The invention relates to prostate specific membrane antigen (PSMA) binding molecules, and the use of such binding molecules in the treatment of disease.
Prostate cancer is the most commonly diagnosed non-skin-related malignancy in males in developed countries. It is estimated that one in six males will be diagnosed with prostate cancer.
Current treatments for prostate cancer include surgery, radiation, and adjuvant hormonal therapy. Although these therapies are relatively effective in the early stages of disease, the majority of patients initially diagnosed with localized prostate cancer ultimately relapse. Whilst chemotherapy is one of the most widely used approaches in combating advanced prostate cancer, its therapeutic efficacy is usually insufficient due to lack of specificity and associated toxicity. Lack of targeted delivery to prostate cancer cells is one of the primary obstacles in achieving feasible therapeutic effect. Consequently, there remains a critical need for strategies to increase the selectivity of anti-prostate cancer agents (Barve et al., J Control Release. 2014 Aug. 10; 0: 118-132).
The diagnosis of prostate cancer has greatly improved following the use of serum-based markers such as the prostate specific antigen (PSA). In addition, prostate tumour-associated antigens offer targets for tumour imaging, diagnosis, and targeted therapies. The prostate specific membrane antigen (PSMA), a prostate tumour associated marker, is such a target.
PSMA is a 750-residue type II transmembrane glycoprotein highly restricted to prostate secretory epithelial cell membranes. It is highly expressed in prostate cancer cells and in nonprostatic solid tumor neovasculature and expressed at lower levels in other tissues, including healthy prostate, kidney, liver, small intestine, and brain. PSMA expression increases with prostate disease progression and metastasis and its expression level has thus been correlated with tumour aggressiveness. Various immunohistological studies have demonstrated increased PSMA levels in virtually all cases of prostatic carcinoma compared to those levels in benign prostate epithelial cells. Intense PSMA staining is found in all stages of the disease, including prostatic intraepithelial neoplasia, late stage androgen-independent prostate cancer and secondary prostate tumours localized to lymph nodes, bone, soft tissue, and lungs. PSMA is thus widely used as a biomarker for prostate cancer cells.
PSMA has a 3-part structure: a 19-amino-acid internal portion, a 24-amino-acid transmembrane portion, and a 707-amino-acid external portion. It forms a noncovalent homodimer that possesses glutamate carboxypeptidase activity based on its ability to process the neuropeptide N-acetylaspartylglutamate and glutamate-conjugated folate derivatives. PSMA is rapidly and efficiently internalized by an endocytic pathway and rapidly recycles back to the membrane.
Antibody-based therapeutics have emerged as important components of therapies for an increasing number of human malignancies in such fields as oncology, inflammatory and infectious diseases. In most cases, the basis of the therapeutic function is the high degree of specificity and affinity the antibody-based drug has for its target antigen. Arming monoclonal antibodies (mAbs) with drugs, toxins, or radionuclides is yet another strategy by which mAbs may induce a therapeutic effect. By combining the targeting specificity of an antibody with the tumour killing power of toxic effector molecules, immunoconjugates permit sensitive discrimination between target and normal tissue thereby resulting in fewer side effects than most conventional chemotherapeutic drugs.
Due to their size and other physical properties, however, mAbs have to be administered either intravenously (iv) or subcutaneously (sc) and therefore have a high systemic exposure. Thus, their route of delivery can often be suboptimal, resulting either in antibody binding to target antigen at non-disease locations (potentially compromising the healthy function of normal, non-disease tissue) or resulting in suboptimal PK/PD characteristics. Either outcome may result in a loss of efficacy and/or a compromised safety profile by virtue of the suboptimal route of administration.
The first PSMA-specific mAb reported, murine mAb 7E11, was subsequently developed and commercialized as a diagnostic agent for tumour imaging (ProstaScint, Cytogen, Princeton, N.J.). However, this antibody recognizes an intracellular epitope of PSMA exposed upon cell death which limits its usefulness as an imaging agent for the detection of PSMA. More recently, mAbs such as J591 that recognize the extracellular portion of PSMA have been identified.
The aim of the present invention is to address the need of alternative antibody-based treatments for use in the treatment of prostate cancer.
The invention relates to binding molecules that bind human PSMA. In particular, the invention relates to multivalent/multiparatopic binding molecules that bind human PSMA comprising two or more single human heavy chain variable (VH) domain antibodies. In particular, the binding is to human PSMA in its native form. In preferred embodiments, the single VH domain is generated from a heavy chain only antibody produced in a transgenic rodent expressing human V gene loci and immunised with a PSMA antigen. Single domain antibodies used in the binding molecules of the invention bind a target in monovalent form. Single domain antibodies are smaller than conventional monoclonal antibody formats and the inventors have shown that such molecules facilitate high levels of specific tumor targeting, fast penetration and high accumulation in the tumor compared to a monoclonal antibody benchmark. As shown herein, the binding molecules have improved properties compared to monovalent single domain antibodies, in particular they demonstrate improved cell internalisation. They also show different properties compared to a monoclonal benchmark antibody. The inventors have also shown that the single domain antibodies bind human PSMA with high affinity, are very stable and expressed to high level. Furthermore, single VH domain antibodies of the invention are less immunogenic than murine antibodies and no humanization is required. These properties make the compounds of the invention particularly useful in different formats, for example in multivalent/multiparatopic formats and conjugated to a toxin or half-life extending moiety. The compounds are thus useful in treating disease, in particular cancer. In one aspect, the invention provides an immunoconjugate comprising more than one single VH domain antibody described herein. Aspects of the invention are further summarised below.
In one aspect, the invention thus relates to a binding molecule comprising a first single human heavy chain variable immunoglobulin (VH) domain antibody capable of binding human PSMA and a second single VH domain antibody capable of binding human PSMA.
In one embodiment, said first VH domain and said second VH domain bind to the same epitope on human PSMA.
In one embodiment, said first single VH domain antibody binds to a first epitope on PSMA and said second single VH domain antibody binds to a second epitope on PSMA wherein said first and said second epitope are not identical.
The invention also relates to a binding molecule according to a preceding claim wherein said first or second single VH domain antibody comprises a CDR3 sequence comprising SEQ ID NO. 3 or a sequence with at least 70%, at least 80%, at least 90% or at least 95% homology thereto.
The invention also relates to a binding molecule wherein said first or second single VH domain antibody comprises a CDR3 sequence comprising SEQ ID NO. 83 or a sequence with at least 70%, at least 80%, at least 90% or at least 95% homology thereto.
The invention also relates to a binding molecule wherein said first or second VH domain comprises a CDR3 sequence comprising SEQ ID NO. 183 or a sequence with at least 70%, at least 80%, at least 90% or at least 95% homology thereto.
The invention also relates to a binding molecule wherein said first or second VH domain comprises a CDR3 sequence comprising SEQ ID NO. 279 or a sequence with at least 70%, at least 80%, at least 90% or at least 95% homology thereto.
The invention also relates to a binding molecule wherein said first or second VH domain comprises a CDR3 sequence comprising SEQ ID NO. 295 or a sequence with at least 70%, at least 80%, at least 90% or at least 95% homology thereto.
The invention also relates to a binding molecule wherein said first or second VH domain comprises a CDR3 sequence comprising SEQ ID NO. 303 or a sequence with at least 70%, at least 80%, at least 90% or at least 95% homology thereto.
The invention also relates to a binding molecule wherein said first or second VH domain comprises a CDR3 sequence comprising SEQ ID NO. 331 or a sequence with at least 70%, at least 80%, at least 90% or at least 95% homology thereto.
The invention also relates to a binding molecule wherein said first or second VH domain comprises a CDR3 sequence comprising SEQ ID NO. 363 or a sequence with at least 70%, at least 80%, at least 90% or at least 95% homology thereto.
The invention also relates to a binding molecule wherein said first or second VH domain comprises a CDR3 sequence comprising SEQ ID NO. 367 or a sequence with at least 70%, at least 80%, at least 90% or at least 95% homology thereto.
The invention also relates to a binding molecule wherein said first and/or second VH domain comprises a CDR3 sequence comprising SEQ ID NO. 371 or a sequence with at least 70%, at least 80%, at least 90% or at least 95% homology thereto.
The invention also relates to a binding molecule wherein said first and/or second VH domain comprises a CDR3 sequence comprising SEQ ID NO. 375 or a sequence with at least 70%, at least 80%, at least 90% or at least 95% homology thereto.
The invention also relates to a binding molecule wherein said first or second VH domain comprises a CDR3 sequence comprising SEQ ID NO. 379 or a sequence with at least 70%, at least 80%, at least 90% or at least 95% homology thereto.
The invention also relates to a binding molecule wherein said first or second VH domain comprises a CDR3 sequence comprising SEQ ID NO. 383 or a sequence with at least 70%, at least 80%, at least 90% or at least 95% homology thereto.
The invention also relates to a binding molecule wherein said first or second VH domain comprises a CDR3 sequence comprising SEQ ID NO. 387 or a sequence with at least 70%, at least 80%, at least 90% or at least 95% homology thereto.
The invention also relates to a binding molecule wherein said first or second VH domain comprises a CDR3 sequence comprising SEQ ID NO. 391 or a sequence with at least 70%, at least 80%, at least 90% or at least 95% homology thereto.
The invention also relates to a binding molecule according to claim 3 in which a) the first single VH domain antibody is selected from a single VH domain antibody of family 2, 3, 4, 7, 9, 10, 11 or 14 and in which b) the second singleH domain antibody is selected from family 1, 5, 6, 12 or 13.
The invention also relates to a binding molecule in which a) the first single VH domain antibody is selected from a single VH domain antibody of family 2, in which b) the second single VH domain antibody is selected from a single VH domain antibody of family 1. Said first single VH domain antibody is located either C or N terminally so that either direction is within the scope of the invention.
