Patent Application
20090123967
The present invention is directed to a method of modifying a spider silk protein and a spider silk protein obtainable by said method. The invention further pertains to a nucleic acid sequence coding for a modified spider silk protein, a vector containing said sequences and host cells transformed with this vector. The invention furthermore is directed to a pharmaceutical or cosmetical composition containing a modified spider silk protein as defined herein and the use of said modified sequences in various fields, in particular in the fields of medicine, cosmetics and technical applications.
Spider silks are protein polymers that display extraordinary physical properties. Among the different types of spider silks, draglines are most intensely studied. Dragline silks are utilized by orb weaving spiders to build frame and radii of their nets and as lifelines that are permanently dragged behind. For these purposes high tensile strength and elasticity are required. The combination of such properties results in a toughness that is higher than that of most other known materials. Dragline silks are generally composed of two major proteins whose primary structures share a common repetitive architecture.
An orb web's capture spiral, in part composed of viscid silk formed by the flagelliform gland, which is therefore named flagelliform silk, is stretchy and can triple in length before breaking, but provides only half the tensile strength of dragline silk.
Variations of a single repeat unit, which can comprise up to 60 amino acids, are iterated several times to represent the largest part of a spider silk sequence. These repeat units comprehend a limited set of distinct amino acid motifs. One motif found in all dragline silk repeat units is a block of typically 6-9 alanine residues. In silk threads several polyalanine motifs form crystalline β-sheet stacks leading to tensile strength.
Glycine rich motifs such as GGX or GPGXX adopt flexible helical structures that connect crystalline regions and provide elasticity to the thread.
Silk assembly in vivo is a remarkable process. Spider dragline silk proteins are stored at concentrations up to 50% (w/v) in the so-called major ampullate gland. Although a “dynamic loose helical structure” has been proposed for the proteins within the major ampullate gland more recent data suggests a random coil conformation for the proteins of the so called A-Zone, which represents the largest part of the gland. The highly concentrated protein solution forms the silk dope (spinning solution), which displays properties of a liquid crystal.
Thread assembly is initiated during a passage of the dope through the spinning duct accompanied by extraction of water, sodium and chloride. At the same time the concentrations of the more lyotropic ions potassium and phosphate are increased and the pH drops from 6.9 to 6.3. Assembly is finally triggered by mechanical stress, which is caused by pulling the thread out of the spider's abdomen.
For several purposes natural silk threads can not be used directly, but have to be dissolved and reassembled into other morphologies such as films, foams, spheres, nanofibrils, hydrogels and the like.
While some structural aspects of spider silk proteins have been unravelled, still little is known about the contribution of individual silk proteins and their primary structure elements to the assembly process. Comparative studies of the two major dragline silk proteins of the garden spider Araneus diadematus, ADF-3 and ADF-4, revealed that, although their amino acid sequences are rather similar, they display remarkably different solubility and assembly characteristics: While ADF-3 is soluble even at high concentrations, ADF-4 is virtually insoluble and self-assembles into filamentous structures under specific conditions (unpublished results).
Scientific and commercial interest initiated the investigation of industrial scale manufacturing of spider silk. Native spider silk production is impractical due to the cannibalism of spiders, and artificial production has encountered problems in achieving both sufficient protein yield and quality thread-assembly. Bacterial expression yielded low protein levels, likely caused by a different codon usage in bacteria and in spiders. Synthetic genes with a codon usage adapted to the expression host led to higher yields, but the proteins synthesized thereof showed different characteristics in comparison to native spider silks. Expression of partial dragline silk cDNAs in mammalian cell lines did yield silk proteins (e.g. ADF-3) that could be artificially spun into ‘silken’ threads, albeit as yet of inferior quality.
The inventors earlier developed systems for the recombinant production of spider silk proteins in E. coli. As an example, it is referred to WO 2006/008163 (claiming priority of U.S. provisional application No. 60/590,196). In this expression system, single building blocks (=modules) can be varied freely and can thus be adapted to the requirements of the specific case. Modules of this type are disclosed also in Hümmerich, D., Helsen, C. W., Oschmann, J., Rudolph, R. & Scheibel, T. (2004): “Primary structure elements of dragline silks and their contribution to protein solubility and assembly, Biochemistry 43, 13604-13612”.
One object of high relevance in particular for applications of spider silk proteins in the field of medicine is the covalent coupling of drugs, proteins, chemicals etc. to those spider silk proteins. However, up to now, no satisfying technique for coupling is known which allows on the one hand a coupling of those substances to spider silk proteins in a predetermined amount and, on the other hand, to predetermined locations within the spider silk protein.
Therefore, it is an object underlying the present invention to provide a method for the manufacture of modified spider silk proteins which can be used for the targeted coupling of substances such as drugs, metals, polypeptides, polysaccharides, marker molecules, quantum dots, nucleic acids, lipids, etc. to these spider silk proteins. It is a further object of the invention to provide such modified spider silk sequences which can be used to carry and deliver a precise amount of those substances and wherein those substances are coupled in predetermined locations within the sequence of the spider silk protein.
This object is achieved by the subject-matter of the independent claims. Preferred embodiments are contained in the dependent claims.
