additional sequences (MN938384.1, MN975262.1, MN985325.1, MN988713.1, MN994467.1, MN994468.1, and MN997409.1) which are >99.9% identical and are hereby incorporate by reference.
i. SARS-CoV-2 Variants
Since SARS-CoV-2 was first identified in 2019, multiple genetic variants of SARS-CoV-2 have been emerging and circulating around the world. Viral mutations and variants in the United States are routinely monitored through sequence-based surveillance, laboratory studies, and epidemiological investigations. The US government SARS-CoV-2 Interagency Group (SIG) developed a Variant Classification scheme that defines three classes of SARS-CoV-2 variants: variant of interest, variant of concern and variant of high consequence.
a. Variant of Interest
A SARS-CoV-2 variant of interest is a variant with specific genetic markers that have been associated with changes to receptor binding, reduced neutralization by antibodies generated against previous infection or vaccination, reduced efficacy of treatments, potential diagnostic impact, or predicted increase in transmissibility or disease severity.
A variant of interest might require one or more appropriate public health actions, including enhanced sequence surveillance, enhanced laboratory characterization, or epidemiological investigations to assess how easily the virus spreads to others, the severity of disease, the efficacy of therapeutics and whether currently approved or authorized vaccines offer protection. The growing list variants of interest that are being monitored and characterized include, but are not limited to, Eta, Iota, Kappa, Lambda and Mu.
b. Variant of Concern
A SARS-CoV-2 variant of concern is a variant for which there is evidence of an increase in transmissibility, more severe disease (e.g., increased hospitalizations or deaths), significant reduction in neutralization by antibodies generated during previous infection or vaccination, reduced effectiveness of treatments or vaccines, or diagnostic detection failures. Possible attributes of a variant of concern include evidence of impact on diagnostics, treatments, or vaccines, widespread interference with diagnostic test targets, evidence of substantially decreased susceptibility to one or more class of therapies, evidence of significant decreased neutralization by antibodies generated during previous infection or vaccination, evidence of reduced vaccine-induced protection from severe disease, evidence of increased transmissibility and evidence of increased disease severity.
Variants of concern might require one or more appropriate public health actions, such as notification to WHO under the International Health Regulations, reporting to CDC, local or regional efforts to control spread, increased testing, or research to determine the effectiveness of vaccines and treatments against the variant. Based on the characteristics of the variant, additional considerations may include the development of new diagnostics or the modification of vaccines or treatments. The growing list of variants of concern that are being closely monitored and characterized, includes, but is not limited to, Alpha, Beta, Delta, Gamma and Omicron.
c. Variant of High Consequence
A SARS-CoV-2 variant of high consequence has clear evidence that prevention measures or medical countermeasures (MCMs) have significantly reduced effectiveness relative to previously circulating variants. Possible attributes of a variant of high consequence include a demonstrated failure of diagnostic test targets, evidence to suggest a significant reduction in vaccine effectiveness, a disproportionately high number of vaccine breakthrough cases, or very low vaccine-induced protection against severe disease, significantly reduced susceptibility to multiple Emergency Use Authorization (EUA) or approved therapeutics and more severe clinical disease and increased hospitalizations.
A variant of high consequence would require notification to WHO under the International Health Regulations, reporting to CDC, an announcement of strategies to prevent or contain transmission, and recommendations to update treatments and vaccines. Currently, there are no SARS-CoV-2 variants that rise to the level of high consequence.
A PIV5 vaccine vector of the present invention may be constructed using any of a variety of methods, including, but not limited to, the reverse genetics system described in more detail in He et al. (Virology; 237(2):249-60, 1997). PIV5 encodes eight viral proteins. Nucleocapsid protein (NP), phosphoprotein (P) and large RNA polymerase (L) protein are important for transcription and replication of the viral RNA genome. The V protein plays important roles in viral pathogenesis as well as viral RNA synthesis. The fusion (F) protein, a glycoprotein, mediates both cell-to-cell and virus-to-cell fusion in a pH-independent manner that is essential for virus entry into cells. The structures of the F protein have been determined and critical amino acid residues for efficient fusion have been identified. The hemagglutinin-neuraminidase (HN) glycoprotein is also involved in virus entry and release from the host cells. The matrix (M) protein plays an important role in virus assembly and budding. The hydrophobic (SH) protein is a 44-residue hydrophobic integral membrane protein and is oriented in membranes with its N terminus in the cytoplasm. For reviews of the molecular biology of paramyxoviruses see, for example, Whelan et al., 2004, Curr Top Microbiol Immunol; 283:61-119; and Lamb & Parks, (2006). Paramyxoviridae: the viruses and their replication. In Fields Virology, 5th edn, pp. 1449-1496. Edited by D. M. Knipe & P. M. Howley. Philadelphia, PA: Lippincott Williams & Wilkins.
Because PIV5 actively replicates in the respiratory tract following intranasal immunization, PIV5-vectored vaccines can generate mucosal immunity that includes antigen-specific IgA antibodies and long-lived IgA plasma cells (Wang, D., et al., J Virol, 91(11) (2017). Xiao, P., et al., Front Immunol, 12:623996 (2021)). Recently a PIV5-vectored vaccine expressing the spike protein from SARS-CoV-2 Wuhan (WA1; CVXGA1) has been shown to be efficacious in mice and ferrets. A single, intranasal dose of CVXGA1 induced WA1-neutralizing antibodies and protected K18-hACE2 mice against lethal infection with SARS-CoV-2 WA1. Furthermore, a single, intranasal dose of CVXGA1 protected ferrets from infection with SARS-CoV-2 WA1 and blocked transmission to cohoused naïve ferrets (An, D., et al., Sci Adv, 7(27) (2021)). While these studies determined its efficacy against SARS-CoV-2 WA1, further studies were necessary to establish its efficacy against SARS-CoV-2 variants.
A PIV5 viral vaccine of the present invention may also have a mutation, alteration, or deletion in one or more of these eight proteins of the PIV5 genome. For example, a PIV5 viral expression vector may include one or more mutations, including, but not limited to any of those described herein. In some aspects, a combination of two or more (two, three, four, five, six, seven, or more) mutations may be advantageous and may demonstrated enhanced activity.
In one embodiment, the PIV5 vector was further modified by introducing the mutations in the PIV5 V/P gene and by deletion of the PIV5 SH gene, further enhancing vaccine efficiency. S157F and S308A in the PIV5 V/P genes have been shown previously to increase viral polymerase activities and improve viral titer or yield (Timani K A, Sun D, Sun M, et al. J Virol., 82(18):9123-9133 (2008); Sun D, Luthra P, Li Z, He B., PLoS Pathog., 5(7):e1000525 (2009)). PIV5 W3A strain-based RSV vaccine with a single S157F mutation was shown to induce higher levels of neutralizing antibodies than PIV5 CPI-vectored RSV vaccine in cotton rats (See table 19). PIV5 W3A strain lacking the SH gene and expressing influenza virus H5 HA protein induced higher levels of antibodies and provided better protection against influenza virus challenge (Li Z, Gabbard J D, Mooney A, et al., J Virol., 87(17): 9604-9609 (2013)). In one embodiment, a newly generated modified PIV5 viral vector backbone is presented herein and named as CVB through introducing S157F into the V/P gene, and deleting the SH gene from the PIV5 W3A viral genome. In another embodiment, CVB-vectored SARS-CoV-2 vaccines for intranasal immunization were generated.
A mutation includes, but is not limited to, a mutation of the V/P gene, a mutation of the shared N-terminus of the V and P proteins, a mutation of residues 26, 32, 33, 50, 102, 156, and/or 157 of the shared N-terminus of the V and P proteins, a mutation lacking the C-terminus of the V protein, a mutation lacking the small hydrophobic (SH) protein, a mutation of the fusion (F) protein, a mutation of the phosphoprotein (P), a mutation of the large RNA polymerase (L) protein, a mutation incorporating residues from canine parainfluenza virus, and/or a mutation that enhances syncytial formation.
A mutation may include, but is not limited to, rPIV5-V/P-CPI−, rPIV5-CPI−, rPIV5-CPI+, rPIV5V ΔC, rPIV-Rev, rPIV5-RL, rPIV5-P-S156N, rPIV5-P-S157A, rPIV5-P-S308A, rPIV5-L-A1981D and rPIV5-F-S443P, rPIV5-MDA7, rPIV5 ΔSH-CPI−, rPIV5 ΔSH-Rev, and combinations thereof.
PIV5 can infect cells productively with little cytopathic effect (CPE) in many cell types. In some cell types, PIV5 infection causes formation of syncytia, i.e., fusion of many cells together, leading to cell death. A mutation may include one or more mutations that promote syncytia formation (see, for example Paterson et al., 2000, Virology; 270:17-30).
The V protein of PIV5 plays a critical role in blocking apoptosis induced by virus. Recombinant PIV5 lacking the conserved cysteine-rich C-terminus (rPIV5V AC) of the V protein induces apoptosis in a variety of cells through an intrinsic apoptotic pathway, likely initiated through endoplasmic reticulum (ER)-stress (Sun et al., 2004, J Virol; 78:5068-5078). Mutant recombinant PIV5 with mutations in the N-terminus of the V/P gene products, such as rPIV5-CPI−, also induce apoptosis (Wansley and Parks, 2002, J Virol; 76:10109-10121). A mutation includes, but is not limited to, rPIV5 ΔSH, rPIV5-CPI−, rPIV5 VΔC, and combinations thereof.
i. CVB-Based Vaccine Vectors Encoding the SARS-CoV-2 Spike (S) Protein
With the CVB-based vaccine vectors of the present invention, a heterologous nucleotide sequence encoding the spike (S) protein of a coronavirus, including, but not limited to, the S protein of SARS-CoV-2, is inserted in the CVB genome. Coronavirus entry into host cells is mediated by the transmembrane S glycoprotein (Tortorici and Veesler, 2019, Adv Virus Res; 105:93-116). As the coronavirus S glycoprotein is surface-exposed and mediates entry into host cells, it is the main target of neutralizing antibodies upon infection and the focus of therapeutic and vaccine design. The spike S protein of SARS-CoV-2 is composed of two subunits, S1 and S2. The S1 subunit contains a receptor-binding domain that recognizes and binds to the host receptor angiotensin-converting enzyme 2, while the S2 subunit mediates viral cell membrane fusion by forming a six-helical bundle via the two-heptad repeat domain. (Huang et al., 2020, Acta Pharmacol Sinica; 0:1-9 (available on the worldwide web at doi.org/10.1038/s41401-020-0485-4).