The invention also relates to a binding molecule in which a) the first VH domain can compete with a Humabody® comprising SEQ ID NO: 4 for binding to PSMA and/or can cross-block the binding of a Humabody® comprising SEQ ID NO: 4 to PSMA and in which b) the second VH domain can compete with a Humabody® comprising SEQ ID NO: 76 for binding to PSMA and/or can cross-block the binding of a Humabody® comprising SEQ ID NO:76 to PSMA.
In another aspect, the invention relates to a pharmaceutical composition comprising a binding molecule described herein and a pharmaceutical carrier.
In another aspect, the invention relates to a method for treating prostate cancer or a prostatic disorder comprising administering a therapeutically-effective amount of a binding molecule or a pharmaceutical composition described herein.
In another aspect, the invention relates to a binding molecule or a pharmaceutical composition described herein for use as medicament.
In another aspect, the invention relates to a binding molecule or a pharmaceutical composition described herein for use in the treatment of prostate cancer or a prostatic disorder.
In another aspect, the invention relates to the use of a binding molecule or a pharmaceutical composition described herein in the manufacture of a medicament for the treatment of prostate cancer or a prostatic disorder.
In another aspect, the invention relates to an in vivo or in vitro method for reducing human PSMA activity comprising contacting human PSMA with a binding molecule described herein.
In another aspect, the invention relates to a method for determining the presence of PSMA in a test sample by an immunoassay comprising contacting said sample with a binding molecule described herein and at least one detectable label.
In another aspect, the invention relates to a nucleic acid construct comprising a nucleic acid according described herein.
In another aspect, the invention relates to a host cell comprising a nucleic acid or a construct described herein.
In another aspect, the invention relates to a method for producing a binding molecule described herein comprising expressing a nucleic acid encoding said binding molecule in a host cell and isolating the binding molecule from the host cell culture.
In another aspect, the invention relates to a kit comprising a binding molecule or a pharmaceutical composition described herein.
In another aspect, the invention relates to a biparatopic, bivalent or multispecific binding molecule comprising one or more single domain antibody described herein.
The present invention will now be further described. In the following passages, different aspects of the invention are defined in more detail. Each aspect so defined may be combined with any other aspect or aspects unless clearly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature or features indicated as being preferred or advantageous.
Generally, nomenclatures used in connection with, and techniques of, cell and tissue culture, pathology, oncology, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art. The methods and techniques of the present disclosure are generally performed according to conventional methods well-known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989)). Enzymatic reactions and purification techniques are performed according to manufacturer's specifications, as commonly accomplished in the art or as described herein. The nomenclatures used in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Standard techniques are used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and delivery, and treatment of patients.
The invention provides isolated formatted binding molecules that bind to human PSMA, in particular those comprising at least two single VH domain antibodies that bind human PSMA, pharmaceutical compositions comprising such binding molecules, as well as isolated nucleic acid constructs, recombinant expression vectors and isolated host cells for making such binding proteins and fragments. Also provided are methods of using the binding proteins disclosed herein to detect human PSMA, to inhibit human PSMA either in vitro or in vivo, and methods of treating disease. One aspect of the invention provides isolated human anti-human PSMA binding molecules, specifically those comprising, or consisting of, more than one single VH domain antibody that binds to human PSMA with high affinity and a slow off rate.
The PSMA binding molecules of the invention bind to wild type human PSMA (accession NO. Q04609). The sequence for the monomer is shown below (SEQ ID No. 529).
In one embodiment, the PSMA binding molecules of the invention bind to wild type human PSMA and/or cyno PSMA. The terms “PSMA binding molecule”, “PSMA binding protein” “anti-PSMA single domain antibody” or “anti-PSMA antibody” as used herein all refer to a molecule capable of binding to the human PSMA antigen. The term “PSMA binding molecule” includes a PSMA binding protein. The binding reaction may be shown by standard methods (qualitative assays) including, for example, a binding assay, competition assay or a bioassay for determining the inhibition of PSMA binding to its receptor or any kind of binding assays, with reference to a negative control test in which an antibody of unrelated specificity. Suitable assays are shown in the examples.
An antibody or binding molecule of the invention, including a single domain antibody and multivalent or multispecific binding agent described herein, “which binds” or is “capable of binding” an antigen of interest, e.g. PSMA, is one that binds the PSMA antigen with sufficient affinity such that it is useful in therapy in targeting a cell or tissue expressing the antigen.
Binding molecules of the invention bind specifically to human PSMA. In other words, binding to the PSMA antigen is measurably different from a non-specific interaction. Preferably, the single domain antibodies used in the binding molecules of the invention bind to human PSMA and also bind to cyno PSMA. The term “specific binding” or “specifically binds to” or is “specific for” a particular polypeptide or an epitope on a particular polypeptide target as used herein can be exhibited, for example, by a molecule having a KD for the target of at least about 10−4 M, alternatively at least about 10−5 M, alternatively at least about 10−6 M, alternatively at least about 10−7 M, alternatively at least about 10−8 M, alternatively at least about 10−9 M, alternatively at least about 10−10 M, alternatively at least about 10−11 M, alternatively at least about 10−12M, or greater. In one embodiment, the term “specific binding” refers to binding where a molecule binds to a particular polypeptide or epitope on a particular polypeptide without substantially binding to any other polypeptide or polypeptide epitope.
In one aspect, the invention relates to a binding molecule comprising a first single VH domain antibody capable of binding human PSMA and a second moiety capable of binding human PSMA. The single VH domain antibody and the second moiety are preferably covalently linked, for example via a peptide linker. The second moiety may be an antibody, a heavy chain only antibody (HCAb), a fragment thereof or an antibody mimetic.
In one aspect, the invention relates to a binding molecule comprising a first single VH domain antibody capable of binding human PSMA and a second single VH domain antibody capable of binding human PSMA. The single VH domain antibodies are preferably covalently linked, for example via a peptide linker.
In one aspect, the invention relates to a binding molecule comprising a HCAb comprising a VH domain as described herein capable of binding human PSMA and a second HCAb capable of binding human PSMA. The HCAbs are preferably covalently linked, for example via a peptide linker.
In one embodiment, the heavy chain only antibody comprises human variable regions. In one embodiment, the HCAb lacks the CH1 domain. In one embodiment, the HCAb comprises murine C regions. In one embodiment, the binding molecule comprises at least one single VH domain antibody.
In one aspect, the invention relates to multivalent/multiparatopic isolated binding molecules capable of binding to human PSMA comprising a heavy chain variable immunoglobulin domain (VH) comprising a CDR3 sequence as shown in any of
The terms “single domain antibody, variable single domain or immunoglobulin single variable domain (ISV)” are all well known in the art and describe the single variable fragment of an antibody that binds to a target antigen. These terms are used interchangeably herein. As explained below, preferred embodiments of the various aspects of the invention relate to single heavy chain variable domain antibodies/immunoglobulin heavy chain single variable domains which bind a PSMA antigen in the absence of light chain. Fragments of the single domain antibody, variable single domain or immunoglobulin single variable domain that bind to human PSMA are also within the scope of the invention. Single heavy chain variable domain antibodies (VH) do not comprise an immunoglobulin light chain. Human heavy chain single variable (VH) domain antibodies are particularly preferred. Human heavy chain single variable VH are commonly abbreviated as VH domains. Single VH domain antibodies are also termed Humabody® herein. Humabody® is a registered trademark of Crescendo Biologics Ltd.
Thus, in some preferred embodiments, the isolated binding agents/molecules of the invention comprise at least two single VH domain antibodies wherein said domain is preferably a human heavy chain variable domain. Thus, in one aspect, the binding agents of the invention comprise at least two human immunoglobulin single variable heavy chain domain; they are devoid of VL domains.
Each single VH domain antibody comprises three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. Thus, in one embodiment of the invention, the domain is a human variable heavy chain (VH) domain with the following formula FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.
The term “isolated” single domain antibody refers to a single domain antibody that is substantially free of other single domain antibodies, antibodies or antibody fragments having different antigenic specificities. Moreover, an isolated single domain antibody may be substantially free of other cellular material and/or chemicals.
In one embodiment, said first or second single VH domain antibody comprises a CDR3 sequence as shown in any of
In one embodiment, the first or second single VH domain antibody comprises a CDR3 sequence as shown in any of
In one embodiment, the first or second single VH domain antibody comprises a set of CDRs1, 2 and 3 sequences selected from the sets of CDR1, 2 and 3 sequences as shown for any of the sdAbs of any of
In one embodiment, said sequence homology or identity is at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.
“Homology” generally refers to the percentage of amino acid residues in the candidate sequence that are identical with the residues of the polypeptide with which it is compared, after aligning the sequences and in some embodiments after introducing gaps, if necessary, to achieve the maximum percent homology, and not considering any conservative substitutions as part of the sequence identity. Thus, the percent homology between two amino acid sequences is equivalent to the percent identity between the two sequences. Neither N- or C-terminal extensions, tags or insertions shall be construed as reducing identity or homology. Methods and computer programs for the alignment are well known.
The term “antibody”, broadly refers to any immunoglobulin (Ig) molecule, or antigen binding portion thereof, comprised of four polypeptide chains, two heavy (H) chains and two light (L) chains, or any functional fragment, mutant, variant, or derivation thereof, which retains the essential epitope binding features of an Ig molecule. Such mutant, variant, or derivative antibody formats are known in the art. In a full-length antibody, each heavy chain is comprised of a heavy chain variable region (abbreviated herein as HCVR or VH) and a heavy chain constant region. The heavy chain constant region is comprised of three domains, CH1, CH2 and CH3. Each light chain is comprised of a light chain variable region (abbreviated herein as LCVR or VL) and a light chain constant region. The light chain constant region is comprised of one domain, CL. The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR). Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. Immunoglobulin molecules can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgG 1, IgG2, IgG 3, IgG4, IgA1 and IgA2) or subclass.