Of major interest in this respect is the incorporation of amino acids in spider silk modules, which have a chemically specific amino acid side chain, in the present case a thiol group of cysteine or an amino group of lysine. None of the above mentioned modules of spider silk proteins, which have been described up to now, contains cysteine or lysine and thus, a specific mutagenesis of the respective nucleic acid sequences allows to incorporate the desired amino acids into the sequence of the modules in a controlled manner. Modules which have been modified in this way can be assembled to new constructs and therefore, by combination of single modules, also more than one chemical active agent or drug can be combined in one single construct.
Therefore, for the first time, a specific multiple coupling of reagents to recombinant spider silk proteins is feasible. Apart from the modification of the basic modules there is additionally the opportunity to couple chemically reactive amino acids by means of TAGs to the existing constructs in order to activate or modify same.
As mentioned above, the inventor himself generated an efficient production method of proteins similar to spider silk proteins and having characteristics, which can be specifically influenced by a cloning strategy which allows to assemble single DNA sequence modules in a controlled way to a synthetic gene (Hümmerich et al., 2004). The single modules are not spaced by foreign DNA sequences as it was the case in prior art cloning systems. In the presently used cloning system, as an example, the cloning vector pAZL (developed by the inventor) can be used, which contains a defined cloning cassette (
Between the restriction sites of BseRI and BsgI a spacer region is present in the cloning cassette which will be replaced in the subsequent steps at first by single sequence modules and later by the synthetic gene. The arrangement of the single elements will be maintained in the subsequent steps (see
The basis of the monomeric sequence modules which are forming the starting point of the present invention are the genes ADF3 and ADF4 of the spider Araneus diadematus as well as the gene FLAG of the spider Nephila clavipes. Variations of the employed sequences of ADF3 and ADF4 are publicly available (available under the accession numbers U47855 and U47856). The first two genes (ADF3 and ADF4) are coding for proteins which are forming the dragline thread of the spider, the third is coding for a protein of the flagelliform silk. Based on the amino acid sequence of these proteins, several modules were designed:
From these amino acid modules, synthetic spider silk protein constructs were assembled. These modules and the spider silk proteins derived therefrom are among others forming the starting material in the present method of modifying spider silk proteins.
The structure of the cloning cassette allows an arbitrary assembly of two modules or module multimers in each case. See in this connection
In the present invention a coupling system of several reagents to spider silk proteins is provided which makes it possible to perform different coupling reactions at the same time and without a high expenditure of work. This is a crucial requirement for potential industrial applications and production of coupled spider silk proteins.
In order to achieve this object, selected modules of spider silk proteins were modified in order to introduce amino acids with chemically distinct side chains in selected amino acid positions. The newly introduced amino acids are lysine and cysteine.
The present invention in particular is directed to the following aspects and embodiments:
According to a first aspect, a method of modifying a spider silk protein is provided comprising the steps of:
The above method is the most efficient way of producing the modified spider silk proteins of the present invention. However, it is also possible to produce the same for example by providing a spider silk protein or a fragment thereof not containing a lysine or cysteine residue (in the protein form) and to chemically couple (or add) an amino acid TAG containing lysine and/or cysteine among other amino acids to said spider silk protein.
Furthermore, the above method also comprises the option to design modified spider silk protein encoding sequences by substitution and to subsequently add a nucleic acid sequence containing nucleic acids encoding lysine and/or cysteine to said sequence.
The kind and origin of the spider silk protein used in step a) is not restricted as long as it fulfils the requirement not to contain lysine or cysteine residues. It does not play any role whether they are naturally derived or artificial sequences.
The term “fragment” as used herein is directed to parts of spider silk proteins (whether artificial/synthetic or naturally derived) having a length of about 5-50 amino acid residues, preferably 10-40, for example between 20 and 30 amino acid residues.
According to a preferred embodiment, the present invention further comprises coupling other substances to said lysine and/or cysteine molecules in the modified spider silk protein. As mentioned above, this will lead to a controlled and targeted coupling pattern of said substances to the spider silk proteins.
The one or more amino acids replaced in step b) are preferably selected from the group consisting of glycine, alanine, serine, glutamate, aspartate and threonine. They usually do not unduly alter the resulting modified spider silk protein as regards assembly behaviour etc.
The substance to be coupled to said lysine and/or cysteine residues contained in the modified spider silk protein is preferably selected from the group consisting of polypeptides, polysaccharides, marker molecules, quantum dots, metals, nucleic acids, lipids and low molecular drugs.
For example, nanogold particles can be coupled to cysteine residues via a chemical linker. In this case, a covalent coupling is achieved via a maleimido or iodoacetamide group of the linker to the thiol group of cysteine. Basically, all substances can be coupled which are capable to covalently bind to the amino group of lysine or the thiol group of cysteine.
Preferably, the low molecular drugs are selected from drugs containing a carboxyl, carbonyl, imido or thiol group. A not restricted selection of drugs is diclofenac, indomethacine, tolmetine, ibuprofene, flurbiprofene, fenoprofene, naproxene, ketoprofene, penicillines, or cephalosporines.
Preferably, the spider silk protein provided in a) is based on a dragline and/or flagelliform protein. The spider silk sequences could for example be derived from orb-web spiders (Araneidae and Araneoids).