The total length of SARS-CoV-2 S is 1273 amino acids (aa) and consists of a signal peptide (amino acids 1-13) located at the N-terminus, the Sl subunit (14-685 residues), and the S2 subunit (686-1273 residues); the last two regions are responsible for receptor binding and membrane fusion, respectively. In the S1 subunit, there is an N-terminal domain (14-305 residues) and a receptor-binding domain (RBD, 319-541 residues); the fusion peptide (FP) (788-806 residues), heptapeptide repeat sequence 1 (HR1) (912-984 residues), HR2 (1163-1213 residues), TM domain (1213-1237 residues), and cytoplasm domain (1237-1273 residues) comprise the S2 subunit (Xia et al., 2020, Cell Mol Immunol; 17:765-7).
In some CVB-based vaccine vectors of the present invention, the heterologous nucleotide sequence encoding the spike (S) protein of a coronavirus, including, but not limited to, the S protein of SARS-CoV-2, has been modified so that the cytoplasmic tail of the coronavirus S protein has been replaced with the cytoplasmic tail of the fusion (F) protein of PIV5.
In some CVB-based vaccine vectors of the present invention, the heterologous nucleotide sequence encoding the coronavirus S protein, including but not limited to, the S protein of SARS-CoV-2, has been modified so that the S protein includes an amino acid substitution at amino acid residue W886 and/or F888. In some aspects, the amino acid substitution at amino acid residue W886 includes a substitution of tryptophan (W) to arginine (R) and/or the amino acid substitution at amino acid residue W888 includes a substitution of phenylalanine (F) to arginine (R).
In some CVB-based vaccine vectors of the present invention, the heterologous nucleotide sequence encoding the spike (S) protein of a coronavirus, including, but not limited to, the S protein of SARS-CoV-2, includes both a modification so that the cytoplasmic tail of the coronavirus S protein has been replaced with the cytoplasmic tail of the fusion (F) protein of PIV5 and includes an amino acid substitution at amino acid residue W886 and/or F888. In some aspects, the amino acid substitution at amino acid residue W886 includes a substitution of tryptophan (W) to arginine (R) and/or the amino acid substitution at amino acid residue W888 includes a substitution of phenylalanine (F) to arginine (R).
The heterologous nucleotide sequence encoding the coronavirus S protein, including but not limited to the S protein of SARS-CoV-2, may be inserted in any of a variety of locations in the CVB genome.
CVB vaccine vectors encoding SARS-COV-2 variants of concern or variants of interest are disclosed herein. The CVB-based vaccine vectors may comprise inserting the SARS-CoV-2 spike (S) or the nucleocapsid (N) gene from different variants into CVB vector.
The CVB-based vaccine vectors of the present invention, have a CVB viral expression vector comprising mutations at amino acid residue S156 or S157 and a deletion of the small hydrophobic (SH) gene of the PIV5 W3A viral genome.
In some CVB-based vaccine vectors of the present invention, the mutation at amino acid residue S157 comprises the substitution of serine (S) with an amino acid residue selected from a group consisting of alanine (A), cysteine (C), aspartic acid (D), glutamic acid (E), phenylalanine (F), glycine (G), histidine (H), isoleucine (I), lysine (K), leucine (L), methionine (M), asparagine (N), proline (P), glutamine (Q), arginine (R), selenocysteine (U), valine (V), tryptophan (W), tyrosine (Y).
In some CVB-based vaccine vectors of the present invention, the amino acid substitution at amino acid residue S157 comprises a substitution of serine (S) to phenylalanine (F) or S156N comprises a substitution of serine (S) to asparagine (N).
In some CVB-based vaccine vectors of the present invention, the SH gene has a deletion of the SH open reading frame or a deletion of an entire SH gene transcript unit.
In some CVB-based vaccine vectors of the present invention, the PIV5 genome has a heterologous nucleic acid sequence with at least 98% sequence identity to SEQ ID NOs: 27, 28, 29, 30, 31, 32, or 33 and wherein the viral expression vector expresses a heterologous polypeptide comprising a coronavirus spike (S) and/or nucleocapsid (N) proteins.
In some CVB-based vaccine vectors of the present invention, the coronavirus S protein is a coronavirus S protein of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), a variant of interest or a variant of concern of SARS-CoV-2 and the coronavirus N protein is the coronavirus N protein of SARS-CoV-2, a variant of interest or a variant of concern of SARS-CoV-2.
In another embodiment, the coronavirus S protein is the coronavirus S protein of a SARS-CoV-2 Wuhan strain, a SARS-CoV-2 beta variant, a SARS-CoV-2 gamma variant, a SARS-CoV-2 delta variant, or a SARS-CoV-2 omicron variant and the coronavirus N protein is the coronavirus N protein of a SARS-CoV-2 Wuhan strain, a SARS-CoV-2 beta variant, a SARS-CoV-2 gamma variant, a SARS-CoV-2 delta variant, or a SARS-CoV-2 omicron variant.
In some CVB-based vaccine vectors of the present invention, the coronavirus S protein comprises the coronavirus S protein of SARS-CoV-2 and wherein the cytoplasmic tail of the coronavirus S protein has been replaced with the cytoplasmic tail of the fusion (F) protein of CVB.
In some CVB-based vaccine vectors of the present invention, the PIV5 W3A viral genome comprises open reading frame deletion mutations of the SH gene and the S gene of SARS-CoV-2 Wuhan strain is inserted between the PIV5 hemagglutinin (HN) and polymerase (L) genes of PIV5.
In some CVB-based vaccine vectors of the present invention, the entire SH gene transcript unit of PIV5 W3A viral genome is deleted and the S gene of the SARS-CoV-2 Wuhan strain is placed between the HN and L genes of PIV5.
In some CVB-based vaccine vectors of the present invention, the N gene of SARS-CoV-2 Wuhan strain is inserted to replace the SH gene of PIV5, and the S gene of SARS-CoV-2 Wuhan strain is inserted between the HN and L genes of PIV5.
In some CVB-based vaccine vectors of the present invention, the S gene of SARS-CoV-2 Omicron BA.1 variant is inserted to replace the S gene of SARS-CoV-2 Wuhan strain and the N gene of SARS-CoV-2 Wuhan strain is inserted in the place of SH gene of PIV5.
In some CVB-based vaccine vectors of the present invention, the S gene of SARS-CoV-2 Omicron BA.5 variant is inserted between the HN and L genes of PIV5 to replace the S gene of Wuhan strain.
In some CVB-based vaccine vectors of the present invention, the S gene of SARS-CoV-2 Omicron BA.5 variant is inserted to replace the S gene of Wuhan strain and the N gene of SARS-CoV-2 Wuhan strain is inserted to replace the SH gene of PIV5.
In some CVB-based vaccine vectors of the present invention, the PIV5 F and HN genes are deleted and wherein the S gene of SARS-CoV-2 Wuhan strain is between HN and L genes of PIV5.
Also included in the present invention are virions and infectious viral particles that include a PIV5 genome including a heterologous nucleotide sequence encoding a coronavirus S protein, including but not limited to the S protein of SARS-CoV-2.
Also included in the present invention are compositions including one or more of the PIV5 viral constructs or virions, as described herein. Such a composition may include a pharmaceutically acceptable carrier. As used, a pharmaceutically acceptable carrier refers to one or more compatible solid or liquid fillers, diluents or encapsulating substances which are suitable for administration to a human or other vertebrate animal. Such a carrier may be pyrogen free. The present invention also includes methods of making and using the viral vectors and compositions described herein.
The compositions of the present disclosure may be formulated in pharmaceutical preparations in a variety of forms adapted to the chosen route of administration. One of skill will understand that the composition will vary depending on mode of administration and dosage unit.
The agents of this invention can be administered in a variety of ways, including, but not limited to, intravenous, topical, oral, intranasal, subcutaneous, intraperitoneal, intramuscular, and intratumor deliver. In some aspects, the agents of the present invention may be formulated for controlled or sustained release. One advantage of intranasal immunization is the potential to induce a mucosal immune response.
