Patent Application
20230398207
The present application claims the right of priority of European patent application 20213488.8 filed with the European Patent Office on 11 Dec. 2020, the entire content of which is incorporated herein for all purposes.
This application contains a Sequence Listing in computer readable form, which is incorporated herein by reference.
The present invention relates to a method of modulating Th1/Th2 immune response by co-administering (i.e., at the same time) a population of polymersomes having an associated antigen together with a population of polymersomes having an associated adjuvant as well as compositions comprising the two populations of polymersomes. The invention also relates to compositions comprising such two populations of polymersomes and therapeutic uses of such two populations of polymersomes. The antigen may be any antigen that is able to elicit an immune response and may, for example, be a polypeptide, a carbohydrate, a polynucleotide as well as combinations thereof.
Although immunization is a well-established process, there are differences in the response level elicited between different immunogens or antigens. For example, membrane proteins form a class of antigens that produce a low response level, which in turn means that large amounts of membrane proteins are required to generate or elicit an immune response to the desired level. Membrane proteins are notoriously difficult to synthesize and are insoluble in water without the presence of a detergent. This makes it expensive and difficult to obtain membrane proteins in sufficient quantity for immunization. Furthermore, membrane proteins require proper folding to function correctly. The immunogenicity of correctly folded native membrane proteins is typically much better than that of their solubilized forms, which may not be folded in a physiologically relevant manner. Thus, even though adjuvants may be used to boost the immunogenicity of such solubilized antigens, it is an inefficient method that does not provide too much of an advantage (e.g., WO2014/077781A1).
Although transfected cells and lipid-based systems have been used to present membrane protein antigens to increase the chances of isolating antibodies that may be efficient in vivo, these systems are often unstable (e.g., oxidation sensitive), tedious and costly. Moreover, the current state of the art for such membrane protein antigens is to use inactive virus-like particles for immunization.
On the other hand, vaccines are the most efficient way to prevent diseases, mainly infectious diseases [e.g., Liu et al., 2016]. As of today, most of the licensed vaccines are made of either live or killed viruses. Despite their effectiveness in generating a humoral response (an antibody mediated response) to prevent viral propagation and entry into cells, safety of such vaccines remains a concern. In the past few decades, scientific advances have helped to overcome such issues by engineering vaccine vectors that are non-replicating recombinant viruses. In parallel, protein based antigens or sub-unit antigens are explored as safer alternatives. However, such protein based vaccines typically illicit poor immune (both humoral and cellular response). To improve immunogenic properties of antigens, several approaches have been used. For example, microencapsulation of antigens into polymers have been investigated extensively, although it did enhance the immunogenicity, aggregation and denaturing of antigens remain unsolved [e.g., Hilbert et al., 1999]. Furthermore, adjuvants (e.g., oil in water emulsions or polymer emulsions) [e.g., U.S. Pat. No. 9,636,397B2, US2015/0044242 A1] are used together with antigens to elicit a more pronounced humoral and cellular response. Despite these advances, they are less efficient in uptake and cross-presentation. To promote cross-presentation, based on the available information of the immune system during infection by viruses, viral like particles that mimics such properties have been exploited. Synthetic architectures such as liposomes with encapsulated antigens are particularly attractive. Liposomes are unilamellar self-assembling structures made of lipids and, cationic liposomes are more attractive and promising as delivery vehicles because of their efficient uptake by Antigen Presenting Cells (APCs) [e.g., Maji et al., 2016]. Furthermore, it allows to integrate immunomodulators such as Monophosphoryl Lipid A (MPL), CpG oligodeoxynucleotide, that are toll-like receptor (TLR) agonists which stimulate immune cells through receptors. Despite these opportunities of such delivery vehicles, one of the limiting factors is stability of liposomes in the presence of serum components. By PEGylations, loading with high melting temperature lipids, stability issues of liposomes are somewhat reduced with and one such well characterized example being interbilayered-crosslinked multilamellar vesicles (ICMVs), formed by stabilizing multilamellar vesicles with short covalent crosslinks linking lipids [e.g., Moon et al., 2011]. Other nanoparticle architectures have led to successful immunisations using nanodiscs [e.g., Kuai et al., 2017] or pH sensitive particles [e.g., Luo et al., 2017]. But such strategies either still requires adjuvants or are not as efficient outside the prototypical Ovalbumin (OVA) models.
In addition, polymersomes, offer as a stable alternative for liposomes and they have been used to integrate membrane proteins to elicit immune response [e.g., Quer et al., 2011, WO2014/077781A1]. Protein antigens were also encapsulated in a chemically altered membrane of the polymersome (however oxidation-sensitive membranes) to release antigens and the adjuvants to dendritic cells [e.g., Stano et al., 2013].
Despite this progress made by the use of polymers, there remains a need to provide alternative methods of eliciting and/or modulating an immune response, in particular for treatment and/or prevention of infectious diseases, cancers and autoimmune diseases. Furthermore, there particularly remains a need to modulate an immune balance between a Th1 immune response and a Th2 immune response such that the Th1 immune response becomes dominant over the Th2 immune response
The present invention relates to a method of modulating an immune response in a subject by administering (e.g., co-administering, e.g., simultaneously administering, consecutive administering, e.g., substantially simultaneous administration, e.g. where the administration may be for example be done via two separate injections administered on or around the same time e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30 minutes from each other) an antigen and an adjuvant, wherein the antigen is associated with a first population of polymersomes, wherein the adjuvant is associated with a second population of polymersomes, wherein the two populations of polymersomes are administered to the subject, and wherein administering of the two separate populations modulates said immune response by increasing the number of CD4+ T cells that express one or more Th1 cytokines selected from the group consisting of IFNγ-, TNFα-, IL-2 and IL-12 compared to administering to the subject the adjuvant in a free form and/or compared to administering the antigen alone when associated with a first population of polymersomes, preferably wherein the two populations of polymersomes are capable of modulating an immune balance between a Th1 immune response and a Th2 immune response, preferably wherein the two populations of polymersomes are capable of modulating an immune balance between a Th1 immune response and a Th2 immune response so that the Th1 immune response becomes dominant over the Th2 immune response.
The present invention further relates to a method of eliciting and/or modulating an immune response in a subject by administration of an antigen and an adjuvant, wherein the antigen is associated with a first population of polymersomes, and wherein the adjuvant is associated with a second population of polymersomes, and wherein the two populations of polymersomes are administered to the subject.
In such a method the antigen may be associated with the first population of polymersomes by encapsulation of the antigen within the first population of polymersomes, by integration of the antigen into the circumferential membrane of the polymersomes of the first population of polymersomes, by conjugation of the antigen to the exterior surface of the polymersomes via a covalent bond and/or by conjugation of the antigen to the exterior surface of the polymersomes via a non-covalent bond.
In such a method also the adjuvant may be associated with the second population of polymersomes by encapsulation of the adjuvant within the second population of polymersomes, by integration of the adjuvant into the circumferential membrane of the polymersomes of the second population of polymersomes, by conjugation of the adjuvant to the exterior surface of the polymersome via a covalent bond and/or by conjugation of the adjuvant to the exterior surface of the polymersome via a non-covalent bond.
In embodiments of the method the antigen may be selected from the group consisting of: a polypeptide, a carbohydrate, a polynucleotide and combinations thereof.
The present invention further relates to a method for production of the two populations of polymersomes. The present invention further relates to compositions comprising the two populations of polymersomes of the present invention, isolated antigen presenting cells and hybridoma cells exposed to polymersomes or compositions of the present invention. The present invention also relates to vaccines comprising the two populations of polymersomes of the present invention, methods of eliciting and/or modulating an immune response or methods for treatment, amelioration, prophylaxis or diagnostics of cancers, autoimmune or infectious diseases, such methods comprising providing polymersomes of the present invention to subject in need thereof.
The invention also relates to the use of the two populations of polymersomes, wherein at least one polymersome population has or both populations have a mean diameter of about 120 nm or 140 nm or more, wherein the population of polymersomes has associated with the polymersomes an antigen or an adjuvant, for example a soluble encapsulated antigen or an encapsulated adjuvant, wherein said antigen may be selected from the group consisting of:
The invention also relates to the use of the two populations of polymersomes, wherein at least one population has or both populations have a mean polymersome diameter of about 120 nm, or 140 nm or more, the polymersomes of the population having associated either an antigen, for example, a soluble encapsulated antigen, or an adjuvant for eliciting and/or modulating an immune response. The antigen may be selected from the group consisting of:
In an alternative embodiment, the invention provides a method of eliciting and/or modulating an immune response in a subject by administration of an antigen and an adjuvant, wherein the antigen is associated with a first population of polymersomes, and wherein the second population of polymersomes acts as an adjuvant, and wherein the two populations of polymersomes are administered to the subject.
In the present invention it was found that administration of two separate populations of polymersomes, wherein one population of polymersomes is associated with an antigen and the other population of polymersomes is associated with only an adjuvant, leads to an increase in the immune response. Furthermore, in the course of the present invention it was found that providing the polymersomes of the present invention allows soluble (or solubilized) encapsulated (in said polymersomes) antigens to produce a stronger humoral immune response (compared to free antigens with or without adjuvants) as well as elicit a CD8(+) T cell-mediated immune response. Consequently, an increase in the efficiency of antibody production in a subject is achieved. The increase in the efficiency can be attained with or without the use of adjuvants. Furthermore, the ability of the polymersomes of the present invention to elicit a CD8(+) T cell-mediated immune response dramatically increases their potential as an immunotherapeutic antigen delivery and presentation system.
Because soluble (e.g., solubilized) encapsulated antigens presented by polymersomes, the antibodies produced by the use of polymersomes and methods of the present invention would not only have a higher production success rate and higher affinity for their corresponding in vitro or in vivo targets and accordingly improved sensitivity when used in various solution-based antibody applications, but also would make possible to easily raise antibodies to difficult antigens not capable of triggering antibody production by conventional methods using free antigen injections and/or decrease the amount of antigen required for such antibody production procedure thus decreasing the cost of such a production. Furthermore, soluble (e.g., solubilized) encapsulated antigens presented by polymersomes of the present invention are also capable of eliciting a CD8(+) T cell-mediated immune response, which extends the use of corresponding polymersomes to cell-mediated immunity and therefore improves their immunotherapeutic- and antigen delivery and presentation potential.
Therefore, the present application satisfies the demand by provision of two separate populations of polymersomes that, when administered, improve the immunogenic properties of antigens, methods for production of such two populations of polymersomes and compositions comprising such two populations of polymersomes, described herein below, characterized in the claims and illustrated by the appended Examples and Figures.
Overview of the Sequence Listing
As described herein references are made to UniProtKB Accession Numbers (http://www.uniprot.org/e.g., as available in UniProtKB Release 2017_12, unless indicated otherwise or otherwise inherent).
As described herein references are made to GenBank Accession Numbers, e.g., as available from GenBank release 239.0 (8/18/2020), unless indicated otherwise or otherwise inherent.
The following detailed description refers to the accompanying Examples and Figures that show, by way of illustration, specific details and embodiments, in which the invention may be practised. These embodiments are described in sufficient detail to enable those skilled in the art to practice the invention. Other embodiments may be utilized such that structural, logical, and eclectic changes may be made without departing from the scope of the invention. Various aspects of the present invention described herein are not necessarily mutually exclusive, as aspects of the present invention can be combined with one or more other aspects to form new embodiments of the present invention.
The present invention is based on the surprising finding that two separate populations of polymersomes, wherein the first population of polymersomes is associated with only antigen and the second population of polymersomes is associated with only adjuvant, when administered together, improve the immune response to the antigen, thereby providing either immunization or a curative effect, for example, to an infectious disease or cancer (cf. Examples 7 to 9 or Example 19 of the present application, with Example 8 showing that administration of a first polymersome population having encapsulated antigen together with a separate second polymersome population having encapsulated CpG (adjuvant) produce an immune response in mice for which both the tumor load and T-cell infiltration correlates, with Example 9 showing that administration of an immunogenic tumor neoantigen Trp2 peptide encapsulated in a first population of polymersomes together with a CpG oligonucleotide (adjuvant) encapsulated in a second (separate) population showed a much stronger anti-tumor response compared to, for example, free Trp2 peptide and with Example 19 showing the highest immune response against the spike protein of the Sars-CoV-2 virus when the spike protein of Sars-CoV-2 is encapsulated in a first population of polymersomes and a CpG oligonucleotide (adjuvant) is encapsulated in a second (separate) population. The finding that such two separate populations of polymersomes result in an improved immune response has the added advantage that is allows to produce the two populations of polymersomes separately/independently from each other. This in turn simplifies, for example, GMP production of a respective vaccine or therapeutic composition, since the first population of polymersomes, which for example, comprises an antigen encapsulated in the polymersomes or conjugated to the surface of the polymersomes, can be produced under standardized GMP conditions, while the second population of polymersomes, which, for example, comprises an adjuvant encapsulated in the polymersomes or conjugated to the surface of the polymersomes, can also be produced under standardized conditions. These two populations can then be combined either in the manufacturing process (to yield a composition that combines both populations of polymersomes for co-administration) or can be administered to a subject separately. Such a drug/vaccine manufacturing process is much easier to control than to, for example, encapsulate both antigen and adjuvant in the same polymersome population.
The antigen can be associated with the first population of polymersomes by any possible interaction of the antigen with the first population of polymersomes. For example, the antigen may be encapsulated within the first population of polymersomes as described in co-pending PCT application PCT/EP2019/051853, filed 25 Jan. 2019, the entire content of which is incorporated by reference herein. Alternatively, the antigen may be integrated into the circumferential membrane of the polymersomes of the first population of polymersomes as described in International Application WO2014/077781. It is also possible that the antigen is conjugated to the exterior surface of the polymersomes of the first polymersome population via a covalent bond as described in co-pending European patent application 18193946.3, filed 12 Sep. 2018, the entire content of which is incorporated by reference herein.
It is further possible to conjugate the antigen to the exterior surface of the polymersomes of the first polymersome population via a non-covalent bond. Examples of such non-covalent bonds include electrostatic interactions such as salt-bridges between positively and negatively charged residues that are present on surface of the polymersome or the surface of the antigen. For example, a salt bridge can be formed between a positively charged amino group (NH2 group) and a negatively charged carboxylate group (COOH). A further illustrative example of such a non-covalent interaction between the first polymersome population and the antigen are binding pair between streptavidin and biotin, avidin and biotin, streptavidin and a streptavidin binding peptide, or avidin and an avidin binding peptide. For example, polymersomes with biotin groups located on their surface can be prepared as described in Broz et al “Cell targeting by a generic receptor-targeted polymer nanocontainer platform” Journal of Controlled Release. 2005; 102(2):475-488 and can be reacted with an antigen that is conjugated to streptavidin or avidin. Non-covalent biotin-streptavidin conjugates of polymersomes with antigens can also prepared as described by Egli et al, “Functionalization of Block Copolymer Vesicle Surfaces Polymers” 2011, 3(1), 252-280. In this context, the term “an antigen associated with a first population of polymersomes” as used herein does not mean that only one particular antigen is associated with the first population of polymersomes but also includes that more than one, for example, two or more antigens can be associated with the first population of polymersomes. As an illustrative example, for example, two or more immunogenic peptides can be associates with a first population of polymersomes of the present invention. It is also possible that one or more immunogenic peptides and respective nucleic acid molecules encoding these peptides are associated with a first population of polymersomes as used herein. The term “an antigen associated with a first population of polymersomes” as used herein also means that two or more first populations of polymersomes, each of which carries a different antigen can be used in the present invention. For example, it is possible to use two different antigenic peptides and associate each of them with a separate first polymersome population of the invention.
The adjuvant can be associated with the second population of polymersomes by also any possible interaction, in the same manner as the association of the antigen with the first population of polymersomes can occur. This means, the adjuvant may be encapsulated within the first population of polymersomes as described in co-pending PCT application PCT/EP2019/051853, filed 25 Jan. 2019, the entire content of which is incorporated by reference herein. Alternatively, the adjuvant may be integrated into the circumferential membrane of the polymersomes of the first population of polymersomes as described in International Application WO2014/077781. Illustrative examples of adjuvants that can be incorporated/integrated into the circumferential membrane of polymersomes (of the second polymersome population) include synthetic monophosphoryl lipid A (cf. in this respect Cluff “Monophosphoryl Lipid A (MPL) as an Adjuvant for Anti-Cancer Vaccines: Clinical Results” in Lipid A in Cancer Therapy, edited by Jean-Frangois Jeannin, 2009 Landes Bioscience and Springer), polysorbate 80, Alpha-DL-Tocopherol, dioleoyl-3-trimethylammonium propane (DOTAP), the cationic lipid 1-[2-(oleoyloxy)ethyl]-2-oleyl-3-(2-hydroxyethyl)imidazolinium chloride (DOTIM) (see Bernstein et al “The Adjuvant CLDC Increases Protection of a Herpes Simplex Type 2 Glycoprotein D Vaccine in Guinea Pig” Vaccine. 2010 May 7; 28(21): 3748-3753, or the synthetic amphiphile dimethyldioctadecylammonium (DDA) (see Smith Korsholm et al “The adjuvant mechanism of cationic dimethyldioctadecylammonium liposomes” Immunology,121,216-226) to name only a few. It is evident in this context, the one or more adjuvants can be present in the polymersomes of the second polymersome population used herein. For example, the second polymersome population may comprise an encapsulated adjuvant such as a CpG oligonucleotide and an adjuvant that is integrated into the circumferential membrane of the polymersomes such as monophosphoryl lipid A or DOTAP (in accordance with the above disclosure the second polymersome population is however free of antigen, meaning it does not contain any antigen).
In line with the above, it is of course also possible that the adjuvant is conjugated to the exterior surface of the polymersomes of the first polymersome population via a covalent bond as described in co-pending European patent application 18193946.3, filed 12 Sep. 2018, the entire content of which is incorporated by reference herein. Alternatively, the conjugation of the adjuvant to the exterior surface of the polymersome may also tale place via a non-covalent bond such as a biotin-streptavidin interaction. It is noted here that CpG oligonucleotides such as the class B CpG oligodeoxynucleotide CpG ODN1826 (5′-tccatgacgttcctgacgtt-3′, SEQ ID NO: 18) is available in biotinylated form and can thus be readily reacted with a biotinylated polymersome that is “decorated” with streptavidin as described in Broz et al “Journal of Controlled Release. 2005; supra. Also, from this example it is evident that the second polymersome population may carry more than one (kind of) adjuvants, for example, a CpG oligonucleotide covalently or non-covalently conjugated to the exterior surface of the polymersomes and a further adjuvant such as monophosphoryl lipid A or DOTAP integrated into the circumferential membrane of the polymersomes. It is further evident that the same adjuvant may be associated with the second polymersome population in different ways, for example, a CpG oligonucleotide can be encapsulated into the polymersomes and at the same time covalently or non-covalently conjugated to the exterior surface of the polymersome. By so doing, a higher amount of adjuvant can be provided for administration, if desired.
In line with the above disclosure, any kind of first polymersome population can be used for administration with any kind of second polymersome population, regardless of how the antigen and the adjuvant is associated with the first and second polymersome population. For example, the first population of polymersomes may have the antigen encapsulated within the polymersomes and also the second population of polymersomes may have the adjuvant encapsulated within the polymersomes. Alternatively, the first population of polymersomes may have the antigen conjugated to the exterior surface of the polymersomes by a covalent or a non-covalent bond while also the second population of polymersomes has the adjuvant conjugated to the exterior surface of the polymersomes by a covalent or a non-covalent bond. As a further purely illustrative example, the first population of polymersomes may have the antigen integrated into the circumferential membrane of the polymersomes and the second population of polymersomes may also have the adjuvants integrated into the circumferential membrane of the polymers. As further illustrative examples, the first population of polymersomes may have the antigen encapsulated within the polymersomes while the second population of polymersomes may have a) the adjuvant conjugated to the exterior surface of the polymersomes by a covalent or non-covalent bond or b) may also have the adjuvant integrated into the circumferential membrane of the polymersome. As yet a further illustrative example, the first population of polymersomes may have the antigen conjugated to the exterior surface of the polymersomes by a covalent bond and the second population of polymersomes may have the adjuvant encapsulated within the polymersomes.
Addressing now the administration of the two polymersome populations of the invention in more detail: the first population of polymersomes and the second population of polymersomes can be administered to a subject either simultaneously (i.e. at the same time) or at a different time. In case the two populations are simultaneously administered, the two populations of polymersomes may be administered together (i.e. by co-administration). In that case, the two populations of polymersomes are combined or mixed together prior to administration and are thus present in the same composition, for example, a pharmaceutically acceptable carrier (such as a physiological buffer or a solid formulation suitable for oral administration). In case of administration at the same time, it is however also possible to administer each of the two populations of polymersomes individually. In that case, the two populations of polymersomes are of course not combined with each other prior to administration, and for example may be administered via two or more separate injections.
The two populations of polymersomes can be administered to a chosen subject in any way that is known for eliciting and/or modulating an immune response (e.g., co-administration or consecutive administration or substantially simultaneous administration, e.g. where the administration may be for example be done via two separate injections administered on or around the same time) in a subject and that is suitable for administering the polymersome population to the given subject. In case fish or farm animals such as chicken, pigs or sheep are to be immunized, it may be advantageous to use oral administration, for example, and formulate a composition containing the two polymersome populations of the invention as food additive. Alternatively, intradermal administration by means of an injection gun or jet injector may be used for farm animals. For humans, both invasive and non-invasive administration can be used. Suitable administration routes for both human and non-human animals include but are not limited to oral administration, intranasal administration, administration to a mucosal surface, inhalation, intradermal administration, intraperitoneal administration, subcutaneous administration, intravenous administration or intramuscular administration.
Turning to conjugation of the antigen and/or the adjuvants to exterior surface of polymersomes of either the first or second polymersome population in more detail, the covalent bond can be any suitable covalent bond capable of conjugating an antigen (e.g., the antigen of the present invention) or an adjuvant to the exterior surface of the polymersome of the present invention. Conjugating reactions producing covalent bonds of the present invention are well known in the art (e.g., NHS-EDC conjugations, reductive amination conjugations, sulfhydryl conjugations, “click” and “photo-click” conjugations, pyrazoline conjugations etc.). Non-limiting examples of such covalent bonds and methods of producing thereof are listed below herein. Thus, in some aspects, the covalent bond via which the antigen or adjuvant of the present invention is conjugated to the exterior surface of the polymersome of the present invention comprises: i) an amide moiety (e.g., as described in the Examples section herein); and/or ii) a secondary amine moiety (e.g., as described in the Examples section herein); and/or iii) a 1,2,3-triazole moiety (e.g., as described in van Dongen et al., 2008, Macromol. Rapid Communications, 2008, 29, pages 321-325), preferably said 1,2,3-triazole moiety is a 1,4-disubstituted[1,2,3]triazole moiety or a 1,5-disubstituted[1,2,3]triazole moiety (e.g., as described in Boren et al., 2008); and/or iv) pyrazoline moiety (e.g., as described in de Hoog et al., Polym. Chem., 2012,3, 302-306) and/or an ether moiety. It is noted in this context that it might be necessary to modify both the polymersome and the antigen, for example a protein, for the conjugation/formation of the covalent bond between the exterior surface of the polymersome and the antigen. In addition to classical chemical conjugation chemistry (reaction) as described above, it is also possible to form the covalent bond between the exterior surface of the polymersome and the antigen by enzymatic reaction.
In some aspects, the present invention relates to NHS-EDC conjugation (i.e., conjugation based on N-hydroxysuccinimide (NHS), and 1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC)) is one of the exemplary alternative ways of conjugating antigens to polymersomes of the present invention. In this method, carboxylic acid groups react with EDC producing an intermediate O-acylisourea that is then reacts with primary amines to form an amide moiety with said carboxyl group.
In some aspects, the present invention relates to a reductive amination conjugation, which is another exemplary alternative way of conjugating antigens or adjuvants to polymersomes of the present invention. In this method an aldehyde-containing compound is conjugated to amine-containing compound to form a Schiff-base intermediate that in turn undergoes reduction to form a stable secondary amine moiety.
In some aspects, the present invention relates to a sulfhydryl conjugation, which is another exemplary alternative way of conjugating an antigen or adjuvant to polymersomes of the present invention. In this method sulfhydryl (—SH) containing compound (e.g., present in side chains of cysteine) is conjugated to sulfhydryl-reactive chemical group (e.g., maleimide) via alkylation or disulfide exchange to form a thioether bond or disulfide bond respectively.
In some aspects, the present invention relates to a so-called “click” reaction (also known as “azide-alkyne cycloaddition”) on polymersome surface (e.g., described by van Dongen et al., 2008, supra), which is another exemplary alternative way of conjugating antigens to polymersomes of the present invention. According to this method a 1,2,3-triazole moiety is produced in that an aqueous solution of azido-functionalised antigens (e.g., a polypeptide) is added to a dispersion of polymersomes, followed by an addition of a premixed aqueous solutions of Cu(II)SO4·5H2O with sodium ascorbate and bathophenanthroline ligand to the resulting dispersion of polymersomes and then left at 4° C. for 60 hours, followed by filtering of said dispersion with a 100 nm cutoff and centrifuging to dryness. In this context it is further noted that copper-catalysed reaction of azide-alkyne cycloaddition” (also known as CuAAC) allows for synthesis of the 1,4-disubstituted regioisomers specifically, whereas a ruthenium-catalysed reaction of azide-alkyne cycloaddition (also known as RuAAC) (e.g., using Cp*RuCl(PPh3)2 as catalysator) allows for the production of 1,5-disubstituted triazoles (cf. R. Johansson, Johan & Beke-Somfai, Tames & Said Stalsmeden, Anna & Kann, Nina. (2016). Ruthenium-Catalyzed Azide Alkyne Cycloaddition Reaction: Scope, Mechanism, and Applications. Chemical Reviews. 116. 10.1021/acs.chemrev.6b00466.).
In some aspects, the present invention relates to a photo-induced generation of the nitrile imine intermediate (e.g., generated from bisaryl-tetrazoles) and its cycloaddition to alkenes (a so-called photo-induced cycloaddition or “photo-click” reaction, e.g., described by de Hoog et al., 2011, supra), which is another exemplary alternative way of conjugating antigens to polymersomes of the present invention. According to this method, ABA block copolymer is methacrylate (MA) terminated or hydroxyl terminated with tetrazole by the photo-induced generation of the nitrile imine intermediate producing ABA polymersomes containing MA-ABA and hydroxyl terminated ABA copolymer, followed by reacting said polymersomes with tetrazole-containing antigen (HRP) under UV-irradiation to produce a pyrazoline moiety.