More preferably the spider silk proteins are derived from one or more of the following spiders: Arachnura higginsi, Araneus circulissparsus, Araneus diadematus, Argiope picta, Banded Garden Spider (Argiope trifasciata), Batik Golden Web Spider (Nephila antipodiana), Beccari's Tent Spider (Cyrtophora beccarii), Bird-dropping Spider (Celaenia excavata), Black-and-White Spiny Spider (Gasteracantha kuhlii), Black-and-yellow Garden Spider (Argiope aurantia), Bolas Spider (Ordgarius furcatus), Bolas Spiders—Magnificent Spider (Ordgarius magnificus), Brown Sailor Spider (Neoscona nautica), Brown-Legged Spider (Neoscona rufofemorata), Capped Black-Headed Spider (Zygiella calyptrata), Common Garden Spider (Parawixia dehaani), Common Orb Weaver (Neoscona oxancensis), Crab-like Spiny Orb Weaver (Gasteracantha cancriformis (elipsoides)), Curved Spiny Spider (Gasteracantha arcuata), Cyrtophora moluccensis, Cyrtophora parnasia, Dolophones conifera, Dolophones turrigera, Doria's Spiny Spider (Gasteracantha doriae), Double-Spotted Spiny Spider (Gasteracantha mammosa), Double-Tailed Tent Spider (Cyrtophora exanthematica), Aculeperia ceropegia, Eriophora pustulosa, Flat Anepsion (Anepsion depressium), Four-spined Jewel Spider (Gasteracantha quadrispinosa), Garden Orb Web Spider (Eriophora transmarina), Giant Lichen Orbweaver (Araneus bicentenarius), Golden Web Spider (Nephila maculata), Hasselt's Spiny Spider (Gasteracantha hasseltii), Tegenaria atrica, Heurodes turrita, Island Cyclosa Spider (Cyclosa insulana), Jewel or Spiny Spider (Astracantha minax), Kidney Garden Spider (Araneus mitificus), Laglaise's Garden Spider (Eriovixia laglaisei), Long-Bellied Cyclosa Spider (Cyclosa bifida), Malabar Spider (Nephilengys malabarensis), Multi-Coloured St Andrew's Cross Spider (Argiope versicolor), Ornamental Tree-Trunk Spider (Herennia ornatissima), Oval St. Andrew's Cross Spider (Argiope aemula), Red Tent Spider (Cyrtophora unicolor), Russian Tent Spider (Cyrtophora hirta), Saint Andrew's Cross Spider (Argiope keyserlingi), Scarlet Acusilas (Acusilas coccineus), Silver Argiope (Argiope argentata), Spinybacked Orbweaver (Gasteracantha cancriformis), Spotted Orbweaver (Neoscona domiciliorum), St. Andrews Cross (Argiope aetheria), St. Andrew's Cross Spider (Argiope Keyserlingi), Tree-Stump Spider (Poltys illepidus), Triangular Spider (Arkys clavatus), Triangular Spider (Arkys lancearius), Two-spined Spider (Poecilopachys australasia), Nephila species, e.g. Nephila clavipes, Nephila senegalensis, Nephila madagascariensis and many more (for further spider species, see also below).
Most preferred, the dragline proteins are derived from Araneus diadematus and the flagelliform proteins are derived from Nephila clavipes.
Preferred dragline sequences are ADF-3 and ADF-4. The term ADF-3/-4 is used in the context of MaSp proteins produced by Araneus diadematus (Araneus diadematus fibroin-3/-4). Both proteins, ADF-3 and 4 belong to the class of MaSp II proteins (major ampullate spidroin II).
According to a further embodiment the fragment is a module, wherein the module comprises one or more polyalanine containing consensus sequences. This polyalanine containing consensus sequence is preferably derived from ADF-3 and has the amino acid sequence of SEQ ID NO: 1 (module A) or a variant thereof.
According to a still further embodiment the fragment is a module derived from ADF-3 and comprises the amino acid sequence of SEQ ID NO: 2 (module Q) or a variant thereof. Also combined sequences of the above (and all other modules mentioned herein) are contemplated. For example, a fragment is provided in step a) which comprises one or more of (AQ) and/or (QAQ). Preferably the spider silk protein in this case comprises (AQ)12, (AQ)24, (QAQ)8 or (QAQ)16.
Thus, the specific modules for use in the present invention can also be combined with each other, i.e. modules (repeat units) combining A and Q, Q and C etc. are also encompassed by the present invention. Although the number of the modules to be introduced in the spider silk protein is not restricted, it is preferred to employ a number of modules of the synthetic repetitive sequence for each recombinant protein which number is preferably ranging from 5-50 modules, more preferably 10-40 and most preferably between 15-35 modules.
Another preferred module is derived from ADF-4 and comprises the amino acid sequence of SEQ ID NO: 3 (module C) or a variant thereof. Combined sequences can provided in a) may preferably comprise C16 or C32.
Preferred modules derived from a flagelliform protein are module K (SEQ ID NO: 4), module sp (SEQ ID NO: 5), module X (SEQ ID NO: 6), and module Y (SEQ ID NO: 7).
Preferred combinations comprise Y8, Y16, X8, X16, K8, K16 or Y6X2sp1K2Y2.
The following new modules were generated by way of the method of the invention and are in particular preferred embodiments:
These modules can be combined purposely with other modules/spider silk proteins in order to achieve a specific modification. As an example for the possibilities of combinations, construct C16 is used. In this respect, possible constructs by use of module CC could be the following:
C16CC, CCC16, C8CCC8, C16C, C8CC8, CC8C8, C4CC8C4, CC4C8CC4, etc.