The CVB-vectored SARS-CoV-2 vaccine virus sequences from the constructs in Table 1 are listed below. The inserted N of SARS-CoV-2 sequences are in the underlined lowercase, M sequences are italicized lowercase, E sequences are bolded lowercase and S is in the lowercase:
i. CVL104
The nucleic acid sequence for CVL104 is:
ii. CVL87
The nucleic acid sequence for CVL87 is:
iii. CVL85
The nucleic acid sequence for CVL85 is:
ggaccacagaaccagaggaacgcacccaggattactttcggagga
ccaagcgatagcaccgggagcaaccagaatggagagcggagcgga
gcaagatccaagcagagacggccccagggcctgccaaacaatacc
gcatcctggttcaccgccctgacacagcacggcaaggaggacctg
aagtttccaaggggacagggagtgcctatcaacaccaatagctcc
cctgacgatcagatcggctactataggagggcaacaaggagaatc
aggggaggcgacggcaagatgaaggatctgagcccacgctggtac
ttctactatctgggaaccggacctgaggcaggcctgccatatggc
gccaacaaggacggaatcatctgggtggcaaccgagggcgccctg
aacacaccaaaggatcacatcggcacaagaaatcccgccaacaat
gcagcaatcgtgctgcagctgccacagggaaccacactgcccaag
ggcttttacgcagagggctctcggggaggcagccaggcatctagc
agatcctctagccggagcagaaactcctctaggaattccacccca
ggaagctccaggggcacatcccctgcccgcatggcaggaaacgga
ggcgacgccgccctggccctgctgctgctggatcgcctgaatcag
ctggagtccaagatgtctggcaagggacagcagcagcagggacag
accgtgacaaagaagtccgccgccgaggcctctaagaagccaagg
cagaagcgcaccgccacaaaggcctacaacgtgacccaggccttc
ggcaggcgcggaccagagcagacacagggcaattttggcgaccag
gagctgatcaggcagggaaccgattataagcactggcctcagatc
gcccagttogccccatctgccagcgccttctttggcatgtctaga
atcggcatggaggtgacccccagcggcacatggctgacctacaca
ggcgccatcaagctggacgataaggaccctaacttcaaggatcag
gtcatcctgctgaacaagcacatcgacgcctataagacctttccc
cctacagagcccaagaaggacaagaagaagaaggccgatgagaca
caggccctgcctcagaggcagaagaagcagcagaccgtgacactg
ctgccagccgccgatctggacgatttctccaaacagctgcagcag
agcatgtccagtgccgactccacccaggcttgaCGTACGACCTGC
iv. CVL83
The nucleic acid sequence for CVL83 is:
aagcgatagcaccgggagcaaccagaatggagagcggagcggagcaagatccaagcagagacggccccagggcct
gccaaacaataccgcatcctggttcaccgccctgacacagcacggcaaggaggacctgaagtttccaaggggacaggg
agtgcctatcaacaccaatagctcccctgacgatcagatcggctactataggagggcaacaaggagaatcaggggaggc
gacggcaagatgaaggatctgagcccacgctggtacttctactatctgggaaccggacctgaggcaggcctgccatatgg
cgccaacaaggacggaatcatctgggtggcaaccgagggcgccctgaacacaccaaaggatcacatcggcacaagaa
atcccgccaacaatgcagcaatcgtgctgcagctgccacagggaaccacactgcccaagggcttttacgcagagggctct
cggggaggcagccaggcatctagcagatcctctagccggagcagaaactcctctaggaattccaccccaggaagctcca
ggggcacatcccctgcccgcatggcaggaaacggaggcgacgccgccctggccctgctgctgctggatcgcctgaatc
agctggagtccaagatgtctggcaagggacagcagcagcagggacagaccgtgacaaagaagtccgccgccgaggcc
tctaagaagccaaggcagaagcgcaccgccacaaaggcctacaacgtgacccaggccttcggcaggcgcggaccaga
gcagacacagggcaattttggcgaccaggagctgatcaggcagggaaccgattataagcactggcctcagatcgcccag
ttcgccccatctgccagcgccttctttggcatgtctagaatcggcatggaggtgacccccagcggcacatggctgacctaca
caggcgccatcaagctggacgataaggaccctaacttcaaggatcaggtcatcctgctgaacaagcacatcgacgcctat
aagacctttccccctacagagcccaagaaggacaagaagaagaaggccgatgagacacaggccctgcctcagaggca
gaagaagcagcagaccgtgacactgctgccagccgccgatctggacgatttctccaaacagctgcagcagagcatgtcc
agtgccgactccacccaggcttgaCGTACGACCTGCTATAGGCTATCCACTGCATCATCT
v. CVL109
The nucleic acid sequence for CVL109 is:
aagcgatagcaccgggagcaaccagaatggagagcggagcggagcaagatccaagcagagacggccccagggcct
gccaaacaataccgcatcctggttcaccgccctgacacagcacggcaaggaggacctgaagtttccaaggggacaggg
agtgcctatcaacaccaatagctcccctgacgatcagatcggctactataggagggcaacaaggagaatcaggggaggc
gacggcaagatgaaggatctgagcccacgctggtacttctactatctgggaaccggacctgaggcaggcctgccatatgg
cgccaacaaggacggaatcatctgggtggcaaccgagggcgccctgaacacaccaaaggatcacatcggcacaagaa
atcccgccaacaatgcagcaatcgtgctgcagctgccacagggaaccacactgcccaagggcttttacgcagagggctct
cggggaggcagccaggcatctagcagatcctctagccggagcagaaactcctctaggaattccaccccaggaagctcca
ggggcacatcccctgcccgcatggcaggaaacggaggcgacgccgccctggccctgctgctgctggatcgcctgaatc
agctggagtccaagatgtctggcaagggacagcagcagcagggacagaccgtgacaaagaagtccgccgccgaggcc
tctaagaagccaaggcagaagcgcaccgccacaaaggcctacaacgtgacccaggccttcggcaggcgcggaccaga
gcagacacagggcaattttggcgaccaggagctgatcaggcagggaaccgattataagcactggcctcagatcgcccag
ttcgccccatctgccagcgccttctttggcatgtctagaatcggcatggaggtgacccccagcggcacatggctgacctaca
caggcgccatcaagctggacgataaggaccctaacttcaaggatcaggtcatcctgctgaacaagcacatcgacgcctat
aagacctttccccctacagagcccaagaaggacaagaagaagaaggccgatgagacacaggccctgcctcagaggca
gaagaagcagcagaccgtgacactgctgccagccgccgatctggacgatttctccaaacagctgcagcagagcatgtcc
agtgccgactccacccaggcttgaCGTACGACCTGCTATAGGCTATCCACTGCATCATCT
vi. CVL110
The nucleic acid sequence for CVL110 is:
vii. CVL112
The nucleic acid sequence for CVL112 is:
viii. CVL119
The nucleic acid sequence for CVL119 is:
ix. CVL120
The nucleic acid sequence for CVL120 is
aacggcaccatcaccgtggaagagcttaaaaagctgctcgagcag
tggaacctggttatcggctttctgttcctgacctggatctgcctg
ctccagttcgcttatgccaaccggaacaggttcctgtacatcatc
aagctgatcttcctgtggctgctgtggcctgtgacactggcctgc
ttcgtgctggccgctgtgtaccggattaactggatcaccggcgga
atcgccatcgccatggcctgtctggtcggcctgatgtggctgtct
tacttcatcgccagcttcagactgtttgccagaaccagaagcatg
tggtccttcaaccccgagacaaacatcctgctgaatgtgccactg
cacggcaccatcctgacaagacctctgctggaaagcgagctggtg
attggagccgtgatcctgagaggccatctgcggatcgctggccac
cacctgggaagatgcgacatcaaggacctgcctaaggaaatcaca
gtggctacatctcggaccctgagctactacaaactgggcgcctct
caaagagtggccggcgacagcggcttcgccgcctacagcagatac
agaatcggcaactacaagctgaataccgatcacagcagctccagc
gacaacatcgccctgctggtgcagtgaTGACGTACGACCTGCTAT
x. CVL121
The nucleic acid sequence for CVL121 is:
aacggcaccatcaccgtggaagagcttaaaaagctgctcgagcag
tggaacctggttatcggctttctgttcctgacctggatctgcctg
ctccagttcgcttatgccaaccggaacaggttcctgtacatcatc
aagctgatcttcctgtggctgctgtggcctgtgacactggcctgc
ttcgtgctggccgctgtgtaccggattaactggatcaccggcgga
atcgccatcgccatggcctgtctggtcggcctgatgtggctgtct
tacttcatcgccagcttcagactgtttgccagaaccagaagcatg
tggtccttcaaccccgagacaaacatcctgctgaatgtgccactg
cacggcaccatcctgacaagacctctgctggaaagcgagctggtg
attggagccgtgatcctgagaggccatctgcggatcgctggccac
cacctgggaagatgcgacatcaaggacctgcctaaggaaatcaca
gtggctacatctcggaccctgagctactacaaactgggcgcctct
caaagagtggccggcgacageggcttcgccgcctacagcagatac
agaatcggcaactacaagctgaataccgatcacagcagctccagc
ggcaccctgatcgttaatagcgtgctgctgtttctggccttcgtg
gtgttcctgctggtgaccctggctatcctgaccgccctgagactg
tgtgcctactgctgcaacatcgtgaacgtgtccctggtcaagcct
agcttctacgtgtacagccgggtgaagaacctgaacagcagcaga
gtgcccgacctgctcgtgtaaGCTAGCACCTGCTATAGGCTATCC
xi. CVL128
The nucleic acid sequence for CVL128 is:
cgtggaagagcttaaaaagctgctcgagcagtggaacctggttatcg
gctttctgttcctgacctggatctgcctgctccagttcgcttatgcc
aaccggaacaggttcctgtacatcatcaagctgatcttcctgtggct
gctgtggcctgtgacactggcctgcttcgtgctggccgctgtgtacc
ggattaactggatcaccggcggaatcgccatcgccatggcctgtctg
gtcggcctgatgtggctgtcttacttcatcgccagcttcagactgtt
tgccagaaccagaagcatgtggtccttcaaccccgagacaaacatcc
tgctgaatgtgccactgcacggcaccatcctgacaagacctctgctg
gaaagcgagctggtgattggagccgtgatcctgagaggccatctgcg
gatcgctggccaccacctgggaagatgcgacatcaaggacctgccta
aggaaatcacagtggctacatctcggaccctgagctactacaaactg
ggcgcctctcaaagagtggccggcgacagcggcttcgccgcctacag
cagatacagaatcggcaactacaagctgaataccgatcacagcagct
ccagcgacaacatcgccctgctggtgcagtgaTGACGTACGAGAAAC
gcacccaggattactttcggaggaccaagcgatagcaccgggagcaa
ccagaatggagagcggagcggagcaagatccaagcagagacggcccc
agggcctgccaaacaataccgcatcctggttcaccgccctgacacag
cacggcaaggaggacctgaagtttccaaggggacagggagtgcctat
caacaccaatagctcccctgacgatcagatcggctactataggaggg
caacaaggagaatcaggggaggcgacggcaagatgaaggatctgagc
ccacgctggtacttctactatctgggaaccggacctgaggcaggcct
gccatatggcgccaacaaggacggaatcatctgggtggcaaccgagg
ggccctgaacacaccaaaggatcacatcggcacaagaaatcccgcca
acaatgcagcaatcgtgctgcagctgccacagggaaccacactgccc
aagggcttttacgcagagggctctcggggaggcagccaggcatctag
cagatcctctagccggagcagaaactcctctaggaattccaccccag
gaagctccaggggcacatcccctgcccgcatggcaggaaacggaggc
gacgccgccctggccctgctgctgctggatcgcctgaatcagctgga
gtccaagatgtctggcaagggacagcagcagcagggacagaccgtga
caaagaagtccgccgccgaggcctctaagaagccaaggcagaagcgc
accgccacaaaggcctacaacgtgacccaggccttcggcaggcgcgg
accagagcagacacagggcaattttggcgaccaggagctgatcaggc
agggaaccgattataagcactggcctcagatcgcccagttcgcccca
tctgccagcgccttctttggcatgtctagaatcggcatggaggtgac
ccccagcggcacatggctgacctacacaggcgccatcaagctggacg
ataaggaccctaacttcaaggatcaggtcatcctgctgaacaagcac
atcgacgcctataagacctttccccctacagagcccaagaaggacaa
gaagaagaaggccgatgagacacaggccctgcctcagaggcagaaga
agcagcagaccgtgacactgctgccagccgccgatctggacgatttc
tccaaacagctgcagcagagcatgtccagtgccgactccacccaggc
ttgaCGTACGGATCCCAATCTTAAATCGACACACCTAATTGACCAGT
ctgaagagacaggcaccctgatcgttaatagcgtgctgctgtttctg
gccttcgtggtgttcctgctggtgaccctggctatcctgaccgccct
gagactgtgtgcctactgctgcaacatcgtgaacgtgtccctggtca
agcctagcttctacgtgtacagccgggtgaagaacctgaacagcagc
agagtgcccgacctgctcgtgtaaGCTAGCACCTGCTATAGGCTATC
Also included in the present invention are methods of making and using CVB viral expression vectors, including, but not limited to any of those described herein.