The covalent bond that conjugates the antigen or the adjuvant to the exterior surface of the polymersome can either be formed between an atom/group of a molecule such an amphiphilic polymer that is part of (present in) of the circumferential membrane of the polymersome. Alternatively, the covalent bond between the antigen or the antigen and the exterior surface of the polymer is formed via a linker moiety that is attached to a molecule that that is part of (present in) of the circumferential membrane of the polymersome. The linker may have any suitable length and can have a length of one main chain atom (for example, if the linker is a simple carbonyl group (C═O) that yields an amide or an ester moiety forming the covalent linkage). An illustrative example for such “one atom/linker moiety with a length of one main atom is the modification of the amphiphilic polymer BD21 by Dess-Martin periodinane carried out in the Example Section to yield BD21-CHO (i.e. a terminal aldehyde group) which is then used to form an amine bond with the selected antigen (hemagglutinin is used as a purely illustrative example antigen in the Experimental Section. Alternatively, the linker moiety may have a length of several hundreds or even more main chain atoms, for example, if a moiety such as polyethylenglycol (PEG) that is commonly used for conjugation (covalent coupling) of polypeptides with a molecule of interest. As a purely illustrative example see distearoylphosphatidylethanolamine [DSPE] polyethylene glycol (DSPE-PEG) conjugates discussed below and used in the Example Section of the present application. The DSPE-PEG(3000) linker moiety used in the Example section has about 65 ethylene oxide (CH2—CH2—O)-subunit and thus about 325 main chain atom in the PEG part alone and a total length of about 408 main chain atoms. In line with the above, illustrative embodiments, the linker moiety may comprise 1 to about 550 main chain atoms, 1 to about 500 main chain atoms, 1 to about 450 main chain atoms, 1 to about 350 main chain atoms, 1 to about 300 main chain atoms, 1 to about 250 main chain atoms, 1 to about 200 main chain atoms, 1 to about 150 main chain atoms, 1 to about 100 main chain atoms, 1 to about 50 main chain atoms, 1 to about 30 main chain atoms, 1 to about 20 main chain atoms, 1 to about 15 main chain atoms, or 1 to about 12 main chain atoms, or 1 to about 10 main chain atoms, wherein the main chain atoms are carbon atoms that are optionally replaced by one or more heteroatoms selected from the group consisting of N, O, P and S.
Also in accordance with the above disclosure, the linker moiety may be a peptidic linker or a straight or branched hydrocarbon-based linker. The linker moiety may also be or a co polymer with a different block length. The linker moiety used in the present invention may comprise a membrane anchoring domain which integrates the linker moiety into the membrane of the polymersome. Such a membrane anchoring domain may comprise a lipid such as a phospholipid or a glycolipid. The glycolipid used in membrane anchoring domain may comprise glycophosphatidylinositol (GPI) which has been widely used a membrane anchoring domain (see, for example, International Patent Applications WO 2009/127537 and WO 2014/057128). The phospholipid used in the linker of the present invention may be phosphosphingolipid or a glycerophospholipid. In illustrative examples of such a linker, the phosphosphingolipid may comprise as a membrane anchoring domain distearoylphosphatidylethanolamine [DSPE] conjugate to polyethylene glycol (PEG) (DSPE-PEG). In such conjugates, the DSPE-PEG may comprise any suitable number of ethylene oxide, for example, from 2 to about 500 ethylene oxide units. Illustrative examples include DSPE-PEG(1000), DSPE-PEG(2000) or DSPE-PEG(3000) to name only a few. Alternatively, the phospholipid (phosphosphingolipid or a glycerophospholipid) may comprise cholesterol as membrane anchoring domain. Cholesterol-based membrane anchoring domains are, for instance, described in Achalkumar et al, “Cholesterol-based anchors and tethers for phospholipid bilayers and for model biological membranes”, Soft Matter, 2010, 6, 6036-6051. In illustrative embodiments the linker moiety of such a membrane anchoring domain comprises 1 to about 550 main chain atoms, 1 to about 500 main chain atoms, 1 to about 450 main chain atoms, 1 to about 350 main chain atoms, 1 to about 300 main chain atoms, 1 to about 250 main chain atoms, 1 to about 200 main chain atoms, 1 to about 150 main chain atoms, 1 to about 100 main chain atoms, 1 to about 50 main chain atoms, 1 to about 30 main chain atoms, 1 to about 20 main chain atoms, 1 to about 15 main chain atoms, or 1 to about 12 main chain atoms, or 1 to about 10 main chain atoms, wherein the main chain atoms are carbon atoms that are optionally replaced by one or more heteroatoms selected from the group consisting of N, O, P and S.
Any kind of polymersome can be used in the present invention, as long as the polymersome is able to function as a carrier for the associated antigen or adjuvant. The polymersome can for example, be an oxidation-sensitive polymersome as described by Stano et al. “Tunable T cell immunity towards a protein antigen using polymersomes vs. solid-core nanoparticles, Biomaterials 34 (2013): 4339-4346” or in U.S. Pat. No. 8,323,696 of Hubbel. Alternatively, the polymersomes may also be insensitive to oxidation. Irrespective of chemical stability (including their possible sensitivity or insensitivity to oxidation), in the present invention, polymersomes are vesicles with a polymeric membrane, which are typically, but not necessarily, formed from the self-assembly of dilute solutions of one or more amphiphilic block copolymers, which can be of different types such as diblock and triblock (A-B-A or A-B-C). Polymersomes of the present invention may also be formed of tetra-block or penta-block copolymers. For tri-block copolymers, the central block is often shielded from the environment by its flanking blocks, while di-block copolymers self-assemble into bilayers, placing two hydrophobic blocks tail-to-tail, much to the same effect. In most cases, the vesicular membrane has an insoluble middle layer and soluble outer layers. The driving force for polymersome formation by self-assembly is considered to be the microphase separation of the insoluble blocks, which tend to associate in order to shield themselves from contact with water. Polymersomes of the present invention possess remarkable properties due to the large molecular weight of the constituent copolymers. Vesicle formation is favored upon an increase in total molecular weight of the block copolymers. As a consequence, diffusion of the (polymeric) amphiphiles in these vesicles is very low compared to vesicles formed by lipids and surfactants. Owing to this less mobility of polymer chains aggregated in vesicle structure, it is possible to obtain stable polymersome morphologies. Unless expressly stated otherwise, the term “polymersome” and “vesicle”, as used herein, are taken to be analogous and may be used interchangeably. Importantly, a polymersome of the invention can be formed from either one kind pf block copolymers or from two or more kinds of block copolymers, meaning a polymersome can also be formed from a mixtures of polymersomes and thus can contain two or more block copolymers. In some aspects, the polymersome of the present invention is oxidation-stable.
In some aspects, the present invention relates to a method for eliciting and/or modulating an immune response to a soluble (e.g., solubilized) encapsulated antigen in a subject. The method is suitable for injecting the subject with a composition comprising a polymersome (e.g., carrier or vehicle) having a membrane (e.g., circumferential membrane) of an amphiphilic polymer. The composition comprises a soluble (e.g., solubilized) antigen encapsulated by the membrane (e.g., circumferential membrane) of the amphiphilic polymer of the polymersome of the present invention. The antigen may be one or more of the following: i) a polypeptide; ii) a carbohydrate; iii) a polynucleotide (e.g., said polynucleotide is not an antisense oligonucleotide, preferably said polynucleotide is a DNA or messenger RNA (mRNA) molecule) or a combination of i) and/or ii) and/or iii).
In some further aspects, the present invention relates to polymersomes capable of eliciting a CD8(+) T cell-mediated immune response.
In some aspects, the present invention relates to polymersomes capable of targeting of lymph node-resident macrophages and/or B cells. Exemplary non-limiting targeting mechanisms envisaged by the present invention include: i) delivery of encapsulated antigens (e.g., polypeptides, etc.) to dendritic cells (DCs) for T cell activation (CD4 and/or CD8). Another one is: ii) delivery of whole folded antigens (e.g., proteins, etc.) that will be route to DC and will also trigger a titer (B cells).
In some aspects, the present invention relates to polymersomes encapsulating an antigen selected from a group consisting of: i) a self-antigen, ii) a non-self antigen, iii) a non-self immunogen and iv) a self-immunogen. Accordingly, the products and methods of the present invention are suitable for uses in settings (e.g., clinical settings) of induced tolerance, e.g., when targeting an autoimmune disease.
In some aspects, the present invention relates to polymersomes of the present invention comprising a lipid polymer.
The polymersomes of the present invention can also have co-encapsulated (i.e. encapsulated in addition to the antigen) one or more adjuvants. Examples of adjuvants include synthetic oligodeoxynucleotides (ODNs) containing unmethylated CpG motifs which can trigger cells that express Toll-like receptor 9 (including human plasmacytoid dendritic cells and B cells) to mount an innate immune response characterized by the production of Th1 and proinflammatory cytokines, cytokines such as Interleukin-1, Interleukin-2 or Interleukin-12, keyhole limpet hemocyanin (KLH), serum albumin, bovine thyroglobulin, or soybean trypsin inhibitor, too name only a few illustrative examples.
The polymersomes of the present invention can be of any size as long as the polymersomes are able to elicit an immune response. For example, the polymersomes may have a diameter of greater than 70 nm. The diameter of the polymersomes may range from about 100 nm to about 1 μm, or from about 100 nm to about 750 nm, or from about 100 nm to about 500 nm. The diameter of the polymersome may further range from about 125 nm to about 175 nm or, from about 125 nm to about 250 nm, from about 140 nm to about 240 nm, from about 150 nm to about 235 nm, from about 170 nm to about 230 nm, or from about 220 nm to about 180 nm, or from about 190 nm to about 210 nm. The diameter of the polymersomes may, for example, about 200 nm; about 205 nm or about 210 nm. When used as a (first and second) population to elicit an immune response, the population of polymersomes is typically a monodisperse population. The mean diameter of the used population of polymersomes is typically above 70 nm, or above 120 nm, or above 125 nm, or above 130 nm, or above 140 nm, or above 150 nm, or above 160 nm, or for above 170 nm, or above 180 nm, or above 190 nm (cf. also
In some aspects, the present invention relates to compositions of the present invention suitable for intradermal, intraperitoneal, subcutaneous, intravenous, or intramuscular injection, or non-invasive administration of an antigen of the present invention, for example, oral administration or inhaled administration or nasal administration. The composition may include a polymersome (e.g., carrier) of the present invention having a membrane (e.g., circumferential membrane) of an amphiphilic polymer. The composition further includes a soluble (e.g., solubilized) antigen encapsulated by the membrane of the amphiphilic polymer of the polymersome. The compositions of the present invention may be used for therapeutic purposes (for example, treatment of a subject suffering from a disease or for preventing from suffering from a disease, for example, by means of vaccination) or be used in antibody discovery, vaccine discovery, or targeted delivery.
In some aspects, polymersomes of the present invention have hydroxyl groups on their surface. In some further aspects, polymersomes of the present invention do not have hydroxyl groups on their surface.
In some aspects, the method for eliciting and/or modulating an immune response according to the present disclosure comprises priming and/or activation of naïve CD8+ T cells. In some aspects, the method for eliciting and/or modulating an immune response according to the present disclosure comprises priming and/or activation of CD4+ T cells. In some aspects, the method for eliciting and/or modulating an immune response according to the present disclosure comprises inducing an increase in IFNγ-expressing CD4+ T cells. In some aspects, the method for eliciting and/or modulating an immune response according to the present disclosure comprises inducing an increase in TNFα-expressing CD4+ T cells. In some aspects, the method for eliciting and/or modulating an immune response according to the present disclosure comprises inducing an increase in IL-2-expressing CD4+ T cells. In some aspects, the method for eliciting and/or modulating an immune response according to the present disclosure comprises inducing an increase in IFNγ-expressing CD8+ T cells. In some aspects, the method for eliciting and/or modulating an immune response according to the present disclosure comprises inducing functional memory CD4+ T cells. Preferably, such functional memory CD4+ T cells can be detected about 40 days after immunization. In some aspects, the method for eliciting and/or modulating an immune response according to the present invention comprises inducing functional memory CD8+ T cells. Preferably, such functional memory CD8+ T cells can be detected about 40 days after immunization. In some aspects, the method for eliciting and/or modulating an immune response according to the present invention comprises inducing CD8+ T cells specific for the Spike protein. In some aspects, the method for eliciting and/or modulating an immune response according to the present invention comprises inducing antibodies against the Spike protein. Preferably, such antibodies are capable of neutralizing a virus comprising said Spike protein. Preferably, such antibodies are capable of neutralizing a virus that is pseudotyped with the Spike protein. Preferably, such antibodies are capable of neutralizing a virus selected from the group consisting of HCoV-229E, HCoV-NL63, SARS-CoV-1, SARS-CoV-2, MERS—CoV, HCoV-OC43, and HCoV-HKU1, with MERS-CoV or SARS-CoV-2 being preferred, with SARS-CoV-2 being most preferred. Preferably, the method includes inducing the antibody in a titer that is capable of neutralizing one of the aforementioned viruses, wherein the titer is preferably in the blood, which may be determined in blood serum. Preferably, such neutralizing titers are persistent for at least 40 days after the last administration of the polymersomes or combination of polymersomes. Preferably, the antibody is an IgG antibody. Preferably, the method comprises inducing an IgG1:IgG2b ratio of less than about 1, which means that more IgG2b antibodies than IgG1 antibodies are induced, in particular if a combination of the disclosure is applied. Preferably, any one of the aforementioned effects are achieved by administration (e.g., co-administration) of a a composition of the disclosure (cf. as shown in Examples 20-23 below).
In the present context, the term “modulating” as used herein may have the meaning of regulating and/or altering, e.g., regulating and/or altering an immune response.
In the present context, the term “polypeptide” may be equally used herein with the term “protein”. Proteins (including fragments thereof, preferably biologically active fragments, and peptides, usually having less than 30 amino acids) comprise one or more amino acids coupled to each other via a covalent peptide bond (resulting in a chain of amino acids).
In the present context, T-cell surface glycoprotein CD4 (or cluster of differentiation 4, e.g., UniProtKB—P01730) is a glycoprotein that can be found on the surface of immune cells, e.g., T helper cells. “CD4+ T cells” are T helper cells having T-cell surface glycoprotein CD4 on their surface.
In the present context, the term “cytokines” as used herein may refer to proteins involved in cell signalling and can be secreted by immune cells in order to regulate the immune response.
In the present context, the term “T helper (Th) cells” may be used herein to refer to subsets of CD4+ T cells with distinct cytokine profiles (e.g., Kaiko et al 2007). The cytokines secreted by Th type 1 (Th1) cells may include interferon gamma (IFNγ, e.g., having UniProtKB Accession Number: P01579), tumor necrosis factor alpha (TNFα, e.g., having UniProtKB Accession Number: P01375), Interleukin-2 (IL-2, e.g., having UniProtKB Accession Number: P60568) and/or Interleukin 12 (IL-12, e.g., having UniProtKB Accession Number: P29459 or P29460). The cytokines secreted by Th type 2 (Th2) cells may include interleukin 4 (IL-4, e.g., having UniProtKB Accession Number: P05112) and/or interleukin 5 (IL-5, e.g., having UniProtKB Accession Number: P05113).
The term “associated” as used herein may refer to a state in which two or more entities are brought together, linked or joined. Non-limiting examples of “associated” of the present invention include encapsulated.
In the present context, the term “encapsulated” means enclosed by a membrane (e.g., membrane of the polymersome of the present invention, e.g., embodied inside the lumen of said polymersome). With reference to an antigen the term “encapsulated” further means that said antigen is neither integrated into-nor covalently bound to—nor conjugated to said membrane (e.g., of a polymersome of the present invention). With reference to compartmentalization of the vesicular structure of polymersome as described herein the term “encapsulated” means that the inner vesicle is completely contained inside the outer vesicle and is surrounded by the vesicular membrane of the outer vesicle. The confined space surrounded by the vesicular membrane of the outer vesicle forms one compartment. The confined space surrounded by the vesicular membrane of the inner vesicle forms another compartment.
In the present context, the term “antigen” means any substance that may be specifically bound by components of the immune system. Only antigens that are capable of eliciting (or evoking or inducing) an immune response are considered immunogenic and are called “immunogens”. Exemplary non-limiting antigens are polypeptides derived from a soluble portion of proteins, hydrophobic polypeptides rendered soluble for encapsulation as well as aggregated polypeptides that are soluble as aggregates. The antigen may originate from within the body (“self-antigen”) or from the external environment (“non-self”).
Membrane proteins form a class of antigens that typically produce a low immune response level. Of specific interest, soluble (e.g., solubilized) membrane proteins (MPs) and membrane-associated peptides (MAPs) and fragments (i.e., portions) thereof (e.g., the antigens mentioned herein) are encapsulated by a polymersome, which may allow them to be folded in a physiologically relevant manner. This greatly boosts the immunogenicity of such antigens so that when compared to free antigens, a smaller amount of the corresponding antigen can be used to produce the same level of the immune response. Furthermore, the larger size of the polymersomes (compared to free membrane proteins) allows them to be detected by the immune system more easily.
In the present context, the term “B16 peptide” refers to any neoantigen polypeptide derived from the spontaneous C57BL/6-derived B16 melanoma model (e.g., melanoma B16-F10 mouse model). Non-limiting examples thereof include the peptides of SEQ ID NO: 9, 10 and 11.
In the present context, the term “MC38 peptide” refers to any neoantigen polypeptide derived from the colon cancer MC38 mouse model. Non-limiting examples thereof include the peptides of SEQ ID NO: 1, 2 and 3.
In the present context, the term “Influenza hemagglutinin (HA)” refers to a glycoprotein found on the surface of influenza viruses. HA has at least 18 different antigens, which are all within the scope of the present invention. These subtypes are named H1 through H18. Non-limiting examples of “Influenza hemagglutinin (HA)” subtype H1 include the polypeptides of SEQ ID NOs: 5, 6, 7 and 8.
In the present context, the term “Swine Influenza hemagglutinin (HA)” refers to a glycoprotein found on the surface of swine influenza viruses, which is a family of influenza viruses endemic in pigs. Non-limiting examples of “Swine Influenza hemagglutinin (HA)” include subtype H1 of SEQ ID NO: 6.
In the present context, the term “coronavirus” refers to a virus of the subfamily Coronaviridae, which is a family of enveloped, positive-sense, single stranded RNA viruses. Coronaviruses may cause diseases in mammals and birds. There are four genera within this subfamily, Alphacoronavirus, Betacoronavirus, Gammacoronavirus, and Deltacoronavirus. In humans, coronaviruses may cause respiratory tract infections that can be mild, and others that can be lethal, such as SARS, MERS, and COVID-19. Human pathogenic coronaviruses commonly belong to the genera of Alphacoronaviruses or Betacoronaviruses. Viruses that belong to genus Alphacoronavirus are e.g. PEDv, transmissible gastroenteritis virus (TGEV), Feline coronavirus (FCoV), including Feline enteric coronavirus (FECV) and Feline infectious peritonitis virus (FIPV), Canine coronavirus (CCoV), or the human-pathogenic coronaviruses Human coronavirus 229E (HCoV-229E) and Human coronavirus NL63 (HCoV-NL63). Within the genus Betacoronavirus, the subgennera Sarbecovirus and Merbecovirus are most relevant in the context of the present disclosure, which include the species SARS-CoV-1, SARS-CoV-2, and MERS-CoV. Other human-pathogenic Betacoronaviruses are Human coronavirus OC43 (HCoV-OC43) Human coronavirus HKU1 (HCoV-HKU1). An overview over human-pathogenic coronaviruses is given by Corman V M, Muth D, Niemeyer D, Drosten C., Hosts and Sources of Endemic Human Coronaviruses. Adv Virus Res. 2018; 100:163-188.
In the present context, the term “SPIKE protein” relates to a glycoprotein that is present on the surface of a viral capsid or viral envelope. SPIKE proteins bind to certain receptors on the host cell and are thus important for both host specificity and viral infectivity.
In the present context, the term “PEDv S Protein” refers to SPIKE glycoprotein present on the surface of Porcine epidemic diarrhea virus (PEDV), which is a family of coronavirus in pigs. Non-limiting examples of soluble “PEDv S Protein” as may be used in the present invention include the entire soluble fragment consisting of the S1 and S2 region having the amino acid sequence of SEQ ID NO: 12, the soluble fragment of the S1 region of SEQ ID NO: 13, or the soluble fragment of the S2 region of SEQ ID NO: 14, of the Porcine Epidemic Diarrhea virus (PEDv) Spike protein (S Protein) (UniProtKB Accession number: V5TA78). It is of course also possible to use shorter fragments of the entire soluble fragment of the S1 and the S2 region or of either of the S1 or S2 regions alone (cf.
In the present context, the term “MERS-CoV S Protein” or “MERS-CoV SPIKE Protein” refers to SPIKE glycoprotein present on the surface of Middle East respiratory syndrome-related coronavirus (MERS-CoV), which is a human-pathogenic coronavirus. A MERS-CoV Spike protein of the disclosure has the sequence set forth in UniProtKB Accession number: KOBRG7 version 40 of 26 Feb. 2020 (GenBank Accession No. AFS88936, version AFS88936.1) or SEQ ID NO: 42. A non-limiting example of soluble “MERS-CoV S Protein” as may be used in the present invention includes the entire soluble fragment of the S1 and S2 region of the the MERS-CoV Spike protein (S Protein), which may correspond to positions 1 to 1297 of the MERS-CoV Spike protein or has the amino acid sequence set forth in SEQ ID NO: 43. A non-limiting example of soluble “MERS-CoV S Protein” as may be used in the present invention also includes the S1 region, which corresponds to positions 18 to 725 of the MERS-CoV Spike protein (S Protein) or has the amino acid sequence of SEQ ID NO: 44. A non-limiting example of soluble “MERS-CoV S Protein” as may be used in the present invention also includes the soluble fragment of the S2 region, which may correspond to positions 726 to 1296 of the MERS-CoV Spike protein (S Protein) or has the amino acid sequence of SEQ ID NO: 45. It is of course also possible to use shorter fragments of the entire soluble fragment of the S1 and the S2 region or of either of the S1 or S2 regions alone, for example a fragment may include a Receptor Binding Domain (RBD), which corresponds to positions 377-588 of the MERS-CoV Spike protein or has the amino acid sequence of SEQ ID NO: 46. It is also noted here that a polymersome of the present invention may have encapsulated one or more different soluble fragments of the Spike protein, for example, the S1 region, the S2 region or the soluble fragment thereof, the entire soluble fragment of the S1 and S2 regions, and/or an RBD. In illustrative embodiments of a polymersomes of the invention, it has encapsulated therein one type of soluble fragments (for example, only the entire soluble fragment of the S1 and S2 regions), two different types of soluble fragments (for example, the entire soluble fragment of the S1 and S2 regions and either S1 region or soluble fragment of the S2 region), three different types of soluble fragments (the S1 region, a soluble fragment of the S2 region and the entire soluble fragment of S1 and S2 of SEQ ID NO: 42 (amino acid residues 1 to 1297) or even four different types of fragments (for example, the S1 region, a soluble fragment of the S2 region, the entire soluble fragment of S1 and S2 of SEQ ID NO: 42 (amino acid residues 1 to 1297) and as fourth type, an the RBD). In a preferred embodiment, a polymersome of the invention has encapsulated therein a soluble fragment that comprises, essentially consists of, or consists of the S1 region corresponding to amino acid residues 18 to 725 of the full-length MERS-CoV SPIKE Protein. In a preferred embodiment, a polymersome of the invention has encapsulated therein a soluble fragment that comprises, essentially consists of, or consists of the soluble fragment of the S2 region corresponding to amino acid residues 726 to 1296 of the full length MERS-CoV SPIKE Protein. In a preferred embodiment, a polymersome of the invention has encapsulated therein a soluble fragment that comprises, essentially consists of, or consists of the S1 and the S2 region corresponding to amino acid residues 1 to 1297 of the full length MERS-CoV SPIKE Protein. In a preferred embodiment, a polymersome of the invention has encapsulated therein a fragment that comprises, essentially consists of, or consists of the S1 and the S2 region corresponding to amino acid residues 1 to 1327 of the full length MERS-CoV SPIKE Protein. In this context, “essentially consist of” means that the N terminal and/or C terminal endpoints of the fragment may vary to a limited extent, such as up to 25 amino acid positions, such as up to 20 amino acid positions, such as up to 15 amino acid positions, up to 10 amino acid positions, up to 5 amino acid positions, up to 4 amino acid positions, up to 3 amino acid positions, up to 2 amino acid positions, or up to 1 amino acid position. As an illustrative example, a fragment that essentially consists of amino acids 726 to 1296 of the full length MERS-CoV SPIKE Protein may consists of positions 716 to 1296, 736 to 1296, 726 to 1286, or 726 to 1306, 716 to 1286, 736 to 1286, 736 to 1306, or 716 to 1306 of the full length MERS-CoV SPIKE Protein.
A MERS-CoV Spike protein of the disclosure may also comprise variants of the sequences mentioned above, which include natural variants of other isolates of the MERS-CoV as well as artificial modification, which can be introduced into the sequence of the MERS-CoV S Protein. As an illustrative example, mutations can be introduced to change the formation of the expressed protein. For this purpose, the furin cleavage site located from position 754 to 757 of SEQ ID NO: 42 may be mutated. Reduction in post expression cleavage may be achieved by reducing the basic nature of this amino acid sequence. For example, the residues Arginine 754 and/or 757 may be mutated to less basic amino acids, such as Glycine (position numbering corresponding to the amino acid sequence set forth in SEQ ID NO: 42), or other less basic amino acids. A furin cleavage site having the native sequence of RSVR (SEQ ID NO: 58) may thus be mutated to the sequence of GSVG (SEQ ID NO: 59).Further modifications may include the addition of a trimerization domain, preferably to the C-terminus of the protein, which may help increasing the native fold of the S1 and/or S2 domains. Such trimerization domains can include a foldon domain (e.g. SEQ ID NO: 54), a GCN4 based trimerization domain (such as SEQ ID NO: 55 or 56), or other motifs that are well known to the person skilled in the art. Further, secretion leader sequences may be added to the N terminus of proteins which may improve production and/or downstream processing, such as isolation and purification. An illustrative example for such a leader sequence is the honey bee melittin leader sequence (SEQ ID NO: 57). Further useful leader sequences are well known to the person skilled in the art. Accordingly, a soluble fragment of a spike protein of the present disclosure also includes highly identical variants of particular sequences of soluble fragments of a spike protein that are explicitly or implicitly disclosed herein. Such as variants having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to a soluble fragment of a spike protein of the disclosure, in particular a soluble fragment of a MERS-CoV S protein of the disclosure. As an illustrative example, a soluble fragment of a S fragment of the disclosure may comprise, essentially consists of or consists of a sequence that has at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 43-46.