In these constructs a controlled and targeted coupling can be achieved via the thiol group of cysteine as well as via the amino groups of lysine. For example, by a combination of CC with module CK1, the possibility is existing to couple appropriate substances to the thiol groups of cysteine and to the amino groups of the lysine side chains.
Preferred constructs could be designed as follows: for example, both amino acids are introduced in one single module (module CKC) which opens up further possibilities (an enormous number of construct variants is occurring).
Since it cannot be ruled out that in single cases the amino acid exchange can lead to an alteration of the assembly characteristics or to modified characteristics of the construct, as a further preferred alternative, the invention is directed to the use of specific TAGs. These tags (for example TAG's as disclosed in SEQ ID NO: 20-28, below) contain cysteine or lysine as mentioned before. The sequence of the TAG is so selected that an interaction with the rest of the protein and an influence of the assembling behaviour can be precluded to the greatest possible extent.
Thus, according to a preferred embodiment, the modified spider silk protein recovered in step d) comprises one or more of the modules of SEQ ID NO: 8-19.
The following TAG's were developed for preferred use in the spider silk constructs:
As also mentioned above, as an example, the following different variants can be used:
NHCYS1C16, C16CHCYS1, NHCYS1C16CHLYS1, NHLYS1C16CHCYS1, etc.
Replacing nucleic acids which are encoding one or more amino acids in spider silk proteins by lysine or cysteine can lead to changes in the characteristics of the resulting modified spider silk protein. In order to avoid unwanted modifications, the skilled artisan knows how to chose the specific position of the substitution reaction in order to avoid those unwanted alterations or in order to introduce further wanted characteristics into the spider silk protein sequence. Therefore, it is in particular preferred to use non hydrophobic amino acids which are neutral, e.g. are not carrying any charges in the amino acid side chains. The amino acids to be replaced into the original spider silk protein sequence additionally should have a comparable size in order to avoid a steric hindrance due to the newly introduced amino acids. Therefore, it is in particular preferred to use serine, alanine, glycine, glutamate, aspartate or threonine to be substituted by lysine or cysteine.
Thus, to the modified spider silk protein recovered in step d) or to the spider silk protein provided in step a) a nucleic acid encoding an amino terminal TAG according to SEQ ID NO: 20-24 and/or a carboxyl terminal TAG of SEQ ID NO: 25-28 may be added.
As explained above, the amino acid sequences disclosed herein are not restricted to the exact sequences provided in the SEQ ID Nos. The amino acid sequences indicated herein also comprise variants. Thus, the amino acid sequences of the proteins of the present invention also encompass all sequences differing from the herein disclosed sequences by amino acid insertions, deletions, and substitutions.
Preferably, amino acid “substitutions” are the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, i.e., conservative amino acid replacements. Amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues involved. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine; polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine; positively charged (basic) amino acids include arginine, lysine, and histidine; and negatively charged (acidic) amino acids include aspartic acid and glutamic acid.
“Insertions” or “deletions” are typically in the range of about 1 to 5 amino acids, preferably about 1, 2 or 3 amino acids. Amino acid additions typically are not more than 100, preferably not more than 80, more preferably not more than 50, most preferred not more than 20 amino acids, which are added on and/or inserted into the proteins of the present invention. It is noted that only those additions are contemplated in this invention, which do not negatively affect the desired characteristics of the proteins disclosed herein.
The variation allowed may be experimentally determined by systematically making insertions, deletions, or substitutions of amino acids in a protein using recombinant DNA techniques and assaying the resulting recombinant variants for activity. This does not require more than routine experiments for the skilled artisan.
It is noted that the present method additionally may comprise the step of spinning said proteins prepared in step d) into filaments, nanofibers and threads by a suitable method.
For this purpose, spinning methods may be used, which are per se known in the art. For example, a dope solution of spider silk protein is extruded through a spinneret to form a biofilament. The resulting biofilament can be drawn or stretched. Whenever both crystalline and amorphous arrangements of molecules exist in biofilaments, drawing or stretching will apply shear stress sufficient to orient the molecules to make them more parallel to the walls of the filament and increase the tensile strength and toughness of the biofilament.
Preferably, the dope solution is at least 1%, 5%, 10%, 15% weight/volume (w/v) modified silk protein. More preferably, the dope solution is as much as 20%, 25%, 30%, 35%, 40%, 45%, or 50% w/v silk protein. In preferred embodiments, the dope solution contains substantially pure modified spider silk protein. In preferred embodiments, the dope has a pH of approximately 6.9.
By “dope solution” is meant any liquid mixture that contains silk protein and is amenable to extrusion for the formation of a biofilament or film casting. Dope solutions may also contain, in addition to protein monomers, higher order aggregates including, for example, dimers, trimers, and tetramers. Normally, dope solutions are aqueous solutions of pH 4.0-12.0 and having less than 40% organics or chaotropic agents (w/v). Preferably, the dope solutions do not contain any organic solvents or chaotropic agents, yet may include additives to enhance preservation, stability, or workability of the solution.
By “filament” is meant a fibril of indefinite length, ranging from nanoscale and microscopic length to lengths of a mile or greater. Silk is a natural filament, while nylon and polyester as an example are synthetic filaments.
Further information regarding how to spin spider silk protein fibrils may be found in WO03060099 (Karatzas et al.), published Jul. 24, 2003, which is incorporated herein by reference.