For example, the present invention includes methods of expressing a coronavirus S protein, including but not limited to the S protein of SARS-CoV-2, in a cell by infecting the cell with a CVB viral expression vector, viral particle, or composition as described herein.
The present invention includes methods of inducing an immune response in a subject to a coronavirus S protein, including but not limited to the S protein of SARS-CoV-2, by administering a viral expression vector, viral particle, or composition as described herein to the subject. The immune response may include a humoral immune response and/or a cellular immune response. The immune response may enhance an innate and/or adaptive immune response.
The present invention includes methods expressing a heterologous coronavirus S protein, including but not limited to the S protein of SARS-CoV-2, in a subject by administering a viral expression vector, viral particle, or composition as described herein to the subject.
The present invention includes methods expressing a heterologous coronavirus S protein, including but not limited to the S protein of SARS-CoV-2 alpha, gamma, delta, and omicron strains, in a subject by administering a viral expression vector, viral particle, or composition as described herein to the subject.
The disclosure can be used in gene therapy and/or therapeutic approaches for the treatment of disease which involve the increase or decrease of a nucleotide sequence of interest in a host-cell. In these embodiments, the expressible heterologous nucleotide sequence may be derived from a mammalian genome. It may be particularly useful in some embodiments to have the expressible heterologous nucleotide sequence derived from a human genome, wherein expression of the wild-type RNA and/or protein can produce therapeutic effects in a patient. For example, the expressible heterologous nucleotide sequence can encode CFTR, NeuroD1, Cas9 and Guide RNAs, or any other such sequence. In other embodiments, the heterologous nucleotide sequence encodes a secreted protein.
In other embodiments, the expressible heterologous nucleotide sequence responds to positive selection stimuli. In other embodiments, the expressible heterologous nucleotide sequence also responds to negative selection stimuli. In further embodiments, it may be useful for the polynucleotide sequences to further comprise a reporter gene. For example, the report gene can be a luciferase or green fluorescent protein.
In some embodiments, CVB expresses one or more nucleotide sequences (e.g., siRNAs) that modify the translation and/or transcription of a host-cell nucleotide sequence of interest within a host cell. In some embodiments, transcription and/or translation of the expressible heterologous nucleotide sequence is modified so that its nucleotide sequence is codon degenerated with respect to the endogenous gene in a cell. Additionally, the expressible heterologous nucleotide sequence can be modified so that it co-expresses inhibitory or silencing sequences capable of inhibiting or silencing a host-cell nucleotide sequence of interest within a host cell.
In certain embodiments of the disclosure, CVB compositions can be utilized to prepare antigenic preparations that be used as vaccines. Any suitable antigen(s) can be prepared in accordance with the disclosure, including antigens obtained from prions, viruses, mycobacterium, protozoa (e.g., Plasmodium falciparum (malaria)), trypanosomes, bacteria (e.g., Streptococcus, Neisseria, etc.), etc.
Host cells can be transfected with single CVB particles containing one or more heterologous polynucleotide sequences, or with a plurality of CVB particles, where each comprises the same or different heterologous polynucleotide sequence(s). For example, a multi-subunit antigen (including intracellular and cell-surface multi-subunit components) can be prepared by expressing the individual subunits on separate vectors, but infecting the same host cell with all the vectors, such that assembly occurs within the host cell.
Vaccines often contain a plurality of antigen components, e.g., derived from different proteins, and/or from different epitopic regions of the same protein. For example, a vaccine against a viral disease can comprise one or more polypeptide sequences obtained from the virus which, when administered to a host, elicit an immunogenic or protective response to viral challenge.
As mentioned, the disclosure can also be utilized to prepare polypeptide multimers, e.g., where an antigenic preparation is produced which is comprised of more than one polypeptide. For instance, virus capsids can be made up of more than one polypeptide subunit. By transducing a host cell with vectors carrying different viral envelope sequences, the proteins, when expressed in the cell, can self-assemble into three-dimensional structures containing more than one protein subunit (e.g., in their native configuration).
In further embodiments, the expressible heterologous nucleotide sequence is derived from another virus, other than PIV5. For example, the heterologous nucleotide sequence may encode (from any strain) influenza HA, RSV F, HIV Gag and/or Env, etc. Such embodiments can be useful for developing vaccines and/or methods of vaccination. The examples given here are non-limiting, as it will be understood by those in the art that nucleotide sequences from a variety of pathogenic agents (including also bacteria, parasites, etc.) may be desirable to use for an CVB vaccine composition and/or method of vaccination.
Examples of viruses to which vaccines can be produced in accordance with the disclosure include, e.g., coronaviruses, orthomyxoviruses, influenza virus A (including all strains varying in their HA and NA proteins, such as (non-limiting examples) H1N1, H1N2, H2N2, H3N2, H5N1, H6N1, H7N7, H7N9, and H3N8 etc); influenza B, influenza C, thogoto virus (including Dhori, Batken virus, SiAR 126 virus), and isavirus (e.g., infectious salmon anemia virus) and the like. These include coronaviruses isolated or transmitted from all species types, including isolates from invertebrates, vertebrates, mammals, humans, non-human primates, monkeys, pigs, cows, and other livestock, birds, domestic poultry such as turkeys, chickens, quail, and ducks, wild birds (including aquatic and terrestrial birds), reptiles, etc. These also include existing strains which have changed, e.g., through mutation, antigenic drift, antigenic shift, recombination, etc., especially strains which have increased virulence and/or interspecies transmission (e.g., human-to-human).
The present invention includes methods of vaccinating a subject by administering a viral expression vector, viral particle, or composition as described herein to the subject.
The disclosure provides vaccines against all coronaviruses, including existing subtypes, derivatives thereof, and recombinants thereof, such as subtypes and recombinants which have the ability to spread from human-to-human. Various isolates have been characterized, especially for SARS-COV-2.
The disclosure also provides methods for producing CVB compositions. Examples of host cells which can be utilized to produce CVB compositions, include, any mammalian or human cell line or primary cell. Non-limiting examples include, e.g., 293, HT1080, Jurkat, and SupTI cells. Other examples are CHO, 293, Hela, Vero, L929, BHK, NIH 3T3, MRC-5, BAE-1, HEP-G2, NSO, U937, Namalwa, HL60, WEHI 231, YAC 1, U 266B1, SH-SY5Y, CHO, e.g., CHO-K1 (CCL-61), 293 (e.g., CRL-1573). Cells are cultured under conditions effective to produce transfection and expression. Such conditions include, e.g., the particular milieu needed to achieve protein production. Such a milieu, includes, e.g., appropriate buffers, oxidizing agents, reducing agents, pH, co-factors, temperature, ion concentrations, suitable age and/or stage of cell (such as, in particular part of the cell cycle, or at a particular stage where particular genes are being expressed) where cells are being used, culture conditions (including cell media, substrates, oxygen, carbon dioxide, glucose and other sugar substrates, serum, growth factors, etc.).
The disclosure also provides various treatment methods involving delivering CVB to host cells in vivo. In some embodiments, CVB is delivered into a subject for treating or preventing coronaviruses. In other embodiments, CVB is delivered into a subject for treating or preventing SARS-COV-2 alpha, delta, omicron strains, or variants thereof or eliciting an immune response to SARS-COV-2 in a subject.