Alternatively or additionally, a polymersome of the present disclosure may have encapsulated one or more nucleic acids, such as mRNA, self-amplifying mRNA, DNA encoding one or more MERS-CoV Spike protein or a soluble fragment thereof according to the disclosure.
It is also noted here that a polymersome of the present invention having encapsulated one or more different soluble fragments of the MERS-CoV Spike protein and/or nucleic acids encoding the same or a full-length MERS-CoV Spike protein are used in one preferred embodiment as vaccine against a human disease, in particular an infection by a human-pathogenic coronavirus, in particular Middle East respiratory syndrome (MERS). Thus, a polymersome of the present invention having encapsulated one or more different soluble fragments of the MERS-CoV Spike protein and/or nucleic acids encoding the same or a full-length MERS-CoV Spike protein may be used in the treatment, including prevention, of fever, cough, expectoration, shortness of breath, pneumonia, and/or acute respiratory distress syndrome (ARDS).
In one preferred embodiment, the polymersome having encapsulated one or more different soluble fragments of the MERS-CoV Spike protein and/or nucleic acids encoding the same or a full-length MERS-CoV Spike protein is administered intramuscularly. In one preferred embodiment, the polymersome having encapsulated one or more different soluble fragments of the MERS-CoV Spike protein and/or nucleic acids encoding the same or a full-length MERS-CoV Spike protein is administered intranasally. In one preferred embodiment, the polymersome having encapsulated one or more different soluble fragments of the MERS-CoV Spike protein and/or nucleic acids encoding the same or a full-length MERS-CoV Spike protein is administered by inhalation.
In the present context, the term “SARS-CoV-2 S Protein” or “SARS-CoV-2 SPIKE Protein” refers to SPIKE glycoprotein present on the surface of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), which is a human-pathogenic coronavirus. A SARS-CoV-2 Spike protein of the disclosure has the sequence set forth in UniProtKB Accession number: PODTC2 version 1 of 22 Apr. 2020 (GenBank Accession Number MN908947, version MN908947.3) or SEQ ID NO: 19. A non-limiting example of soluble “SARS-CoV-2 S Protein” as may be used in the present invention includes the entire soluble fragment consisting of the S1 and S2 region of the the SARS-CoV-2 Spike protein (S Protein), which corresponds to positions 16 to 1213 or 14 to 1204 or 19 to 1204 of the SARS-CoV-2 Spike protein or has the amino acid sequence set forth in SEQ ID NO: 34 or SEQ ID NO: 35 or SEQ ID NO: 65. A non-limiting example of soluble “SARS-CoV-2 S Protein” as may be used in the present invention also includes the S1 region, which corresponds to positions 16 to 685 of the SARS-CoV-2 Spike protein (S Protein) or has the amino acid sequence of SEQ ID NO: 37. A non-limiting example of soluble “SARS-CoV-2 S Protein” as may be used in the present invention also includes the S2 region, which corresponds to positions 686 to 1213 or 646 to 1204 of the SARS-CoV-2 Spike protein (S Protein) or has the amino acid sequence of SEQ ID NO: 38 or 39. It is of course also possible to use shorter fragments of the entire soluble fragment of the S1 and the S2 region or of either of the S1 or S2 regions alone, for example the amino acid sequence of 318-524 of SARS-CoV-2 protein as the Receptor Binding domains (SEQ ID NO: 41, cf.
Several variants of the SARS-CoV-2 S Protein are known in the art, such as GeneBank Accession No. Q1157278.1 (SEQ ID NO: 20), GeneBank Accession No. YP_009724390.1 (SEQ ID NO: 21), GeneBank Accession No. QI004367.1(SEQ ID NO: 22), GeneBank Accession No. QHU79173.2 (SEQ ID NO: 23), GeneBank Accession No. Q1187830.1 (SEQ ID NO: 24), GeneBank Accession No. QIA98583.1 (SEQ ID NO: 25), GeneBank Accession No. QIA20044.1 (SEQ ID NO: 26), GeneBank Accession No. QIK50427.1 (SEQ ID NO: 27), GeneBank Accession No. QHR84449.1 (SEQ ID NO: 28), GeneBank Accession No. QIQ08810.1 (SEQ ID NO: 29), GeneBank Accession No. QIJ96493.1 (SEQ ID NO: 30), GeneBank Accession No. QIC53204.1 (SEQ ID NO: 31), GeneBank Accession No. QHZ00379.1 (SEQ ID NO: 32), and GeneBank Accession No. QHS34546.1 (SEQ ID NO: 33). Compared to SEQ ID NO: 19, mutations at sequence positions corresponding to positions 28, 49, 74, 145, 157, 181, 221, 307, 408, 528, 614, 655, 797, 930 can be found in these variants. Further modifications can be introduced into the sequence of the SARS-CoV-2 S Protein. As an illustrative example, mutations can be introduced to change the formation of the expressed protein. For this purpose, the furin cleavage site located from positions 679 to 685 of SEQ ID NO: 19 may be mutated. Reduction in post expression cleavage may be achieved by reducing the basic nature of this amino acid sequence. For example, the residues Pro 681, Arg 682, and/or Arg 683 may be mutated to less basic amino acids, such as Pro 681->Asn, Arg 682->Gln, and/or Arg 683->Ser (position numbering corresponding to the amino acid sequence set forth in SEQ ID NO: 19), or other less basic amino acids. A furin cleavage site having the native sequence of NSPRRAR (SEQ ID NO: 52) may thus be mutated to the sequence of NSNQSAR (SEQ ID NO: 53). An illustrative example for a soluble fragment of a SARS-CoV-2 spike protein having a mutated furin cleavage site is shown in SEQ ID NO: 65. An illustrative example for a SARS-CoV-2 spike protein having a mutated furin cleavage site is shown in SEQ ID NO: 66. Further modifications may include the addition of a trimerization domain, preferably to the C-terminus of the protein, which may help increasing the native fold of the S1 and/or S2 domains. Such trimerization domains can include a foldon domain (GYIPEAPRDG QAYVRKDGEW VLLSTFL, SEQ ID NO: 54, as e.g. described in Guthe et al.,J. Mol. Biol. (2004) 337, 905-915), a GCN4 based trimerization domain including a immune-silenced variant thereof (such as GGGTGGGGTG RMKQIEDKIEE ILSKIYHIEN EIARIKKLIG ERGGR, SEQ ID NO: 55, or GGGTGGNGTG RMKQIEDKIE NITSKIYNITN EIARIKKLIG NRTGGR, SEQ ID NO: 56, as described in Sliepen et al. J. Biol. Chem. (2015) 290(12):7436-7442), or other motifs that are well known to the person skilled in the art. Further, secretion leader sequences may be added to the N terminus of proteins which may improve production and/or downstream processing, such as isolation and purification. An illustrative example for such a leader sequence is the honey bee melittin leader sequence (MKFLVNVALV FMVVYISYIY A, SEQ ID NO: 57). Further useful leader sequences are well known to the person skilled in the art. Accordingly, a soluble fragment of a spike protein of the present disclosure also includes highly identical variants of particular sequences of soluble fragments of a spike protein that are explicitly or implicitly disclosed herein. Such as variants having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to a soluble fragment of a spike protein of the disclosure, in particular a soluble fragment of a SARS CoV-2 S protein of the disclosure. As an illustrative example, a soluble fragment of a S fragment of the disclosure may comprise, essentially consists of or consists of a sequence that has at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to a sequence selected from the group consisting of: a sequence corresponding to positions 16 to 1213, 16 to 685, 686 to 1213, 686 to 1204, 646 to 1204, or 14 to 1204 of SEQ ID NO: 19 (the SARS-CoV-2 Spike protein). As another illustrative example, a soluble fragment of a S fragment of the disclosure may have at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to a sequence selected from the group consisting of: SEQ ID NO: 34-41 and 65.
In a preferred embodiment, a polymersome of the invention has encapsulated therein a soluble fragment that comprises, essentially consists of, or consists of the S1 region corresponding to amino acid residues 16 to 685 of the full length SARS-CoV-2 SPIKE Protein set forth in SEQ ID NO: 19 or has the amino acid sequence of SEQ ID NO: 37. In a preferred embodiment, a polymersome of the invention has encapsulated therein a soluble fragment that comprises, essentially consists of, or consists of the S2 region corresponding to amino acid residues 686 to 1213 of the full length SARS-CoV-2 SPIKE Protein set forth in SEQ ID NO: 19 or has the amino acid sequence of SEQ ID NO: 38. In a preferred embodiment, a polymersome of the invention has encapsulated therein a soluble fragment that comprises, essentially consists of, or consists of the S1 and the S2 region corresponding to amino acid residues 16 to 1213 of the full length SARS-CoV-2 SPIKE Protein set forth in SEQ ID NO: 19 or has the amino acid sequence of SEQ ID NO: 34. In a preferred embodiment, a polymersome of the invention has encapsulated therein a soluble fragment that comprises, essentially consists of, or consists of amino acids corresponding to amino acid residues 686 to 1204 of the full length SARS-CoV-2 SPIKE Protein set forth in SEQ ID NO: 19. In a preferred embodiment, a polymersome of the invention has encapsulated therein a soluble fragment that comprises, essentially consists of, or consists of amino acids corresponding to amino acid residues 646 to 1204 of the full length SARS-CoV-2 SPIKE Protein set forth in SEQ ID NO: 19 or has the amino acid sequence of SEQ ID NO: 39. In a preferred embodiment, a polymersome of the invention has encapsulated therein a soluble fragment that comprises, essentially consists of, or consists of amino acids corresponding to amino acid residues 14 to 1204 of the full length SARS-CoV-2 SPIKE Protein set forth in SEQ ID NO: 19 or has the amino acid sequence of SEQ ID NO: 35. In a preferred embodiment, a polymersome of the invention has encapsulated therein a soluble fragment that comprises, essentially consists of, or consists of amino acids corresponding to amino acid residues 19 to 1204 of the full length SARS-CoV-2 SPIKE Protein set forth in SEQ ID NO: 19 or has the amino acid sequence of SEQ ID NO: 65. In a preferred embodiment, a polymersome of the invention has encapsulated therein a soluble fragment that comprises, essentially consists of, or consists of a sequence that has at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to a sequence selected from the group consisting of: a sequence corresponding to positions 16 to 1213, 16 to 685, 686 to 1213, 686 to 1204, 646 to 1204, 14 to 1204, or 19 to 1204 of SEQ ID NO: 19 (the SARS-CoV-2 Spike protein). In a preferred embodiment, a polymersome of the invention has encapsulated therein a soluble fragment that comprises, essentially consists of, or consists of a sequence that has at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to a sequence selected from the group consisting of: SEQ ID NO: 36, 40 and/or 65. In this context, “essentially consist of” means that the N terminal and/or C terminal endpoints of the fragment may vary to a limited extent, such as up to 25 amino acid positions, such as up to 20 amino acid positions, such as up to 15 amino acid positions, up to 10 amino acid positions, up to 5 amino acid positions, up to 4 amino acid positions, up to 3 amino acid positions, up to 2 amino acid positions, or up to 1 amino acid position. As an illustrative example, a fragment that essentially consists of amino acids 646 to 1204 of the full length SARS-CoV-2 SPIKE Protein may consists of positions 641 to 1204, 651 to 1204, 646 to 1209, or 646 to 1199, 641 to 1209, or 651 to 1199 of the full length SARS-CoV-2 SPIKE Protein.
Alternatively or additionally, a polymersome of the present disclosure may have encapsulated one or more nucleic acids, such as mRNA, self-amplifying mRNA, DNA encoding one or more SARS-CoV-2 Spike protein or a soluble fragment thereof according to the disclosure.
It is also noted here that a polymersome of the present invention having encapsulated one or more different soluble fragments of the SARS-CoV-2 Spike protein and/or nucleic acids encoding the same are used in one preferred embodiment as vaccine against a human disease, in particular an infection by a human-pathogenic coronavirus, Coronavirus disease 2019 (COVID-19). Thus, a polymersome of the present invention having encapsulated one or more different soluble fragments of the SARS-CoV-2 Spike protein and/or nucleic acids encoding the same may be used in the treatment, including prevention, of fever, cough, shortness of breath, pneumonia, organ failure, acute respiratory distress syndrome (ARDS), fatigue, muscle pain, diarrhea, sore throat, loss of smell and/or abdominal pain.
In one preferred embodiment, the polymersome having encapsulated one or more different soluble fragments of the SARS-CoV-2 Spike protein and/or nucleic acids encoding the same or a full-length SARS-CoV-2 Spike protein is administered intramuscularly. In one preferred embodiment, the polymersome having encapsulated one or more different soluble fragments of the SARS-CoV-2 Spike protein and/or nucleic acids encoding the same or a full-length SARS-CoV-2 Spike protein is administered intranasally. In one preferred embodiment, the polymersome having encapsulated one or more different soluble fragments of the SARS-CoV-2 Spike protein and/or nucleic acids encoding the same or a full-length SARS-CoV-2 Spike protein is administered by inhalation.
In the present context, the term “SARS-CoV-1 S Protein” or “SARS-CoV-1 Spike protein” refers to Spike glycoprotein present on the surface of Severe acute respiratory syndrome coronavirus (SARS-CoV or SARS-CoV-1), which is a human-pathogenic coronavirus. A SARS-CoV-1 Spike protein of the disclosure has the sequence set forth in UniProtKB Accession number: P59594 version 134 of 11 Dec. 2019 or SEQ ID NO: 48. A non-limiting example of soluble “SARS-CoV-1 S Protein” as may be used in the present invention includes the entire soluble fragment of the S1 and S2 region of the the SARS-CoV-1 Spike protein (S Protein), which may correspond to positions 14 to 1195 of the SARS-CoV-1 Spike protein or has the amino acid sequence set forth in SEQ ID NO: 48. A non-limiting example of soluble “SARS-CoV-1 S Protein” as may be used in the present invention also includes the S1 region, which corresponds to positions 14 to 667 of the SARS-CoV-1 Spike protein (S Protein) or has the amino acid sequence of SEQ ID NO: 49. A non-limiting example of soluble “SARS-CoV-1 S Protein” as may be used in the present invention also includes the soluble fragment of the S2 region, which may correspond to positions 668 to 1198 of the SARS-CoV-1 Spike protein (S Protein) or has the amino acid sequence of SEQ ID NO: 50. It is of course also possible to use shorter fragments of the entire soluble fragment of the S1 and the S2 region or of either of the S1 or S2 regions alone, for example a fragment may include a Receptor Binding Domain (RBD), which corresponds to positions 306-527 of the SARS-CoV-1 Spike protein or has the amino acid sequence of SEQ ID NO: 51. It is also noted here that a polymersome of the present invention may have encapsulated one or more different soluble fragments of the Spike protein, for example, the S1 region, the S2 region or the soluble fragment thereof, the entire soluble fragment of the S1 and S2 regions, and/or an RBD. In illustrative embodiments of a polymersomes of the invention, it has encapsulated therein one type of soluble fragments (for example, only the entire soluble fragment of the S1 and S2 regions), two different types of soluble fragments (for example, the entire soluble fragment of the S1 and S2 regions and either S1 region or a soluble fragment of the S2 region), three different types of soluble fragments (the S1 region, a soluble fragment of the S2 region and the entire soluble fragment of S1 and S2 of SEQ ID NO: 47 (amino acid residues 14 to 1195)) or even four different types of fragments (for example, the S1 region, a soluble fragment of the S2 region, the entire soluble fragment of S1 and S2 of SEQ ID NO: 47 (amino acid residues 14 to 1195) and as fourth type, an RBD). In a preferred embodiment, a polymersome of the invention has encapsulated therein a soluble fragment that comprises, essentially consists of, or consists of the S1 region corresponding to amino acid residues 14 to 667 of the full-length SARS-CoV-1 Spike protein. In a preferred embodiment, a polymersome of the invention has encapsulated therein a soluble fragment that comprises, essentially consists of, or consists of the soluble fragment of the S2 region corresponding to amino acid residues 668 to 1195 of the full length SARS-CoV-1 Spike protein. In a preferred embodiment, a polymersome of the invention has encapsulated therein a soluble fragment that comprises, essentially consists of, or consists of the S1 and the S2 region corresponding to amino acid residues 14 to 1195 of the full length SARS-CoV-1 Spike protein. In a preferred embodiment, a polymersome of the invention has encapsulated therein a fragment that comprises, essentially consists of, or consists of the S1 and the S2 region corresponding to amino acid residues 14 to 1255 of the full length SARS-CoV-1 Spike protein. In this context, “essentially consist of” means that the N terminal and/or C terminal endpoints of the fragment may vary to a limited extent, such as up to 25 amino acid positions, such as up to 20 amino acid positions, such as up to 15 amino acid positions, up to 10 amino acid positions, up to 5 amino acid positions, up to 4 amino acid positions, up to 3 amino acid positions, up to 2 amino acid positions, or up to 1 amino acid position.
A SARS-CoV-1 Spike protein of the disclosure may also comprise variants of the sequences mentioned above, which include natural variants of other isolates of SARS-CoV-1 as well as artificial modification(s), which can be introduced into the sequence of the SARS-CoV-1 S Protein. As an illustrative example, mutations can be introduced to change the formation of the expressed protein. For this purpose, the furin cleavage site located from position 761 to 767 of SEQ ID NO: 47 may be mutated. Reduction in post expression cleavage may be achieved by reducing the basic nature of this amino acid sequence. For example, the residues Arg 764 and/or Arg 767 may be mutated to less basic amino acids, such as Gly (position numbering corresponding to the amino acid sequence set forth in SEQ ID NO: 47), or other less basic amino acids. A furin cleavage site having the native sequence of EQDRNTR (SEQ ID NO: 60) may thus be mutated to the sequence of EQDGNTG (SEQ ID NO: 61).Further modifications may include the addition of a trimerization domain, preferably to the C-terminus of the protein, which may help increasing the native fold of the S1 and/or S2 domains. Such trimerization domains can include a foldon domain (e.g. SEQ ID NO: 54), a GCN4 based trimerization domain (such as SEQ ID NO: 55 or 56), or other motifs that are well known to the person skilled in the art. Further, secretion leader sequences may be added to the N terminus of proteins which may improve production and/or downstream processing, such as isolation and purification. An illustrative example for such a leader sequence is the honey bee melittin leader sequence (SEQ ID NO: 57). Further useful leader sequences are well known to the person skilled in the art. Accordingly, a soluble fragment of a spike protein of the present disclosure also includes highly identical variants of particular sequences of soluble fragments of a spike protein that are explicitly or implicitly disclosed herein. Such as variants having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to a soluble fragment of a spike protein of the disclosure, in particular a soluble fragment of a SARS-CoV-1 S protein of the disclosure. As an illustrative example, a soluble fragment of a S fragment of the disclosure may comprise, essentially consists of or consists of a sequence that has at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 48-51.
Alternatively or additionally, a polymersome of the present disclosure may have encapsulated one or more nucleic acids, such as mRNA, self-amplifying mRNA, DNA encoding one or more SARS-CoV-1 Spike protein or a soluble fragment thereof according to the disclosure.
It is also noted here that a polymersome of the present invention having encapsulated one or more different soluble fragments of the SARS-CoV-1 Spike protein and/or nucleic acids encoding the same or a full-length SARS-CoV-1 Spike protein are used in one preferred embodiment as vaccine against a human disease, in particular an infection by a human-pathogenic coronavirus, in particular Severe acute respiratory syndrome (SARS). Thus, a polymersome of the present invention having encapsulated one or more different soluble fragments of the SARS-CoV-1 Spike protein and/or nucleic acids encoding the same or a full-length SARS-CoV-1 Spike protein may be used in the treatment, including prevention, of fever, muscle pain, lethargy, cough, sore throat, shortness of breath, pneumonia, and/or acute respiratory distress syndrome (ARDS).
In one preferred embodiment, the polymersome having encapsulated one or more different soluble fragments of the SARS-CoV-1 Spike protein and/or nucleic acids encoding the same or a full-length SARS-CoV-1 Spike protein is administered intramuscularly. In one preferred embodiment, the polymersome having encapsulated one or more different soluble fragments of the SARS-CoV-1 Spike protein and/or nucleic acids encoding the same or a full-length SARS-CoV-1 Spike protein is administered intranasally. In one preferred embodiment, the polymersome having encapsulated one or more different soluble fragments of the SARS-CoV-1 Spike protein and/or nucleic acids encoding the same or a full-length SARS-CoV-1 Spike protein is administered by inhalation.
In the present context, the term “oxidation-stable” refers to a measure of polymersomes (or the corresponding polymers or membranes) resistance to oxidation, for example, using the method described by Scott et al., 2012, In this method a polymersome with an encapsulated antigen is incubated in a 0.5% solution of hydrogen peroxide and the amount of free (released) antigen can be quantified with UV/fluorescence HPLC. Polymersomes which release a substantial or all of the encapsulated antigen under these oxidizing conditions are considered to be oxidation sensitive. Another method of determining whether a block-copolymer and thus the resulting polymersome is oxidation stable or oxidation-sensitive is described in column 16 of U.S. Pat. No. 8,323,696. According to this method, polymers with functional groups that are oxidation-sensitive will be chemically altered by mild oxidizing agents, with a test for the same being enhanced solubility to 10% hydrogen peroxide for 20 h in vitro. As, for example, poly(propylene sulfide) (PPS) is an oxidation-sensitive polymer (see, for example, Scott et al 2012, supra and U.S. Pat. No. 8,323,696) PPS can serve as a reference to determine whether a polymer of interest and the respective polymersome of interest is oxidation-sensitive or oxidation stable, If, for example, the same or a higher amount of antigen, or about 90% or more of the amount, or about 80% or more, or about 70% or more, or about 60% or more is released from polymersomes of interest as it is from a PPS polymersome that has encapsulated therein the same antigen, then the polymersome is considered oxidation sensitive. If about only 0.5% or less, or about only 1.0% or less, or about 2% or less, or about 5% of less, or about 10% or less, or about 20% or less, or about 30% or less, or about 40% or less or about 50% or less of antigen is released from polymersomes of interest as it is from a PPS polymersome that has encapsulated therein the same antigen, then the polymersome is considered oxidation-stable. Thus, in line with this, PPS polymersomes as described in U.S. Pat. No. 8,323,696 or. PPS-bl-PEG polymersomes, e.g., made from poly(propylene sulfide) (PPS) and poly(ethylene glycol) (PEG) as components as described in Stano et al, are not oxidation-stable polymersomes within the meaning of the present invention. Similarly, PPS30-PEG17 polymersomes are not oxidation-stable polymersomes within the meaning of the present invention. Other non-limiting examples of measuring oxidation stability include measurement of stability in the presence of serum components (e.g., mammalian serum, e.g., human serum components) or stability inside an endosome, for example.
In the present context, the term “reduction-stable” refers to a measure of polymersome resistance to reduction in a reducing environment.
In the present context, the term “serum” refers to blood plasma from which the clotting proteins have been removed.
In the present context, the term “oxidation-independent release” refers to a release of the polymersome content without or essentially without oxidation of the polymers forming the polymersomes.
The term “polypeptide” is equally used herein with the term “protein”. Proteins (including fragments thereof, preferably biologically active fragments, and peptides, usually having less than 30 amino acids) comprise one or more amino acids coupled to each other via a covalent peptide bond (resulting in a chain of amino acids).
The term “polypeptide” as used herein describes a group of molecules, which, for example, consist of more than 30 amino acids. Polypeptides may further form multimers such as dimers, trimers and higher oligomers, i.e. consisting of more than one polypeptide molecule. Polypeptide molecules forming such dimers, trimers etc. may be identical or non-identical. The corresponding higher order structures of such multimers are, consequently, termed homo- or heterodimers, homo- or heterotrimers etc. An example for a heteromultimer is an antibody molecule, which, in its naturally occurring form, consists of two identical light polypeptide chains and two identical heavy polypeptide chains. The terms “polypeptide” and “protein” also refer to naturally modified polypeptides/proteins wherein the modification is effected e.g. by post-translational modifications like glycosylation, acetylation, phosphorylation and the like. Such modifications are well known in the art.
In the present context, the term “carbohydrates” refers to compounds such as aldoses and ketoses having the stoichiometric formula Cn(H2O)n (e.g., hence “hydrates of carbon”). The generic term “carbohydrate” includes, but is not limited to, monosaccharides, oligosaccharides and polysaccharides as well as substances derived from monosaccharides by reduction of the carbonyl group (alditols), by oxidation of one or more terminal groups to carboxylic acids, or by replacement of one or more hydroxy group(s) by a hydrogen atom, an amino group, thiol group or similar groups. It also includes derivatives of these compounds.
In the present context, the term “polynucleotide” (also “nucleic acid”, which can be used interchangeably with the term “polynucleotide”) refers to macromolecules made up of nucleotide units which e.g., can be hydrolysable into certain pyrimidine or purine bases (usually adenine, cytosine, guanine, thymine, uracil), d-ribose or 2-deoxy-d-ribose and phosphoric acid. Non-limiting examples of “polynucleotide” include DNA molecules (e.g. cDNA or genomic DNA), RNA (mRNA), combinations thereof or hybrid molecules comprised of DNA and RNA. The nucleic acids can be double- or single-stranded and may contain double- and single-stranded fragments at the same time. Most preferred are double stranded DNA molecules and mRNA molecules.
In the present context, the term “antisense oligonucleotide” refers to a nucleic acid polymer, at least a portion of which is complementary to a nucleic acid which is present in a normal cell or in an affected cell. Exemplary “antisense oligonucleotide” include antisense RNA, siRNA, RNAi.
In the present context, the term “CD8(+) T cell-mediated immune response” refers to the immune response mediated by cytotoxic T cells (also known as TC, cytotoxic T lymphocyte, CTL, T-killer cells, cytolytic T cells, CD8(+) T-cells or killer T cells). Example of cytotoxic T cells include, but are not limited to antigen-specific effector CD8(+) T cells. In order for the T-cell receptors (TCR) to bind to the class I MHC molecule, the former must be accompanied by a glycoprotein called CD8, which binds to the constant portion of the class I MHC molecule. Therefore, these T cells are called CD8(+) T cells. Once activated, the TC cell undergoes “clonal expansion” with the help of the cytokine Interleukin-2 (IL-2), which is a growth and differentiation factor for T cells. This increases the number of cells specific for the target antigen that can then travel throughout the body in search of antigen-positive somatic cells.
In the present context, the term “clonal expansion of antigen-specific CD8(+) T cells” refers to an increase in the number of CD8(+) T cells specific for the target antigen.