Furthermore, the modified spider silk proteins of the present invention may be provided as films or the like, i.e. as a spider silk protein product, for which a spinning step is not required.
According to a second aspect a modified spider silk protein obtainable by the above method is provided by the present invention.
A preferred modified spider silk protein further comprises one or more of the modules of SEQ ID NO: 8-28.
According to a third aspect, a nucleic acid sequence is provided coding for a modified spider silk protein as obtained in step d) of the method of the invention or for a modified spider silk protein of claims as mentioned above.
The term “nucleic acid sequence” refers to a heteropolymer of nucleotides or the sequence of these nucleotides. The terms “nucleic acid” and “polynucleotide” are used interchangeably herein to refer to a heteropolymer of nucleotides.
Stringency of hybridization, as used herein, refers to conditions under which polynucleotide duplexes are stable. As known to those of skill in the art, the stability of duplex is a function of sodium ion concentration and temperature (see, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual 2nd Ed. (Cold Spring Harbor Laboratory, (1989)). Stringency levels used to hybridize can be readily varied by those of skill in the art.
As used herein, the phrase “moderately stringent conditions” refers to conditions that permit DNA to bind a complementary nucleic acid that has about 60% identity, preferably about 75% identity, more preferably about 85% identity to the DNA; with greater than about 90% identity to said DNA being especially preferred. Preferably, moderately stringent conditions are conditions equivalent to hybridization in 50% formamide, 5×Denhart's solution, 5×SSPE, 0.2% SDS at 42° C., followed by washing in 0.2×SSPE, 0.2% SDS, at 65° C.
A fourth aspect is directed to an expression vector, which comprises the above defined nucleic acid sequence and one or more regulatory sequences. This expression vector preferably comprises one or more regulatory sequences. The term “expression vector” generally refers to a plasmid or phage or virus or vector, for expressing a polypeptide/protein from a DNA (RNA) sequence. An expression vector can comprise a transcriptional unit comprising an assembly of (1) a genetic element or elements having a regulatory role in gene expression, for example, promoters or enhancers, (2) a structural or coding sequence which is transcribed into mRNA and translated into protein, and (3) appropriate transcription initiation and termination sequences. Structural units intended for use in yeast or eukaryotic expression systems preferably include a leader sequence enabling extracellular secretion of translated protein by a host cell. Alternatively, where recombinant protein is expressed without a leader or transport sequence, it may include an amino-terminal methionine residue. This residue may or may not be subsequently cleaved from the expressed recombinant protein to provide a final product.
The vector preferably is a plasmid or a viral vector, preferably a baculovirus system or a vaccinia virus vector system. Further viral vector systems may also be used in this invention. From case to case, a modification of the vector may be needed. Examples for further viral vectors are adenoviruses and all negative-strand RNA-viruses, e.g. rabies, measles, RSV, etc.
Ready-to-use genetic constructs can be cloned in different commercially available expression vectors as for example pET (Novagen, Madison, Wis., USA) or the pQE-systems (Qiagen GmbH, Hilden, Germany). By the specific choice of the vectors or of the restriction enzymes which are used for cloning, different protein TAGs can be attached to the protein (for example T7-tag (Novagen, Madison, Wis., USA) or the 6×histidin-tag. Furthermore, one can choose between different promotors (for example T7 or T5).
Preferably, the vector comprises the above nucleic acid sequence coding for a modified spider silk protein and preferably is derived from the cloning vector of SEQ ID NO: 29 (cloning vector pAZL) or a variant thereof.
A fifth aspect of the invention is related to a host, which has been transformed with the above vector. The host may be a prokaryotic cell, preferably E. coli or Bacillis subtilis. The expression of the synthetic gene can be performed for example in E. coli K12 or E. coli B cells. The yield of the expression can be about 1 g of purified protein per litre of bacterial culture.
The host may also be a eukaryotic cell, for example a mammalian cell, plant cell, yeast cell or an insect cell. Preferably, it can be a CHO, COS, HeLa, 293T, HEH or BHK cell, a yeast cell (for example Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, Candida albicans, Hansenula polymorpha), an insect cell selected from Lepidoptera insect cells, preferably from Spodoptera frugiperda and from Trichoplusia ni, more preferably a Sf9, Sf21 or high five cell, or a plant cell, preferably derived from tobacco, potato, corn, pea and tomato.
One advantage of an insect cell expression system, for example regarding bacterial systems, resides in the fact that the proteins produced are glycosylated, thereby being a target for degradation by micro organisms. This characteristic may be of importance, for example, in the field of medicine, whenever the silk proteins are intended for an in vivo use, in which biological degradation is desired. This characteristic may in particular find application in suture materials and wound closure and coverage systems.
In a sixth aspect, the present invention is directed to fibrils/threads or filaments made from the above modified spider silk protein.
The proteins, threads, filaments, films, foams, spheres, nanofibrils, hydrogels and the like as defined herein may be used in the field of biotechnology and/or medicine, preferably for the manufacture of wound closure or coverage systems, suture materials for use in neurosurgery or ophthalmic surgery. Furthermore, the proteins/threads may preferably be used for the manufacture of replacement materials, preferably artificial cartilage or tendon materials.