It is contemplated that when used to treat various diseases, the compositions and methods of the disclosure can be combined with other therapeutic agents suitable for the same or similar diseases. Also, two or more embodiments of the disclosure may be also co-administered to generate additive or synergistic effects. When co-administered with a second therapeutic agent, the embodiment of the disclosure and the second therapeutic agent may be simultaneously or sequentially (in any order). Suitable therapeutically effective dosages for each agent may be lowered due to the additive action or synergy.
As a non-limiting example, the disclosure can be combined with other therapies that block inflammation through (e.g., via inhibition, reduction and/or blockage of IL1, INFα/β, IL6, TNF, L13, IL23, etc.). In some embodiments, CVB compositions and methods disclosed herein are useful to enhance the efficacy of vaccines directed to SARS-COV-2 infections. The compositions and methods of the disclosure can be administered to a subject either simultaneously with or before (e.g., 1-30 days before) a reagent (including but not limited to small molecules, antibodies, or cellular reagents) that acts to elicit an immune response (e.g., to treat cancer or an infection). The compositions and methods of the disclosure can be also administered in combination with an anti-tumor antibody or an antibody directed at a pathogenic antigen or allergen.
The pharmaceutical compositions of the invention can be readily employed in a variety of therapeutic or prophylactic applications, e.g., for treating SARS-COV-2 infection or eliciting an immune response to SARS-COV-2 in a subject. In various embodiments, the vaccine compositions can be used for treating or preventing infections caused by a pathogen from which the displayed immunogen polypeptide in the PIV5-based vaccine is derived. Thus, the vaccine compositions of the invention can be used in diverse clinical settings for treating or preventing infections caused by various viruses. As exemplification, a SARS-COV-2 CVB-based vaccine composition can be administered to a subject to induce an immune response to SARS-COV-2, e.g., to induce production of broadly neutralizing antibodies to the virus. For subjects at risk of developing an SARS-COV-2 infection, a vaccine composition of the invention can be administered to provide prophylactic protection against viral infection. Therapeutic and prophylactic applications of vaccines derived from the other immunogens described herein can be similarly performed. Depending on the specific subject and conditions, pharmaceutical compositions of the invention can be administered to subjects by a variety of administration modes known to the person of ordinary skill in the art, for example, topical, oral, intranasal, intramuscular, subcutaneous, intravenous, intra-arterial, intra-articular, intraperitoneal, or parenteral routes. In some aspects, administration is to a mucosal surface. A vaccine may be administered by mass administration techniques such as by placing the vaccine in drinking water or by spraying the animals' environment. When administered by injection, the immunogenic composition or vaccine may be administered parenterally. Parenteral administration includes, for example, administration by intravenous, subcutaneous, intramuscular, or intraperitoneal injection.
B. i. Administration by Inhalation
In one embodiment, the disclosed CVB vaccine compositions are formulated to allow intranasal administration. Intranasal compositions may comprise an inhalable dry powder pharmaceutical formulation comprising a therapeutic agent, wherein the therapeutic agent is present as a freebase or as a mixture of a salt and a freebase. Pharmaceutical formulations disclosed herein can be formulated as suitable for airway administration, for example, nasal, intranasal, sinusoidal, peroral, and/or pulmonary administration. Typically, formulations are produced such that they have an appropriate particle size for the route, or target, of airway administration. As such, the formulations disclosed herein can be produced so as to be of defined particle size distribution.
For example, the particle size distribution for a salt form of a therapeutic agent for intranasal administration can be between about 5 μm and about 350 μm. More particularly, the salt form of the therapeutic agent can have a particle size distribution for intranasal administration between about 5 to about 250 μm, about 10 μm to about 200 μm, about 15 μm to about 150 μm, about 20 μm to about 100 μm, about 38 μm to about 100 μm, about 53 μm to about 100, about 53 μm to about 150 μm, or about 20 μm to about 53 μm. The salt form of the therapeutic agent in the pharmaceutical compositions of the invention can a particle size distribution range for intranasal administration that is less than about 200 μm. In other embodiments, the salt form of the therapeutic agent in the pharmaceutical compositions has a particle size distribution that is less than about 150 μm, less than about 100 μm, less than about 53 μm, less than about 38 μm, less than about 20 μm, less than about 10 μm, or less than about 5 μm. The salt form of the therapeutic agent in the pharmaceutical compositions of the invention can have a particle size distribution range for intranasal administration that is greater than about 5 μm, greater than about 10 μm, greater than about 15 μm, greater than about 20 μm, greater than about 38 μm, less than about 53 μm, less than about 70 μm, greater than about 100 μm, or greater than about 150 μm.
Additionally, the salt form of the therapeutic agent in the pharmaceutical compositions of the invention can have a particle size distribution range for pulmonary administration between about 1 μm and about 10 μm. In other embodiments for pulmonary administration, particle size distribution range is between about 1 μm and about 5 μm, or about 2 μm and about 5 μm. In other embodiments, the salt form of the therapeutic agent has a mean particle size of at least 1 μm, at least 2 μm, at least 3 μm, at least 4 μm, at least 5 μm, at least 10 μm, at least 20 μm, at least 25 μm, at least 30 μm, at least 40 μm, at least 50 μm, at least 60 μm, at least 70 μm, at least 80 μm, at least 90 μm, or at least 100 μm.
In some embodiments the disclosed cannabinoid compositions include one or more cannabinoids or pharmaceutically acceptable derivatives or salts thereof, a propellant, an alcohol, and a glycol and/or glycol ether. The alcohol may be a monohydric alcohol or a polyhydric alcohol, and is preferably a monohydric alcohol. Monohydric alcohol has a lower viscosity than a glycol or glycol ether. Accordingly, the composition is able to form droplets of a smaller diameter in comparison to compositions in which the monohydric alcohol is not present. The present inventors have surprisingly found that a specific ratio of monohydric alcohol to glycol or glycol ether results in a composition with a desired combination of both long term stability (for example the composition remains as a single phase for at least a week at a temperature of 2-40° C.) and small droplet size.
ii. Pulmonary Compositions
One embodiment provides a formulation and method for treating SARS-COV-2 in the pulmonary system by inhalation or pulmonary administration. The diffusion characteristics of the particular drug formulation through the pulmonary tissues are chosen to obtain an efficacious concentration and an efficacious residence time in the tissue to be treated. Doses may be escalated or reduced or given more or less frequently to achieve selected blood levels. Additionally, the timing of administration of administration and amount of the formulation is preferably controlled to optimize the therapeutic effects of the administered formulation on the tissue to be treated and/or titrate to a specific blood level.
Diffusion through the pulmonary tissues can additionally be modified by various excipients that can be added to the formulation to slow or accelerate the absorption of drugs into the pulmonary tissues. For example, the drug may be combined with surfactants such as the phospholipids, dimyristoylphosphatidyl choline, and of administration dimyristoylphosphatidyl glycerol. The drugs may also be used in conjunction with bronchodilators that can relax the bronchial airways and allow easier entry of the antineoplastic drug to the lung. Albuterol is an example of the latter with many others known in the art. Further, the drug may be complexed with biocompatible polymers, micelle forming structures or cyclodextrins.
Particle size for the aerosolized drug used in the present examples was measured at about 1.0-5.0 μm with a GSD less than about 2.0 for deposition within the central and peripheral compartments of the lung. As noted elsewhere herein particle sizes are selected depending on the site of desired deposition of the drug particles within the respiratory tract.
Aerosols useful in the invention include aqueous vehicles such as water or saline with or without ethanol and may contain preservatives or antimicrobial agents such as benzalkonium chloride, paraben, and the like, and/or stabilizing agents such as polyethyleneglycol.
Powders useful in the invention include formulations of the neat drug or formulations of the drug combined with excipients or carriers such as mannitol, lactose, or other sugars. The powders used herein are effectively suspended in a carrier gas for administration. Alternatively, the powder may be dispersed in a chamber containing a gas or gas mixture which is then inhaled by the patient.
An agent of the present disclosure may be administered at once or may be divided into a number of multiple doses to be administered at intervals of time. For example, agents of the invention may be administered repeatedly, e.g., at least 2, 3, 4, 5, 6, 7, 8, or more times, or may be administered by continuous infusion. It is understood that the precise dosage and duration of treatment is a function of the disease being treated and may be determined empirically using known testing protocols or by extrapolation from in vivo or in vitro test data. It is to be noted that concentrations and dosage values may also vary with the severity of the condition to be alleviated. It is to be further understood that for any particular subject, specific dosage regimens should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions, and that any concentration ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed compositions and methods.
In some therapeutic embodiments, an “effective amount” of an agent is an amount that results in a reduction of at least one pathological parameter. Thus, for example, in some aspects of the present disclosure, an effective amount is an amount that is effective to achieve a reduction of at least about 10%, at least about 15%, at least about 20%, or at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95%, compared to the expected reduction in the parameter in an individual not treated with the agent.
In some aspects, any of the PIV5-based constructs and methods described in WO 2013/112690 and WO 2013/112720 (which is hereby incorporated by reference herein in its entirety) may be used in the present invention.
As used herein, the term “subject” represents an organism, including, for example, a mammal. A mammal includes, but is not limited to, a human, a non-human primate, and other non-human vertebrates. A subject may be an “individual,” “patient,” or “host.” Non-human vertebrates include livestock animals (such as, but not limited to, a cow, a horse, a goat, and a pig), a domestic pet or companion animal, such as, but not limited to, a dog or a cat, and laboratory animals. Non-human subjects also include non-human primates as well as rodents, such as, but not limited to, a rat or a mouse. Non-human subjects also include, without limitation, poultry, horses, cows, pigs, goats, dogs, cats, guinea pigs, hamsters, mink, and rabbits.