In the present context, the term “cellular immune response” refers to an immune response that does not involve antibodies, but rather involves the activation of phagocytes, antigen-specific cytotoxic T-lymphocytes, and the release of various cytokines in response to an antigen.
In the present context, the term “cytotoxic phenotype of antigen-specific CD8(+) T cells” refers to the set of observable characteristics of antigen-specific CD8(+) T cells related to their cytotoxic function.
In the present context, the term “lymph node-resident macrophages” refers to macrophages, which are large white blood cell that is an integral part of our immune system that use the process of phagocytosis to engulf particles and then digest them, present in lymph nodes that are small, bean-shaped glands throughout the body.
In the present context, the term “humoral immune response” refers to an immune response mediated by macromolecules found in extracellular fluids such as secreted antibodies, complement proteins, and certain antimicrobial peptides. Its aspects involving antibodies are often called antibody-mediated immunity.
In the present context, the term “B cells”, also known as B lymphocytes, are a type of white blood cell of the lymphocyte subtype. They function in the humoral immunity component of the adaptive immune system by secreting antibodies.
An “antibody” when used herein is a protein comprising one or more polypeptides (comprising one or more binding domains, preferably antigen binding domains) substantially or partially encoded by immunoglobulin genes or fragments of immunoglobulin genes. The term “immunoglobulin” (Ig) is used interchangeably with “antibody” herein. The recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon and mu constant region genes, as well as myriad immunoglobulin variable region genes. In particular, an “antibody” when used herein, is typically tetrameric glycosylated proteins composed of two light (L) chains of approximately 25 kDa each and two heavy (H) chains of approximately 50 kDa each. Two types of light chain, termed lambda and kappa, may be found in antibodies.
Depending on the amino acid sequence of the constant domain of heavy chains, immunoglobulins can be assigned to five major classes: A, D, E, G, and M, and several of these may be further divided into subclasses (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2, with IgG being preferred in the context of the present invention. IgG2 can exist in three dominant forms based on its disulfide configuration: IgG2A, IgG2B, and IgG2A/B (e.g., Thomson C A, Encyclopedia of Immunobiology, 2016 and Dillon et al., 2008; Martinez et al., 2008; Ryazantsev et al., 2013 referred therein). IgG2A is a representative of the canonical Y-shaped IgG molecule with the disulfide bonds of the Fab portion being independent of those in the hinge. IgG2B is more constrained due to the Fab arms being covalently attached to the hinge via disulfide bonds and can be depicted as a T-shaped molecule (e.g., Thomson C A, in Encyclopedia of Immunobiology, 2016).
An antibody relating to the present invention is also envisaged which has an IgE constant domain or portion thereof that is bound by the Fc epsilon receptor I. An IgM antibody consists of 5 of the basic heterotetramer unit along with an additional polypeptide called a J chain, and contains 10 antigen binding sites, while IgA antibodies comprise from 2-5 of the basic 4-chain units which can polymerize to form polyvalent assemblages in combination with the J chain. In the case of IgGs, the 4-chain unit is generally about 150,000 daltons. Each light chain includes an N-terminal variable (V) domain (VL) and a constant (C) domain (CL). Each heavy chain includes an N-terminal V domain (VH), three or four C domains (CHs), and a hinge region. The constant domains are not involved directly in binding an antibody to an antigen, but can exhibit various effector functions, such as participation of the antibody dependent cellular cytotoxicity (ADCC). If an antibody should exert ADCC, it is preferably of the IgG1 subtype, while the IgG4 subtype would not have the capability to exertADCC.
The term “antibody” also includes, but is not limited to, but encompasses monoclonal, monospecific, poly- or multi-specific antibodies such as bispecific antibodies, humanized, camelized, human, single-chain, chimeric, synthetic, recombinant, hybrid, mutated, grafted, and in vitro generated antibodies, with chimeric or humanized antibodies being preferred. The term “humanized antibody” is commonly defined for an antibody in which the specificity encoding CDRs of HC and LC have been transferred to an appropriate human variable frameworks (“CDR grafting”). The term “antibody” also includes scFvs, single chain antibodies, diabodies or tetrabodies, domain antibodies (dAbs) and nanobodies. In terms of the present invention, the term “antibody” shall also comprise bi-, tri- or multimeric or bi-, tri- or multifunctional antibodies having several antigen binding sites.
Furthermore, the term “antibody” as employed in the invention also relates to derivatives of the antibodies (including fragments) described herein. A “derivative” of an antibody comprises an amino acid sequence which has been altered by the introduction of amino acid residue substitutions, deletions or additions. Additionally, a derivative encompasses antibodies which have been modified by a covalent attachment of a molecule of any type to the antibody or protein. Examples of such molecules include sugars, PEG, hydroxyl-, ethoxy-, carboxy- or amine-groups but are not limited to these. In effect the covalent modifications of the antibodies lead to the glycosylation, pegylation, acetylation, phosphorylation, amidation, without being limited to these.
The antibody relating to the present invention is preferably an “isolated” antibody. “Isolated” when used to describe antibodies disclosed herein, means an antibody that has been identified, separated and/or recovered from a component of its production environment. Preferably, the isolated antibody is free of association with all other components from its production environment. Contaminant components of its production environment, such as that resulting from recombinant transfected cells, are materials that would typically interfere with diagnostic or therapeutic uses for the polypeptide, and may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes. In preferred embodiments, the antibody will be purified (1) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (2) to homogeneity by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or, preferably, silver stain. Ordinarily, however, an isolated antibody will be prepared by at least one purification step.
The term “essentially non-immunogenic” means that the block copolymer or amphiphilic polymer of the present invention does not elicit an adaptive immune response, i.e., in comparison to an encapsulated immunogen, the block copolymer or amphiphilic polymer shows an immune response of less than 30%, preferably 20%, more preferably 10%, particularly preferably less than 9, 8, 7, 6 or 5%.
The term “essentially non-antigenic” means that the block copolymer or amphiphilic polymer of the present invention does not bind specifically with a group of certain products that have adaptive immunity (e.g., T cell receptors or antibodies), i.e., in comparison to an encapsulated antigen the block copolymer or amphiphilic polymer shows binding of less than 30%, preferably 20%, more preferably 10%, particularly preferably less than 9, 8, 7, 6 or 5%.
Typically, binding is considered specific when the binding affinity is higher than 10−6M. Preferably, binding is considered specific when binding affinity is about 10−11 to 10−8 M (KD), preferably of about 10−11 to 10−9 M. If necessary, nonspecific binding can be reduced without substantially affecting specific binding by varying the binding conditions.
The term “amino acid” or “amino acid residue” typically refers to an amino acid having its art recognized definition such as an amino acid selected from the group consisting of: alanine (Ala or A); arginine (Arg or R); asparagine (Asn or N); aspartic acid (Asp or D); cysteine (Cys or C); glutamine (Gln or Q); glutamic acid (Glu or E); glycine (Gly or G); histidine (His or H); isoleucine (He or I): leucine (Leu or L); lysine (Lys or K); methionine (Met or M); phenylalanine (Phe or F); pro line (Pro or P); serine (Ser or S); threonine (Thr or T); tryptophan (Trp or W); tyrosine (Tyr or Y); and valine (Val or V), although modified, synthetic, or rare amino acids may be used as desired. Generally, amino acids can be grouped as having a nonpolar side chain (e.g., Ala, Cys, He, Leu, Met, Phe, Pro, Val); a negatively charged side chain (e.g., Asp, Glu); a positively charged sidechain (e.g., Arg, His, Lys); or an uncharged polar side chain (e.g., Asn, Cys, Gln, Gly, His, Met, Phe, Ser, Thr, Trp, and Tyr).
“Effector cells”, preferably human effector cells are leukocytes which express one or more FcRs and perform effector functions. Preferably, the cells express at least FcyRm and perform ADCC effector function. Examples of human leukocytes which mediate ADCC include peripheral blood mononuclear cells (PBMC), natural killer (NK) cells, monocytes, cytotoxic T cells and neutrophils. The effector cells may be isolated from a native source, e.g., blood.
The term “immunizing” refers to the step or steps of administering one or more antigens to a human non-human animal so that antibodies can be raised in the animal.
Specifically, the non-human animal is preferably immunized at least two, more preferably three times with said polypeptide (antigen), optionally in admixture with an adjuvant. An “adjuvant” is a nonspecific stimulant of the immune response. The adjuvant may be in the form of a composition comprising either or both of the following components: (a) a substance designed to form a deposit protecting the antigen (s) from rapid catabolism (e.g. mineral oil, alum, aluminium hydroxide, liposome or surfactant (e.g. pluronic polyol) and (b) a substance that nonspecifically stimulates the immune response of the immunized host animal (e.g. by increasing lymphokine levels therein).
As used herein, “cancer” refers a broad group of diseases characterized by the uncontrolled growth of abnormal cells in the body. Unregulated cell division may result in the formation of malignant tumors or cells that invade neighboring tissues and may metastasize to distant parts of the body through the lymphatic system or bloodstream.
Non-limiting examples of cancers include squamous cell carcinoma, small-cell lung cancer, non-small cell lung cancer, squamous non-small cell lung cancer (NSCLC), non NSCLC, glioma, gastrointestinal cancer, renal cancer (e.g. clear cell carcinoma), ovarian cancer, liver cancer, colorectal cancer, endometrial cancer, kidney cancer (e.g., renal cell carcinoma (RCC)), prostate cancer (e.g. hormone refractory prostate adenocarcinoma), thyroid cancer, neuroblastoma, pancreatic cancer, glioblastoma (glioblastoma multiforme), cervical cancer, stomach cancer, bladder cancer, hepatoma, breast cancer, colon carcinoma, and head and neck cancer (or carcinoma), gastric cancer, germ cell tumor, pediatric sarcoma, sinonasal natural killer, melanoma (e.g., metastatic malignant melanoma, such as cutaneous or intraocular malignant melanoma), bone cancer, skin cancer, uterine cancer, cancer of the anal region, testicular cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer of the urethra, cancer of the penis, solid tumors of childhood, cancer of the ureter, carcinoma of the renal pelvis, neoplasm of the central nervous system (CNS), primary CNS lymphoma, tumor angiogenesis, spinal axis tumor, brain stem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid cancer, squamous cell cancer, T-cell lymphoma, environmentally-induced cancers including those induced by asbestos, virus-related cancers (e.g., human papilloma virus (HPV)— related tumor), and hematologic malignancies derived from either of the two major blood cell lineages, i.e., the myeloid cell line (which produces granulocytes, erythrocytes, thrombocytes, macrophages and mast cells) or lymphoid cell line (which produces B, T, NK and plasma cells), such as all types of luekemias, lymphomas, and myelomas, e.g., acute, chronic, lymphocytic and/or myelogenous leukemias, such as acute leukemia (ALL), acute myelogenous leukemia (AML), chronic lymphocytic leukemia (CLL), and chronic myelogenous leukemia (CML), undifferentiated AML (MO), myeloblastic leukemia (MI), myeloblastic leukemia (M2; with cell maturation), promyelocytic leukemia (M3 or M3 variant [M3V]), myelomonocytic leukemia (M4 or M4 variant with eosinophilia [M4E]), monocytic leukemia (M5), erythroleukemia (M6), megakaryoblastic leukemia (M7), isolated granulocytic sarcoma, and chloroma; lymphomas, such as Hodgkin's lymphoma (HL), non-Hodgkin's lymphoma (NHL), B-cell lymphomas, T-cell lymphomas, lymphoplasmacytoid lymphoma, monocytoid B-cell lymphoma, mucosa-associated lymphoid tissue (MALT) lymphoma, anaplastic (e.g., Ki 1+) large-cell lymphoma, adult T-cell lymphoma/leukemia, mantle cell lymphoma, angio immunoblastic T-cell lymphoma, angiocentric lymphoma, intestinal T-cell lymphoma, primary mediastinal B-cell lymphoma, precursor T-lymphoblastic lymphoma, T-lymphoblastic; and lymphoma/leukaemia (T-Lbly/T-ALL), peripheral T-cell lymphoma, lymphoblastic lymphoma, post-transplantation, lymphoproliferative disorder, true histiocytic lymphoma, primary central nervous system lymphoma, primary effusion lymphoma, lymphoblastic lymphoma (LBL), hematopoietic tumors of lymphoid lineage, acute lymphoblastic leukemia, diffuse large B-cell lymphoma, Burkitt's lymphoma, follicular lymphoma, diffuse histiocytic lymphoma (DHL), immunoblastic large cell lymphoma, precursor B-lymphoblastic lymphoma, cutaneous T-cell lymphoma (CTLC) (also called mycosis fungoides or Sezary syndrome), and lymphoplasmacytoid lymphoma (LPL) with Waldenstrom's macroglobulinemia; myelomas, such as IgG myeloma, light chain myeloma, nonsecretory myeloma, smoldering myeloma (also called indolent myeloma), solitary, plasmocytoma, and multiple myelomas, chronic lymphocytic leukemia (CLL), hairy cell lymphoma; hematopoietic tumors of myeloid lineage, tumors of mesenchymal origin, including fibrosarcoma and rhabdomyoscarcoma; seminoma, teratocarcinoma, tumors of the central and peripheral nervous, including astrocytoma, schwannomas; tumors of mesenchymal origin, including fibrosarcoma, rhabdomyoscaroma, and osteosarcoma; and other tumors, including melanoma, xeroderma pigmentosum, keratoacanthoma, seminoma, thyroid follicular cancer and teratocarcinoma, hematopoietic tumors of lymphoid lineage, for example T-cell and B-cell tumors, including but not limited to T-cell disorders such as T-prolymphocytic leukemia (T-PLL), including of the small cell and cerebriform cell type; large granular lymphocyte leukemia (LGL) preferably of the T-cell type; a/d T-NHL hepatosplenic lymphoma; peripheral/post-thymic T cell lymphoma (pleomorphic and immunoblastic subtypes); angiocentric (nasal) T-cell lymphoma; cancer of the head or neck, renal cancer, rectal cancer, cancer of the thyroid gland; acute myeloid lymphoma, as well as any combinations of said cancers. The methods described herein may also be used for treatment of metastatic cancers, refractory cancers (e.g., cancers refractory to previous immunotherapy, e.g., with a blocking CTLA-4 or PD-1 or PD-L1 antibody), and recurrent cancers.
The term “subject” is intended to include living organisms. Examples of subjects include mammals, e.g., humans, dogs, cows, horses, pigs, sheep, goats, cats, mice, rabbits, rats, and transgenic non-human animals. The subject (animal) can however be a non-mammalian animal such as a bird or a fish. In some preferred embodiments of the invention, the subject is a human, while in other some other preferred embodiments, the subject might be a farm animal, wherein the farm animal can be either a mammal or a non-mammalian animal. Examples of such non-mammalian animals are birds (e.g. poultry such as chicken, duck, goose or turkey), fishes (for example, fishes cultivated in aquaculture such as salmon, trout, or tilapia) or crustacean (such as shrimps or prawns). Examples of mammalian (life stock) animals includes goats; sheep; cows; horses; pigs; or donkeys. Other mammals include cats, dogs, mice and rabbits, for example. In illustrative embodiments the polymersomes of the present invention are used for the vaccination or immunization of the above-mentioned farm animals, both mammalian farm animals and non-mammalian farm animals (a bird, a fish, a crustacean) against virus infections (cf. the Example section in this regard). Accordingly, in such cases, polymersomes of the invention may have encapsulated therein soluble viral full length proteins or soluble fragments of viral full-length proteins.
When used for vaccinations of both humans and non-humans animals, polymersomes or compositions comprising polymersomes of the invention may be administered orally to the respective subject (cf. also the Example Section) dissolved only in a suitable (pharmaceutically acceptable) buffer such as phosphate-buffered saline (PBS) or 0.9% saline solution (an isotonic solution of 0.90% w/v of NaCl, with an osmolality of 308 mOsm/L). The polymersomes may further be mixed with adjuvants. If administered orally, the adjuvant may help protecting the polymersomes against the acidic environment in the stomach. Such adjuvants may be water-miscible or capable of forming a water-oil emulsion, such as oil in water emulsion or water in oil emulsion. Illustrative examples of such an adjuvant are an oil in water emulsion, a water in oil emulsion, monophosphoryl lipid A, and/or trehalose dicorynomycolate, wherein the oil preferably comprises, essentially consists of or consists of mineral oil, simethicone, Span 80, squalene, and combinations thereof. Further illustrative examples are monophosphoryl lipid A (e.g. from Salmonella Minnesota), trehalose dicorynomycolate, or a mixture thereof, which may be in form of an oil (such as squalene) in water emulsion. Said emulsion may comprise an emulsifier (such as polysorbate, such as polysorbate 80). Alternatively, the polymersomes can be modified, for example, by a coating with natural polymers or can be formulated in particles of natural polymers such as alginate or chitosan or of synthetic polymers such as as poly(d,l-lactide-co-glycolide) (PLG), poly(d,l-lactic-coglycolic acid)(PLGA), poly(g-glutamicacid) (g-PGA) [31,32] or poly(ethylene glycol) (PEG). These particles can either be particles in the micrometer range (“macrobeads”) or nanoparticles, or nanoparticles incorporated into macobeads all of which are well known in the art. See, for example. Hari et al, “Chitosan/calcium-alginate beads for oral delivery of insulin”, Applied Polymer Science, Volume 59, Issue11, 14 Mar. 1996, 1795-1801, the review of Sosnik “Alginate Particles as Platform for Drug Delivery by the Oral Route: State-of-the-Art” ISRN Pharmaceutics Volume 2014, Article ID 926157, Machado et al, Encapsulation of DNA in Macroscopic and Nanosized Calcium Alginate Gel Particles”, Langmuir 2013, 29, 15926-15935, International Patent Application WO 2015/110656, the review “Nanoparticle vaccines” of Liang Zhao et al. Vaccine 32 (2014) 327-337) or Li et al “Chitosan-Alginate Nanoparticles as a Novel Drug Delivery System for Nifedipine” Int J Biomed Sci vol. 4 no. 3 Sep. 2008, 221-228. In illustrative embodiments of these polymersomes and oral formulations, the polymersomes that are used for vaccination have encapsulated therein a viral antigen that comprises a soluble portion of Influenza hemagglutinin, Swine Influenza hemagglutinin, Foot and Mouth Disease (FMD) virus protein such as the VP1, VP2 or VP3 coat protein (the VP1 coat protein contains the main antigenic determinants of the FMD virion, and hence changes in its sequence should be responsible for the high antigenic variability of the virus), Ovalbumin (OVA), a SPIKE protein, such as the Porcine epidemic diarrhea (PED) virus SPIKE protein, a SPIKE protein of a human-pathogenic coronavirus, such as MERS-CoV SPIKE protein, SARS-CoV-2 SPIKE protein, or SARS-CoV-1 SPIKE protein. As evident from the use of polymersomes comprising a soluble portion of the influenza hemagglutinin or a Foot and Mouth Disease (FMD) virus protein such as the VP1, VP2 or VP3 coat protein, the viral disease can affect any animal including birds and mammals, wherein a mammal can also be a human.
The term “effective dose” or “effective dosage” is defined as an amount sufficient to achieve or at least partially achieve the desired effect. The term “therapeutically effective dose” is defined as an amount sufficient to cure or at least partially arrest the disease and its complications in a patient already suffering from the disease. Amounts effective for this use will depend upon the severity of the infection and the general state of the subject's own immune system. The term “patient” includes human and other mammalian subjects that receive either prophylactic or therapeutic treatment.
The appropriate dosage, or therapeutically effective amount, of the antibody or antigen binding portion thereof will depend on the condition to be treated, the severity of the condition, prior therapy, and the patient's clinical history and response to the therapeutic agent. The proper dose can be adjusted according to the judgment of the attending physician such that it can be administered to the patient one time or over a series of administrations. The pharmaceutical composition can be administered as a sole therapeutic or in combination with additional therapies as needed.
If the pharmaceutical composition has been lyophilized, the lyophilized material is first reconstituted in an appropriate liquid prior to administration. The lyophilized material may be reconstituted in, e.g., bacteriostatic water for injection (BWFI), physiological saline, phosphate buffered saline (PBS), or the same formulation the protein had been in prior to lyophilization.
Pharmaceutical compositions for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. In addition, a number of recent drug delivery approaches have been developed and the pharmaceutical compositions of the present invention are suitable for administration using these new methods, e. g., Inject-ease, Genject, injector pens such as Genen, and needleless devices such as MediJector and BioJector. The present pharmaceutical composition can also be adapted for yet to be discovered administration methods. See also Langer, 1990, Science, 249: 1527-1533.
The pharmaceutical composition may be prepared for intranasal or inhaled administration, e.g. local administration to the respiratory tract and/or the lung. Means and devides for inhaled administration of a substance are known to the skilled person and are for example disclosed in WO 94/017784A and Elphick et al. (2015) Expert Opin Drug Deliv, 12, 1375-87. Such means and devices include nebulizers, metered dose inhalers, powder inhalers, and nasal sprays. Other means and devices suitable for directing inhaled administration of a drug or vaccine are also known in the art. A preferred route of local administration to the respiratory tract and/or the lung is via aerosol inhalation. An overview about pulmonary drug delivery, i.e. either via inhalation of aerosols (which can also be used in intranasal administration) or intratracheal instillation is given by Patton, J. S., et al. (2004) Proc. Amer. Thoracic Soc., 1, 338-344, for example. Nebulizers are useful in producing aerosols from solutions, while metered dose inhalers, dry powder inhalers, etc. are effective in generating small particle aerosols. The pharmaceutical composition may thus be formulated in form of an aerosol (mixture), a spray, a mist, or a powder.
A pharmaceutical composition against mucosal pathogens such as respiratory coronaviruses like SARS-CoV-2, MERS, or SARS-CoV1 should confer sustained, protective immunity at both system and mucosal levels. A pharmaceutical composition of the disclosure may thus be preferably prepared for mucosal administration, such as inhaled or intranasal administration. As shown in Example 14, intranasal administration of a coronavirus vaccine is not only capable of eliciting a mucosal but also a systemic immune response. A pharmaceutical composition of the disclosure may also be preferably prepared for systemic administration, such as intramuscular administration.
A nebulizer is a drug delivery device used to administer medication in the form of a mist inhaled into the lungs. Different types of nebulizers are known to the skilled person and include jet nebulizers, ultrasonic wave nebulizers, vibrating mesh technology, and soft mist inhalers. Some nebulizers provide a continuous flow of nebulized solution, i.e. they will provide continuous nebulization over a long period of time, regardless of whether the subject inhales from it or not, while others are breath-actuated, i.e. the subject only gets some dose when they inhale from it. A vaccine of the present invention, in particular a vaccine for a human-pathogenic coronavirus infection, such as MERS, COVID-19, or SARS, may be, confectioned for the use in a nebulizer, comprised in a nebulizer or administered by using a nebulizer.
A metered-dose inhaler (MDI) is a device that delivers a specific amount of medication to the lungs, in the form of a short burst of liquid aerosolized medicine. Such a metered-dose inhaler commonly consists of three major components; a canister which comprises the formulation to be administered, a metering valve, which allows a metered quantity of the formulation to be dispensed with each actuation, and an actuator (or mouthpiece) which allows the patient to operate the device and directs the liquid aerosol into the patient's lungs. A vaccine of the present invention, in particular a vaccine for a human-pathogenic coronavirus infection, such as MERS, COVID-19, or SARS, may be, confectioned for the use in a MDI, comprised in a MDI, in particular a canister for an MDI, or administered by using a MDI.
A dry-powder inhaler (DPI) is a device that delivers medication to the lungs in the form of a dry powder. Dry powder inhalers are an alternative to the aerosol-based inhalers, such as metered-dose inhalers. The medication is commonly held either in a capsule for manual loading or a proprietary blister pack located inside the inhaler. A vaccine of the present invention, in particular a vaccine for a human-pathogenic coronavirus infection, such as MERS, COVID-19, or SARS, may be, confectioned for the use in a DPI, comprised in a DPI, in particular a capsule or a blister pack for an MDI, or administered by using a MDI.
A nasal spray can be used for nasal administration, by which a drug is insufflated through the nose. A vaccine of the present invention, in particular a vaccine for a human-pathogenic coronavirus infection, such as MERS, COVID-19, or SARS may be, confectioned as a nasal spray, comprised in a nasal spray bottle, or administered as a nasal spray.
The pharmaceutical composition can also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously, into the ligament or tendon, subsynovially or intramuscularly), by subsynovial injection or by intramuscular injection. Thus, for example, the formulations may be modified with suitable polymeric or hydrophobic materials (for example as a emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
The pharmaceutical compositions may also be in a variety of conventional depot forms employed for administration to provide reactive compositions. These include, for example, solid, semi-solid and liquid dosage forms, such as liquid solutions or suspensions, slurries, gels, creams, balms, emulsions, lotions, powders, sprays, foams, pastes, ointments, salves, balms and drops.
The pharmaceutical compositions may, if desired, be presented in a vial, pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient. In one embodiment, the dispenser device can comprise a syringe having a single dose of the liquid formulation ready for injection. The syringe can be accompanied by instructions for administration.
The pharmaceutical composition may further comprise additional pharmaceutically acceptable components. Other pharmaceutically acceptable carriers, excipients, or stabilizers, such as those described in Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980) may also be included in a protein formulation described herein, provided that they do not adversely affect the desired characteristics of the formulation. As used herein, “pharmaceutically acceptable carrier” means any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed and include: additional buffering agents; preservatives; co-solvents; antioxidants, including ascorbic acid and methionine; chelating agents such as EDTA; metal complexes (e.g., Zn-protein complexes); biodegradable polymers, such as polyesters; salt-forming counterions, such as sodium, polyhydric sugar alcohols; amino acids, such as alanine, glycine, asparagine, 2-phenylalanine, and threonine; sugars or sugar alcohols, such as lactitol, stachyose, mannose, sorbose, xylose, ribose, ribitol, myoinisitose, myoinisitol, galactose, galactitol, glycerol, cyclitols (e.g., inositol), polyethylene glycol; sulfur containing reducing agents, such as glutathione, thioctic acid, sodium thioglycolate, thioglycerol, [alpha]-monothioglycerol, and sodium thio sulfate; low molecular weight proteins, such as human serum albumin, bovine serum albumin, gelatin, or other immunoglobulins; and hydrophilic polymers, such as polyvinylpyrrolidone.
The formulations described herein are useful as pharmaceutical compositions in the treatment and/or prevention of the pathological medical condition as described herein in a patient in need thereof. The term “treatment” refers to both therapeutic treatment and prophylactic or preventative measures. Treatment includes the application or administration of the formulation to the body, an isolated tissue, or cell from a patient who has a disease/disorder, a symptom of a disease/disorder, or a predisposition toward a disease/disorder, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve, or affect the disease, the symptom of the disease, or the predisposition toward the disease.