An antibody fragment is a portion of an antibody, for example as F(ab′)2, Fab, Fv, sFv and the like. Functional fragments of a full length antibody retain the target specificity of a full length antibody. Recombinant functional antibody fragments, such as Fab (Fragment, antibody), scFv (single chain variable chain fragments) and single domain antibodies (dAbs) have therefore been used to develop therapeutics as an alternative to therapeutics based on mAbs. scFv fragments (˜25 kDa) consist of the two variable domains, VH and VL. Naturally, VH and VL domain are non-covalently associated via hydrophobic interaction and tend to dissociate. However, stable fragments can be engineered by linking the domains with a hydrophilic flexible linker to create a single chain Fv (scFv). The smallest antigen binding fragment is the single variable fragment, namely the VH or VL domain. Binding to a light chain/heavy chain partner respectively is not required for target binding. Such fragments are used in single domain antibodies. A single domain antibody (˜12 to 15 kDa) therefore has either the VH or VL domain.
Thus, in some preferred embodiments of the invention, the binding molecule does not comprise a light chain. In some embodiments, the binding molecule does not comprise heavy chain domains CH2 and CH3. In some embodiments, the binding molecule does not comprise a hinge region and heavy chain domains CH2 and CH3. In some embodiments, the binding molecule does not comprise heavy chain domains CH1, CH2, and CH3. In some embodiments the binding molecule does not comprise heavy chain domain CH1, a hinge region heavy chain domain CH2 and heavy chain domain CH3. In some embodiments the binding molecule does not comprise a light chain, a heavy chain domain CH1, a hinge region heavy chain domain CH2 and heavy chain domain CH3.
Each VH domain comprises three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. Modifications to the VH framework may be made to improve binding properties. For example, the VH domain may comprise C or N-terminal extensions. In one embodiment, the VH domain comprises C-terminal extensions of from 1 to 10, for example 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 additional amino acids. In one embodiment, the VH domain comprises C-terminal extensions of from 1 to 12 amino acid residues, for example 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 additional amino acids of the CH1 domain. In one embodiment, said extension comprises at least 1 alanine residue, for example a single alanine residue, a pair of alanine residues or a triplet of alanine residues. Such extended VH domains are within the scope of the invention. Also within the scope of the invention are binding molecules that comprise VH domains that comprise additional C or N-terminal residues, for example linker residues and/or His tags, e.g., hexa-His (HHHHHH, SEQ ID No. 530) or myc tags. Additional residues of the vector may also be present, for example in addition to tags. Binding molecules used may have the additional residues LEGGGSEQKLISEEDLNHHHHHHGS (SEQ ID No. 531).
According to the various aspects and embodiments of the invention, the variable domain of the single domain antibodies is preferably a human variable domain (VH). As used herein, a human VH domain includes a fully human or substantially fully human VH domain. As used herein, the term human VH domain also includes VH domains that are isolated from heavy chain only antibodies made by transgenic mice expressing fully human immunoglobulin heavy chain loci, in particular in response to an immunisation with an antigen of interest, for example as described in WO2016/062990 and in the examples. In one embodiment, a human VH domain can also include a VH domain that is derived from or based on a human VH domain amino acid or nucleic acid sequence encoding such VH domain. Thus, the term includes variable heavy chain regions derived from or encoded by human germline immunoglobulin sequences. A substantially human VH domain or VH domain that is derived from or based on a human VH domain may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced in vitro, e.g. by random or site-specific mutagenesis, or introduced by somatic mutation in vivo). The term “human VH domain” therefore also includes a substantially human VH domain wherein one or more amino acid residue has been modified. For example, a substantially human VH domain the VH domain may include up to 10, for example 1, 2, 3, 4 or 5 amino acid modifications compared to a fully human sequence. However, the term “human VH domain” or “substantially human VH domain”, as used herein, is not intended to include antibodies in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted onto human framework sequences. Preferably, the term “human VH domain”, as used herein, is also not intended to include camelized VH domains, that is human VH domains that have been specifically modified, for example in vitro by conventional mutagenesis methods to select predetermined positions in the VH domains sequence and introduce one or more point mutation at the predetermined position to change one or more predetermined residue to a specific residue that can be found in a camelid VHH domain.
As used herein, the term VH or “variable domain” refers to immunoglobulin variable domains defined by Kabat et al., Sequences of Immunological Interest, 5th ed., U.S. Dept. Health & Human Services, Washington, D.C. (1991). The numbering and positioning of CDR amino acid residues within the variable domains is in accordance with the well-known Kabat numbering convention.
More particularly, the invention provides a single VH domain antibody or a binding molecule single VH domain antibody wherein said single VH domain antibody binds to human PSMA with an affinity, a Kon-rate, a Koff rate, KD and/or KA, EC50 and IC50 values as further described herein, in particular in the examples. Assays suitable for measuring these values are also shown in the examples.
A binding molecule of the invention comprises or consists of an amino acid sequence and preferred sequences and/or parts thereof, such as CDRs, as defined herein.
The term “CDR” refers to the complementarity-determining region within antibody variable sequences. There are three CDRs in each of the variable regions of the heavy chain and the light chain, which are designated CDR1, CDR2 and CDR3, for each of the variable regions.
The term “CDR set” refers to a group of three CDRs that occur in a single variable region capable of binding the antigen. The exact boundaries of these CDRs have been defined differently according to different systems. The system described by Kabat is used herein. The terms “Kabat numbering”, “Kabat definitions” and “Kabat labeling” are used interchangeably herein. These terms, which are recognized in the art, refer to a system of numbering amino acid residues which are more variable (i.e., hypervariable) than other amino acid residues in the heavy and light chain variable regions of an antibody, or an antigen binding portion thereof (Kabat et al., (1971) Ann. NY Acad. Sci. 190:382-391 and Kabat, et al., (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242).
The binding molecule may be multivalent, for example bivalent, or multiparatopic, for example biparatopic. Thus, the binding molecule may have the following formula: VH(A)-VH(B). Each VH comprises CDR and FR regions. Thus, the binding molecule may have the following formula: FR1(A)-CDR1(A)-FR2(A)-CDR2(A)-FR3(A)-CDR3(A)-FR4(A)-FR1(B)-CDR1(B)-FR2(B)-CDR2(BA)-FR3(B)-CDR3(B)-FR4(B). The order of the immunoglobulin single variable domains A (first single VH domain antibody) and B (second single VH domain antibody) is not particularly limited, so that, within a polypeptide of the invention, immunoglobulin single variable domain A may be located N-terminally and immunoglobulin single variable domain B may be located C-terminally, or vice versa. The VH domains may be connected via a linker.
In one embodiment, the binding molecule is biparatopic. In a biparatopic binding molecule, the two binding moieties bind to different epitopes on a target molecule. Preferred biparatopic binding molecules comprise two different single VH domain antibodies that bind to the target protein PSMA, but on different sites. These sites may be overlapping. Complete or partial blocking can be assessed in epitope binning studies.
The term “epitope” or “antigenic determinant” refers to a site on the surface of an antigen (e.g., PSMA) to which an immunoglobulin, antibody or antibody fragment, including a VH single domain antibody specifically binds. Generally, an antigen has several or many different epitopes and reacts with many different antibodies. The term specifically includes linear epitopes and conformational epitopes. Epitopes within protein antigens can be formed both from contiguous amino acids (usually a linear epitope) or non-contiguous amino acids juxtaposed by tertiary folding of the protein (usually a conformational epitope). Epitopes formed from contiguous amino acids are typically, but not always, retained on exposure to denaturing solvents, whereas epitopes formed by tertiary folding are typically lost on treatment with denaturing solvents. An epitope typically includes at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 amino acids in a unique spatial conformation. Methods for determining what epitopes are bound by a given antibody or antibody fragment (i.e., epitope mapping) are well known in the art and include, for example, immunoblotting and immunoprecipitation assays, wherein overlapping or contiguous peptides from are tested for reactivity with a given antibody or antibody fragment. An antibody binds “essentially the same epitope” as a reference antibody, when the two antibodies recognize identical or sterically overlapping epitopes. The most widely used and rapid methods for determining whether two epitopes bind to identical or sterically overlapping epitopes are competition assays, which can be configured in different formats, using either labelled antigen or labelled antibody.
In one embodiment, the binding molecule is bivalent. Bivalent binding molecules comprise two Humabody® VH that bind to the same target protein (PSMA) at the same sites. In one embodiment, such molecules may comprise the same Humabody® VH. In another embodiment, such molecules may comprise two Humabody® VH that are part of the same Humabody® VH family. In another embodiment, such molecules may comprise two Humabody® VH that are not part of the same Humabody® VH but bind to the same site. Biparatopic and bivalent binding molecules of the present invention can be constructed using methods known in the art.
As described in more detail in the experimental part, single VH domain antibodies that can be used in the multiparatopic or multivalent binding molecules of the invention were isolated and grouped into 15 families based on sequence homology in the CDR3 sequence. Through a process of optimization, a panel of variant single VH domain antibodies with a CDR sequence derived from a parent CDR sequence were also generated to improve affinities to PSMA and/or improve potencies compared to the parent molecule. Each single VH domain antibody has a set of CDR sequences (CDR1, 2 and 3) as shown in
In some embodiments, the first or second single VH domain antibody is a variant VH single domain antibodies of a parent molecules, in particular of a parent VH single domain antibody selected from sdAb 1.1, 2.1, 3.1, 4.1, 5.1, 6.1, 7.1, 8.1, 9.1, 10.1, 11.1, 12.1, 13.1, 14.1 or 15.1 having one or more amino acid substitutions, deletions, insertions or other modifications, and which retains a biological function of the single domain antibody. Thus, a variant VH single domain antibody can be sequence engineered. Modifications may include one or more substitution, deletion or insertion of one or more codons encoding the single domain antibody or polypeptide that results in a change in the amino acid sequence as compared with the native sequence VH single domain antibody or polypeptide. Amino acid substitutions can be the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, such as the replacement of a leucine with a serine, i.e., conservative amino acid replacements. Insertions or deletions may optionally be in the range of about 1 to 5 amino acids. The variation allowed may be determined by systematically making insertions, deletions or substitutions of amino acids in the sequence and testing the resulting variants for activity exhibited by the full-length or mature native sequence. A variant of a VH single domain antibody described herein has at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence homology to the non-variant molecule, preferably at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence homology.