As used herein “in vitro” is in cell culture and “in vivo” is within the body of a subject. As used herein, “isolated” refers to material that has been either removed from its natural environment (e.g., the natural environment if it is naturally occurring), produced using recombinant techniques, or chemically or enzymatically synthesized, and thus is altered “by the hand of man” from its natural state.
The present disclosure provides for the administration of a booster CVB vaccine for use in such a method for inducing in a human subject an immune response, wherein said subject has previously received a primary vaccination against SARS-COV-2.
The method of booster vaccination according to the disclosure comprises the step of administering the vaccine composition to the subject.
The immune response induced by the vaccine composition of the disclosure or by the method of the disclosure is preferably a humoral response, especially a response comprising the production of neutralizing antibodies against the COVID-19 virus, i.e. a neutralizing antibody response.
Objective: To compare immunogenicity of CPI-RSV-F and W3AΔSH-RSV-F administered intranasally as a single dose in the African green monkey model.
Four monkeys in each dose group were immunized at Day 0 with 106 PFU intranasally of either CPI-RSV-F or W3AΔSH-RSV-F.
The antibody responses to RSV F-protein and PIV5 vector at Day 28 were determined by ELISA assays (plates coated with recombinant RSV F protein, source Sino Biologicals: 11049-V088 LC120C 2910, or PIV5 wild type virus) as shown in Table 4. In summary, all animals developed antibodies against the F protein expressed by the CPI or W3AΔSH with comparable RSV F ELISA titers between the two groups. Yet, W3AΔSH-RSV-F elicited higher PIV5 antibodies than CPI-RSV-F.
Cell Mediated Responses: RSV F protein-specific cellular responses were evaluated by intracellular cytokine staining (ICS) assay. Following immunization, blood was collected at days −1, 14, and 28 to quantify the RSV F protein-specific CD4 and CD8 cellular responses. INFγ, TNFα, MIP-1b, IL-13, and CD107a positive cells were quantitated (see
Both CPI-RSV-F and W3AΔSH-RSV-F elicited immune responses against RSV F protein. The antibody responses against RSV F protein elicited by either CPI-RSV-F or W3AΔSH-RSV-F were comparable following a single intranasal dose at 106 PFU. The CD4 and CD8 cellular responses elicited by CPI-RSV-F were slightly lower than W3AΔSH-RSV-F, but the difference was not statistically significant.
Objective: To evaluate the efficacy and safety of RSV F protein vaccine candidates based on the CPI strain or the W3A strain of PIV5 (CPI-RSV-F and W3AΔSH-RSV-F, respectively) in the cotton rat Sigmodon hispidus model of RSV A/A2 challenge.
Animals were first immunized with 100 μl of the PIV5-based vaccines containing 104, 105, or 106 PFU of virus intranasally and then challenged with 105 PFU RSV A/A2 four weeks later. The primary infection control group was mock-immunized with PBS and then infected with RSV A/A2. The secondary infection control group was infected with RSV A/A2 and re-infected seven weeks later. The vaccine-enhanced disease control group was immunized with FI-RSV (formalin inactivated RSV) twice by the i.m. route with an interval of four weeks and infected with RSV three weeks after the second immunization. See Table 5 for study groups.
Animals were sacrificed five days after RSV challenge for sample collection. RSV replication in the lung and nose, pulmonary histopathology, pulmonary cytokine and RSV NS1 mRNA expression, and the RSV serum neutralizing antibody (NA) and the anti-F protein binding antibody titers were measured. To confirm replication of the PIV5 vaccines in the respiratory tract of cotton rats, groups of 3 animals were inoculated with 106 PFU of CPI-RSV-F or control intranasally and sacrificed four days later.
Both candidate vaccine viruses replicated efficiently in the upper and lower respiratory track of cotton rats (Group K and L) (Table 6). W3AΔSH-RSV-F vaccine virus replicated to higher levels in the upper respiratory tract compared to CPI-RSV-F, but it replicated to lower levels in the lower respiratory tract compared to CPI-RSV-F.
Both CPI-RSV-F and W3AΔSH-RSV-F vaccines were highly efficacious at protecting RSV challenge virus replication in the lungs of cotton rats as indicated by the very low levels of viral titer in the lung tissues (
Both CPI-RSV-F and W3AΔSH-RSV-F vaccines induced strong neutralizing antibody (nAb) responses, with W3AΔSH-RSV-F at all three doses tested inducing higher titers of nAb compared to CPI-RSV-F administered at the highest dose (106 PFU). Lower doses (104 and 105 PFU) of CPI-RSV-F induced weaker nAb responses (
None of the vaccines induced the level of pulmonary histopathology or IL-4 mRNA expression that was seen in FI-RSV-immunized animals (positive control animals for enhanced disease), with the exception of one animal immunized with the intermediate dose (105 PFU) of W3AΔSH-RSV-F showing elevated interstitial inflammation and alveolitis (which coincided with elevated IL-4 levels in this animal). Levels of IFN-γ, Il-2 and IL-4 were low in both vaccine groups (Data not shown). No deaths were observed in the PIV5-vectored vaccine groups. A single animal in the FI-RSV (positive control) group died at Day 24.
Both PIV5 CPI and W3A based RSV vaccine constructs were effective in eliciting neutralizing RSV antibody responses and protecting lungs following RSV challenge infection following a single vaccination. Overall, the efficacy of W3AΔSH-RSV-F vaccine appeared to be higher than that of CPI-RSV-F in regard to nasal protection and neutralizing antibody response at all dose levels tested. There was no indication of enhanced lung pathology when compared to positive control group (RSV-FI group) except for one animal in the 105 PFU W3AΔSH-RSV-F group.
Rescue of the recombinant vector virus used in the production of CPI−, W3AΔSH-, CVB-based vaccines was performed. For the rescue of the recombinant virus, the antigenomic cDNA plasmid was transfected into serum-free 293T suspension cells (obtained from GenHunter Corporation) together with plasmids encoding the PIV5 NP, P, L proteins and T7 RNA Polymerase allowing for the rescue of recombinant virus from the transfected cell culture (
The supporting PIV5 plasmid clones encoding the nucleoprotein (N), phosphoprotein (P) or large polymerase protein (L) were described previously (1,2) each gene is under the T7 promoter in pCAGGS vector. The following 5 plasmids were used in the generation of research virus seed (RVS).
The medium used for virus rescue was CDM4HEK293 medium (Hyclone) with 4 mM GlutaMAX (Gibco).
Following two days of incubation, the 293T cells were co-cultured with serum-free Vero cells (P159) passaged from Vero MCB cells (obtained from CRL: African Green Monkey Kidney (WHO Vero 10-87) CyanVac MCB DOM:19aug.2020-P148). After 4 days of incubation, 2 mL of supernatant containing the rescued virus was obtained and mixed with 10×SPG and stored at −80° C.
Aliquots of the frozen stock with rescued virus were serially diluted to perform a plaque assay on serum-free Vero cells in 6-well plates, with the objective of obtaining several isolated single plaques. A 1000 μL pipette tip was used to poke a single plaque and re-suspend in VP-SFM media containing 4 mM GlutaMAX. The re-suspended plaque was then used to infect fresh serum-free Vero cells in a 6-well plate. After 6 days, the supernatant (2 mL) from the 6-well plate infected with single plaque was mixed with 10% 10×SPG and stored at −80° C. (to result in 1×SPG). Part of the supernatant (140 μL was used to do RNA extraction and RT-PCR to verify viral genomic sequence. The RT-PCR was done with the primers described in Table 7.
Step 3: Manufacture of pre-MVS on Serum Free Vero Cells
An aliquot from step 2 (plaque purified virus) was used to infect serum-free Vero cells in T75 flask, incubated at 37° C. for 5 days and the cell culture supernatants were centrifuged at 1,500 rpm for 10 minutes at 4° C. to remove cell debris. The clarified supernatants (20 mL) were mixed with 10% 1×SPG with 10% Arginine (Sigma Aldrich), fast frozen in 1 mL aliquots and stored at −80° C. as pre-MVS stock. The pre-MVS was sequenced from the NP gene through the L gene to confirm the viral genomic sequence and proper insertion of the RSV F protein or other antigen gene.
The pre-MVS prior to use in cGMP production of the MVS was tested at CRL for sterility (direct method), bacteriostasis and fungistasis, mycoplasma, mycobacteria, presence of porcine and bovine circoviruses, and in apparent viruses.
The production of the MVS was performed in adherence to cGMP.
Vaccine bulk substance manufacture: The Vero cells grown in T225 flasks in serum free media (VP-SFM) were infected with pre-MVS (using 2 vials) at MOI of 0.001 to 0.002 at 37° C. for 7 days. The cell culture fluid of infected cells constitutes the crude vaccine bulk substance (3.0 liter). Samples of the MVS crude bulk virus fluid were taken for testing of: Sterility (direct method), bacteriostasis and fungistasis, in vitro mycoplasma testing (agar cultivable and non-cultivable), tissue culture safety testing, in vitro mycobacterium testing, inapparent viruses, PBERT, potency.
The vaccine bulk substance was clarified by centrifugation at 1,500 rpm for 10 min at 2-8° C. resulting in 1.2 L followed by filtration through a 0.45 μM PES filter unit from ThermoFisher resulting in 1.2 L. The clarified and filtered vaccine bulk substance is immediately formulated with 10×SPG to stabilize the virus prior to fill. There is no hold of the vaccine bulk substance before formulation and fill.
During the virus production process, control harvest fluid was prepared using uninfected Vero cells fromthe same production lot. The control fluids were stored at −60° C. or below. The production control fluid was harvested and tested for the Bacteriostasis and Fungistasis Bulk Product (Direct Method), Sterility, Detection and Quantitation of Residual Vero DNA and Determination of Endotoxin Levels (LAL).