As used herein, the term “treating” and “treatment” refers to administering to a subject a therapeutically effective amount of a pharmaceutical composition according to the invention. A “therapeutically effective amount” refers to an amount of the pharmaceutical composition or the antibody which is sufficient to treat or ameliorate a disease or disorder, to delay the onset of a disease or to provide any therapeutic benefit in the treatment or management of a disease.
As used herein, the term “prophylaxis” refers to the use of an agent for the prevention of the onset of a disease or disorder. A “prophylactically effective amount” defines an amount of the active component or pharmaceutical agent sufficient to prevent the onset or recurrence of a disease.
As used herein, the terms “disorder” and “disease” are used interchangeably to refer to a condition in a subject. In particular, the term “cancer” is used interchangeably with the term “tumor”.
As used herein the term “CpG oligonucleotide” may refer to any synthetic or naturally occurring oligodeoxynucleotides (ODNs) containing unmethylated CpG motifs (e.g., as described by Bode et al., CpG DNA as a vaccine adjuvant. Expert Rev Vaccines. 2011 April; 10(4): 499-511). Thus, any suitable CpG oligonucleotide may be used in the present invention. The CpG oligonucleotide may, for example, belong to any of the three major classes of (stimulatory) CpG ODNs that have been identified based on structural characteristics and activity on human peripheral blood mononuclear cells (PBMCs), in particular B cells and plasmacytoid dendritic cells (pDCs). These three classes are Class A (e.g., PS-PO (phosphorothioated-phosphodiester) backbone; also known as Type D), Class B (e.g., PS (phosphorothioated) backbone; also known as Type K) and Class C (e.g., PS (phosphorothioated) backbone). CpG-A ODNs are usually characterized by a PO (phosphodiester) central CpG-containing palindromic motif and a PS-modified (i.e., phosphorothioated-modified) 3′ poly-G string, while CpG-B ODNs contain a full PS backbone with one or more CpG dinucleotides. CpG-C ODNs combine features of both classes A and B CpG oligonucleotides. Exemplary CpG ODNs of the present invention are further depicted in
The kit of the invention will typically comprise the container described above and one or more other containers comprising materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes, and package inserts with instructions for use.
In the present context, the term “liposome” refers to a spherical vesicle having at least one lipid bilayer.
In the present context, the term “endosome” refers to a membrane-bound compartment (i.e., a vacuole) inside eukaryotic cells to which materials ingested by endocytosis are delivered.
In the present context, the term “late-endosome” refers to a pre-lysosomal endocytic organelle differentiated from early endosomes by lower lumenal pH and different protein composition. Late endosomes are more spherical than early endosomes and are mostly juxtanuclear, being concentrated near the microtubule organizing center.
In the present context, the term “T helper cells” (also called TH cells or “effector CD4(+) T cells”) refers to T lymphocytes that assist other white blood cells in immunologic processes, including maturation of B cells into plasma cells and memory B cells, and activation of cytotoxic T cells and macrophages. These cells are also known as “CD4(+) T cells” because they express the CD4 glycoprotein on their surfaces. Helper T cells become activated when they are presented with e.g., peptide antigens, by MHC class II molecules, which are expressed on the surface of antigen-presenting cells (APCs).
As used herein, the term “self-antigen” refers to any molecule or chemical group of an organism which acts as an antigen in inducing antibody formation in another organism but to which the healthy immune system of the parent organism is tolerant.
As used herein, the term “% identity” refers to the percentage of identical amino acid residues at the corresponding position within the sequence when comparing two amino acid sequences with an optimal sequence alignment as exemplified by the ClustalW or X techniques as available from www.clustal.org, or equivalent techniques. Accordingly, both sequences (reference sequence and sequence of interest) are aligned, identical amino acid residues between both sequences are identified and the total number of identical amino acids is divided by the total number of amino acids (amino acid length). The result of this division is a percent value, i.e. percent identity value/degree.
An immunization method of the present invention can be carried out using a either a full length soluble encapsulated antigen (e.g., protein) or fragment of the protein in a synthetic environment that allows its proper folding, and therefore the probability of isolating antibodies capable of detecting corresponding antigens (e.g., a membrane protein) in vivo would be higher. Moreover, the immunization and antibody generation can be carried out without any prior knowledge of the membrane protein structure, which may otherwise be necessary when using a peptide-based immunization approach.
Further, when compared to other techniques, the method of the present invention allows for a rapid and cost-effective production of membrane protein encapsulated in an oxidation-stable membrane environment.
In some aspects, the present invention relates to a method for eliciting and/or modulating an immune response to an antigen (e.g., an immunogen) in a subject. The method may include administering to the subject a composition including a polymersome of the present invention having a membrane (e.g., circumferential) of an amphiphilic polymer. The composition further includes a soluble antigen encapsulated by the membrane of the amphiphilic polymer of the polymersome of the present invention. The immunogen may be a membrane-associated protein. In some further aspects, the polymersome of the present invention comprises a lipid polymer. The administration may be carried out in any suitable fashion, for example, by oral administration, topical administration, local administration to the respiratory tract, local administration to the lung, inhaled administration, intranasal administration, or injection.
The frequency of the administration (e.g. oral administration or injection) may be determined and adjusted by a person skilled in the art, dependent on the level of response desired. For example, weekly or bi-weekly administration (e.g. orally or by injection) of polymersomes of the present invention may be given to the subject, which may include a mammalian animal. The immune response can be measured by quantifying the blood concentration level of antibodies (titres) in the mammalian animal against the initial amount of antigen encapsulated by the polymersome of the present invention (cf., the Example Section).
The structure of the polymersomes may include amphiphilic block copolymers self-assembled into a vesicular format and encapsulating various antigens (e.g., soluble proteins, etc.), that are encapsulated by methods of solvent re-hydration, direct dispersion or by spontaneous self-assembly (e.g., Example 1 as described herein).
In the present context, the term “soluble antigen” as used herein means an antigen capable of being dissolved or liquefied. As an illustrative example, soluble antigen may consist of amino acids of the extracellular and/or intracellular region of a membrane protein. It can, however also comprise amino acids from the extracellular and/or intracellular region of a membrane protein and further one or more amino acids belonging to the transmembrane region of the membrane protein, as long as the antigen is still capable of being dissolved or liquefied. As an illustrative example, the soluble fragment of the MERS-CoV Spike protein of SEQ ID NO: 43 is a soluble antigen within the meaning of the present disclosure, while it comprises one amino acid (position 1297), which belongs to the transmembrane region. It is however envisioned that a soluble antigen preferably lacks at least a portion of a transmembrane region or the entire transmembrane region. The term “soluble antigen” includes antigens that were “solubilized”, i.e., rendered soluble or more soluble, especially in water, by the action of a detergent or other agent. Exemplary non-limiting soluble antigens of the present invention include: polypeptides derived from a non-soluble portion of proteins, hydrophobic polypeptides rendered soluble for encapsulation as well as aggregated polypeptides that are soluble as aggregates.
In some aspects, the antigens (e.g., membrane proteins) of the present invention are solubilized with the aid of detergents, surfactants, temperature change or pH change. The vesicular structure provided by the amphiphilic block copolymers allows the antigens (e.g., membrane protein) to be folded in a physiologically correct and functional manner, allowing the immune system of the target mammalian animal to detect said antigens, thereby producing a strong immune response.
In some aspects, the injection of the composition of the present invention may include intraperitoneal, subcutaneous, or intravenous, intramuscular injection, or non-invasive administration. In some other aspects, the injection of the composition of the present invention may include intradermal injection.
In some other aspects, the immune response level may be further heightened or boosted by including an adjuvant in the composition including the polymersome of the present invention. The adjuvant may be encapsulated adjuvant or non-encapsulated adjuvant. The adjuvant may be in mixture with a polymersome or combination of the invention. The adjuvant may be soluble in water or may be in form of a water-oil emulsion. In such aspects, the polymersome and the adjuvant can be administered simultaneously to the subject.
In some aspects, a block copolymer or an amphiphilic polymer of the polymersome of the present invention is neither immunostimulant nor adjuvant.
In some other aspects, a block copolymer or an amphiphilic polymer of the polymersome of the present invention is immunostimulant and/or adjuvant.
In some further aspects, a polymersome of the present invention is immunogenic.
In some further aspects, a polymersome of the present invention is non-immunogenic.
In some aspects, the adjuvant may be administered separately from the administration of the composition of the present invention including the polymersome of the present invention. The adjuvant may be administered before, simultaneously, or after the administration of the composition including the polymersome encapsulating an antigen of the present invention. For example, the adjuvant may be injected to the subject after injecting the composition including the polymersome encapsulating an antigen of the present invention. In some aspects, the adjuvant can be encapsulated together with the antigen in the polymersomes. In other preferred aspects the adjuvant is encapsulated in separate polymersomes, meaning the adjuvant in encapsulated separately from the antigen, so the antigen is encapsulated in a first kind of polymersome and the adjuvant is encapsulated in a second kind of polymersome. It is noted here that the adjuvant and the polymersome can be encapsulated in polymersomes that are formed from the same amphiphilic polymer. See Examples 7 to 9 or 14 or 18 of the present application in which the respective antigen and CpG oligodeoxynucleotide (for example, CpG ODN1826: 5′-tccatgacgttcctgacgtt-3′, SEQ ID NO: 18 or CpG ODN 2007: 5′—TCGTCGTTGTCGTTTTGTCGTT-3′, SEQ ID NO: 63) as illustrative adjuvant are both encapsulated in BD21 polymersomes. Alternatively, the amphiphilic polymer that is used for encapsulation of the antigen can be different from the amphiphilic polymersome that is used for encapsulation of the adjuvant. As a purely illustrative example, the antigen may be encapsulated in BD21 polymersomes while the adjuvant may be encapsulated in PDMS12-PEO46 or PDMS47PEO36 polymersomes.
Any known adjuvant can be used in the present invention and the person skilled in the art will readily recognize and appreciate that the types of adjuvant to be injected may depend on the types of antigen to be used for eliciting and/or modulating an immune response. The adjuvant may be an antigen of bacterial, viral, or fungi origin. The adjuvant may be a nucleic acid such as CpG oligodeoxynucleotides (also known as “CpG ODN” or herein also referred to as “CpG”), CpG molecules are natural oligonucleotides from bacteria that contain unmethylated CpG dinucleotides, in particular sequence contexts (CpG motifs). These CpG motifs are present at a 20-fold greater frequency in bacterial DNA compared to mammalian DNA. CpG ODNs are recognized by Toll-like receptor 9 (TLR9) leading to strong immunostimulatory effects. and are widely commercially available. Illustrative examples of commercially available CpG ODN include ODN 2006, a 24mer having the sequence TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: 62, commercially available from Miltenyi Biotech under catalogue number 130-100-106), ODN 2007, a 22mer having the sequence 5′—TCGTCGTTGTCGTTTTGTCGTT-3′ (SEQ ID NO: 63), ODN 1826 mentioned earlier, a 20mer having the sequence 5′-TCCATGACGTTCCTGACGTT-3′ (SEQ ID NO: 18), or ODN 2216, a 20mer having the sequence 5′-GGGGGACGA:TCGTCGGGGGG-3′ (SEQ ID NO: 64), with the latter three all being available from InvivoGen. Being natural DNA molecules, the bases are linked together through a phosphodiester bond (PO4). This bond however is susceptible to degradation from nucleases. When used as an adjuvant without any protective elements, the half-life of nature CpG molecules in the body is extremely short. In order to avoid this short half-life, phosphodiester bonds may be replaced with phosphorothioate bonds by changing one of the oxygen atom to a sulphur atom. This substitution prevents degradation by nucleases and extends the half-life of modified CpG. For example, the CpG molecules ODN 2006, ODN 2007 or ODN 1826 are offered with a complete phosphorothioate backbone form to render them nuclease resistant. Alternatively, CpG are encapsulated in cationic liposomes to avoid the degradation from nucleases. Other than CpG, many other widely used Toll like receptor agonists such as polyinosinic:polycytidylic acid (Poly (1:C)) (TLR3), Lipopolysaccharide (LPS) (TLR4), Monophosphryl lipid (MPL) (TLR5) can be used as one or more adjuvants in the present invention. Furthermore. components derived from bacterial and mycobacterial cell wall such as components present in Sigma Adjuvant System or Freund's adjuvants, or a protein such as Keyhole limpet hemocyanin (KLH) are further illustrative examples of adjuvants that can be also used in the present invention. Further illustrative examples of suitable adjuvants that can be used in the present invention include Sigma Adjuvant System (SAS) or simethicone or alpha-tocopherol. Other antigen-adjuvant pairs are also suitable for use in the methods of the present invention.
In this context, the term “adjuvant” as used herein is not limited to a pharmacological or immunological agent that modifies the effect of other agents (as, for example the adjuvants described above do) but means “any substance that stimulates the actions of the immune system”. Thus, a checkpoint inhibitor that stimulates the actions of the immune system is also encompassed within the meaning of the term adjuvant as used herein. For example, PD-L1 that is present on a cell surface binds to PD1 on an immune cell surface, which inhibits immune cell activity. Accordingly, for example, antibodies that bind to either PD-1 or PD-L1 and block the interaction of PD1 with PD-L1 are “such positive checkpoint inhibitor” since they may allow T-cells to attack the tumor.
In some aspects, a membrane protein used as antigen in the present invention may comprise a fragment or a extracellular domain of a transmembrane protein. The antigen may also be a (full length) transmembrane protein, G protein-coupled receptor, neurotransmitter receptor, kinase, porin, ABC transporter, ion transporter, acetylcholine receptor and cell adhesion receptor. The membrane proteins may also be fused to or coupled with a tag or may be tag-free. If the membrane proteins are tagged, then the tag may, for example, be selected from well-known affinity tags such as VSV, His-tag, Strep-tag®, Flag-tag, Intein-tag or GST-tag or a partner of a high affinity binding pair such as biotin or avidin or from a label such as a fluorescent label, an enzyme label, NMR label or isotope label.
In some aspects, the membrane proteins of fragments (or portions) thereof may be presented prior to encapsulation, or encapsulated simultaneously with the production of the protein through a cell-free expression system. The cell-free expression system may be an in vitro transcription and translation system.
The cell-free expression system may also be an eukaryotic cell-free expression system such as the TNT system based on rabbit reticulocytes, wheat germ extract or insect extract, a prokaryotic cell-free expression system or an archaic cell-free expression system.
An antigen or fragment (or portion) thereof of the disclosure may be produced in vivo. The antigen or fragment (or portion) thereof can for example be produced in a bacterial or eukaryotic host organism and then isolated from this host organism or its culture. It is also possible to produce antigen or fragment (or portion) thereof in vitro, for example by use of an in vitro translation system. A preferred expression system is the Baculovirus expression system. The utilization of the Baculovirus protein expression system is often overlooked as it is seen as being slow and expensive. However, one of the major advantages of the Baculovirus system is that the cell lines can be produced and maintained independent of the virus. This allows for rapid production of new subunit antigens without having to gain regulatory approval for new cell lines a useful tool given the rapid change in the sequence of virus's like MERS-CoV and SARS-CoV-1. Moreover, Baculovirus system produces antigens with novel glycosylation profiles compared to mammalian systems that have been shown to enhance the immune response. For example, both the full soluble (S1-S2) domains of the spike proteins for SARS-CoV-1 and MERS-CoV can been expressed in Sf9 cells. These proteins once immunised into Balb/c mice and show high virus neutralisation titres whether given alone, with alum of Matrix M1 adjuvants and this neutralisation may last for at least 45 days. The antigen of the disclosure is thus preferably produced using a eukaryotic host cell, preferably an insect cell, such as a Sf9 cell, or preferably using a Baculovirus expression system.
As mentioned above, the polymersomes may be formed of amphiphilic di-block or tri-block copolymers. In various aspects, the amphiphilic polymer may include at least one monomer unit of a carboxylic acid, an amide, an amine, an alkylene, a dialkylsiloxane, an ether or an alkylene sulphide.
In some aspects, the amphiphilic polymer may be a polyether block selected from the group consisting of an oligo(oxyethylene) block, a poly(oxyethylene) block, an oligo(oxypropylene) block, a poly(oxypropylene) block, an oligo(oxybutylene) block and a poly(oxybutylene) block. Further examples of blocks that may be included in the polymer include, but are not limited to, poly(acrylic acid), poly(methyl acrylate), polystyrene, poly(butadiene), poly(2-methyloxazoline), poly(dimethyl siloxane), poly(e-caprolactone), poly(propylene sulphide), poly(N-isopropylacrylamide), poly(2-vinylpyridine), poly(2-(diethylamino)ethyl methacrylate), poly(2-diisopropylamino)ethylmethacrylate), poly(2-methacryloyloxy)ethylphosphorylcholine, poly (isoprene), poly (isobutylene), poly (ethylene-co-butylene) and poly(lactic acid). Examples of a suitable amphiphilic polymer include, but are not limited to, poly(ethyl ethylene)-b-poly(ethylene oxide) (PEE-b-PEO), poly(butadiene)-b-poly(ethylene oxide) (PBD-b-PEO), poly(styrene)-b-poly(acrylic acid) (PS-PAA), poly (dimethylsiloxane)-poly(ethylene oxide (herein called PDMS-PEO) also known as poly(dimethylsiloxane-b-ethylene oxide), poly(dimethyl siloxane)-poly(acrylic acid) (PDMS-PAA), poly(2-methyloxazo1ine)-b-poly(dimethylsiloxane)-b-poly(2-methyloxazoline) (PMOXA-bPDMS-bPMOXA) including for example, triblock copolymers such as PMOXA20-PDMS54-PMOXA20 (ABA) employed by May et al., 2013, poly(2-methyloxazoline)-b-poly(dimethylsiloxane)-b-poly(ethylene oxide) (PMOXA-b-PDMS-b-PEO), poly(ethylene oxide)-b-poly(propylene sulfide)-b-poly(ethylene oxide) (PEO-b-PPS-b-PEO) and a poly(ethylene oxide)-poly(butylene oxide) block copolymer. A block copolymer can be further specified by the average block length of the respective blocks included in a copolymer. Thus, PBMPEON indicates the presence of polybutadiene blocks (PB) with a length of M and polyethyleneoxide (PEO) blocks with a length of N. M and N are independently selected integers, which may for example be selected in the range from about 6 to about 60. Thus, PB35PEO18 indicates the presence of polybutadiene blocks with an average length of 35 and of polyethyleneoxide blocks with an average length of 18. In certain aspects, the PB-PEO diblock copolymer comprises 5-50 blocks PB and 5-50 blocks PEO. Likewise, PB10PEO24 indicates the presence of polybutadiene blocks with an average length of 10 and of polyethyleneoxide blocks with an average length of 24. Illustrative examples of suitable PB-PEO diblock copolymers that can be used in the present invention include the diblock copolymers PBD21-PEO14 (that is also commercially available) and [PBD]21-[PEO]12, (cf, WO2014/077781A1 and Nallani et al., 2011), As a further example E0Bp indicates the presence of ethylene oxide blocks (E) with a length of 0 and butadiene blocks (B) with a length of P. Thus, 0 and P are independently selected integers, e.g. in the range from about 10 to about 120. Thus, E16E22 indicates the presence of ethylene oxide blocks with an average length of 16 and of butadiene blocks with an average length of 22.
Turning to another preferred block copolymer that is used to form polymersome of the invention, poly(dimethylsiloxane-b-ethyleneoxide) (PDMS-PEO), it is noted that both linear and comb-type PDMS-PEO can be used herein (cf. Gaspard et al, “Mechanical Characterization of Hybrid Vesicles Based on Linear Poly(Dimethylsiloxane-b-Ethylene Oxide) and Poly(Butadiene-b-Ethylene Oxide) Block Copolymers” Sensors 2016, 16(3), 390 which describes polymersomes formed from PDMS-PEO).
The structure of linear PDMS-PEO is shown in the following as formula (I)
while the structure of comb-type PDMS-PEO is shown in the following formula (II):
In line with the structural formula (I), the terminology PDMSn-PEOm indicates the presence of polydimethylsiloxane (PDMS) blocks with a length of n and polyethyleneoxide (PEO) blocks with a length of m. m and n are independently selected integers, each of which may, for example, be selected in the range from about 5 or about 6 to about 100, from about 5 to about 60 or from about 6 to about 60 or from about 5 to 50. For example, linear PDMS-PEO such as PDMS12-PEO46 or PDMS47PEO36 are commercially available from Polymer Source Inc., Dorval (Montreal) Quebec, Canada. Accordingly, the PDMS-PEO block copolymer may comprise 5-100 blocks PDMS and 5-100 blocks PEO, 6-100 blocks PDMS and 6-100 blocks PEO, 5-100 blocks PDMS and 5-60 blocks PEO, or 5-60 blocks PDMS and 5-60 blocks PEO.
In accordance with the above, the present invention relates in one aspect to the method of eliciting and/or modulating an immune response in a subject, comprising administering to the subject a polymersome formed from PDMS-PEO carrying an antigen. The antigen can be associated/physically linked with the PDMS-PEO polymersome in any suitable way. For example, the PDMS-PEO polymersome may have a soluble antigen encapsulated therein as described in the present invention. Alternatively or in addition, the polymersome may have an antigen integrated/incorporated into the circumferential membrane of the polymersome as described in WO2014/077781A1. In this case, antigen is a membrane protein that is integrated with its (one or more) transmembrane domain into the circumferential membrane of the PDMS-PEO-polymersome. The integration can be achieved as described in WO2014/077781A1 or Nallani et al, “Proteopolymersomes: in vitro production of a membrane protein in polymersome membranes”, Biointerphases, 1 Dec. 2011, page 153. In case, the antigen is encapsulated in the PDMS-PEO polymersome, it may be a soluble antigen selected from the group consisting of a polypeptide, a carbohydrate, a polynucleotide and combinations thereof. The present invention further relates to a method for production of such encapsulated antigens in a polymersome formed from PDMS-PEO as well as to polymersomes produced by said method.
The present invention further relates to compositions comprising PDMS-PEO polymersomes carrying an antigen. Also, in these compositions, the antigen can be associated/physically linked with the PDMS-PEO polymersome in any suitable way. For example, the PDMS-PEO polymersome may have a soluble antigen encapsulated therein as described in the present invention. Alternatively, or in addition, the polymersome may have an antigen integrated/incorporated into the circumferential membrane of the polymersome as described in WO2014/077781A1. The present invention also relates to vaccines comprising such PDMS-PEO polymersomes carrying an antigen, methods of eliciting and/or modulating an immune response or methods for treatment, amelioration, prophylaxis or diagnostics of cancers, autoimmune or infectious diseases, such methods comprising providing PDMS-PEO polymersomes carrying an antigen to subject in need thereof.
In accordance with the above, the present invention also relates to the in vitro and in vivo use of a PDMS-PEO polymersomes carrying (or transporting) an antigen in a manner suitable for eliciting and/or modulating an immune response. The antigen can either be encapsulated in the PDMS-PEO polymersome or, for example, incorporated into the circumferential membrane of the polymersome as described in WO2014/077781A1.
Another preferred block copolymer is poly(dimethyl siloxane)-poly(acrylic acid) (PDMS-PAA). The PDMS-PAA may be PDMSM-PAAN which indicates the presence of poly(dimethyl siloxane) (PDMS) blocks with a length of M and poly(acrylic acid) (PAA) blocks with a length of N. M and N are independently selected integers, which may for example be selected in the range from about 5 to about 100 and represent the average length of the blocks. The PDMS-PAA preferably comprises 5-100 blocks PDMS and 5-100 blocks PAA. Preferably, the PDMS-PAA comprises 5-50, preferably 10-40 blocks of PDMS and/or 5-30, preferably 5-25, preferably 5-20 blocks of PAA. The PDMS-PAA is preferably selected from the group consisting of PDMS30-PAA14, PDMS15-PAA7, or PDMS34-PAA16.
In certain aspects, the polymersome of the present invention may contain one or more compartments (or otherwise termed “multicompartments). Compartmentalization of the vesicular structure of polymersome allows for the co-existence of complex reaction pathways in living cell and helps to provide a spatial and temporal separation of many activities inside a cell. Accordingly, more than one type of antigens may be encapsulated by the polymersome of the present invention. The different antigens may have the same or different isoforms. Each compartment may also be formed of a same or a different amphiphilic polymer. In various aspects, two or more different antigens are integrated into the circumferential membrane of the amphiphilic polymer. Each compartment may encapsulate at least one of peptide, protein, and nucleic acid. The peptide, protein, polynucleotide or carbohydrate may be immunogenic.
Further details of suitable multicompartmentalized polymersomes can be found in WO20121018306, the contents of which being hereby incorporated by reference in its entirety for all purposes.
The polymersomes may also be free-standing or immobilized on a surface, such as those described in WO 2010/1123462, the contents of which being hereby incorporated by reference in its entirety for all purposes.