In one embodiment, the modification is a conservative sequence modification. As used herein, the term “conservative sequence modifications” is intended to refer to amino acid modifications that do not significantly affect or alter the binding characteristics of the antibody containing the amino acid sequence. Such conservative modifications include amino acid substitutions, additions and deletions. Modifications can be introduced into binding molecule of the invention by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions are ones in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, one or more amino acid residues within the CDR regions of a single domain antibody can be replaced with other amino acid residues from the same side chain family and the altered antibody can be tested for retained function (i.e., the functions set forth in (c) through (I) above) using the functional assays described herein.
In some embodiments, the VH single domain antibody that is a variant of a single domain antibody selected from those shown in Tables 1 to 15 that comprises one or more sequence modification and has improvements in one or more of a property such as binding affinity, specificity, thermostability, expression level, effector function, glycosylation, reduced immunogenicity, or solubility as compared to the unmodified single domain antibody.
A skilled person will know that there are different ways to identify, obtain and optimise the antigen binding molecules as described herein, including in vitro and in vivo expression libraries. This is further described in the examples. Optimisation techniques known in the art, such as display (e.g., ribosome and/or phage display) and/or mutagenesis (e.g., error-prone mutagenesis) can be used. The invention therefore also comprises sequence optimised variants of the single domain antibodies described herein.
In one embodiment, modifications can be made to decrease the immunogenicity of the single domain antibody. For example, one approach is to revert one or more framework residues to the corresponding human germline sequence. More specifically, a single domain antibody that has undergone somatic mutation may contain framework residues that differ from the germline sequence from which the single domain antibody is derived. Such residues can be identified by comparing the single domain antibody framework sequences to the germline sequences from which the single domain antibody is derived. To return one or more of the amino acid residues in the framework region sequences to their germline configuration, the somatic mutations can be “backmutated” to the germline sequence by, for example, site-directed mutagenesis or PCR-mediated mutagenesis.
Another type of framework modification involves mutating one or more residues within the framework region, or even within one or more CDR regions, to remove T cell epitopes to thereby reduce the potential immunogenicity of the antibody. In still another embodiment, the glycosylation of an antibody is modified. For example, an aglycoslated antibody can be made (i.e., the antibody lacks glycosylation). Glycosylation can be altered to, for example, increase the affinity of the antibody for antigen. Such carbohydrate modifications can be accomplished by, for example, altering one or more sites of glycosylation within the antibody sequence. For example, one or more amino acid substitutions can be made that result in elimination of one or more variable region framework glycosylation sites to thereby eliminate glycosylation at that site. Such aglycosylation may increase the affinity of the antibody for antigen.
In one aspect, the binding molecule comprises a single VH domain antibody comprising a family 1 or a family-1 like sequence. In one embodiment, two VH domains comprising a family 1 or a family-1 like sequence may be combined for a bivalent binding molecule. In another embodiment, a first VH domain comprising a family 1 or a family-1 like sequence may be combined with a second VH domain as described herein that binds to the same a epitope, part, domain, subunit or confirmation of PSMA for a bivalent binding molecule. The second VH domain may be selected from family 1, 5, 6, 12 or 13 or family 1, 5, 6, 12 or 13-like sequence. In one embodiment, the first VH domain comprises SEQ ID No:4 and the second VH domain comprises SEQ ID NO:4.
In one embodiment, a first VH domain comprising a family 1 or a family-1 like sequence may be combined with a second VH domain as described herein that binds to a different epitope, part, domain, subunit or confirmation of PSMA for a biparatopic binding molecule. The second VH domain may be selected from a family 2, 3, 4, 7, 9, 10, 11 or 14 or a family 2, 3, 4, 7, 9, 10, 11 or 14-like sequence. In one embodiment, the first VH domain comprises SEQ ID No:4 and the second VH domain comprises SEQ ID NO:84.
A single VH domain antibody of family 1 may include the sequence of the parent (1.1; SEQ ID NO. 4) or a part thereof, for example a CDR3 sequence, and sequences that are derived from the parent 1.1 through a process of optimization, for example sequences as shown as shown in
In one aspect, the VH domain comprises a CDR3 sequence comprising SEQ ID NO. 3 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology to SEQ ID NO. 3.
In one embodiment, the VH domain comprises a CDR3 sequence comprising or consisting of an amino acid sequence selected from SEQ ID NO. 3, 7, 11, 15, 19, 23, 27, 31, 35, 39, 43, 47, 51, 55, 59, 63, 67, 71, 75 or 79.
In one embodiment, the VH domain comprises hypervariable regions CDR1, CDR2 and CDR3, said CDR1 comprises the amino acid sequence SEQ ID NO. 1 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, said CDR2 comprising the amino acid sequence SEQ ID NO. 2 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, and said CDR3 comprising the amino acid sequence SEQ ID NO. 3 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto. For example, the CDR may be a CDR selected from those shown in
In one embodiment, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 1 or a sequence with at least at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95% 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 2 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95% 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 3 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95% 96%, 97%, 98% or 99% homology thereto.
In one embodiment, the CDR sequences of the VH domain are as shown for single VH domain antibodies 1.1 to 1.20 as in
In one aspect, the single VH domain antibody has combinations of CDR1, CDR2 and CDR3 as shown for clones 1.1 to 1.20 in
In one embodiment, the single VH domain antibody has a VH domain that comprises or consists of SEQ ID NO. 4 or a sequence with at least 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95% 96%, 97%, 98% or 99% homology thereto. CDR sequences of such sequences are shown in
Thus, in one embodiment, the invention relates to a binding molecule comprising or consisting of at least one immunoglobulin single domain antibody capable of binding PSMA wherein said domain is a human VH domain and wherein said VH domain comprises or consists of SEQ ID NO. 4, 8, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, 52, 56, 60, 64, 68, 72, 76 or 80 or a sequence with at least 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto.
In one embodiment, the single VH domain antibody comprises a VH domain as shown in SEQ ID NO. 4 or a variant thereof wherein in said variant, residue 33 is T, 36 is L, residue 57 is D, residue 59 is N, R, A, D, H, residue 63 D, Y, residue 65 is V, residue 66 is A, and/or residue 67 is F, N, A, D, V, T, S, Y.
In one embodiment, the VH domain is as shown in SEQ ID NO. 4 or a variant thereof wherein said variant includes the following changes compared to SEQ ID NO. 4
In one embodiment, additional changes may be included. In another embodiment, the variants listed above do not include additional changes.
The single VH domain antibody in family 1 has KD, Koff, KA, Kd, EC50 and IC50 values as further described herein and as shown in the examples. The term “KD” as used in this application refers to the “equilibrium dissociation constant” and refers to the value obtained in a titration measurement at equilibrium, or by dividing the dissociation rate constant (Koff) by the association rate constant (Kon). “KA” as used in this application refers to the affinity constant. The association rate constant, the dissociation rate constant and the equilibrium dissociation constant are used to represent the binding affinity of an antibody to an antigen. Methods for determining association and dissociation rate constants are well known in the art. Using fluorescence-based techniques offers high sensitivity and the ability to examine samples in physiological buffers at equilibrium. Other experimental approaches and instruments such as a BIAcore® (biomolecular interaction analysis) assay and assays described in the examples can be used to test the binding molecules of the invention.
In one aspect, the binding molecule of the invention comprises one or more human VH domain comprising a family 2 or family-2 like sequence. Thus, in one embodiment, the binding molecule comprises or consists of at least two single VH domain antibody capable of binding PSMA, preferably human PSMA, of family 2. In another embodiment, one VH domain comprising a family 2 or a family-2 like sequence may be combined with a second VH domain as described herein that binds to the same a epitope, part, domain, subunit or confirmation of PSMA for a bivalent binding molecule. The second VH domain may be selected from a family 2, 3, 4, 7, 9, 10, 11 or a family 2, 3, 4, 7, 9, 10, 11-like sequence.
In one embodiment, one VH domain comprising a family 2 or a family-2 like sequence may be combined with a second VH domain as described herein that binds to a different epitope, part, domain, subunit or confirmation of PSMA for a biparatopic binding molecule. The second VH domain may be selected from a family 1, 5, 6, 12 or 13 or a family 1, 5, 6, 12 or 13-like sequence.
The family 2 single VH domain antibody may include sequences that are derived from the parent (2.1; SEQ ID NO. 84) or a part thereof, for example a CDR3 sequence, and VH sequences or parts thereof that are derived from the parent 2.1 through a process of optimization, for example as shown in
In one aspect, the VH domain comprising a CDR3 sequence comprising SEQ ID NO. 83 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology to SEQ ID NO. 83. In one embodiment, the VH domain comprises a CDR3 selected from SEQ ID NO. 83, 87, 91, 95, 99, 103, 107, 111, 115, 119, 123, 127, 131, 135, 139, 143, 147, 151, 155, 159, 163, 167, 171, 175 or 179.
In one embodiment, the VH domain comprises at least one antigen binding site comprising CDR3 said CDR3 having the amino acid sequence SEQ ID NO. 75 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology thereto. In one embodiment, the family 2 family 2-like sequence comprises a binding molecule comprising or consisting of at least one immunoglobulin single domain antibody capable of binding PSMA wherein said domain is a human VH domain comprising hypervariable regions CDR1, CDR2 and CDR3, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 81 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 82 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, and said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 83 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto.