Additionally, the threads/fibrils of the invention can be used in the manufacture of medical devices such as medical adhesive strips, skin grafts, replacement ligaments, and surgical mesh; and in a wide range of industrial and commercial products, such as clothing fabric, bullet-proof vest lining, container fabric, bag or purse straps, cable, rope, adhesive binding material, non-adhesive binding material, strapping material, automotive covers and parts, aircraft construction material, weatherproofing material, flexible partition material, sports equipment; and, in fact, in nearly any use of fibrils or fabric for which high tensile strength and elasticity are desired characteristics. Adaptability and use of the stable fibril product in other forms, such as a dry spray coating, bead-like particles, or use in a mixture with other compositions is also contemplated by the present invention.
As mentioned above, pharmaceutical substances may be coupled to the modified spider silk proteins of the invention via their cysteine/lysine residues. Especially those coupled proteins can be used for the above purposes. For example, an envisioned application of such a coupled protein is the manufacture of a suture material or wound coverage system having antibiotics or anti-inflammatory drugs attached to the proteins/threads, from which they were made.
It is explicitly noted that the most preferred applications of the modified spider silk proteins of the present invention are in the manufacture and processing of clothing fabric (textiles) and leather, automotive covers and parts, aircraft construction materials as well as in the manufacture and processing of paper.
The modified spider silk proteins of the present invention may be added to cellulose and keratin and collagen products and thus, the present invention is also directed to a paper or a skin care and hair care product, comprising cellulose and/or keratin and/or collagen and the spider silk proteins of the present invention. Papers and skin care and hair care products, in which the proteins of the present invention are incorporated are showing improved characteristics, in particular improved tensile strength or tear strength.
Furthermore, the modified spider silk proteins of the invention may be used as a coating for textile and leather products, thereby conferring stability and durability to the coated product. The silk proteins in particular show applicability for coating leather products, since in this case, tanning and its negative effects for environment can be avoided or at least reduced.
They can also be used in food packaging or electronic devices, for example in batteries. Experiments conducted with films made out of the modified spider silk proteins showed their resistance and stability towards acid after immersion in battery acid.
In a seventh aspect, the invention provides a pharmaceutical or cosmetical composition containing a modified spider silk protein as defined hereinabove and a pharmaceutically acceptable carrier.
The invention is further illustrated by the accompanying figures, wherein:
Materials. Chemicals were obtained from Merck KGaA (Darmstadt, Germany) if not otherwise stated. Manipulation and modification of DNA was performed as described previously (1). Restriction enzymes were obtained from New England Biolabs (Beverly, Mass., USA) and ligase from Promega Biosciences Inc. (San Luis Obispo, Calif., USA). DNA purification was performed using kits from Promega Biosciences Inc. (San Luis Obispo, Calif., USA). Synthetic oligonucleotides were obtained from MWG Biotech AG (Ebersberg, Germany). All cloning steps were performed in the E. coli strain DH10B from Novagen (Madison, Wis., USA).
Cloning of Modified Silk Modules and TAGs into the pAZL Vector.
Module CC (SEQ ID NO: 10), was created via PCR mutagenesis using Module C (SEQ ID NO: 3) as template nucleotide sequence and primers pAZL-fwd (CACTGAGCGTCAGA CCCCGTAGAAAAGA) (SEQ ID NO: 30) and pAZLmut-rev (CTCTTAAGCTT TCATTAGCCTGGACCACCTGGACCGTAGCCGCCCGGGCCGCAAGGACCCTGG) (SEQ ID NO: 31). In order to obtain an optimized primer some codons of the original Modul C were mutated (CCA (Pro24) to CCT (Pro), GGT (Gly28) to GGC (Gly), CCT (Pro32) to CCA (Pro), GGC (Gly33) to GGT and CCG (Pro35) to CCA (Pro)). The PCR-product and pAZL vector (SEQ ID NO: 29) were ligated after digestion with AlwNI and HindIII. Module NHCYS3 (GCGG S GGGG S GGGG, ggt tgc ggt ggc tct ggt ggt ggc ggg tcc gga ggc ggt ggc) (SEQ ID NO: 22) was created by annealing two synthetic oligonucleotides N1 (GATCCATGGGTTGCGGTGGCTCTGGTGGTGGCGGGTCCG GAGGCGGTGGCTAATGAA) (SEQ ID NO: 32) and N2 (AGCTTTCATTAGCCACCGCCTCC GGACCCGCCACCACCAGAGCCACCGCAACCCATG) (SEQ ID NO: 33). Annealing was accomplished by decreasing the temperature of a 50 pmol/μl (each) oligonucleotide solution from 95° C. to 20° C. with an increment of 0.1° C./s. Mismatched double strands were denatured at 70° C. followed by another temperature decrease to 20° C. After repeating the 20° C.-70° C.-20° C. cycle ten times, ten additional cycles were performed with a denaturing temperature of 65° C. The resulting cloning cassette was ligated with vector pAZL (SEQ ID NO: 29) digested with BamHI and HindIII.
Construction of modified synthetic spider silk genes. Connecting of two gene fragments e.g. single modules or module multimers represented the basic step of the cloning strategy. For this purpose the pAZL vector, containing the designated 5′-terminal gene fragment was digested with BsaI and BsgI, while the vector comprising the 3′-terminal gene fragment was digested with BseRI and BsaI respectively (
For gene construction, modified modules CC (SEQ ID NO: 10) or NHCYS3 (SEQ ID NO: 22) were connected to repeat units like C16. Afterwards, they were excised from the pAZL vector with BamHI and HindIII and ligated with the bacterial expression vector pET21a (Novagen) likewise digested, providing a T7-tag (MASMTGGQQMGR) (SEQ ID NO: 34) coding sequence (2). The fidelity of all constructs was confirmed by DNA sequencing.