In the case where the polymersome carrier contains more than one compartment, the compartments may comprise an outer block copolymer vesicle and at least one inner block copolymer vesicle, wherein the at least one inner block copolymer vesicle is encapsulated inside the outer block copolymer vesicle. In some aspects, each of the block copolymer of the outer vesicle and the inner vesicle includes a polyether block such as a poly(oxyethylene) block, a poly(oxypropylene) block, and a poly(oxybutylene) block. Further examples of blocks—that may be included in the copolymer include, but are not limited to, poly(acrylic acid), poly(methyl acrylate), polystyrene, poly(butadiene), poly(2-methyloxazoline), poly(dimethyl siloxane), poly(L-isocyanoalanine(2-thiophen-3-yl-ethyl)amide), poly(e-caprolactone), poly(propylene sulphide), poly(N-isopropylacrylamide), poly(2-vinylpyridine), poly(2-(diethylamino)ethyl methacrylate), poly(2-(diisopropylamino)ethylmethacrylate), poly(2-(methacryloyloxy)ethylphosphorylcholine) and poly(lactic acid). Examples of suitable outer vesicles and inner vesicles include, but are not limited to, poly(ethyl ethylene)-b-poly(ethylene oxide) (PEE-b-PEO), poly(butadiene)-b-poly(ethylene oxide) (PBD-b-PEO), poly(styrene)-b-poly(acrylic acid) (PS-b-PAA), poly(ethylene oxide)-poly(caprolactone) (PEO-b-PCL), poly(ethylene oxide)-poly(lactic acid) (PEO-b-PLA), poly(isoprene)-poly(ethylene oxide) (PI-b-PEO), poly(2-vinylpyridine)-poly(ethylene oxide) (P2VP-b-PEO), poly(ethylene oxide)-poly(N-isopropylacrylamide) (PEO-b-PNIPAm), poly(ethylene glycol)-poly(propylene sulfide) (PEG-b-PPS), poly(dimethyl siloxane)-poly(acrylic acid) (PDMS-PAA), poly (methylphenylsilane)-poly(ethylene oxide) (PMPS-b-PEO-b-PMPS-b-PEO-b-PMPS), poly(2-methyloxazoline)-b-poly-(dimethylsiloxane)-b-poly(2-methyloxazoline) (PMOXA-b-PDMS-b-PMOXA), poly(2-methyloxazoline)-b-poly(dimethylsiloxane)-b-poly(ethylene oxide) (PMOXA-b-PDMS-b-PEO), poly[styrene-b-poly(L-isocyanoalanine(2-thiophen-3-yl-ethyl)amide)] (PS-b-PIAT), poly(ethylene oxide)-b-poly(propylene sulfide)-b-poly(ethylene oxide) (PEO-b-PPS-b-PEO) and a poly(ethylene oxide)-poly(butylene oxide) (PEO-b-PBO) block copolymer. A block copolymer can be further specified by the average number of the respective blocks included in a copolymer. Thus PSM-PIATN indicates the presence of polystyrene blocks (PS) with M repeating units and poly(L-isocyanoalanine(2-thiophen-3-yl-ethyl)amide) (PIAT) blocks with N repeating units. Thus, M and N are independently selected integers, which may for example be selected in the range from about 5 to about 95. Thus, PS40—PIAT50 indicates the presence of PS blocks with an average of 40 repeating units and of PIAT blocks with an average of 50 repeating units.
In some aspects, the polymersome of the disclosure includes a lipid, which is preferably in mixture with the block copolymer or amphiphilic polymer. The content of the lipid is typically low as compared to the amount of block copolymer or amphiphilic polymer. Typically, the lipid will be up to about 50%, up to about 45%, up to about 40%, up to about 35%, up to about 30%, up to about 20%, up to about 15%, up to about 10%, up to about 5%, up to about 2%, up to about 1%, up to 0.5%, up to about 0.2%, up to about 0.1% of the components that form the polymersome membrane (percentages are given by weight). Addition of a lipid may enhance encapsulation efficiency. The lipid may be a synthetic lipid, a natural lipid, a lipid mixture, or a combination of synthetic and natural lipids. Non-limiting examples for a lipid are phospholipids, such as a phosphatidylcholine, such as POPC, lecithin, cephalin, or phosphatidylinositol, or lipid mixture comprising phospholipids such as soy phospholipids such as asolectin. Further non-limiting examples of a lipid include cholesterol, cholesterol sulfate, 1,2-Dioleoyl-3-trimethylammonium propane (DOTAP). The lipid is preferably non-antigenic. In some aspects, the polymersome of the disclosure includes less than about 20%, less than about 15%, less than about 10%, less than about 5%, less than about 2%, less than about 1%, less than about 0.5%, less than about 0.2%, less than about 0.1% or is essentially free of a saponin (percentages are given by weight).
In some aspects, the invention relates to a method for production of an encapsulated antigen in polymersome, said method comprising: i) dissolving an amphiphilic polymer of the present invention in chloroform, preferably said amphiphilic polymer is polybutadiene-polyethylene oxide (BD); ii) drying said dissolved amphiphilic polymer to form a polymer film; iii) adding a solubilized antigen to said dried amphiphilic polymer film from step ii), wherein said antigen is selected from the group consisting of: (a) a polypeptide; preferably said polypeptide is an antigen is according to the present invention; (b) a carbohydrate; (c) a combination of a) and/or b) and/or c); iv) rehydrating said polymer film from step iii) to form polymer vesicles; v) optionally, filtering polymer vesicles from step iv) to purify polymer vesicles monodisperse vesicles; and/or vi) optionally, isolating said polymer vesicles from step iv) or v) from the non-encapsulated antigen.
In some other aspects, the invention relates to other methods for production of an encapsulated antigen in polymersome including methods based on mixing a non-aqueous solution of polymers in aqueous solution of antigens, sonication of corresponding mixed solutions of polymers and antigens, or extrusion of corresponding mixed solutions of polymers and antigens. Exemplary methods include those described in Rameez et al, Langmuir 2009, and in Neil et al Langmuir 2009, 25(16), 9025-9029.
In some aspects the invention relates to a method of modulating an immune response in a subject by administering an antigen and an adjuvant, wherein the antigen is associated with a first population of polymersomes, wherein the adjuvant is associated with a second population of polymersomes, wherein the two populations of polymersomes are administered to the subject, and wherein administering of the two separate populations modulates said immune response by increasing the number of CD4+ T cells that express one or more Th1 cytokines selected from the group consisting of IFNγ-, TNFα-, IL-2 and IL-12 compared to administering to the subject the adjuvant in a free form and/or compared to administering the antigen alone when associated with a first population of polymersomes.
In some aspects the invention relates to methods and compositions capable of inducing Th1-biased, functional memory T cells against an antigen (e.g., SARS-CoV-2 spike protein, cf. as described in Example 23 below).
In some aspects, co-administered (or consecutively administered, e.g., substantially simultaneous administration, e.g. where the administration may be for example be done via two separate injections administered on or around the same time) compositions of the present invention (e.g., ACM-S1S2+ACM-CpG formulation) are capable of inducing highly significant increase in IFNγ-, TNFα- or IL-2-expressing CD4+ T cells in response to an antigen. Strikingly, production of IL-5 can be strongly suppressed by co-administration (or consecutively administered, e.g., substantially simultaneous administration, e.g. where the administration may be for example be done via two separate injections administered on or around the same time) of an adjuvant (e.g., CpG). In particular, co-administered (or consecutively administered, e.g., substantially simultaneous administration, e.g. where the administration may be for example be done via two separate injections administered on or around the same time) compositions of the present invention (e.g., ACM-S1S2+ACM-CpG formulation) is capable of producing a clear Th1-polarized profile, which can be also reflected by an IgG1:IgG2b ratio<1. With regards to CD8+ T cells, IFNγ can be a predominant response to co-administered (or consecutively administered, e.g., substantially simultaneous administration, e.g. where the administration may be for example be done via two separate injections administered on or around the same time) compositions of the present invention (e.g., ACM-S1S2+ACM-CpG), In some aspects of the present invention, CD4+ T cells can exhibit a Th1-skewed cytokine profile, which can also be reflected in the predominance of IgG2b over IgG1.
In summary, ACM-S1S2+ACM-CpG can induce functional memory CD4+ and CD8+ T cells that could be detected 40 days after the last administration. The efficient uptake of ACM vesicles by cDC1 is likely important for generating CD8+ T cell immunity, given cDC1's ability to efficiently cross-present. In the present study, spike-specific CD8+ T cell responses has been demonstrated in mice vaccinated with ACM-S1S2, but not free S1S2 protein.
Inclusion of CpG in the vaccine formulation confers several benefits. It potently activates DCs to upregulate co-stimulatory molecules, including CD40, CD80 and CD86, which promotes T cell activation and B cell antibody class switch and secretion. Binding of CpG to TLR-9 triggers MAPK and NF-κB signalling that results in pro-inflammatory cytokine production and a Th1-skewed immune response. In the present study, such polarization is clearly demonstrated by the cytokine profile of CD4+ T cells and the IgG1:IgG2b ratio of the CpG-containing vaccine formulations. In the absence of CpG, IL-5 production was consistently observed which fits a broader picture of an inherent Th2 skew from immunizing with protein antigens of viral and non-viral origins. From a safety standpoint, this represents a potential risk of Th2 immunopathology, best exemplified by whole-inactivated RSV vaccines. Accordingly, such vaccines primed the immune system for a Th2-biased response during actual infection and the resultant production of Th2 cytokines promoted increased mucus production, eosinophil recruitment and airway hyperreactivity. Therefore, skewing of the immune response to Th1 by CpG can improve vaccine safety.
It has been shown that neutralizing titers can remain stable despite rapidly declining total IgG, which is consistent with SARS-CoV-2-infection in humans. This may be due to affinity maturation which progressively selects for high avidity, strongly neutralizing antibodies while excluding weaker binders. Additionally, compared to the neutralizing titers measured in convalescent patients recruited in Singapore, it appears that a vaccine formulation of the present disclosure may be more efficient in triggering neutralizing antibodies. Although the role of antibodies in Covid-19 remains to be established, it is reasonable to regard neutralizing antibodies as a potential correlate of protection. Reports of asymptomatic or mild patients producing widely varying neutralizing antibody levels, including a minority with no detectable neutralizing response, underscore the unpredictability of a natural infection. In this regard, a vaccine of the present disclosure can facilitate the induction of a more uniform neutralizing antibody response.
The role of T cells in SARS-CoV-2 is arguably less clear than antibodies. Nevertheless, several studies have confirmed the induction of a T cell response following infection. Early in the adaptive immune response against SARS-CoV-2, T cells are robustly activated. Patients who recovered from SARS in 2003 possessed memory T cells that could be detected 17 years after. Additionally, individuals with no history of SARS, Covid-19 or contact with individuals who had SARS and/or Covid-19 possessed cross-reactive T cells that may be generated by a previous infection with other betacoronaviruses. These data suggested that the SARS-CoV-2-specific T cell response may be similarly durable. In a study examining the T cell specificities of Covid-19 convalescent patients, spike-specific CD4+ T cells were consistently detected whereas CD8+ T cells were present in most subjects. This implies that a spike-based vaccine may generate a cellular immune response that largely recapitulates the CD4+ T cell profile of a natural infection, albeit with a narrower CD8+ T cell repertoire.
One major challenge in creating a pandemic vaccine is generating sufficient doses of high-quality antigen to rapidly meet global demand. As such, dose-sparing strategies are critical, and this has traditionally been achieved using adjuvants. Based on this work, it is believed that ACM technology together with an adjuvant can further augment the dose-sparing effect. It was shown that some embodiments greatly improve vaccine immunogenicity, such that even the 1/10th dose retains a substantial level of efficacy. The present investigation strongly supports the use of ACM technology to address limited antigen availability in a pandemic.
Compared to existing uptake and cross-presentation vehicles and methods based thereon the polymersomes of present invention inter alia offer the following advantages that are also aspects of the present invention:
The invention is also characterized by the following items:
In order that the invention may be readily understood and put into practical effect, some aspects of the invention are described by way of the following non-limiting examples.
Materials and Methods
A 100 mg/ml stock of Polybutadiene-Polyethylene oxide (herein referred to as “BD21”) is dissolved in chloroform. 100 μL of the 100 mg/ml BD21 stock is then deposited into a borosilicate (12×75 mm) culture tube and slowly dried under a stream of nitrogen gas to form a thin polymer film. The film was further dried under vacuum for 6 hours in a desiccator. A 1 mL solution of 1-5 mg/ml solubilized Ovalbumin (OVA) protein in 1x PBS buffer was then added to the culture tube. The mixture was stirred at 600 rpm, 4° C. for at least 18 hours to rehydrate the film and to allow the formation of polymer vesicles. The turbid suspension was extruded through a 200-nm pore size Whatman Nucleopore membrane with an extruder (Avanti 1 mL liposome extruder, 21 strokes) to obtain monodisperse vesicles [e.g., Fu et al., 2011, Lim. S.K, et al., 2017]. The protein containing BD21 polymer vesicles were purified from the non-encapsulated proteins by dialyzing the mixture against 1 L of 1x PBS using a dialysis membrane (300 kDa MWCO, cellulose ester membrane).
The final vesicle mixture was analysed for non-encapsulated protein using size-exclusion chromatography. Fractions of the vesicle peak from SEC were used to quantify the amount of protein encapsulation via SDS-PAGE. Vesicle size and mono-dispersity was characterized by dynamic light scattering instrument (Malvern, United Kingdom) (100× dilution with 1× PBS). For quantification of OVA encapsulated in polymersomes, samples were pre-treated with 20% DMSO followed by sample buffer, after which they were loaded on to the SDS-PAGE analysis.
For peptides encapsulation (exemplified by MC 38 neo-antigen peptides of SEQ ID NO: 1, 2 and 3), a similar protocol was followed. Peptides concentration was 0.5-0.3 mg/ml dissolved in PBS for encapsulation. After dialysis, an amount of encapsulated peptides was determined using Phenylalanine fluorescence (ex 270 nm/em 310 nm) using a Cary Eclipse Spectrophotometer (Agilent). Encapsulation of all 3 peptides was performed individually and concentration was determined to be 20-30 μg/ml for all peptides. An equivalent volume of each of 3 encapsulated peptides was mixed together just before injection into mice.
For Trp2 peptide encapsulation, co-solvent or nanoprecipitation method was followed. 0.4 mg of Trp2 173-196 peptide (QPQIANCSVYDFFVWLHYYSVRDT, SEQ ID NO: 9) was diluted in 1 ml of buffer containing 10 mM Borate buffer, 125 mM NaCl, 10% Glycerol, pH 8.5. 4.25 μmol of BD2I/0.75 μmol of Dioleoyl-3-trimethylammonium propane (DOTAP lipid) mixture dissolved in THF was added slowly to the solution while vortexing vigorously for 4-5 h. Extrusion and dialysis was performed as above with slight modification in the dialysis step. Briefly, vesicles were then filtered through a 0.22 μm filter (PES membrane, Millipore) and subjected to dialysis over 48 h with 3 buffer exchanges. Concentration of encapsulated Trp2 was determined by HPLC and the final concentration of Trp2 is 160 μg/ml.
For adjuvant CpG encapsulation (using the class B CpG-Oligodeoxynucleotide of SEQ ID NO: 18, available from InvivoGen), 4.25 μmol of BD2I/0.75 μmol of Dioleoyl-3-trimethylammonium propane (DOTAP lipid) mixture was dissolved in chloroform. The resulting mixture was then deposited into a borosilicate (12×75 mm) culture tube and slowly dried under a stream of nitrogen gas to form a thin polymer film. The film was further dried under vacuum for 6 hours in a desiccator. 100 μg of the CpG dissolved in 10 mM Borate buffer, 125 mM NaCl, 10% Glycerol. The samples were extruded was then dialyzed over 48 h with 3 buffer exchanges. CpG quantified by generating a standard curve using known amount of CpG using SYBR-Safe dye. ACM samples were ruptured and incubated for 30 min at RT and transferred to a black plate for quantification (Ex500 nm: Em 530 nm). Routinely, the encapsulated CpG concentration was around 70-90 μg/ml.
For HA encapsulation, a similar protocol was followed. Recombinant HA (H1N1/A/Puerto Rico/8/1934 strain) at a concentration of 10 μg/ml was dissolved in PBS for encapsulation. After dialysis, an amount of encapsulated peptides was determined by western blot. HA concentration after encapsulation was determined to be around μg/ml. 100 ul were injected in mice.
For PEDv SPIKE protein encapsulation in BD21 polymersomes, a similar protocol was followed as described above. PEDv SPIKE protein (different constructs, SEQ ID Nos: 12-14) were expressed using Baculovirus expression system. Proteins isolated from the insect cells were added for encapsulation. Whereas, for encapsulation of PEDv SPIKE protein in polymersomes made of poly (dimethyl siloxane)-poly(ethylene oxide (PDMS46-PEO37 obtained from Polymer Source, Quebec, Canada), or a mixture of block copolymers and lipids such as PDMS46-PEO37 (/DSPE-PEG, PLA-PEG/POPC, PLA-PEG/Asolectin, a different protocol was followed in order to show the generality of the methods. Polymer and or polymer lipid mixture were dissolved in ethanol or any water miscible solvent and added dropwise to a protein solution to self-assemble and the proteins are encapsulated into polymersomes during self-assembly. Non-encapsulated proteins were removed by dialysis with PBS. After dialysis, amount of each polymersome sample encapsulated proteins was determined by densitometry. The concentration of proteins after encapsulation was determined to be around 1 μg/ml for each of these polymersome formulations. Polymersomes were encapsulated either with soluble SPIKE protein (SEQ 12) or S1 region of SPIKE protein (SEQ 13) and S2 region of SPIKE protein (SEQ 14). 100-200 μl of polymersomes (either only with soluble SPIKE protein or with mixture of polymersomes with S1 and S2 region of SPIKE proteins) were injected in mice and 1 ml of such polymersomes was orally administered to pigs.
For eGFR DNA encapsulation, a similar protocol as OVA encapsulation was followed. Briefly, block co-polymers such as poly(butadiene)-poly(ethyleneoxide) (BD21), poly(butadiene)-poly(ethyleneoxide) modified with functional groups (e.g., NH2, COOH) at the end of poly (ethylene oxide) chain (BD21-NH2), mixture of block copolymers and lipids such as PLA-PEG/POPC, PLA-PEG/Asolectin, Dimethylaminoethane-carbamoyl (DC)-Cholesterol, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP) were dissolved in chloroform and transferred to a glass tube and slowly dried under a stream of nitrogen gas to form a thin film. The film was further dried under vacuum for 6 hours in a desiccator. 1 μg of eGFP DNA was added to the film and rehydrated overnight. Afterwards, the samples were extruded with 0.2 um polycarbonate filter and dialyzed in HEPES Buffer.
HEK293T cells were seeded with a density of 50,000 cells/well into a 48-well plate. For transfections (the Lipofectamine 2000 transfection), 1,000 μL of Opti-MEM I (Invitrogen), 2 μL of Lipofectamine 2000 (Invitrogen), and 1 μg of SF-GFP PC DNA (or polymersomes formulation containing 1 μg of SF-GFP PC DNA) were mixed. The transfection complexes were formed during 20 min incubation at RT. For transfection, the lipofectamine complex was added to the cells and incubated for 24 hr to 72 hr at 37° C. and 5% C02. The efficiency of transfection was measured by GFP fluorescence, Ex 485 nm, Em 520 nm). For cellular uptake fluorescence measured at Ex 530 nm Em 560 nm. For imaging, aspirated the cell media followed by washed the cells with DPBS (with Ca2+/Mg2+) and fixed with 4% p-formaldehyde. Then, the glass cover-slip was removed and flipped into a glass slide containing a drop of 20 ul mounting media with DAP. Finally, sealed the cover-slip with nail polish and stored at 4° C. for future imaging. Fluorescence microscopy was used for imaging.
C57bl/6 mice were immunized using free OVA with or without Sigma Adjuvant System (SAS) and OVA encapsulated ACMs (polymersomes) by doing a prime and a boost 21 days later. All immunizations were performed with a final amount of OVA: 5-10 μg OVA/injection/mouse. Final bleeds were collected 42 days after prime. ELISA was then performed to assess titers: OVA was coated onto MaxiSorp plates (1 μg/ml) overnight. Plates were blocked using 3% BSA in PBS for 1h at RT. All sera were diluted at 1:100 and incubated on plates for 1h at RT. After 3 washes with PBS+0.05% Tween 20, secondary antibody anti-mouse IgG HRP coupled was incubated at 1:10,000 dilution for 1h, RT (room temperature). After 3 washes with PBS/Tween 20 buffer, TMB substrate was added and reaction was stopped using 1M HCl. Optical densities were quantified at 450 nm.
Similarly, Balb/c mice were immunized with free HA proteins (SEQ ID NO: 7), ACM encapsulated HA (polymersomes) in PBS or PBS control. All immunizations were performed with a same final amount of HA: 100 ng HA/injection/mouse. Final bleeds were collected 42 days after prime and ELISA were performed as above using 1 μg/ml HA for plate coating.
To observe a specific CD8 T cell response after immunization we used a MC-38 syngeneic tumour model. C57bl/6 mice were inoculated with subcutaneously at the right flank with MC-38 tumour cells (3×105) in 0.1 ml of PBS for tumour development. The inoculation day is defined as Day 0. The animals were randomized based on the bodyweights and immunizations were started at day 4 after the inoculation. Immunizations consisted of: free peptides, ACM encapsulated peptides (polymersomes) with and without co-treatment with a commercially available anti-PD-1 antibody. Peptides were: Reps1 P45A (SEQ ID NO: 1), Adpgk R304M (SEQ ID NO: 2) and Dpagt1 V213L (SEQ ID NO: 3) and were obtained from Genscript. 200 ul of peptides and peptides in ACMs were immunized subcutaneously on day 4, 11 and 18. The concentration of peptides in ACMs was determined to be 20-30 μg/ml, whereas for peptides alone 10 μg per injection per mice was used. The anti-PD1 antibody was injected intraperitoneally on day 5, 8, 12, 15, 19 and 22 at 5 mg/kg dosage. Animals were checked for any effects of tumour growth and treatments on normal behaviour such as mobility, food and water consumption, body weight gain/loss (body weights will be measured 3 times per week). Tumour sizes were measured 3 times per week in two dimensions using a caliper, and the volume was expressed in mm3 using the formula: V=0.5 a×b2 where a and b are the long and short diameters of the tumour, respectively.
Mice were immunised with ACM encapsulated PEDv spike protein (as an illustrative example of a vaccine against a coronavirus) and boosted with a second dose after 21 days, 150 ul-200 μl of polymersomes encapsulated with PEDv Spike protein were immunized. Sera was collected from the final bleed and was used for ELISA. Moreover, these sera were tested for their ability to neutralise the PEDV strain USA/Colorado/2013 (CO/13) through a conventional virus neutralisation. Furthermore, weaned pigs were orally vaccinated with 1 ml of polymersome encapsulated with PED SPIKE protein (after a prime on day 1 and a boost on day 14). A simple physiological solution was used for the oral vaccination.
Mice were administered with four different OVA protein immunization protocols: 1. free OVA with free CpG co-administered, 2. OVA encapsulated by BD21 polymersomes with free CpG co-administered, 3. free OVA with CpG encapsulated by BD21 polymersomes and 4. OVA encapsulated by BD21 polymersomes (representing a first population of polymersomes as used in the present invention) co-administered with a CpG encapsulated by BD21 polymersomes (representing a second population of polymersomes as used in the present invention) as a prime and boost subcutaneously to C57Bl/6 mice 7 days apart followed by inoculation of 105 B16-OVA cells on the right flank on the same side as immunizations. Tumor development was monitored for 30 days.
Mice were inoculated with 105 B16-OVA cells for tumor growth and three different OVA protein formulations (1. free OVA with CpG co-administered, 2. OVA encapsulated BD21 polymersomes and free CpG co-administered, 3. OVA encapsulated BD21 polymersomes (representing a first population of polymersomes as used in the present invention) with separate CpG encapsulated polymersomes (representing a second population of polymersomes as used in the present invention) were immunized as prime and 2 boosts (on day 5, day 10 and day 14) after inoculation of B16-OVA cells. All immunization samples consist of 5-10 μg of OVA, 8 μg of CpG per mice. Tumor development was monitored for more than 20 days and in order to directly correlate the tumor response for the different OVA formulations, blood samples were collected on day 20 for dextramer staining.
105 B16F10 cells were first inoculated into C57Bl/6 mice and followed by the different Trp2 (tyrosinase related protein-2, as an antigen) formulations for immunization. All formulations consist of 16 μg of Trp2 peptide that was injected per mice. After Vaccination, the tumor growth was monitored and in order to directly correlate the tumor response for the different Trp2 formulations, tumor samples were collected on day 17 by sacrificing animals (n=4) and the blood samples on day 21 for the animals that were monitored for tumor growth.
CpG ODN can be conjugated via either 5′ or 3′ end with a functional group. Amine (—NH2) and free thiol (—SH) functional ODN can be custom synthesized in either 5′ or 3′ terminus. Three conjugation strategies described in more detail below can all be used to effectively conjugate an adjuvant such as CpG ODN to functional polymers and surface functional ACM particles. (1) SH-ODN/ACM—Maleimide conjugation, (2) NH2—ODN/ACM—NHS (N-hydroxysuccinimidyl ester), (3) NH2-ODN/ACM-Aldehyde. In addition to the covalent conjugation of ODN to ACM, hydrolyzable linkers or cleavable linkers can be introduced between ODN and polymer chain. Acid cleavable linker (hydrazone, oxime), enzyme cleavable linker (dipeptide-based linkers Val-Cit-PABC and Phe-Lys) or glutathione cleavable disulfide linker can be introduced to release CpG in the Antigen Presenting Cells.
ACM-ODN conjugation strategy using SH-ODN and Polymer-Maleimide (Polymer-MAL): The disulfide precursor to 5′ sulfhydryl ISS CpG-ODN or 3′ sulfhydryl ISS CpG-ODN was treated with 700 mM tris-(2-carboxyethyl) phosphine (TCEP) solution was made in HBSE (140 mM NaCl buffered with 10 mM HEPES containing 1 mM EDTA) pH 7, and used at a five molar excess to reduce disulfide-ODN at 40° C. for 2 h. Residual TCEP was removed using a PD-10 desalting column (GE Healthcare) and eluted in HBSE pH 6.5. Reduced SH-ODN was used immediately or stored at −80° C. until use. Polymer-MAL was prepared beforehand using amine function polymer and NHS-PEG-MAL linker group. ACM-ODN complex can be prepared either pre-conjugating ODN to polymer then form ACM or conjugation of ODN on pre-formed ACM. For pre-conjugation of SH-ODN and polymer-MAL can be done in presence of DMF in HBSE buffer, pH 7 at 40° C. for 4 hr in dark or via water-in-oil emulsion (HBSE buffer: ether, 2:1 ratio) at 40° C. for 4 hr in dark. The organic solvents and water were removed by rotor evaporator followed by lyophilization. Dry ODN-polymer was used to form ACM upon mixing with a non-functional polymer. For pre-formed ACM-MAL was prepared using 10-20% function Polymer-MAL with 80-90% non-functional polymer via thin-film rehydration technique, rehydrated in HBSE buffer, pH 7. Reduced SH-ODN was conjugated with pre-formed ACM-MAL in HBSE buffer, pH 7 at 40° C. for 4 hr. Unconjugated SH-ODN was removed from ACM-ODN conjugates by Sepharose CL-4B size-exclusion chromatography or via dialysis.
ACM-ODN conjugation strategy using NH2-ODN and Polymer-N-hydroxysuccinimidyl ester (Polymer-NHS): The amine functional 5′ CpG-ODN or 3′ CpG-ODN was conjugated with N-hydroxysuccinimidyl ester functionalized polymer (polymer-NHS). Polymer-NHS was prepared beforehand from hydroxyl function polymer and N,N′-Disuccinimidyl carbonate in presence of DMAP under dry acetone/dioxane mixture.