In one embodiment, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 81 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95% 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 82 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95% 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 83 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95% 96%, 97%, 98% or 99% homology thereto.
In one embodiment, the CDR sequences of the VH domain are as shown for sdAbs 2.1 to 2.25 as in
In one aspect, the single VH domain antibody has combinations of CDR1, CDR2 and CDR3 as shown for 2.1 to 2.25 in
In one embodiment, the single VH domain antibody comprises or consists of SEQ ID NO. 84 or a sequence with at least 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95% 96%, 97%, 98% or 99% homology thereto. In one embodiment, homology is at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. CDR sequences of such sequences are shown in
In another embodiment, the VH domain is selected from one of the sequences above, for example SEQ ID NO. 84, but comprises one or more amino acid substitutions, for example 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions. In one embodiment, the one or more amino acid substitution is in one or more of the framework areas. In another embodiment, the one or more amino acid substitution is in one or more of the CDRs. In one embodiment, the amino acid substitutions are in the framework and CDR sequences.
In one embodiment, the single VH domain antibody comprises SEQ ID NO. 84 or a variant thereof wherein the variant has the following amino acid substitutions compared to SEQ ID NO. 76: residue 34 is L, V, M, Q, T, F, residue 50 is H, V, L, I, residue 55 is E, K, A, L, residue 58 is R, residue 62 is E, P, R, S, A, residue 63 is E, residue 64 is N, K, P, L, G, S, residue 79 is K, residue is L, Q, residue 84 is K, A, residue is D.
In one embodiment, the single VH domain antibody comprises or consists of a VH as shown in SEQ ID NO. 4 or a variant thereof wherein said variant includes the following changes compared to SEQ ID NO. 84:
In one embodiment, additional changes may be included. In another embodiment, the variants listed above do not include additional changes. In one embodiment, the variant does not include a combination of the following changes: G55→A55, S63→N63, D99→N99 together with P100→T100; G34→L34, G55→K55 together with S63→K63; G55→T55, S63→R63, D99→G99 together with P100→R100.
The family 2 or family 2-like binding molecules have KD, Koff, KA, Kd, EC50 and IC50 values as further described herein and as shown in the examples.
In one aspect, the binding molecule capable of binding human PSMA comprises a human VH domain comprising a family 3 or family-3 like sequence.
In one embodiment, two VH domains comprising a family 3 or a family-3 like sequence may be combined for a bivalent binding molecule. In another embodiment, one VH domain comprising a family 3 or a family-3 like sequence may be combined with a second VH domain as described herein that binds to the same a epitope, part, domain, subunit or confirmation of PSMA for a bivalent binding molecule. The second VH domain may be selected from a family 2, 3, 4, 7, 9, 10, 11 or a family 2, 3, 4, 7, 9, 10, 11-like sequence.
In one embodiment, one VH domain comprising a family 3 or a family-3 like sequence may be combined with a second VH domain as described herein that binds to a different epitope, part, domain, subunit or confirmation of PSMA for a biparatopic binding molecule. The second VH domain may be selected from a family 1, 5, 6, 12 or 13 or a family 1, 5, 6, 12 or 13-like sequence.
A family 3 or family 3-like single VH domain antibody includes the parent sequence and sequences of that are derived from the parent (3.1; SEQ ID NO. 184) or a part thereof, for example a CDR3 sequence, and VH sequences or parts thereof that are derived from the parent 3.1 through a process of optimization, for example as shown in
In one aspect, the invention relates to a family 3 or family 3-like binding molecule comprising a human VH domain comprising a CDR3 sequence comprising SEQ ID NO. 183 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology to SEQ ID NO. 183.
In one embodiment, the VH domain comprises at least one antigen binding site comprising a CDR3 sequence comprising SEQ ID NO. 183 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology to SEQ ID NO. 183. In one embodiment, homology is at least 90%.
In one embodiment, the single VH domain antibody comprises the amino acid sequence SEQ ID NO. 183 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology thereto. In one embodiment, the family 3 or family 3-like sequence comprises a binding molecule comprising or consisting of at least one immunoglobulin single domain antibody capable of binding PSMA wherein said domain is a human VH domain and wherein said PSMA binding molecule comprises at least one antigen binding site comprising hypervariable regions CDR1, CDR2 and CDR3, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 181 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 182 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, and said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 183 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto.
In one embodiment, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 181 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 182 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 183 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto.
In one embodiment, the CDR sequences of the VH domain are as shown for sdAbs 3.1 to 3.24 as in
In one aspect, the invention relates to a single VH domain antibody which has combinations of CDR1, CDR2 and CDR3 as shown for 3.1 to 3.24 in
In one embodiment, the single VH domain antibody comprises or consists of SEQ ID NO. 180 or a sequence with at least 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, homology is at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. CDR sequences of such sequences are shown in
In one embodiment, the VH domain comprises or consists of SEQ ID NO. 184, 188, 192, 196, 200, 204, 208, 212, 216, 220, 224, 228, 232, 236, 240, 244, 248, 252, 256, 260, 264, 268, 272 or 276, or a sequence with at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. CDR sequences of such sequences are listed below.
In another embodiment, the VH domain is selected from one of the sequences above, but comprises one or more amino acid substitutions, for example 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions. In one embodiment, the one or more amino acid substitution is in one or more of the framework areas. In another embodiment, the one or more amino acid substitution is in one or more of the CDRs. In one embodiment, the amino acid substitutions are in the framework and CDR sequences.
The family 3 or family 3-like binding molecules have KD, Koff, KA, Kd, EC50 and IC50 values as further described herein and as shown in the examples.
In one aspect, the binding molecule capable of binding human PSMA comprises a human VH domain comprising a family 4 or family 4-like sequence.
In one embodiment, two VH domains comprising a family 4 or a family-4 like sequence may be combined for a bivalent binding molecule. In another embodiment, one VH domain comprising a family 4 or a family-4 like sequence may be combined with a second VH domain as described herein that binds to the same a epitope, part, domain, subunit or confirmation of PSMA for a bivalent binding molecule. The second VH domain may be selected from a family 2, 3, 4, 7, 9, 10, 11 or a family 2, 3, 4, 7, 9, 10, 11-like sequence. In one embodiment, one VH domain comprising a family 4 or a family-4 like sequence may be combined with a second VH domain as described herein that binds to a different epitope, part, domain, subunit or confirmation of PSMA for a biparatopic binding molecule. The second VH domain may be selected from a family 1, 5, 6, 12 or 13 or a family 1, 5, 6, 12 or 13-like sequence.
Family 4 single VH domain antibodies include the parent sequence and sequences of that are derived from the parent (4.1, SEQ ID NO. 279) or a part thereof, for example a CDR3 sequence, and VH sequences or parts thereof that are derived from the parent 4.1 through a process of optimization, for example as shown in
In one aspect, the invention relates to a family 4 or family 4-like binding molecule comprising a human VH domain comprising a CDR3 sequence comprising SEQ ID NO. 279 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology to SEQ ID NO. 279.
In one embodiment, the VH domain comprises a CDR3 selected from SEQ ID NOs. 279, 282, 287 or 291.
In one embodiment, the single VH domain antibody comprises at least one antigen binding site comprising hypervariable region CDR3 said CDR3 having the amino acid sequence SEQ ID NO. 279 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology thereto. In one embodiment, the family 4 or family 4-like sequence comprises a binding molecule comprising or consisting of at least one immunoglobulin single domain antibody capable of binding PSMA wherein said domain is a human VH domain and wherein said PSMA binding molecule comprises at least one antigen binding site comprising hypervariable regions CDR1, CDR2 and CDR3, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 277 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 278 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, and said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 279 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto.
In one embodiment, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 277 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 278 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 279 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto.
In one embodiment, the CDR sequences of the VH domain are as shown for clones 4.1 to 4.4 as in
In one aspect, the single VH domain antibody has combinations of CDR1, CDR2 and CDR3 as shown for 4.1 to 4.4 in
In one embodiment, the VH domain comprises or consists of SEQ ID NO. 280 or a sequence with at least 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology thereto. In one embodiment, homology is at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. CDR sequences of such sequences are shown in
In one embodiment, the VH domain comprises or consists of SEQ ID NO. 280, 284, 288 or 290, or a sequence with at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. CDR sequences of such sequences are listed below.
In another embodiment, the VH domain is selected from one of the sequences above, but comprises one or more amino acid substitutions, for example 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions. In one embodiment, the one or more amino acid substitution is in one or more of the framework areas. In another embodiment, the one or more amino acid substitution is in one or more of the CDRs. In one embodiment, the amino acid substitutions are in the framework and CDR sequences.
The family 4 or family 4-like binding molecules have KD, Koff, KA, Kd, EC50 and IC50 values as further described herein and as shown in the examples.
In one aspect, the invention relates to a binding molecule capable of binding human PSMA comprising a human VH domain comprising a family 5 or family-5 like sequence.
In one embodiment, the binding molecule comprises or consists of a binding molecule comprising or consisting of at least one immunoglobulin single domain antibody capable of binding PSMA, preferably human PSMA, wherein said domain is a human VH domain and wherein said PSMA binding molecule comprises a family 5 or family-5 sequence. In one embodiment, two VH domains comprising a family 5 or a family-5 like sequence may be combined for a bivalent binding molecule. In another embodiment, one VH domain comprising a family 5 or a family-5 like sequence may be combined with a second VH domain as described herein that binds to the same a epitope, part, domain, subunit or confirmation of PSMA for a bivalent binding molecule. The second VH domain may be selected from family 1, 5, 6, 12 or 13 or family 1, 5, 6, 12 or 13-like sequence.