Gene expression. All silk genes were expressed in the E. coli strain BLR [DE3] (Novagen). Cells were grown at 37° C. in LB medium to an OD600=0.6-0.7. After induction with 1 mM IPTG (Isopropyl-β-D-thiogalactosid), cells were shifted to 25° C. in the case of NHCYS3C16 and C16CC and to 30° C. in the case of CCC16, respectively. Cells expressing NHCYS3C16 were harvested after 3-4 hours of induction while cells expressing CCC16 were harvested after 4 hours and cells expressing C16CC after 5 hours.
Protein purification. Cells were resuspended with 5 ml/g buffer containing 20 mM N-(2-hydroxyethyl)piperazine-N′-(2-ethanesulfonic acid) (HEPES) pH 7.5, 100 mM NaCl, 0.2 mg/ml lysozyme (Sigma-Aldrich, St. Louis, Mo., USA) and incubated at 4° C. for 30 min. Cells were disrupted by high pressure using a French Press (Basic Z Model, APV Deutschland GmbH, Lübeck, Germany). Genomic DNA was digested by incubating cell lysates with 0.1 mg/ml DNase I (Roche, Mannheim, Germany) and 3 mM MgCl2 at room temperature for 30 min. Insoluble cell fragments were sedimented at 50,000×g and 4° C. for 30 min. Soluble E. coli proteins of lysates were precipitated by heat denaturation at 80° C. for 20 min. Precipitated proteins were removed by sedimentation at 50,000×g for 30 min. Silk proteins, which remained soluble during heat denaturation, were precipitated with 20% ammonium sulphate (800 mM) at room temperature and harvested by centrifugation at 10,000×g for 10 min. Pellets were rinsed with 8 M urea and dissolved in 6 M guanidinium thiocyanate (GdmSCN). All proteins were dialyzed against 10 mM NH4HCO3. Precipitates formed during dialysis were removed by sedimentation at 50,000×g for 30 min and the remaining soluble silk proteins were lyophilized. Prior to analysis lyophilized protein was dissolved in 6 M GdmSCN followed by dialysis against appropriate buffers. Aggregates were removed by sedimentation at 125,000×g for 30 min. Protein concentrations were determined photometrically in a 1 cm path length cuvette at 276 nm using calculated extinction coefficients (Table 1) (3). Identity of proteins was confirmed by sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE; 10% Tris-Glycine gels) followed by blotting onto polyvinylidene fluoride (PVDF) membranes (Millipore, Billerica, Mass., USA) and detection using a mouse anti-T7 monoclonal antibody (Novagen, 1:10,000) as primary and anti-mouse IgG peroxidase conjugate (Sigma-Aldrich, 1:5,000) as secondary antibody. Peroxidase activity was visualized using the ECLplus western blot detection kit from Amersham Biosciences (Piscataway, N.J., USA).
Fluorescence. Fluorescence spectra were recorded on a FluoroMax 3 Spectrofluorometer (Jobin Yvon Inc, Edison, N.J., USA). Spectra were taken in 10 mM NH4HCO3 or 10 mM Tris(hydroxymethyl)aminomethane (Tris)/HCl (pH 8.0) at 25° C. Integration time was Is, step size was 0.5 nm and band widths were 5 nm (excitation) and 5 nm (emission), respectively.
Secondary structure analysis. Far-UV circular dichroism (CD) spectra were obtained using a Jasco 715 spectropolarimeter equipped with a temperature control unit (Jasco International Co. Ltd., Tokyo, Japan). Spectra were taken at a protein concentration of 150 μg/ml in 10 mM Tris/HCl (pH 8.0) in a 0.1 cm path length quartz cuvette at 20° C. Scan speed was 20 nm/min, step size was 0.2 nm, integration time was set to 1 s and band width was 1 nm. Four scans were averaged and buffer-corrected.
Aggregation assay. To test the solubility of the proteins at different pH-values and different phosphate concentrations, respectively, lyophilized protein was dissolved in 6M GdmSCN and dialysed against 10 mM Tris/HCl (pH 8.0) at 4° C. All samples were incubated at room temperature for 2 hours in different buffers (see below), protein precipitates were removed from the samples by sedimentation at 125,000×g for 30 min and the amount of the remaining soluble protein was determined photometrically. Since the sum of soluble and aggregated protein had to equal the initial amount of soluble protein, the percentage of aggregated protein could be calculated by subtracting the amount of soluble protein from the initially used amount of protein. As a control, proteins were incubated in 10 mM Tris/HCl (pH 8.0).
Influence of pH-Values
Protein solutions were diluted 1:10 with buffers of different pH (Table 2). Final protein concentrations were 0.2 mg/ml in case of NHCYS3C16 and CCC16 and 0.174 mg/ml in case of C16CC.
Protein solutions were diluted 1:5 in KxHxPO4 (pH 8.0). Final protein concentrations were 0.4 mg/ml and phosphate concentrations were 50 mM, 100 mM, 200 mM, 300 mM and 500 mM.