Vaccine drug product manufacture (formulation and fill) MVS: The filtered viruses were stabilized by formulation with 10% 10×SPG buffer and dispensed using a calibrated repeater pipette in 1 mL volumes into 2 mL cryovials to make the MVS stock/Vaccine Product. The dispensed MVS/Vaccine product was flash frozen in dry ice/methanol bath and stored at −60° C. or below.
MVS characterization: In addition, genetic identity was confirmed by sequencing of viral genomic cDNA from the NP gene through the L gene region to confirm identity.
The objective of the single and repeat dose GLP tox study conducted in cotton rats was to determine the potential toxicity of single or repeat dose of CPI-RSV-F when administered intranasally to male and female cotton rats.
The study was conducted in 48 cotton rats (24 male and 24 females). PIV5 vectored RSV vaccine viruses (CPI-RSV-F and CVB-RSV-F) at 107 PFU dose level were evaluated following a single dose (Day 1) or a repeat dose (Day 1 and Day 15) instilled by the intranasal route.
Test Article 1: CPI-RSV-F, 1×107.0 PFU/100 μL dose (50 μl each nostril) (8.0 log10 PFU/mL; lot number CPI-RSV-F-210519PQ10MVS) formulated in 1×SPG.
Test Article 2: Active comparator CVB-RSV-F; 1×107.1 PFU/100 μL dose (50 μl each nostril) (8.1 log 10 PFU/mL; lot number 211007CHD) formulated in 1×SPG.
Control: SPG 1×100 μL dose (50 μl each nostril)
On Study Day 1, Animals were dosed via intranasal instillation using a calibrated pipette. A fresh pipette tip was used for each animal. Prior to administration of test or control articles, rats were anesthetized via injection of 0.1 mL of a ketamine (25 mg/mL)/xylazine (10 mg/mL) mixture. The dosing groups are shown in Table 8.
Experimental endpoints consisted of moribundity/mortality and cage-side clinical observations; physical examination observations; body weight and body weight change; body temperature; food consumption; clinical pathology (clinical chemistry, hematology, and coagulation) parameters; blood serum immunogenicity analysis, brain weight; gross necropsy observations; and histopathological evaluations.
Tissues required for microscopic evaluation were trimmed, processed routinely, embedded in paraffin, and stained with hematoxylin and eosin by Charles River Laboratories, Inc (See Table 9). Light microscopic evaluation was conducted by the Contributing Scientist, a board-certified veterinary pathologist, on protocol-specified tissues from all animals.
For all study animals, the tissues/organs listed above were examined, sampled, and fixed in 1000 neutral buffered formalin with the exceptions of the bone marrow smears, which were fixed in methanol. Prior to being sampled, the brain of each animal was weighed. Brain-to-body weight ratios were calculated using the fasted body weight (taken on the day of necropsy).
Statistical Procedures: Descriptive statistics (mean and standard deviation) were calculated and analyzed for statistical significance for the following quantitative data using the ToxData® system: body weights and body weight changes, food consumption, body temperature, clinical pathology (clinical chemistry, hematology, and coagulation) parameters, and absolute brain weights and brain-to-body weight ratios.
For all analyses, if the data set was normally distributed and of equal variance, statistical comparisons were conducted using a one-way analysis of variance (ANOVA), with post hoc comparisons made (if necessary) using Dunnett's test. If normality and/or equal variance failed fora data set, statistical comparisons were conducted using nonparametric Kruskal-Wallis ANOVA, with post hoc comparisons made (if necessary) using Dunn's test. Incidence data (e.g., clinical observations and physical examination observations) were evaluated using Chi-square analysis and/or Fisher's Exact test. A minimum significance level of p<0.05 was used for the statistical comparisons in this study.
For all statistical comparisons, data from Groups 2 and 3 were compared against Group 1 (Control) data from animals of the same sex, and data from Groups 5 and 6 were compared against Group 4 (Control) data from animals of the same sex.
Safety assessment Following single or double intranasal administration of CPI-RSV-F at 107 PFU dose level to male and female cotton rats, no unscheduled treatment related mortalities or treatment-related clinical signs of toxicity were seen. In addition, no treatment-related findings were seen in body weight, body weight change, body temperature, food consumption, absolute or relative brain weight, gross necropsy or histopathology for both vaccine candidates (CPI-RSV-F and CVB-RSV-F).
The CPI-RSV-F vaccine was shown to be immunogenic in this study. A summary of the immunogenicity data is shown in Table 10.
RSV neutralizing antibody titer was measured using RSV-rLuc report virus per CVL protocol-038. RSV-F specific ELSIA antibody titer was determined per CVL protocol-049. The PIV5 antibody level was measured by ELISA assay using PIV5 virus particles per CVL protocol-048. CVB-RSV-F is more immunogenic than CPI-RSV-F in eliciting RSV neutralizing antibodies.
Single intranasal administration of CPI-RSV-F to cotton rats on Day 1 and repeat intranasal administration of CPI-RSV-F to cotton rats on Day 1 and Day 15 resulted in no early deaths by Day 29.
No treatment-related clinical signs of toxicity were seen or no treatment-related findings in body weight, body weight change, body temperature, food consumption, absolute or relative brain weight, gross necropsy, or histopathology. These findings were not considered toxicologically significant due to the small magnitude of changes and the lack of any correlating histopathological findings.
The study was validated by confirmation of antibody responses to PIV5, the vaccine vector and the RSV F protein expressed by the CPI-RSV-F vaccine.
Repeat dose toxicity of CPI-RSV-F vaccine was assessed in Group 4 and 5 of the GLP toxicology study above.
Repeat intranasal administration of CPI-RSV-F to cotton rats on Day 1 and 15 resulted in no gross or microscopic findings on Day 29 or other treatment related signs of toxicity.
Vaccine virus-induced antibody responses were detected in Groups 2, 3, 5 and 6 animals which received CPI-RSV-F or CVB-RSV-F, and absent in Groups 1 and 3 which received the control only (1×SPG). Animals which received two doses of CPI-RSV-F showed slightly higher RSV F and PIV5 antibody responses to those observed after a single dose.
Single or double administration of CPI-RSV-F and CVB-RSV-F at 7.0 log10 PFU was found to be immunogenic in cotton rats, with no toxicologically relevant adverse effects including local reactogenicity in the nasal cavity.
The vaccine virus induced antibody responses were detected in the animals that received one and two doses of either CPI-RSV-F or CVB-RSV-F, but not detected in the control animals that received the control article (1×SPG buffer). Animals that received a second dose of CPI-RSV-F or CVB-RSV-F two weeks after the first dose had higher anti-PIV5 antibody levels compared to those that received a single dose. A second dose of CPI-RSV-F did not significantly increase anti-RSV-F or RSV neutralizing antibody titers. A second dose of CVB-RSV-F significantly increase RSV neutralizing antibody titers, but not anti-RSV-F antibody titers. CVB-RSV-F is more immunogenic than CPI-RSV-F, producing higher anti-PIV5 antibody titers and RSV neutralizing antibody titers. Overall, the serology data indicate both CPI-RSV-F and CVB-RSV-F are immunogenic in cotton rats (see Table 1 for serology data summary), which validated this GLP toxicity study in that CPI-RSV-F and CVB-RSV-F were shown to be active.
The CVB Vectored SARS-CoV-2 vaccine candidates generated are described herein and in
The primers used in cDNA cloning of the CVB vaccine candidates are listed in Table 11.
SARS-CoV-2 candidate vaccines based on the CVB vector were evaluated in this study (Table 12).
The vaccine virus sequences generated using the primers listed as described above.
CVL104 for CVXGA16: The S gene of SARS-CoV-2 Wuhan strain, S157F mutation in P/V gene, and SH open reading frame from (orf) deletion mutations were introduced into W3A backbone by Gibson assembly. The recombinant plasmid contains CVB backbone and the S gene of SARS-CoV-2 Wuhan strain between the HN and L genes of PIV5. The recombinant virus was obtained.
CVL87 for CVXGA17: The S gene of SARS-CoV-2 Wuhan strain, S157F mutation in P/V gene, and the entire SH gene transcript unit deletion mutations were introduced into W3A backbone by Gibson assembly. The recombinant plasmid contains CVB backbone and the S gene of SARS-CoV-2 Wuhan strain between the HN and L genes of PIV5. The recombinant virus was obtained.
CVL85 for CVXGA18: The N gene of SARS-CoV-2 Wuhan strain was amplified and introduced into CVL104 backbone by Gibson assembly. The recombinant plasmid contains CVB backbone, the N gene of SARS-CoV-2 Wuhan strain in the place of SH gene of PIV5, and the S gene of SARS-CoV-2 Wuhan strain between the HN and L genes of PIV5. CVXGA18 contains both the N and S genes of SARS-CoV-2 Wuhan strain in the CVB backbone. The recombinant virus was obtained.
CVL83 for CVXGA19: The S gene of SARS-CoV-2 Omicron BA.1 variant was amplified and inserted into CVL85 backbone to replace the S gene of SARS-CoV-2 Wuhan strain by Gibson assembly. The recombinant plasmid contains CVB backbone, N gene of SARS-CoV-2 Wuhan strain in the place of SH gene of PIV5, and S gene of SARS-CoV-2 Omicron BA.1 variant between the HN and L genes of PIV5. The recombinant virus was obtained.
CVL109 for CVXGA22: The S gene of SARS-CoV-2 Omicron BA.5 variant was amplified and inserted into CVL85 backbone to replace the S gene of Wuhan strain by Gibson assembly. The recombinant plasmid contains CVB backbone, N gene of SARS-CoV-2 Wuhan strain in the place of SH gene of PIV5, S gene of SARS-CoV-2 Omicron BA.5 variant between HN and L genes of PIV5. The recombinant plasmid was obtained and virus rescue is ongoing.