In one embodiment, one VH domain comprising a family 5 or a family-5 like sequence may be combined with a second VH domain as described herein that binds to a different epitope, part, domain, subunit or confirmation of PSMA for a biparatopic binding molecule. The second VH domain may be selected from a family 2, 3, 4, 7, 9, 10, 11 or 14 or a family 2, 3, 4, 7, 9, 10, 11 or 14-like sequence.
A single VH domain antibody of family 5 includes sequences that are derived from the parent (5.1; SEQ ID NO. 292) or a part thereof, for example a CDR3 sequence, and to VH sequences or parts thereof that are derived from the parent 5.1 through a process of optimization, for example as shown in
In one aspect, the invention relates to a family 5 or family 5-like binding molecule comprising a human VH domain comprising a CDR3 sequence comprising SEQ ID NO. 295 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology to SEQ ID NO. 295.
In one embodiment, the VH domain comprises a CDR3 selected from SEQ ID NO. 295 and 299.
In one embodiment, the single VH domain antibody comprises at least one antigen binding site comprising hypervariable region CDR3 said CDR3 having the amino acid sequence of SEQ ID NO. 295 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology thereto. In one embodiment, the family 5 or family-5 sequence comprises a binding molecule comprising or consisting of at least one immunoglobulin single domain antibody capable of binding PSMA wherein said domain is a human VH domain and wherein said PSMA binding molecule comprises at least one antigen binding site comprising hypervariable regions CDR1, CDR2 and CDR3, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 293 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 294 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, and said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 295 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto.
In one embodiment, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 293 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 294 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 295 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto.
In one embodiment, the CDR sequences of the VH domain are as shown for clones 5.1 and 5.2 as in
In one aspect, the invention relates to a VH domain which has combinations of CDR1, CDR2 and CDR3 as shown for 5.1 to 5.2 in
In one embodiment, the VH domain comprises or consists of SEQ ID NO. 296 or 300 or a sequence with at least 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, homology is at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. CDR sequences of such sequences are shown in
In another embodiment, the VH domain is selected from one of the sequences above, but comprises one or more amino acid substitutions, for example 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions. In one embodiment, the one or more amino acid substitution is in one or more of the framework areas. In another embodiment, the one or more amino acid substitution is in one or more of the CDRs. In one embodiment, the amino acid substitutions are in the framework and CDR sequences.
The family 5 or family-5 binding molecules have KD, Koff, KA, Kd, EC50 and IC50 values as further described herein and as shown in the examples.
In one aspect, the invention relates to a binding molecule capable of binding human PSMA comprising a human VH domain comprising a family 6 or family 6-like sequence.
In one aspect, the binding molecule capable of binding human PSMA comprises a human VH domain comprising a family 6 or family 6-like sequence. In one embodiment, two VH domains comprising a family 6 or a family-6 like sequence may be combined for a bivalent binding molecule. In another embodiment, one VH domain comprising a family 6 or a family-6 like sequence may be combined with a second VH domain as described herein that binds to the same a epitope, part, domain, subunit or confirmation of PSMA for a bivalent binding molecule. The second VH domain may be selected from family 1, 5, 6, 12 or 13 or family 1, 5, 6, 12 or 13-like sequence.
In one embodiment, one VH domain comprising a family 6 or a family-6 like sequence may be combined with a second VH domain as described herein that binds to a different epitope, part, domain, subunit or confirmation of PSMA for a biparatopic binding molecule. The second VH domain may be selected from a family 2, 3, 4, 7, 9, 10, 11 or 14 or a family 2, 3, 4, 7, 9, 10, 11 or 14-like sequence.
A family 6 single VH domain antibody includes the parent (6.1; SEQ ID NO. 304) or a part thereof, for example a CDR3 sequence, and to VH sequences or parts thereof that are derived from the parent 6.1 through a process of optimization, for example as shown in
In one aspect, the invention relates to a family 6 or family 6-like binding molecule comprising a human VH domain comprising a CDR3 sequence comprising SEQ ID NO. 303 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology to SEQ ID NO. 303.
In one embodiment, homology is at least 90%. In one embodiment, the VH domain comprises a CDR3 selected from SEQ ID NO. 303, 307, 311, 315, 319, 323 or 327.
In one embodiment, the single VH domain antibody comprises at least one antigen binding site comprising hypervariable region CDR3 said CDR3 having the amino acid sequence SEQ ID NO. 303 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology thereto. In one embodiment, the family 6 or family 6-like sequence comprises a binding molecule comprising or consisting of at least one immunoglobulin single domain antibody capable of binding PSMA wherein said domain is a human VH domain and wherein said PSMA binding molecule comprises at least one antigen binding site comprising hypervariable regions CDR1, CDR2 and CDR3, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 301 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 302 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, and said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 303 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto.
In one embodiment, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 301 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO.302 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 303 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto.
In one embodiment, the CDR sequences of the VH domain are as shown for clones 6.1 to 6.7 as in
In one aspect, single VH domain antibody which has combinations of CDR1, CDR2 and CDR3 as shown for 6.1 to 6.7 in
In one embodiment, the VH domain comprises or consists of SEQ ID NO. 304 or a sequence with at least 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, homology is at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. CDR sequences of such sequences are shown in
In one embodiment, the VH domain comprises or consists of SEQ ID NO. 304, 308, 312, 316, 320, 324 or 328 or a sequence with at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto.
In another embodiment, the VH domain is selected from one of the sequences above, but comprises one or more amino acid substitutions, for example 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions. In one embodiment, the one or more amino acid substitution is in one or more of the framework areas. In another embodiment, the one or more amino acid substitution is in one or more of the CDRs. In one embodiment, the amino acid substitutions are in the framework and CDR sequences.
The family 6 or family 6-like binding molecules have KD, Koff, KA, Kd, EC50 and IC50 values as further described herein and as shown in the examples.
In one aspect, the invention relates to a binding molecule capable of binding human PSMA comprising a human VH domain comprising a family 7 or family 7-like sequence.
In one aspect, the binding molecule capable of binding human PSMA comprises a human VH domain comprising a family 7 or family 7-like sequence. In one embodiment, two VH domains comprising a family 7 or a family-7 like sequence may be combined for a bivalent binding molecule. In another embodiment, one VH domain comprising a family 7 or a family-7 like sequence may be combined with a second VH domain as described herein that binds to the same a epitope, part, domain, subunit or confirmation of PSMA for a bivalent binding molecule. The second VH domain may be selected from a family 2, 3, 4, 7, 9, 10, 11 or a family 2, 3, 4, 7, 9, 10, 11-like sequence.
In one embodiment, one VH domain comprising a family 7 or a family-7 like sequence may be combined with a second VH domain as described herein that binds to a different epitope, part, domain, subunit or confirmation of PSMA for a biparatopic binding molecule. The second VH domain may be selected from a family 1, 5, 6, 12 or 13 or a family 1, 5, 6, 12 or 13-like sequence.
A family 7 or family 7-like sequence includes the parent sequence and sequences of clones that are derived from the parent (7.1) or a part thereof, for example a CDR3 sequence, and to VH sequences or parts thereof that are derived from the parent 7.1 through a process of optimization, for example as shown in
In one aspect, the invention relates to a family 7 or family 7-like binding molecule comprising a human VH domain comprising a CDR3 sequence comprising SEQ ID NO. 331 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology to SEQ ID NO. 331.
In one embodiment, homology is at least 90%. In one embodiment, the VH domain comprises a CDR3 selected from SEQ ID NO. 331, 335, 339, 343, 347, 351, 355 or 359.
In one embodiment, the single VH domain antibody comprises at least one antigen binding site comprising hypervariable region CDR3 said CDR3 having the amino acid sequence SEQ ID NO. 331 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology thereto. In one embodiment, the family 7 or family 7-like sequence comprises a binding molecule comprising or consisting of at least one immunoglobulin single domain antibody capable of binding PSMA wherein said domain is a human VH domain and wherein said PSMA binding molecule comprises at least one antigen binding site comprising hypervariable regions CDR1, CDR2 and CDR3, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 329 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 330 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, and said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 331 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto.
In one embodiment, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 329 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 330 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 331 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto.
In one embodiment, the CDR sequences of the VH domain are as shown for clones 7.1 to 7.8 as in
In one aspect, the single VH domain antibody has combinations of CDR1, CDR2 and CDR3 as shown for 7.1 to 7.8 in
In one embodiment, the VH domain comprises or consists of SEQ ID NO. 332 or a sequence with at least 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, homology is at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. CDR sequences of such sequences are shown in
In one embodiment, the VH domain comprises or consists of SEQ ID NO. 332, 336, 340, 344, 348, 352, 356, 360 or a sequence with at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto.
In another embodiment, the VH domain is selected from one of the sequences above, but comprises one or more amino acid substitutions, for example 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions. In one embodiment, the one or more amino acid substitution is in one or more of the framework areas. In another embodiment, the one or more amino acid substitution is in one or more of the CDRs. In one embodiment, the amino acid substitutions are in the framework and CDR sequences.
The family 7 or family 7-like binding molecules have KD, Koff, KA, Kd, EC50 and IC50 values as further described herein and as shown in the examples.
In one aspect, the invention relates to a binding molecule capable of binding human PSMA comprising a human VH domain comprising a family 8 or family 8-like sequence.
A family 8 or family 8-like sequence includes the parent sequence and sequences of clones that are derived from the parent (8.1, SEQ ID NO. 36) or a part thereof, for example a CDR3 sequence, and VH sequences or parts thereof that are derived from the parent 8.1 through a process of optimization, CDR sequences and full length sequences of 8.1 in are numbered according to Table 8 as shown below.
In one aspect, the invention relates to a family 8 or family 8-like binding molecule comprising a human VH domain comprising a CDR3 sequence comprising SEQ ID NO. 363 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology to SEQ ID NO. 363.