Coupling of Rhodamine maleimide to thiol groups. In order to couple a small organic compound to modified spider silk proteins, the fluorescent dye rhodamine was coupled to the protein NHCYS3C16. A stock solution of 1 mM Rhodamine Red™ C2 maleimide (Molecular Probes, Leiden, The Netherlands) in DMSO was added to a protein solution in 10 mM Tris/HCl (pH 7.5) to give a molar excess of 20. The reaction was carried out over night in the dark at 4° C. To inactivate remaining non-coupled fluorescent dye, 100 mM 2-mercaptoethanol was added to the reaction before size exclusion chromatography (PD10 columns, Sephadex G 25, Pharmacia Biotech, Uppsala, Sweden). Fractions were collected, tested for the presence of protein by UV-spectrometry and finally analysed by SDS-PAGE. Visualization of proteins and the fluorophore was performed by silver staining and by fluorescent imaging using a Typhoon 9200 Variable Mode Imager (Molecular Dynamics, Amersham Pharmacia Biotech, Uppsala, Sweden) with an excitation wavelength of 532 nm and an emission wavelength of 580 nm, respectively.
Design, synthesis and purification of modified synthetic spider silks. Different modified modules based on the synthetic spider silk Module C (SEQ ID NO: 3), which is derived from the dragline silk protein ADF-4 from the garden spider Araneus diadematus, were created. The modifications contain one cysteine in each of the variants, either in a TAG or in the Module C. Therein, serine at position 25 was mutated to cysteine due to similar size and polarity of both amino acids. Additionally, the position was considered not to affect protein characteristics too much, as hydrophobicity predictions for this mutation differ only slightly from Module C. The resulting Module CC (SEQ ID NO: 10) was gained using PCR mutagenesis (see experimental procedures). In a following step, the nucleotide sequence of Module CC was cloned upstream or downstream the nucleotide sequence coding for C16 yielding proteins CCC16 and C16CC using cloning vector pAZL (SEQ ID NO: 29). Additionally, an oligonucleotide sequence encoding a TAG consisting of glycine, serine and one cysteine (NHCYS3, SEQ ID NO: 22) was cloned at the 5′-terminal nucleotide sequence coding for C16 to yield NHCYS3C16.
After bacterial synthesis, modified silk proteins were purified by a heat step followed by an ammonium sulphate precipitation. The identity of the proteins was confirmed by immunoblotting, using antibodies directed against T7-peptide tag sequences, attached to the amino-terminal end of all silk proteins. As comparison the unmodified protein C16 was applied. Besides full length proteins, traces of proteins with lower molecular weight were observed. In contrast to C16, all modified proteins, containing one cysteine each, revealed an additional protein band at higher molecular weight (
Modified C16 spider silks show the same secondary structure as non-modified C16. Secondary structure was investigated by CD spectroscopy. All modified proteins revealed spectra akin to C16, which displays a spectrum typical for intrinsically unstructured proteins (
Modified C16 spider silks are more susceptible towards phosphate and pH than non-modified C16. pH, ions, such as potassium and phosphate, and mechanical stress are involved in natural silk assembly. We investigated the influence of different potassium phosphate concentrations and varying pH on the aggregation behaviour of modified proteins CCC16, C16CC and NHCYS3C16 in comparison to C16. All modified proteins showed significant aggregation (>10%) at pH-values below 5.0, CCC16 even at values below 7.0 and showed more than 70% aggregation at pH 1. C16, in contrast, only displayed moderate aggregation under these conditions (
Synthetic spider silk proteins derived from spider silk sequences ADF-3 and ADF-4 can be assembled into morphological distinct forms, like spheres, nanofibrils, foams and films. The following experiments were performed to demonstrate, that modified spider silk proteins show the same features concerning distinct assembly behaviour.
Protein spheres, displaying diameters ranging between 0.3 and 1.5 μm (
Nanofibrils were formed by incubating solutions of C16CC and NHCYS3C16 in 10 mM Tris pH 8.0 at 4° C. for several weeks followed by incubation at room temperature for 3 days (
Films made of synthetic spider silk proteins derived from the dragline silk protein ADF-4 from the garden spider Araneus diadematus can be cast from hexafluoro-2-propanol (HFIP) or formic acid (5). Lyophilized proteins were directly dissolved in HFIP or formic acid. As observed for C16, HFIP induces an increase in secondary structure of the modified proteins CCC16, C16CC and NHCYS3C16. While CD spectra of these proteins in 10 mM Tris (pH 8.0) showed only a single minimum at a wavelength below 200 nm (
From modified spider silk proteins films could be cast out of HFIP as well as from formic acid. Films were cast on a polystyrene surface, where they could be easily peeled off after evaporation of the solvent (
Modification of synthetic spider silks by a cysteine or lysine should allow for specific coupling of drugs, metals, polypeptides, quantum dots etc. In order to demonstrate the coupling of the SH-group of a cysteine to small organic molecules, the fluorophore rhodamine was coupled to the protein NHCYS3C16. Rhodamine was used in a maleimide-conjugated form, which reacts readily and very specifically with SH-groups at pH 7.0-7.5. Effective coupling was visualized by SDS-PAGE followed by fluorescence imaging and silver staining (
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/EP2006/008452 | 8/29/2006 | WO | 00 | 1/14/2009 |
| Number | Date | Country | |
|---|---|---|---|
| 60712095 | Aug 2005 | US |