ACM-ODN complex can be prepared either pre-conjugating ODN to polymer then form ACM or conjugation of ODN on pre-formed ACM. For pre-conjugation of NH2-ODN and polymer-NHS can be done in the presence of dry DMF at room temperature for 8 hr. The organic solvent was removed by lyophilization. Dry ODN-polymer was used to form ACM-ODN upon mixing with non-functionalized polymer via thin-film rehydration technique.
For pre-formed ACM-NHS was prepared using 20-30% function Polymer-NHS with 70-80% non-functional polymer via thin-film rehydration technique in phosphate buffer, pH 6.8. NH2-ODN was added to the pre-formed ACM-NHS in PB buffer, pH 6.8 at 4° C. and react overnight. Unconjugated NH2-ODN was removed from ACM-ODN conjugates by Sepharose CL-4B size-exclusion chromatography or via dialysis.
ACM-ODN Conjugation Strategy Using NH2-ODN and Polymer-Aldehyde (Polymer-CHO):
The amine functional 5′ CpG-ODN or 3′ CpG-ODN was conjugated with aldehyde functionalized polymer (polymer-CHO) to form imine bond which further reduced to stable amine bond formation by sodium cyanoborohydride (NaCNBH4) treatment. Polymer-CHO was prepared beforehand from hydroxyl function polymer by selective oxidation of alcohol to aldehyde in the presence of Dess-Martin periodinane.
ACM-ODN complex can be prepared either pre-conjugating ODN to polymer then form ACM or conjugation of ODN on pre-formed ACM.
For pre-conjugation of NH2-ODN and polymer-CHO can be done in the presence of dry DMF at room temperature for 16 hr which give rise to imine bond formation which further reduced to an amine by NaCNBH4. Residual NaCNBH4 was removed using a PD-10 desalting column (GE Healthcare) and eluted in water/DMF mixture. The organic solvent was removed by lyophilization. Dry ODN-Polymer was used to form ACM-ODN upon mixing with non-function polymer via thin-film rehydration technique.
For pre-formed ACM-CHO was prepared using 30-40% functional Polymer-CHO with 60-70% non-functional polymer via thin-film rehydration technique, rehydrated in 10 mM borate buffer, pH 8.2. NH2-ODN was added to pre-formed ACM-CHO in borate buffer, pH 8.2 and react overnight at room temperature for form imine bond. Further imine bond reduced to a stable amine bond upon NaCNBH4 treatment at 4° C. overnight. Unconjugated NH2-ODN and free NaCNBH4 were removed from ACM-ODN conjugates by Sepharose CL-4E size-exclusion chromatography or via dialysis.
Conjugation of BD21 Vesicles to Ovalbumin (OVA):
BD21+5% DSPE-PEG(3000)-Maleimide Vesicles formation:
100 μL of BD21 (100 mg/mL) in CHCl3 was transferred to 25 mL of single-neck RBF (round bottom flask) to which was added 80.89 μL of DSPE-PEG-Maleimide (10 mg/mL in CHCl3). The solvent was slowly evaporated under reduced pressure at 35° C. to get wide-spread thin-film and was dried in desiccator under vacuum for 6 hours. 1 mL of NaHCO3 buffer (10 mM, 0.9% NaCl, pH 6.5) was added to the thin-film for rehydration and stirred at 25° C. for 16-20 hours to form milky homogeneous solution. After rehydration for 16-20 hours, the solution was extruded with 200 nm Whatman membrane at 25° C. for 21 times. The solution was transferred to dialysis bag (MWCO (weight cut-off): 300 KD) and dialyzed in NaHCO3 buffer (10 mM, 0.9% NaCl, pH 6.5) (2×500 mL and 1×1 L; first two dialysis were done for 3 hours each and the last one for 16 hours). Vesicle size and mono-dispersity was characterized by dynamic light scattering Instrument (Malvern, United Kingdom) (100× dilution with 1× PBS).
Conjugation of BD21+ DSPE-PEG(3000)-Maleimide (5%) to OVA:
OVA (0.5 mg) was dissolved in 200 μL of NaHCO3 buffer (10 mM, 0.9% NaCl, pH 6.5) to which was added 2.5 mg of TCEP-HCl (dissolved in 100 μL of same NaHCO3 buffer) and incubated for 20 minutes. pH of the reaction was adjusted from ˜2.0 to 6-7 using 1N NaOH solution (˜10 μL). 350 μL of polymersomes (10 mg/mL of BD/DSPE-PEG(3000)-Maleimide 5% in 10 Mm NaHCO3, 0.9% NaCl buffer, pH 7.0) was then added to the protein mix and pH of the reaction was adjusted again to pH 7.0 (if pH of reaction was not 7). Reaction was incubated at 24° C. for 3 hours away from light. The reaction solution (˜660 μL) was transferred to dialysis bag (MWCO: 1000 KD) and dialyzed in NaHCO3 buffer (10 mM, 0.9% NaCl, pH 7.0) (3×1L; first two dialysis were done for 3 hours each and the last one for 16 hours). 100 μL of dialyzed solution was purified through SEC chromatography and collected in 96-well plate. The corresponding ACM peak fractions were combined and lyophilized for quantification by SDS-PAGE.
For comparison, OVA was also encapsulated in BD21 alone. For this a film was produced as above using 100 μl of a 100 mg/ml BD21 stock dissolved in CHCl3. Rehydration was then performed by adding 1 mL solution of 0.5 mg/ml solubilized OVA protein in 1×PBS buffer. The mixture was stirred at 600 rpm, 4° C. for at least 18 hours to allow the formation of polymer vesicles, extruded and dialyzed as above.
Conjugation of BD21 Vesicles to Hemagglutinin (HA):
To a stirred solution of BD21 (100 mg) in single-neck RBF was dissolved in anhydrous CH2Cl2 (6 mL) and was added Dess-Martin periodinane (10 mg, 0.4 equiv) at 0° C. in one-portion. Reaction was stirred at 25° C. for 4 hours. Then 1:1 mixture of saturated NaHCO3 and Na2S2O3 (20 mL) was added and stirred at the same temperature for 2 hours. Organic layers was separated, and the aqueous layers was extracted with CH2Cl2 (20 mL) and separated the organic layer. The combined organic layers were washed with 1:1 mixture of sat. NaHCO3 and Na2S2O3 (20 mL), brine (20 mL), dried over anhydrous Na2SO4 and evaporated under reduced pressure to get colourless viscous oil (100 mg, quantitative). Modification yield was estimated to be around 30% by NMR.
Conjugation of BD-CHO to HA:
10 mg of modified BD21-CHO (colourless viscous oil) was dissolved in 0.5 mL of CHCl3 in 25 mL of single-neck RBF and slowly evaporated the solvent under reduced pressure using Rotavap at 35° C. for 10 minutes to get wide spread thin-film. The film was dried under vacuum in desiccator for 6 hours. The film was rehydrated in 400 μl of borate buffer (borate 10 mM, 150 mM NaCl, pH 7.5) for 30 minutes before adding 0.5 mg of HA (150 μl of HA was prepared by pre-equilibrating it in borate buffer by dialysis). Reaction was stirred at 25° C. for 16 hours. 20 μL of NaCNBH4 was then added to the solution (preparation: 126 mg of NaCNBH4 was dissolved in 1 mL of Millipore water and degassed the excess H2 gas by stirring the solution at 25° C. for 30 minutes) and kept on stirring at 25° C. for another 8-16 hours. The conjugated polymersomes were extruded by using 200 nm Whatman membrane at 25° C. for 21 times. The reaction solution was transferred to dialysis bag (MWCO: 1000 KD) and dialysed in PBS buffer (1×, pH 7.4) (3×1L; first two dialysis were done for 3 hours each and the last one for 16 hours). After dialysis, 400 μL of dialysed solution was purified through SEC chromatography (Size-exclusion chromatography) and collected in a 96-well plate. The presence of coupled HA was detected using both Western Blot and ELISA assays (Enzyme-linked Immunosorbent Assay). Vesicle size and mono-dispersity was characterized by dynamic light scattering (100× dilution with 1× PBS).
For comparison, HA was also encapsulated in BD21 alone. For this a film was produced as above using 100 μl of a 100 mg/ml BD21 stock dissolved in CHCl3. Rehydration was then performed by adding 1 mL solution containing 20 μg of HA protein in 1× PBS buffer. The mixture was stirred at 600 rpm, 4° C. for at least 18 hours to allow the formation of polymer vesicles, extruded and dialyzed as above.
Quantification of Coupled HA and OVA:
To detect the presence of coupled proteins several techniques were used. 100 to 300 μl of dialyzed sample was loaded onto a Size Exclusion Chromatography (SEC, Akta) using a Sephacryl column. SEC fractions corresponding to the peak of ACM vesicles were pooled or used as is to either be analysed by SDS-PAGE or/and ELISA. For SDS-PAGE, 20-40 μl of each fraction was mixed DMSO (20% v/v) and vortexed thoroughly before adding loading buffer. Different amounts of free BSA (Bovine serum albumin), HA or OVA was added for quantification. After migration, the gel was either stained by sliver staining (OVA) or used for a membrane transfer and immunoblotting with rabbit polyclonal antibody (HA). To further ensure that HA was coupled to the polymer, 25 ul of all SEC fractions was coated into a Maxisorp 384-well plate overnight at 4° C. After blocking with 3% BSA, rabbit polyclonal anti-HA antibody was used as primary antibody followed by HRP (horseradish peroxidase) coupled anti-rabbit as secondary. TMB substrate was added and reaction was stopped using 1M HCl. Optical densities were quantified at 450 nm.
Mouse Immunizations and Titer Determination (mAb):
C57bl/6 mice were immunized with different OVA formulations: PBS (negative control), free OVA with or without Sigma Adjuvant System (SAS), OVA encapsulated ACMs or OVA conjugated ACMs. Balb/c mice were immunized with different HA formulations: PBS (negative control), free HA, HA encapsulated ACMs or HA conjugated ACMs. Both trials were performed by doing a prime and a boost 21 days later. All immunizations were performed with a same final amount of antigen within each trial: 5-10 μg OVA/injection/mouse or 100-200 ng HA/injection/mouse. Final bleeds were collected 42 days after prime. ELISA was then performed to assess titers: OVA or HA were coated onto MaxiSorp plates (1 μg/ml in carbonate buffer) overnight. Plates were blocked using 3% BSA in PBS for 1h at RT. All sera were diluted at 1:100 and incubated on plates for 1h at RT. After 3 washes with PBS+0.05% Tween 20, secondary antibody anti-mouse IgG HRP coupled was incubated at 1:10,000 dilution for 1h, RT (room temperature). After 3 washes with PBS/Tween 20 buffer, TMB substrate was added and reaction was stopped using 1M HCl. Optical densities were quantified at 450 nm.
Polymersomes (also called ACMs (artificial cell membranes) prepared with 5% DSPE-PEG(3000)-Maleimide were used to couple OVA through available cysteines. At least one cysteine has been shown to be accessible to solvent (Tatsumi et al., 1997). Coupling conditions were achieved in pH-controlled environment.
BD21 polymer was modified as described in the methods and the aldehyde modification percentage was estimated to be around 30-40% by NMR. The aldehyde moiety added to the BD21 will react with the primary amines of HA's lysine and arginine residues. After overnight coupling followed by extensive dialysis, the resulting vesicles were characterized.
C57bl/6 mice were immunized with the following formulations: a negative control (PBS), free OVA with or without Sigma Adjuvant System (SAS), BD21 encapsulated OVA and BD21 conjugated OVA. All immunizations had a same amount of 4 μg of OVA per injection and per mouse. 21 days after the boost, sera were collected for tittering by ELISA.
In addition, Balb/c mice were immunized with the following formulations: a negative control (PBS), free HA, BD21 encapsulated HA and BD21 conjugated HA. Since some residual free HA was observable in the HA conjugated polymersome sample even after extensive dialysis, pooled fractions of SEC were used for immunizations. All immunizations had a same amount of 100-200 ng of HA per injection and per mouse.
OVA encapsulated polymersomes were purified by dialysis and size exclusion column (SEC) to remove the non-encapsulated proteins and analysed by dynamic light scattering. As shown in
Dynamic light scattering (DLS) data is presented in
eGFP DNA encapsulated polymersomes were transfected with HEK293T cells and after transfection, the uptake of ACM polymersomes were measured by fluorescence plate reader at Ex 530 nm and Em 560 nm and the transfection efficiency was measured by the GFP fluorescence (Ex 485 nm, Em 520 nm). As shown in
OVA encapsulated polymersomes were immunized in C57bl/6 mice by doing a prime and a boost 21 days later. Final bleeds were used for performing the ELISA. As shown in
HA (H1N1/A/Puerto Rico/8/1934 strain, SEQ ID NO: 7) encapsulated polymersomes were immunized in Balb/c mice by doing a prime and a boost 21 days later. Final bleeds were used for performing the ELISA. As shown in
In order to show that ACM encapsulated antigen are able to trigger a CD8 T cell response we used a well-defined MC-38 syngeneic mouse tumour model which relies on the delivery of known CD8 antigenic peptides. High quantities of these peptides combined with adjuvants have been shown to trigger tumour control in therapeutic mouse models (e.g., Kuai et al., 2017, Luo et al., 2017). In addition, these effects were clearly correlated to the presence of peptide-specific CD8 T cells in the mouse blood. Hence any tumour development difference between groups would be directly attributed to the presence of a peptide-specific pool of CD8 T cells. 4 days after inoculation with MC-38 cell lines, mice were immunized with either free peptides, ACM encapsulated peptides (polymersomes) with and without anti-PD1 antibody treatment as described in the section Materials and Methods herein. As shown in
Mice were immunised with ACM encapsulated PEDv spike protein and boosted with a second dose after 21 days. Sera was collected from the final bleed and was used for ELISA. As can be seen in
Mice were administered with different formulations as a prime and boost subcutaneously to C57Bl/6 mice 7 days apart followed by inoculation of 105 B16-OVA cells on the right flank on the same side as immunizations. In all groups but the PBS control group, CpG was used as an adjuvant. All mice immunized with PBS control developed tumors (
Mice were treated as given in Example 8. In this experiment, CpG was used as an adjuvant in groups except the PBS control. Subcutaneous immunization of soluble OVA as well as ACM-OVA (
Mice were treated with different ACM formulations in B16F10 tumor model in which tumorigenicity relies on endogenously expressed tumor peptide antigens. Therefore the peptide of SEQ ID NO: 9 that has already been described to be immunogenic in this model (tyrosinase related protein-2, Trp2) was chosen as an antigen for immunization. 105 B16F10 cells were first inoculated into C57Bl/6 mice and followed by the immunizations with the following different formulations: 1. PBS, 2. free Trp2 co-administered with CpG (figure legend “Free Trp2+CpG”), 3. ACM (BD21) encapsulated Trp2 co-administered with free CpG (figure legend “ACM Trp2+CpG”), 4. free Trp2 co-administered with ACM (BD21) encapsulated CpG (figure legend “Free Trp2+ ACM-CpG”) and 5. ACM (BD21) encapsulated Trp2 co-administered with a separate population of ACM (BD21) encapsulated CpG (figure legend “ACM-Trp2+ACM-CpG”) groups were monitored for tumor growth (
After extensive dialysis, 100 μl of sample was separated using SEC (
DLS showed a slightly smaller size (average size: 104 nm) and acceptable pdi (pdi: 0.191) (
400 μl of the final product were separated by SEC as above (see
To ascertain that HA proteins are accessible at the surface of particles, ELISA was conducted on all collected fractions coated overnight on a Maxisorp plate able to trap BD21 vesicles. HA protein was clearly detected and when the ELISA profile was superimposed on the SEC, both profiles nicely correlated (
As shown in
Balb/c mice were immunized with the following formulations: a negative control (PBS), free HA, BD21 encapsulated HA and BD21 conjugated HA. Since some residual free HA was observable in the HA conjugated polymersome sample even after extensive dialysis, pooled fractions of SEC were used for immunizations. All immunizations had a same amount of 100-200 ng of HA per injection and per mouse.
As shown in
The PEDv spike protein was expressed using the baculovirus system. The cell solution was clarified, and ACM polymers were added along with required additives to encapsulate the proteins of interest. The encapsulation was conducted as described in Example 1. CpG was also encapsulated as described in Example 1, using CpG ODN 2007 (5′—TCG TCG TTG TCG TTT TGT CGT T-3′, SEQ ID NO: 63, commercially available from InvivoGen under catalogue number tlrl-2007).
Guinea pigs (N=4 for I.M.;=5 for other groups) were immunised in 3 different ways, oral, nasal, and I.M. Each method was dosed with 40 μl of a 1:1 mixture of ACM encapsulated PEDv spike protein and ACM encapsulated CpG. and boosted with a second dose after 21 days. Sera was collected from the final bleed and was used for ELISA (Data not shown). Moreover, these sera were tested for their ability to neutralise the PEDV strain USA/Colorado/2013 (CO/13) through a conventional virus neutralisation (
The soluble fragment of the MERS-CoV spike protein (SEQ ID NO: 43, corresponding to positions 1-1297 of UniProtKB accession no. KOBRG7) was expressed using the baculovirus system and purified. A thin film of 10 mg of BD21 polymer was formed in a 10 ml round bottom flask and exhaustively dried. 1 ml of the protein solution was added to the round bottom flask and spun on a rotary evaporator at 150 rpm for 4 hours. The sample was removed from the flask and extruded through a 400 nm filter followed by a 200 nm filter. The extruded sample containing ACM-proteins and free protein was then separated using size exclusion chromatography.
The fractions corresponding to the ACM/protein fractions were collected and used for immunisation into mice. C57bl/6 mice were immunized using encapsulated ACM-MERS-CoV and control ACMs by doing a prime and a boost 21 days later. Final bleeds were collected 42 days after prime. ELISA was then performed to assess titers: MERS-CoV was coated onto Maxisorp plates (1 μg/ml) overnight. Plates were blocked using 3% BSA for 1h at RT. All sera were diluted at 1:100 and incubated on plates for 1h at RT. After 3 washes with PBS+0.05% Tween 20, secondary antibody anti-mouse HRP was incubated at 1:10,000 dilution for 1h, RT. TMB substrate was added and reaction was stopped using 1M HCl. Optical densities were quantified at 450 nm (
The different spike protein domains were expressed in the baculovirus system (Baculo). The cell cultures were clarified, and the solution used for ACM formation. PEDv spike protein S1 domain, S2 domain, and a mixture of S1 and S2 domains was used for immunisation without adjuvants I.M. with a 200 μl dose into Balb/c female mice aged 6-8 weeks old (n=5).
The animals were boosted with a second dose after 21 days. Sera was collected from the final bleed and was used for ELISA. Moreover, these sera were tested for their ability to neutralise the PEDV strain USA/Colorado/2013 (CO/13) through a conventional virus neutralisation (
Soluble fragments of the SARS-CoV-2 spike proteins (SEQ ID NO: 36, 40 and 65) were expressed using the baculovirus system and purified from the media using traditional Ni-NTA affinity purification. A thin film of 10 mg BD21 polymer was formed in a 10 ml round bottom flask and exhaustively dried. 1 ml of the protein solution was added to the round bottom flask and spun on a rotary evaporator at 150 rpm for 4 hours. The sample was removed from the flask and extruded through a 400 nm filter followed by a 200 nm filter. The extruded sample containing ACM-proteins and free protein was then separated using size exclusion chromatography.
In a first study, ACM having encapsulated S1-S2 region (SEQ ID NO: 36) with or without adjuvant were employed. In case of adjuvant, ACM encapsulated SPIKE protein was mixed with 1:1 ratio of Sigma Adjuvant System (an oil in water emulsion consists of 0.5 mg Monophosphoryl Lipid A (detoxified endotoxin) from Salmonella Minnesota and 0.5 mg synthetic Trehalose Dicorynomycolate in 2% oil (squalene)-Tween 80-water. ACM having encapsulated S1-S2 region (SEQ ID NO: 36) with or without adjuvant were compared with ACM having encapsulated S2 region (SEQ ID NO: 40) with adjuvant and a PBS control.
Mice were immunized using encapsulated ACM-SARS-CoV2 and control ACMs by doing a prime and a boost 21 days later. Final bleeds were collected 35 days after prime (
In addition, SARS-CoV-2 neutralizing antibodies will be assessed using plaque reduction neutralization assay (PRNT).
In a second study, different modes of administration, i.e. IM and IN of ACM having encapsulated S1-S2 region (SEQ ID NO: 65), ACM having encapsulated S2 region (SEQ ID NO: 40), either alone or in combination with ACM encapsulated CpG were compared.
Mice were immunized using encapsulated ACM-SARS-CoV2 and control ACMs by doing a prime and a boost 14 days later. Final bleeds were collected 56 days after prime. ELISA was then performed to assess antibody titers against SARS-CoV-2. In addition, SARS-CoV-2 neutralizing antibodies will be assessed using plaque reduction neutralization assay (PRNT). Furthermore, Bronchoalveolar Lavage fluid (BALF) will be collected by washing the lung airways. BALF will be used to measure secretory IgA and neutralization antibodies. For neutralization assay, SARS-CoV-2 pseudovirus will be incubated with serially diluted sera or BALFs.
In this experiment BD21 encapsulated SARS-CoV-2 spike protein, with or without the use of CpG adjuvant was tested as vaccine. For this experiment, the full length soluble SARS-CoV-2 spike protein (SEQ ID NO: 65) which was produced as in the baculovirus/insect cell system was used. The protein was purified from the media using a combination of tangential flow filtration and Ion exchange chromatography. To determine the effect of the encapsulation on the immunogenicity of the spike protein antigen as well as CpG adjuvant, the following formulations were prepared: i) free recombinant spike protein (SEQ ID NO: 65, “fSpike); ii) BD21 polymersome-encapsulated spike protein (“ACM-Spike”); iii) a mixture of free spike protein and free CpG adjuvant (“fSpike fCpG); iv) a mixture of BD21 polymersome-encapsulated spike protein and BD21 polymersome-encapsulated CpG (ACM-Spike ACM-CpG).
Thereafter, 6-8 weeks old female C57BL/6 mice were immunized via subcutaneous route on days 0 and 14 (cf.
The following materials and methods were applied in Examples 21-23.
20.1 Materials. Murine CpG 1826 was purchased from InvivoGen. Rhodamine B-terminated PEG13-b-PBD22 was purchased from Polymer Source Inc. DQ ovalbumin protein (OVA-DQ) was purchased from Life Technologies, Thermo Fisher Scientific. 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP) was from Avanti Polar Lipids. Triton X-100 was from MP Biomedicals. All other chemicals were purchased from Sigma-Aldrich unless stated otherwise. The trimeric spike protein (SEQ ID NO: 68) was purchased from ACROBiosystems (#SPN-C52H8) and the S2 domain protein (SEQ ID NO: 67) from Sino Biological.
20.2 Protein expression. Recombinant SARS-CoV-2 spike protein containing only the ectodomain (hereby referred to as “S1S2”) having the sequence shown in SEQ ID NO: 36, was expressed via T.ni insect cells (Hi5, Thermo Fisher Scientific). The gene of interest was placed into the Bac-to-Bac system (Thermo Fisher Scientific), transfected and passaged in Sf9 cells (Thermo Fisher Scientific) until a high titre was achieved. T.ni cells, diluted to 1.5×106 cells/ml, were infected at a MOI of 0.1 and left to incubate (27° C. for 96 hours, shaking at 125 rpm). The cell culture was harvested, and the cells removed by centrifugation (3,500×g for 15 min at 4° C.) and clarified by 0.22 μm filtration. The media containing the protein of interest was first concentrated to a tenth of the original volume via Tangential flow filtration hollow fibre cassettes (10 kDa Hollow fibre cassette; Cytiva), followed by 5 volumes worth of diafiltration into IEX binding buffer (20 mM Phosphate, 50 mM NaCl, 5% sucrose, 5% glycerol, 0.025% tween 20, 1 mM EDTA, pH 4.6). The protein was initially purified by first binding the sample in a HiTrap FF SP column (5 ml; Cytiva) using a GE AKTA system loaded with Unicorn software, set at 2 ml/min. Once the sample had been loaded and washed with 5 column volumes of IEX binding buffer, the protein of interest was eluted off the column by switching to IEX elution buffer (20 mM Phosphate, 50 mM NaCl, 5% sucrose, 5% glycerol, 0.025% tween 20, 1 mM EDTA, pH 7.6). The eluted sample was concentrated using a Vivaspin concentrator (10 kDa, 15 ml, PES; Sartorius) to a 5 ml volume. The protein was polished by loading 2.5 ml of sample in a 5 ml loading loop onto a Hiload 16/60 Superdex 200 Prep Grade column, running with SEC buffer (20 mM Phosphate, 150 mM NaCl, 5% sucrose, pH 7.6) at 1 ml/min. Purified protein was analysed for size by injection of 100 μl of sample into a Superdex 200 increase 10/300 GL column using a GE AKTA system running at 0.75 ml/min. Molecular mass of the protein was calculated via comparison with a Gel filtration calibration kit HMW (containing a mixture of Thyroglobulin, Ferritin, Aldose and Conalbumin; Cytiva).
20.3 Preparation of ACM-antigen polymersomes. ACM polymersomes encapsulating SARS-CoV-2 spike trimer, S1S2 and S2 proteins were prepared by the solvent dispersion method, followed by extrusion. A 400 mg/ml stock solution of DOTAP and PEG13-b-PBD22 polymer were prepared by dissolving solid DOTAP and polymer in tetrahydrofuran (THF). 0.15 equivalents (1.5 μmol) of DOTAP stock solution and 0.85 equivalents (8.5 μmol) of polymer stock solution were mixed in a 2 ml glass vial and vortexed to prepare Solution A. After mixing, Solution A was aspirated in a 50 μl Hamilton glass syringe. A 1 ml solution of 100 μg/ml antigen was placed in a 5 ml glass test tube (Solution B). Solution A was added slowly to 1 ml of Solution B while constantly mixing (600-700 rpm) at room temperature. A turbid solution was obtained. The resultant solution was extruded 21 times through a 200 nm membrane filter (Avanti Polar Lipids) using a 1 ml mini-extruder (Avanti Polar Lipids) to get monodispersed ACM-antigen vesicles. Non-encapsulated antigens were removed by overnight dialysis. Encapsulation of antigen were quantified by densiometric analysis using a known BSA standards in Fiji ImageJ software (v. 1.52a).
20.4 Preparation of ACM-CpG polymersomes. ACM-CpG polymersomes were prepared by the solvent dispersion method above, followed by extrusion. 50 μl of the 400 mg/ml stock solution containing DOTAP and PEG13-b-PBD22 polymer was added dropwise to 1 ml CpG solution. A turbid solution was obtained. The resultant solution was extruded 21 times through a 200-nm membrane filter using a 1 ml mini-extruder to get monodispersed ACM-CpG polymersomes. Unencapsulated CpG was removed by overnight dialysis using 300 kDa molecular weight cut-off (MWCO) regenerated cellulose membrane (Spectrum Laboratories Inc.) against PBS, pH 7.4 at 4° C.