In one embodiment, homology is at least 90%. In one embodiment, the VH domain comprises a CDR3 of SEQ ID NO. 363.
In one embodiment, the single VH domain antibody comprises at least one antigen binding site comprising hypervariable region CDR3 said CDR3 having the amino acid sequence SEQ ID NO. 363 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology thereto. In one embodiment, the family 8 or family 8-like sequence comprises a binding molecule comprising or consisting of at least one immunoglobulin single domain antibody capable of binding PSMA wherein said domain is a human VH domain and wherein said PSMA binding molecule comprises at least one antigen binding site comprising hypervariable regions CDR1, CDR2 and CDR3, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 361 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 362 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, and said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 363 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto.
In one embodiment, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 361 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 362 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 363 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, the CDR sequences of the VH domain are as shown for sdAb 8.1 as in
In one embodiment, the VH domain comprises or consists of SEQ ID NO. 364 or a sequence with at least 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto.
In another embodiment, the VH domain is selected from one of the sequences above, but comprises one or more amino acid substitutions, for example 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions. In one embodiment, the one or more amino acid substitution is in one or more of the framework areas. In another embodiment, the one or more amino acid substitution is in one or more of the CDRs. In one embodiment, the amino acid substitutions are in the framework and CDR sequences.
The family 8 or family 8-like binding molecules have KD, Koff, KA, Kd, EC50 and IC50 values as further described herein and as shown in the examples.
In one aspect, the invention relates to a binding molecule capable of binding human PSMA comprising a human VH domain comprising a family 9 or family 9-like sequence.
In one aspect, the invention relates to a binding molecule capable of binding human PSMA comprising a human VH domain comprising a family 9 or family 9-like sequence. In one embodiment, two VH domains comprising a family 9 or a family-9 like sequence may be combined for a bivalent binding molecule. In another embodiment, one VH domain comprising a family 9 or a family-9 like sequence may be combined with a second VH domain as described herein that binds to the same a epitope, part, domain, subunit or confirmation of PSMA for a bivalent binding molecule. The second VH domain may be selected from a family 2, 3, 4, 7, 9, 10, 11 or a family 2, 3, 4, 7, 9, 10, 11-like sequence.
In one embodiment, one VH domain comprising a family 9 or a family-9 like sequence may be combined with a second VH domain as described herein that binds to a different epitope, part, domain, subunit or confirmation of PSMA for a biparatopic binding molecule. The second VH domain may be selected from a family 1, 5, 6, 12 or 13 or a family 1, 5, 6, 12 or 13-like sequence.
A family 9 or family 9 sequence includes the parent sequence and sequences that are derived from the parent (9.1; SEQ ID NO. 368) or a part thereof, for example a CDR3 sequence, and VH sequences or parts thereof that are derived from the parent 9.1 through a process of optimization, CDR sequences and full-length sequences of 9.1 in are numbered according to Table 9 as shown below.
In one aspect, the invention relates to a family 9 or family 9-like binding molecule comprising a human VH domain comprising a CDR3 sequence comprising SEQ ID NO. 367 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology to SEQ ID NO. 367.
In one embodiment, the binding molecule comprises at least one immunoglobulin single domain antibody capable of binding PSMA wherein said domain is a human VH domain and wherein said human VH domain comprises at least one antigen binding site comprising a CDR3 sequence comprising SEQ ID NO. 367 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology to SEQ ID NO. 367. In one embodiment, homology is at least 90%. In one embodiment, the VH domain comprises a CDR3 of SEQ ID NO. 367.
In one embodiment, the single VH domain antibody comprises a CDR3 said CDR3 having the amino acid sequence SEQ ID NO. 363 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology thereto. In one embodiment, the family 9 or family 9-like sequence comprises a binding molecule comprising or consisting of at least one immunoglobulin single domain antibody capable of binding PSMA wherein said domain is a human VH domain and wherein said PSMA binding molecule comprises at least one antigen binding site comprising hypervariable regions CDR1, CDR2 and CDR3, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 365 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 366 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, and said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 367 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto.
In one embodiment, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 365 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 366 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 367 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, the CDR sequences of the VH domain are as shown for clone 9.1 as in
In one embodiment, the VH domain comprises or consists of SEQ ID NO. 368 or a sequence with at least 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto.
In another embodiment, the VH domain is selected from one of the sequences above, but comprises one or more amino acid substitutions, for example 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions. In one embodiment, the one or more amino acid substitution is in one or more of the framework areas. In another embodiment, the one or more amino acid substitution is in one or more of the CDRs. In one embodiment, the amino acid substitutions are in the framework and CDR sequences.
The family 9 or family 9-like binding molecules have KD, Koff, KA, Kd, EC50 and IC50 values as further described herein and as shown in the examples.
In one aspect, the invention relates to a binding molecule capable of binding human PSMA comprising a human VH domain comprising a family 10 or family 10-like sequence.
In one embodiment, two VH domains comprising a family 10 or a family-10 like sequence may be combined for a bivalent binding molecule. In another embodiment, one VH domain comprising a family 10 or a family-10 like sequence may be combined with a second VH domain as described herein that binds to the same a epitope, part, domain, subunit or confirmation of PSMA for a bivalent binding molecule. The second VH domain may be selected from a family 2, 3, 4, 7, 9, 10, 11 or a family 2, 3, 4, 7, 9, 10, 11-like sequence.
In one embodiment, one VH domain comprising a family 10 or a family-10 like sequence may be combined with a second VH domain as described herein that binds to a different epitope, part, domain, subunit or confirmation of PSMA for a biparatopic binding molecule. The second VH domain may be selected from a family 1, 5, 6, 12 or 13 or a family 1, 5, 6, 12 or 13-like sequence. A family 10 or family 10 sequence includes the parent sequence and sequences that are derived from the parent (10.1) or a part thereof, for example a CDR3 sequence, and VH sequences of or parts thereof that are derived from the parent 10.1 through a process of optimization, CDR sequences and full length sequences of 10.1 in are numbered according to Table 10 as shown below.
In one aspect, the invention relates to a family 10 or family 10-like binding molecule comprising a human VH domain comprising a CDR3 sequence comprising SEQ ID NO. 371 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology to SEQ ID NO. 371.
In one embodiment, the family 10 or family 10-like binding molecule comprises at least one immunoglobulin single domain antibody capable of binding PSMA wherein said domain is a human VH domain and wherein said human VH domain comprises at least one antigen binding site comprising a CDR3 sequence comprising SEQ ID NO. 371 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology to SEQ ID NO. 371. In one embodiment, homology is at least 90%. In one embodiment, the VH domain comprises a CDR3 of SEQ ID NO. 371.
In one embodiment, said VH domain and wherein said PSMA binding molecule comprises at least one antigen binding site comprising hypervariable regions CDR1, CDR2 and CDR3, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 369 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 370 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, and said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 371 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto.
In one embodiment, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 369 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 370 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 371 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, the CDR sequences of the VH domain are as shown for clone 10.1 as in
In one embodiment, the VH domain comprises or consists of SEQ ID NO. 372 or a sequence with at least 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto.
In another embodiment, the VH domain is selected from one of the sequences above, but comprises one or more amino acid substitutions, for example 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions. In one embodiment, the one or more amino acid substitution is in one or more of the framework areas. In another embodiment, the one or more amino acid substitution is in one or more of the CDRs. In one embodiment, the amino acid substitutions are in the framework and CDR sequences.
The family 10 or family 10-like binding molecules have KD, Koff, KA, Kd, EC50 and IC50 values as further described herein and as shown in the examples.
In one aspect, the invention relates to a binding molecule capable of binding human PSMA comprising a VH domain comprising a family 11 or family 11-like sequence. In one embodiment, two VH domains comprising a family 11 or a family-11 like sequence may be combined for a bivalent binding molecule. In another embodiment, one VH domain comprising a family 11 or a family-11 like sequence may be combined with a second VH domain as described herein that binds to the same a epitope, part, domain, subunit or confirmation of PSMA for a bivalent binding molecule. The second VH domain may be selected from a family 2, 3, 4, 7, 9, 10, 11 or a family 2, 3, 4, 7, 9, 10, 11-like sequence.
In one embodiment, one VH domain comprising a family 11 or a family-11 like sequence may be combined with a second VH domain as described herein that binds to a different epitope, part, domain, subunit or confirmation of PSMA for a biparatopic binding molecule. The second VH domain may be selected from a family 1, 5, 6, 12 or 13 or a family 1, 5, 6, 12 or 13-like sequence.
A family 11 or family 11 sequence includes the parent sequence and sequences that are derived from the parent (11.1, SEQ ID NO. 376) or a part thereof, for example a CDR3 sequence, and VH sequences or parts thereof that are derived from the parent 11.1 through a process of optimization, CDR sequences and full-length sequences of 11.1 in are numbered according to Table 11 as shown below.
In one embodiment, the VH domain comprises at least one antigen binding site comprising a CDR3 sequence comprising SEQ ID NO. 375 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology to SEQ ID NO. 375. In one embodiment, homology is at least 90%. In one embodiment, the VH domain comprises a CDR3 of SEQ ID NO. 375.
In one embodiment, the single VH domain antibody comprises at least one antigen binding site comprising hypervariable region CDR3 said CDR3 having the amino acid sequence SEQ ID NO. 375 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology thereto. In one embodiment, the family 11 or family 11-like sequence comprises a binding molecule comprising or consisting of at least one immunoglobulin single domain antibody capable of binding PSMA wherein said domain is a human VH domain and wherein said PSMA binding molecule comprises at least one antigen binding site comprising hypervariable regions CDR1, CDR2 and CDR3, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 373 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 374 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, and said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 375 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto.