CVL110 for CVXGA21: The S gene of SARS-CoV-2 Omicron BA.5 variant was amplified and inserted into CVL87 backbone to replace the S gene of Wuhan strain by Gibson assembly. The recombinant plasmid contains CVB2 backbone and S gene of SARS-CoV-2 Omicron BA.5 variant between the HN and L genes of PIV5. The recombinant plasmid was obtained and virus rescue is ongoing.
CVL112 for CVXGA24: The PIV5 F and HN genes are deleted from CVL104 backbone by Gibson assembly. The recombinant plasmid contains CVB backbone without F and HN genes but the S gene of SARS-CoV-2 Wuhan strain between HN and L genes of PIV5. The recombinant plasmid was obtained and virus rescue is ongoing. The recombinant virus will only contain the glycoprotein from the SARS-COV-2 virus. This virus can serve either as the vaccine strain and/or the virus for microneutralization assay to measure S-specific antibody response.
CVL119 for CVXGA29: wt S gene of SARS-CoV-2 Wuhan strain was amplified and inserted into CVL85 backbone by Gibson assembly. The recombinant plasmid contains CVB backbone, the N gene of SARS-CoV-2 Wuhan strain in the place of SH gene of PIV5, and the wt S gene of SARS-CoV-2 Wuhan strain between the HN and L genes of PIV5. The recombinant virus was obtained.
CVL120 for CVXGA30: M gene of SARS-CoV-2 Wuhan strain was amplified and inserted into CVL119 backbone by Gibson assembly. The recombinant plasmid contains CVB backbone, the M gene of SARS-CoV-2 Wuhan strain in the place of SH gene of PIV5, and the wt S gene of SARS-CoV-2 Wuhan strain between the HN and L genes of PIV5. The recombinant virus was obtained.
CVL121 for CVXGA31: E gene of SARS-CoV-2 Wuhan strain was amplified and inserted into CVL120 backbone by Gibson assembly. The recombinant plasmid contains CVB backbone, the M gene of SARS-CoV-2 Wuhan strain in the place of SH gene of PIV5, E gene of SARS-CoV-2 Wuhan strain between M of SARS-CoV-2 and HN of PIV5, and the wt S gene of SARS-CoV-2 Wuhan strain between the HN and L genes of PIV5. The recombinant virus was obtained.
CVL128 for CVXGA32: N gene of of SARS-CoV-2 Wuhan strain was amplified and inserted into CVL121 backbone by Gibson assembly. The recombinant plasmid contains CVB backbone, the M gene of SARS-CoV-2 Wuhan strain in the place of SH gene of PIV5, N gene of SARS-CoV-2 Wuhan strain between M and E of SARS-CoV-2, E gene of SARS-CoV-2 Wuhan strain between N of SARS-CoV-2 and HN of PIV5, and the wt S gene of SARS-CoV-2 Wuhan strain between the HN and L genes of PIV5. The recombinant virus was obtained.
To evaluate the immunogenicity of CVXGA16, PIV5 CVB with the SH open reading frame (ORF) deletion encoding the S protein from the Wuhan strain, CVXGA17, PIV5 CVB with the entire SH gene deletion encoding the S protein from the Wuhan strain, CVXGA18, PIV5 CVB with the SH ORF deletion encoding the N and S protein from the Wuhan strain compared to CVXGA1 in a Balb/c murine model (AE26) and Golden Syrian hamster model (AE25).
For AE26, twenty-five female Balb/c mice were used in this study (N=5 each group). The mice were immunized intranasally with 50 μL of PBS or 105 plaque forming units (PFU) of CVXGA1, CVXGA16, CVXGA17 and CVXGA18. At 32 days post-immunization (dpi), blood and spleens were collected. Anti-S or S RBD IgG antibodies were determined, as well as levels of IFNγ-secreting cells.
For AE25, twenty male Golden Syrian hamsters were used in this study (N=5 for group 1 and N=15 for Group 2 (COVID-19 mRNA). The hamsters were immunized intramuscularly with 50 μL of PBS (Group 1) or with 2 μg of COVID-19 mRNA vaccine per hamster (group 2). At 21 days post-immunization (dpi), the hamsters from Group 2 were boosted intramuscularly with 2 μg of COVID-19 mRNA. At day 42 post-immunization, hamsters from Group 1 were boosted intranasally with 50 μL of PBS, and hamsters from Group 2 were boosted a second time intramuscularly with 2 μg of COVID-19 mRNA (Group 2A), or intranasally with 2×106 PFU of CVXGA1 (Group 2B), or CVXGA18 (Group 2C). At 63 days post-immunization, blood was collected. Anti-S IgG antibodies were determined.
From AE26 study, CVXGA16, CVXGA17 and CVXGA18 vaccinated mice produced comparable IgG antibodies against S protein or S-RBD domain compared to CVXGA1 (
CVXGA16, CVXGA17 and CVXGA18 are immunogenic in Balb/c mice. CVXGA18 is also immunogenic in hamsters when given as a booster to hamsters that have received prime-boost immunization with COVID-19 mRNA vaccine.
We successfully rescued CVB based SARS-CoV-2 viruses expressing multiple antigens, CVXGA29, CVXGA30, CVXGA31, and CVXGA32 as indicated in Table 13. These rescued viruses were grown in T75 flasks of Vero cells with titer>7.2 Log 10 PFU/mL.
Viral replication in Vero cells: Vero cells in 6-well plates were infected with CVXGA17, CVXGA29, CVXGA30, CVXGA31, and CVXGA32 at a multiplicity of infection (MOI) of 0.1. The cells were then washed with PBS and maintained in DMEM-2% FBS. Media were collected at 1-6 days post infection (dpi). The titers of viruses were determined by plaque assay on Vero cells.
Mice study: To determine whether these viruses were immunogenic in vivo, five- to 7-week-old female Balb/c mice (Envigo) were used in the immunogenicity study. Following quarantine, five female mice were randomly grouped into 7 study groups (Table 14). Each mouse was anesthetized by intraperitoneal injection of 250 or 300 μl of Avertin (2,2,2-tribromoethanol in tert-amyl alcohol) and was inoculated intranasally with 100 μl (50 μl per nostril) of PBS, 1.7×105 PFU of CVXGA1, CVXGA18, CVXGA29, CVXGA30, CVXGA31, or CVXGA32, and housed in HEPA-filtered isolators under ABSL2. Twenty-one days after immunization, the animals were euthanized, and blood was collected via cardiothoracic bleeds for serum isolation. All experiments were performed in the animal facility at the University of Georgia in accordance with protocols approved by the IACUC at the University of Georgia.
ELISA: To quantify the anti-SARS-CoV-2-S or N antibody response, mouse serum was analyzed via enzyme-linked immunosorbent assay (ELISA). Immulon 2HB 96-well microtiter plates were coated with 25 ng of purified SARS-CoV-2-S trimmer protein or N protein for 24 hours. Mouse serum samples were inactivated at 56° C. and prediluted in 1:100 dilution then serially diluted in 2-fold dilutions and incubated on the plates for 1 hour. Following washes, the plates were incubated with horseradish peroxidase (HRP)-labeled goat anti-mouse IgG secondary antibody at 1:1250 dilution for 1 hour. The plates were developed with KPL SureBlue Reserve TMB microwell peroxidase substrate, and OD450 (optical density at 450 nm) values were read with a BioTek Epoch microplate spectrophotometer (BioTek, Winooski, VT). Antibody titers were calculated as the highest serum dilution at which the OD450 value was greater than 3 SD above the mean OD450 value of the negative controls.
Growth curve: CVXGA29, CVXGA30, CVXGA31, and CVXGA32 expressing wt SARS-CoV-2 S grew to similar titers compared to CVXGA17 expressing SARS-CoV-2 S with PIV5 F tail (
Immunogenicity: For anti-SARS-CoV-2 S immunogenicity (
For anti-SARS-CoV-2 N immunogenicity (
From the study, we concluded that PIV5 is a good vector to express up to 4 antigens with total length of ˜6.4 kb. All recombinant viruses grew to titer >7 Log10 PFU/mL in Vero cells. Anti-S immunogenicity from these viruses was similar. Anti-N immunogenicity from CVXGA29 and CVXGA32 was similar, but lower than that of CVXGA18 expressing N and S with PIV5 F tail. It is possible that S with PIV5 F tail may enhance immunogenicity of other genes.
The disclosure provided herein include the generation of a more potent and high yield PIV5 CVB backbone which contains the P/V gene S157F mutation or alternatively S156N mutation, the PIV5 SH deletion as either open reading frame or the entire S gene transcription unit in the PIV5 W3A strain. Multiple SARS-CoV-2 vaccine candidates in the CVB backbone have been produced showing that the antigenic genes can be inserted between the SH and HN gene junctions and/or the HN-L gene junctions without significantly affecting virus antigen expression. Both the N and S genes (˜5 kb) have been successfully inserted into CVB backbone, reaching titer of ˜108 PFU/ml.
The complete disclosure of all patents, patent applications, and publications, and electronically available material (including, for instance, nucleotide sequence submissions in, e.g., GenBank and RefSeq, and amino acid sequence submissions in, e.g., SwissProt, PIR, PRF, PDB, and translations from annotated coding regions in GenBank and RefSeq) cited herein are incorporated by reference. In the event that any inconsistency exists between the disclosure of the present application and the disclosure(s) of any document incorporated herein by reference, the disclosure of the present application shall govern. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The invention is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the invention defined by the claims.
This application is a US utility patent application of U.S. Provisional Application Ser. No. 63/483,377, filed Feb. 6, 2023, which is hereby incorporated by this reference in its entirety.
| Number | Date | Country | |
|---|---|---|---|
| 63483377 | Feb 2023 | US |