20.5 Preparation of ACM-Rhodamine and ACM-Rhodamine-OVA-DQ. ACM-Rhodamine and ACM-Rhodamine-OVA-DQ were prepared by the thin-film rehydration method, followed by extrusion. A 9.9 mg of PEG13-b-PBD22 polymer in chloroform were mixed with 0.1 mg Rhodamine B-terminated PEG13-b-PBD22 in chloroform with a ratio of 99:1 w/v shaken in a round bottom flask. After mixing, chloroform was removed by rotary evaporator followed by drying for 1 h at high vacuum. A 1 ml solution of 100 μg/ml OVA-DQ was placed in the flask for the preparation of ACM-Rhodamine-OVA-DQ; for ACM-Rhodamine, 1 mL buffer was added. The solution was stirred at 600-700 rpm for overnight at 4° C. A pink coloured turbid solution was obtained. The resultant solution was extruded 21 times through a 200-nm membrane filter (Avanti Polar Lipids) using a 1 mL mini-extruder (Avanti Polar Lipids) to get monodispersed ACM nanoparticles. Non-encapsulated OVA-DQ was removed by overnight dialysis against 1X PBS.
20.6 Particle size measurement by dynamic light scattering (DLS). DLS was performed on the Zetasizer Nano ZS system (Malvern Panalytical). 100 μl of the 20-fold diluted, purified, filtered sample was placed in a micro cuvette (Eppendorf® UVette; Sigma-Aldrich) and an average of 30 runs (10 s per run) was collected using the 173° detector.
20.7 Quantification of SARS-CoV-2 spike protein by SDS-PAGE. 20 μl of ACM-spike protein or free spike protein at known concentrations was added to microcentrifuge tubes. 2 μl of 25% Triton X-100 was added to each sample and incubated for 30 min at 25° C. to lyse ACM vesicles. Next, 20 μl of 1X gel loading dye buffer was added and tubes were shaken at 95° C. for 10 min. 20 μl of each sample was migrated on 4-12% Bis-Tris SDS-PAGE gel at 140 V for 40 min. The completed gel was fixed and then stained with SYPRO® Ruby protein gel stain (Molecular Probes, Thermo Fisher Scientific).
20.8 Western blot. Proteins were transferred from SDS-PAGE gel to PVDF membrane using the iBlot 2 Dry Blotting System (Thermo Fisher Scientific). The membrane was blocked 1 h at room temperature with 5% w/v non-fat milk dissolved in TBST (Tris-buffered saline with 0.1% v/v Tween-20). Mouse serum raised against a recombinant SARS-CoV-2 spike protein (purchased from Sino Biological) was diluted 1:6,000 and incubated with the membrane for 1 h at room temperature. The membrane was washed thrice with TBST for a total of 30 min before incubating 1 h at room temperature with HRP-conjugated goat anti-mouse secondary antibody at a 1:10,000 dilution. After three final washes with TBST, the membrane was briefly incubated with ECL substrate (Pierce, Thermo Fisher Scientific). Chemiluminescent signals were captured using the ImageQuant LAS 500 system (Cytiva).
20.9 Quantification of CpG by fluorescence. 20 μl of ACM-CpG or free CpG at known concentrations were added to a 384-well black plate. 20 μl of PBS with 10% Triton X-100 was added into each well, and the plate was incubated for 30 min at 25° C. to lyse ACM vesicles before adding 10 μl of 20X SYBR™ Safe DNA gel stain (Invitrogen, Thermo Fisher Scientific). The plate was incubated for 5 min at 25° C. and fluorescence was measured (excitation—500 nm; emission—530 nm) using a plate reader (Biotek).
20.10 Cryogenic-transmission electron microscopy (Cryo-TEM). For cryo-TEM, 4 μL of the samples containing ACM-S1S2, ACM-CpG, and ACM-S1S2+ ACM-CpG vesicles (5 mg/ml) were adsorbed onto a lacey holey carbon-coated Cu grid, 200 mesh size (Electron Microscopy Sciences). The grid was surface treated for 20 s via glow discharge before use. After surface treatment, 4 μl sample was added and the grid was blotted with Whatman filter paper (GE Healthcare Bio-Sciences) for 2 s with blot force 1, and then plunged into liquid ethane at −178° C. using Vitrobot (FEI Company). The cryo-grids were imaged using a FEG 200 keV transmission electron microscope (Arctica; FEI Company) equipped with a direct electron detector (Falcon II; Fei Company). Images were analyzed in Fiji ImageJ software (v. 1.52a) and membrane thickness of vesicles were calculated by counting at least 20 particles.
20.11 Mice (vaccination). This study was performed at the Biological Resource Center (Agency for Science, Technology and Research, Singapore). Female C57BL/6 mice were purchased from InVivos and used at 8-9 weeks of age. Seven to eight mice were assigned to each vaccine formulation, unless stated otherwise. Mice were administered 5 μg of a respective antigen (free or encapsulated) with or without 5 μg CpG adjuvant (free or encapsulated) in 200 μl volume per dose via the subcutaneous route, for one prime and one boost separated by 14 days. Blood was collected on days 13, 28, 40 and 54; spleens were collected on the final time point of day 54. The study was done in accordance with approved IACUC protocol 181137.
20.12 Mouse tissue preparation and data analysis for flow cytometry. Mice were injected subcutaneously with 100 ml PBS, 100 ml ACM-Rhodamine or 100 ml ACM-Rhodamine-OVA-DQ and analysed on day 1, 3 or 6 post injection. Back skin from the injection site was harvested and placed in RPMI1640 (Gibco, Thermo Fisher Scientific) containing Dispase for 90 min at 37° C. The back skin and skin-draining LNs (separately) then were transferred into RPM11640 containing DNasel (Roche) and collagenase (Sigma-Aldrich), disrupted using scissors or tweezers, and digested for 30 min at 37° C. Digest was stopped by adding PBS+10 mM EDTA and cell suspensions were transferred into a fresh tube over a 70 μm nylon mesh sieve. If necessary, red blood cells were lysed using RBC lysis buffer (eBioscience™), and single cell suspensions were passed through a 70 μm nylon mesh sieve before further use. Single cell suspensions then were stained for flow cytometry analysis following standard protocols. Monoclonal antibodies against Ly6C (clone HK1.4), CD11b (clone M1/70), EpCAM (clone G8.8), CD64 (clone X54-5/7.1), and F4/80 (clone BM8) were purchased from BioLegend, CD11c (clone N418), CD103 (clone 2E7), CD8a (clone 53-6.7), and MHC-II (clone M5/114.15.2) were purchased from eBioscience, CD24 (clone M1/69), CD3 (clone 500A2), CD45 (clone 30-F11), CD49b (clone HMa2), and Ly6G (clone 1A8) were purchased from BD Bioscience, CD19 (clone 1D3) and Streptavidin for conjugation of biotinylated antibodies were purchased from BD Horizon. DAPI staining was used to allow identification of cell doublets and dead cells. Flow cytometry acquisition was performed on a 5-laser LSR II (BD) using FACSDiva software, and data subsequently analyzed with FlowJo v.10.5.3 (Tree Star).
20.13 Intracellular cytokine staining. Single-cell suspensions of splenocytes were generated by pushing each spleen through a 70 μm cell strainer. Red blood cells were lysed using 1X RBC Lysis Buffer (eBioscience, Thermo Fisher Scientific) for 5 min at room temperature. Splenocytes were resuspended in complete cell culture medium (RPMI 1640 supplemented with 10% v/v heat-inactivated FBS, 50 μM β-mercaptoethanol, 2 mM L-glutamax, 10 mM HEPES and 100 U/ml Pen/Strep; all materials purchased from Gibco, Thermo Fisher Scientific) and seeded in a 96-well U-bottom plate at a density of ˜3 million per well. Splenocytes were incubated with an overlapping peptide pool covering the spike protein (JPT product PM-WCPV-S-1 Vials 1 and 2) along with functional anti-mouse CD28 and CD49d antibodies overnight at 37° C., 5% CO2. Peptides and antibodies were used at 1 μg/ml, respectively. Negative control wells were generated by incubating splenocytes with culture medium and costimulatory antibodies. Positive control wells were generated by incubating splenocytes with 20 ng/ml PMA (Sigma-Aldrich) and 1 μg/ml ionomycin (Sigma-Aldrich). The following morning, cytokine secretion was blocked with 1× brefeldin A (eBioscience) and 1× monensin (eBioscience) for 6 h. Subsequently, cells were stained with Fixable Viability Dye eFluor™ 455UV (eBioscience) at 1:1000 in PBS for 30 min at 4° C. Cells were washed with FACS buffer (1× PBS supplemented with 2% v/v heat-inactivated FBS and 1 mM EDTA) and stained for surface markers with the following antibodies purchased from BioLegend, eBioscience and BD: BUV395-CD45 (30-F11), Brilliant Violet 785™-CD3 (17A2), Alexa Fluor 700-CD4 (GK1.5), APC-eFluor 780-CD8 (53-6.7) and PE/Dazzle™ 594-CD44 (IM7). Antibodies were diluted 1:200 with FACS buffer and incubated with cells for 30 min at 4° C. Fixation and permeabilization was done using the Cytofix/Cytoperm™ kit (BD), according to manufacturer's instructions. Intracellular cytokines were stained with the following antibodies: Alexa Fluor 488-IFNγ (XMG1.2), Brilliant Violet 650-TNFα (MP6-XT22), APC-IL-2 (JES6-5H4), PerCP-eFluor 710-IL-4 (11B11) and PE-IL-5 (TRFK5). Antibodies were diluted 1:200 with 1× Permeabilization Buffer and incubated with cells for 30 min at 4° C. Cells were washed with 1× Permeabilization Buffer and then resuspended in FACS buffer for analysis with the LSR II flow cytometer (BD). Approximately 600,000 total events were recorded for each sample. Data analysis was performed using FlowJo V10.6.2 software. Percentage of cytokine-positive events for immunized mouse groups were compared against PBS-control group. Responses above the background of the PBS-control group were considered spike-specific.
20.14 ACE2 binding assay. SARS-CoV-2 Spike protein was coated onto 96-well EIA/RIA high binding plate (Corning) in carbonate-bicarbonate buffer (15 mmol/L Na2CO3, 35 mmol/L NaHCO3; pH 9.6) at 200 ng per well, overnight at 4° C. Plates were blocked with 2% BSA in TBS+0.05% v/v Tween-20 for 1.5 h at 37° C. Three-fold serial dilutions of recombinant hACE2-Fc protein (12,000 ng/ml to 0.61 ng/ml; GenScript) were prepared in TBS buffer containing 0.5% w/v BSA and applied to the plate for 1 h at 37° C. HRP-conjugated goat anti-human IgG (Fc specific; Sigma Aldrich) was diluted 1:10,000 and applied to the plate for 1 h at 37° C. ACE2 binding was visualized by addition of TMB substrate (Sigma-Aldrich) for 15 min at room temperature and the reaction was terminated with Stop Solution (Invitrogen, Thermo Fisher Scientific). Absorbance was measured at 450 nm using a microplate reader (Biotek). Background absorbance was subtracted and the EC50 value of the titration curve was determined using GraphPad Prism version 8.4.3 with five-parameter non-linear regression.
20.15 SARS-CoV-2 spike-specific serum IgG. SARS-CoV-2 spike protein was coated onto 96-well EIA/RIA high binding plate (Corning) at 100 ng per well in PBS overnight at 4° C. Plates were blocked with 2% w/v BSA in PBS+0.1% v/v Tween-20 for 1.5 h at 37° C. Mouse sera were serially diluted from an initial of 1:100 with blocking buffer and applied to the plate for 1 h at 37° C. HRP-conjugated goat anti-mouse IgG (H/L), anti-mouse IgG1 or anti-mouse IgG2b (each purchased from BioRad) was diluted in blocking buffer at 1:10,000, 1:4,000 and 1:4,000, respectively, and applied to the plate for 1 h at 37° C. Antibody binding was visualized by addition of TMB substrate for 10 min at room temperature and the reaction was terminated with Stop Solution. Absorbance was measured at 450 nm. Each titration curve was analysed via five-parameter non-linear regression (GraphPad Prism V8.4.3) to calculate endpoint titer, which was defined as the highest dilution producing an absorbance three times the plate background.
20.16 Serum neutralizing antibody by competitive ELISA. The cPass™ SARS-CoV-2 Surrogate Virus Neutralization Test Kit (GenScript) was used according to manufacturer's instructions. Briefly, each serum sample was diluted 1:10 using Sample Dilution Buffer and incubated with an equal volume of HRP-RBD solution for 30 min at 37° C. The mix was then applied to 8-well strips pre-coated with ACE2 protein for 15 min at 37° C. RBD-ACE2 binding was visualized by addition of TMB substrate for 15 min at room temperature. Reaction was terminated using Stop Solution and absorbance was measured at 450 nm. Inhibition of RBD-ACE2 binding was calculated using the formula:
20.17 Pseudovirus neutralization test. Pseudotyped lentiviral particles harbouring the SARS-CoV-2 spike glycoprotein (S-pp) were generated by co-transfection of 293FT cells with S expression plasmid and envelope-defective pNL4-3.Luc.R-E-luciferase reporter vector. The S expression plasmid was constructed by cloning the codon-optimised spike gene (according to GenBank accession QHD43416.1) containing a 19 amino acid C-terminal truncation to enhance pseudotyping efficiency into the pTT5 mammalian expression vector (pTT5LnX-coV-SP, a kind gift from Brendon John Hanson, Biological Defence Program, DSO National Laboratories, Singapore). The viral supernatant was collected 48-72 hours post-transfection, clarified by centrifugation, and stored at −80° C. until use. S-pp titer was determined using a lentivirus-associated p24 ELISA kit (Cell Biolabs, Inc., San Diego, CA). CHO cells stably overexpressing human ACE2 (CHO-ACE2) were seeded in 96-well plates 24 hour before transduction. Mouse serum samples were diluted 1:20 in culture medium, inactivated at 56° C. for 30 min and sterilised using Ultrafree-MC centrifugal filters (Millipore, Burlington, MA). For S-pp neutralization assays, the serum samples were two-fold serially diluted six times and incubated with S-pp for 1 hour at room temperature before the mixture was added to target cells in triplicate wells. Cells were incubated at 37° C. for 48 hour before being tested for luciferase activity using Bright-Glo™ Luciferase Assay System (Promega, Madison, WI). Luminescence was measured using a plate reader (Tecan Infinite M200) and after subtraction of background luminescence, the data were expressed as a percentage of the reading obtained in the absence of serum (cells+S-pp only), which was set at 100%. Dose-response curves were plotted with a four-parameter non-linear regression using GraphPad Prism 8 and neutralizing titers were reported as the serum dilution that blocked 50% S-pp entry (IC50). Samples that did not achieve 50% neutralization at the input serum dilution (1:40) were expressed as 1 while the neutralizing titer of samples that achieved more than 50% neutralization at the highest serum dilution (1:1280) were reported as 1280.
20.18 SARS-CoV-2 neutralization test. Serum samples were serially diluted two-fold in DMEM supplemented with 5% v/v FBS, from an initial of 1:10 and incubated with equal volume of viral suspension (1×104 TCID50/ml) for 90 min at 37° C. The mixture was transferred to Vero-E6 cells and incubated for 1 h at 37° C. The inoculum was removed, and cells were washed once with DMEM. Fresh culture medium was added, and cells were incubated for 4 days at 37° C. Assay was performed in duplicate. Neutralization titer was defined as the highest serum dilution that fully inhibited cytopathic effect (CPE).
The SARS-CoV-2 spike protein is immunogenic and targeted by T cells and strongly neutralizing antibodies, making it a highly attractive subunit vaccine target. Based on previous work with various viral and cancer proteins (data not shown), it was established that immunogenicity of a protein could be significantly improved through encapsulation within ACM polymersomes. Moreover, a further increase in the immune response could be achieved via co-administration of an appropriate adjuvant, such as the toll-like receptor (TLR) 9 agonist CpG. Therefore, the present approach involved the encapsulation of both the spike protein as well as CpG adjuvant for co-administration (
The three spike variants were analysed by SDS-PAGE followed by SYPRO Ruby staining (
Taken together, the data suggests a correctly folded spike protein that presents a functional receptor binding domain (RBD). Adopting the correct conformation is fundamentally important from an immunization standpoint since potently neutralizing antibodies typically target the RBD, though other regions of the spike protein have also been reported. Viral antigens (spike trimer, S2 and S1S2 protein) and CpG adjuvant were separately encapsulated in individual vesicles as ACM-trimer, ACM-S2, ACM-S1S2 and ACM-CpG, respectively. Vesicles were extruded to within 100-200 nm diameter range followed by dialysis to remove the solvent, non-encapsulated antigens and adjuvant. The final vaccine formulation was a 50:50 v/v mixture of ACM-S1S2 and ACM-CpG prior to administration. All samples were tested negative for endotoxin using colorimetric HEK Blue cell-based assay (
The sizes and morphologies of ACM-antigen and ACM-CpG were assessed by dynamic light scattering (DLS) and cryogenic-transmission electron microscopy (cryo-TEM), respectively. Overall, the sizes of ACM polymersomes were uniform (
To assess protein encapsulation within vesicles, ACM-antigen particles were lysed with 2.5% non-ionic surfactant Triton X100 and then characterized by SDS-PAGE alongside free protein calibration standards. The concentrations of encapsulated proteins were quantified by the densitometric method from SDS-PAGE followed by SYPRO Ruby staining (
Given the importance of shelf life and product stability in the context of local and global distribution, a stability study was performed on free S1S2 protein, ACM-S1S2, free CpG, ACM-CpG, free S1S2+free CpG and ACM-S1S2+ACM-CpG at 4° C. and 37° C. The initial observation showed a very stable vesicle with no change of size and PDI of the ACM-S1S2 formulation, no degradation of S1S2 protein content, and minimal loss of activity for up to 20 weeks at 4° C. measured by DLS, SDS-PAGE followed by SYPRO staining, and ACE2 binding assay by ELISA, respectively (
In summary, functional SARS-CoV-2 spike (“S1S2”) protein from T.ni cells were expressed and purified that bound ACE2 with high avidity. This suggested a correctly folded protein, which was necessary for the induction of neutralizing antibodies. The protein and CpG adjuvant were separately encapsulated in ACM-polymersomes for the purpose of co-administration in the final vaccine formulation. In stability tests, the ACM-encapsulated S1S2 protein quickly degraded at 37° C. but remained intact for at least 20 weeks at 4° C. With proper temperature control at 4° C. during storage, transport and distribution, the ACM-S1S2 formulation would be expected to maintain functionality for prolonged periods.
Having established the DC-targeting property of ACM polymersomes, it was proceeded to assess the ACM-spike vaccine formulations in C57BL/6 mice. Two doses of each formulation were administered at 2-week interval via subcutaneous injection and serum antibodies were examined on Day 13 (pre-boost) and Days 28, 40 and 54 (post-boost) (
A multi-step approach was adopted to identify potentially neutralizing serum samples in a BSL-½ setting before doing a final validation against live virus in BSL-3. The first step involved the cPass™ kit, an FDA-approved, competitive ELISA-based assay that measured neutralizing antibodies blocking the interaction between recombinant RBD and ACE2 proteins. Crucially, this kit had been validated against patient sera and live SARS-CoV-2 and was shown to discriminate patients from healthy controls with 99.93% specificity and 95-100% sensitivity. Consistent with the low IgG titers on Day 13 (
It was proceeded to analyse sera from the last time point (Day 54) by pseudovirus and live SARS-CoV-2 neutralization tests (
To evaluate spike-specific T cell responses, splenocytes were harvested from all mice on Day 54 and stimulated ex vivo with an overlapping peptide pool covering the spike protein. T cell function was measured by intracellular cytokine staining. At this late time point (40 days after boost), activated T cells would have progressed beyond the initial expansion phase and entered contraction/memory phase. To the best of the present inventors' knowledge, only Moderna had investigated murine T cell responses at the late time point of seven weeks after boost. Memory-phenotype CD4+ and CD8+ T cells were identified by gating on the respective CD44hi subpopulations. Among the S1S2 vaccine groups, only the ACM-S1S2+ACM-CpG formulation (5 or 0.5 μg dose) induced highly significant increase in IFNγ-, TNFα- or IL-2-expressing CD4+ T cells in response to spike peptide stimulation (
In summary, ACM-S1S2+ACM-CpG induced functional memory CD4+ and CD8+ T cells that could be detected 40 days after the last administration. The efficient uptake of ACM vesicles by cDC1 is likely important for generating CD8+ T cell immunity, given cDC1's ability to efficiently cross-present. In the present study, spike-specific CD8+ T cell responses has been demonstrated in mice vaccinated with ACM-S1S2 but not free S1S2 protein.
Inclusion of CpG in the vaccine formulation confers several benefits. It potently activates DCs to upregulate co-stimulatory molecules, including CD40, CD80 and CD86, which promotes T cell activation and B cell antibody class switch and secretion. Binding of CpG to TLR-9 triggers MAPK and NF-κB signalling that results in pro-inflammatory cytokine production and a Th1-skewed immune response. In the present study, such polarization is clearly demonstrated by the cytokine profile of CD4+ T cells and the IgG1:IgG2b ratio of the CpG-containing vaccine formulations. In the absence of CpG, IL-5 production was consistently observed which fits a broader picture of an inherent Th2 skew from immunizing with protein antigens of viral and non-viral origins. From a safety standpoint, this represents a potential risk of Th2 immunopathology, best exemplified by whole-inactivated RSV vaccines. Accordingly, such vaccines primed the immune system for a Th2-biased response during actual infection and the resultant production of Th2 cytokines promoted increased mucus production, eosinophil recruitment and airway hyperreactivity. Therefore, skewing of the immune response to Th1 by CpG is likely to improve vaccine safety.
It has been shown that neutralizing titers can remain stable despite rapidly declining total IgG, which is consistent with SARS-CoV-2-infection in humans. This may be due to affinity maturation which progressively selects for high avidity, strongly neutralizing antibodies while excluding weaker binders. Additionally, compared to the neutralizing titers measured in convalescent patients recruited in Singapore, it appears that a vaccine formulation of the present disclosure may be more efficient in triggering neutralizing antibodies. Although the role of antibodies in Covid-19 remains to be established, it is reasonable to regard neutralizing antibodies as a potential correlate of protection. Reports of asymptomatic or mild patients producing widely varying neutralizing antibody levels, including a minority with no detectable neutralizing response, underscore the unpredictability of a natural infection. In this regard, a vaccine of the present disclosure can perhaps facilitate the induction of a more uniform neutralizing antibody response.
The role of T cells in SARS-CoV-2 is arguably less clear than antibodies. Nevertheless, several studies have confirmed the induction of a T cell response following infection. Early in the adaptive immune response against SARS-CoV-2, T cells are robustly activated. Patients who recovered from SARS in 2003 possessed memory T cells that could be detected 17 years after. Additionally, individuals with no history of SARS, Covid-19 or contact with individuals who had SARS and/or Covid-19 possessed cross-reactive T cells that may be generated by a previous infection with other betacoronaviruses. These data suggested that the SARS-CoV-2-specific T cell response may be similarly durable. In a study examining the T cell specificities of Covid-19 convalescent patients, spike-specific CD4+ T cells were consistently detected whereas CD8+ T cells were present in most subjects. This implies that a spike-based vaccine may generate a cellular immune response that largely recapitulates the CD4+ T cell profile of a natural infection, albeit with a narrower CD8+ T cell repertoire.
One major challenge in creating a pandemic vaccine is generating sufficient doses of high-quality antigen to rapidly meet global demand. As such, dose-sparing strategies are critical, and this has traditionally been achieved using adjuvants. Based on this work, it is believed that ACM technology together with an adjuvant can further augment the dose-sparing effect. It was shown that some embodiments greatly improve vaccine immunogenicity, such that even the 1/10th dose retains a substantial level of efficacy. The present investigation strongly supports the use of ACM technology to address limited antigen availability in a pandemic.
Class B CpG binds endosomal Toll-like receptor 9 (TLR9) to induce several immunological effects, including activation of dendritic cells (DCs), production of pro-inflammatory cytokines and B cell differentiation and antibody secretion. These attributes make class B CpG valuable as a vaccine adjuvant. In this study, C57BL/6 mice were subcutaneously (SC) injected with 5 μg free murine CpG 1826 or ACM-CpG 1826 to compare their relative abilities to activate classical dendritic cells (cDCs). Two days after, inguinal lymph nodes (which drain the site of injection) were harvested to assess DC activation. Mice injected with empty ACM polymersomes did not upregulate CD86 or CD80 activation marker on cDC1 (
The outcome of TLR9 activation by CpG depends on the class of the agonist. Class A CpG possesses a multimeric structure that enables signalling through the IRF7 pathway, which results in production of IFNα alongside IL-6. Class B CpG, which include murine CpG 1826 and human CpG 7909, is monomeric and signals via the NFκB pathway instead to produce IL-6 but not IFNα. Nevertheless, CpG-B may be re-structured through aggregation within ACM polymersomes to resemble CpG-A, thereby gaining the properties of both.
In the present ex vivo experiment, peripheral blood mononuclear cells (PBMCs) from six healthy donors were stimulated with free CpG-A, free CpG-B (7909) or ACM-CpG-B at increasing concentration (0.62, 1.25, 2.5 and 5 μM). Levels of IL-6 and IFNα secreted into culture supernatant was measured by ELISA. IL-6 was detected at low to moderate quantities in all donors after incubating with CpG-A or CpG-B, with levels quickly saturating at around 1.25 μM CpG (
One skilled in the art would readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. Further, it will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. The compositions, methods, procedures, treatments, molecules and specific compounds described herein are presently representative of certain embodiments are exemplary and are not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention are defined by the scope of the claims. The listing or discussion of a previously published document in this specification should not necessarily be taken as an acknowledgement that the document is part of the state of the art or is common general knowledge.
The invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms “comprising”, “including,” containing”, etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by exemplary embodiments and optional features, modification and variation of the inventions embodied herein may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.
The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein. All documents, including patent applications and scientific publications, referred to herein are incorporated herein by reference for all purposes.
Other embodiments are within the following claims. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.
| Number | Date | Country | Kind |
|---|---|---|---|
| 20213488.8 | Dec 2020 | EP | regional |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/EP2021/085366 | 12/13/2021 | WO |