In one embodiment, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 373 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 374 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 375 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, the CDR sequences of the VH domain are as shown for sdAb 11.1 as in
In one embodiment, the VH domain comprises or consists of SEQ ID NO. 376 or a sequence with at least 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto.
In another embodiment, the VH domain is selected from one of the sequences above, but comprises one or more amino acid substitutions, for example 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions. In one embodiment, the one or more amino acid substitution is in one or more of the framework areas. In another embodiment, the one or more amino acid substitution is in one or more of the CDRs. In one embodiment, the amino acid substitutions are in the framework and CDR sequences.
The family 11 or family 11-like binding molecules have KD, Koff, KA, Kd, EC50 and IC50 values as further described herein and as shown in the examples.
In one aspect, the invention relates to a binding molecule capable of binding human PSMA comprising a human VH domain comprising a family 12 or family 12-like sequence. In one embodiment, two VH domains comprising a family 12 or a family-12 like sequence may be combined for a bivalent binding molecule. In another embodiment, one VH domain comprising a family 12 or a family-12 like sequence may be combined with a second VH domain as described herein that binds to the same a epitope, part, domain, subunit or confirmation of PSMA for a bivalent binding molecule. The second VH domain may be selected from family 1, 5, 6, 12 or 13 or family 1, 5, 6, 12 or 13-like sequence.
In one embodiment, one VH domain comprising a family 12 or a family-12 like sequence may be combined with a second VH domain as described herein that binds to a different epitope, part, domain, subunit or confirmation of PSMA for a biparatopic binding molecule. The second VH domain may be selected from a family 2, 3, 4, 7, 9, 10, 11 or 14 or a family 2, 3, 4, 7, 9, 10, 11 or 14-like sequence.
A family 12 or family 12-like sequence includes the parent sequence and sequences that are derived from the parent (12.1, SEQ ID NO. 380) or a part thereof, for example a CDR3 sequence, and VH sequences or parts thereof that are derived from the parent 12.1 through a process of optimization, CDR sequences and full-length sequences of 12.1 in are numbered according to Table 12 as shown below.
In one embodiment, the VH domain comprises at least one antigen binding site comprising a CDR3 sequence comprising SEQ ID NO. 379 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology to SEQ ID NO. 379. In one embodiment, homology is at least 90%. In one embodiment, the VH domain comprises a CDR3 of SEQ ID NO. 379.
In one embodiment, the single VH domain antibody comprises at least one antigen binding site comprising hypervariable region CDR3 said CDR3 having the amino acid sequence SEQ ID NO. 379 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology thereto. In one embodiment, the family 12 or family 12-like sequence comprises a binding molecule comprising or consisting of at least one immunoglobulin single domain antibody capable of binding PSMA wherein said domain is a human VH domain and wherein said PSMA binding molecule comprises at least one antigen binding site comprising hypervariable regions CDR1, CDR2 and CDR3, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 377 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 378 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, and said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 379 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto.
In one embodiment, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 377 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 378 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 379 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, the CDR sequences of the VH domain are as shown for clone 12.1 as in
In one embodiment, the VH domain comprises or consists of SEQ ID NO. 380 or a sequence with at least 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto.
In another embodiment, the VH domain is selected from one of the sequences above, but comprises one or more amino acid substitutions, for example 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions. In one embodiment, the one or more amino acid substitution is in one or more of the framework areas. In another embodiment, the one or more amino acid substitution is in one or more of the CDRs. In one embodiment, the amino acid substitutions are in the framework and CDR sequences.
The family 12 or family 12-like binding molecules have KD, Koff, KA, Kd, EC50 and IC50 values as further described herein and as shown in the examples
In one aspect, the invention relates to a binding molecule capable of binding human PSMA comprising a human VH domain comprising a family 13 or family 13-like sequence. In one embodiment, two VH domains comprising a family 13 or a family-13 like sequence may be combined for a bivalent binding molecule. In another embodiment, one VH domain comprising a family 13 or a family-13 like sequence may be combined with a second VH domain as described herein that binds to the same a epitope, part, domain, subunit or confirmation of PSMA for a bivalent binding molecule. The second VH domain may be selected from family 1, 5, 6, 12 or 13 or family 1, 5, 6, 12 or 13-like sequence.
In one embodiment, one VH domain comprising a family 13 or a family-13 like sequence may be combined with a second VH domain as described herein that binds to a different epitope, part, domain, subunit or confirmation of PSMA for a biparatopic binding molecule. The second VH domain may be selected from a family 2, 3, 4, 7, 9, 10, 11 or 14 or a family 2, 3, 4, 7, 9, 10, 11 or 14-like sequence.
A family 13 or family-like 13 sequence includes the parent sequence and sequences that are derived from the parent (13.1, SEQ ID NO. 384) or a part thereof, for example a CDR3 sequence, and VH sequences of clones or parts thereof that are derived from the parent 13.1 through a process of optimization, CDR sequences and full-length sequences of 13.1 in are numbered according to Table 13 as shown below.
In one embodiment, the VH domain comprises at least one antigen binding site comprising a CDR3 sequence comprising SEQ ID NO. 383 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology to SEQ ID NO. 383. In one embodiment, homology is at least 90%. In one embodiment, the VH domain comprises a CDR3 of SEQ ID NO. 383.
In one embodiment, the single VH domain antibody comprises at least one antigen binding site comprising hypervariable region CDR3 said CDR3 having the amino acid sequence SEQ ID NO. 383 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology thereto. In one embodiment, the family 13 or family 13-like sequence comprises a binding molecule comprising or consisting of at least one immunoglobulin single domain antibody capable of binding PSMA wherein said domain is a human VH domain and wherein said PSMA binding molecule comprises at least one antigen binding site comprising hypervariable regions CDR1, CDR2 and CDR3, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 381 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 382 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, and said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 383 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto.
In one embodiment, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 381 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 382 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 383 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, the CDR sequences of the VH domain are as shown for clone 13.1 as in
In one embodiment, the VH domain comprises or consists of SEQ ID NO. 384 or a sequence with at least 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto.
In another embodiment, the VH domain is selected from one of the sequences above, but comprises one or more amino acid substitutions, for example 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions. In one embodiment, the one or more amino acid substitution is in one or more of the framework areas. In another embodiment, the one or more amino acid substitution is in one or more of the CDRs. In one embodiment, the amino acid substitutions are in the framework and CDR sequences.
The family 13 or family 13-like binding molecules have KD, Koff, KA, Kd, EC50 and IC50 values as further described herein and as shown in the examples
In one aspect, the invention relates to a binding molecule capable of binding human PSMA comprising a human VH domain comprising a family 14 or family 14-like sequence. In one embodiment, two VH domains comprising a family 14 or a family-14 like sequence may be combined for a bivalent binding molecule. In another embodiment, one VH domain comprising a family 14 or a family-14 like sequence may be combined with a second VH domain as described herein that binds to the same a epitope, part, domain, subunit or confirmation of PSMA for a bivalent binding molecule. The second VH domain may be selected from a family 2, 3, 4, 7, 9, 10, 11 or a family 2, 3, 4, 7, 9, 10, 11-like sequence.
In one embodiment, one VH domain comprising a family 14 or a family-14 like sequence may be combined with a second VH domain as described herein that binds to a different epitope, part, domain, subunit or confirmation of PSMA for a biparatopic binding molecule. The second VH domain may be selected from a family 1, 5, 6, 12 or 13 or a family 1, 5, 6, 12 or 13-like sequence.
A family 14 or family 14 sequence includes the parent sequence and sequences of clones that are derived from the parent (14.1) or a part thereof, for example a CDR3 sequence, and VH sequences or parts thereof that are derived from the parent 14.1 through a process of optimization, CDR sequences and full-length sequences of 14.1 in are numbered according to Table 14 as shown below.
In one embodiment, the VH domain comprises at least one antigen binding site comprising a CDR3 sequence comprising SEQ ID NO. 387 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology to SEQ ID NO. 387. In one embodiment, homology is at least 90%. In one embodiment, the VH domain comprises a CDR3 of SEQ ID NO. 387.
In one embodiment, the single VH domain antibody comprises at least one antigen binding site comprising hypervariable region CDR3 said CDR3 having the amino acid sequence SEQ ID NO. 385 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology thereto. In one embodiment, the family 14 or family 14-like sequence comprises a binding molecule comprising or consisting of at least one immunoglobulin single domain antibody capable of binding PSMA wherein said domain is a human VH domain and wherein said PSMA binding molecule comprises at least one antigen binding site comprising hypervariable regions CDR1, CDR2 and CDR3, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 385 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 386 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, and said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 387 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto.
In one embodiment, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 385 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 386 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 387 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, the CDR sequences of the VH domain are as shown for clone 14.1 as in
In one embodiment, the VH domain comprises or consists of SEQ ID NO. 388 or a sequence with at least 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto.
In another embodiment, the VH domain is selected from one of the sequences above, but comprises one or more amino acid substitutions, for example 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions. In one embodiment, the one or more amino acid substitution is in one or more of the framework areas. In another embodiment, the one or more amino acid substitution is in one or more of the CDRs. In one embodiment, the amino acid substitutions are in the framework and CDR sequences.
The family 14 or family 14-like binding molecules have KD, Koff, KA, Kd, EC50 and IC50 values as further described herein and as shown in the examples
In one aspect, the invention relates to a binding molecule capable of binding human PSMA comprising a human VH domain comprising a family 15 or family 15-like sequence. In one embodiment, the binding molecule comprises at least two one single VH domain antibodies capable of binding PSMA, preferably human PSMA, of family 15 or family 15 sequence.
Family 15 single VH domain antibodies include the parent sequence and sequences that are derived from the parent (15.1) or a part thereof, for example a CDR3 sequence, and VH sequences or parts thereof that are derived from the parent 15.1 through a process of optimization, CDR sequences and full-length sequences of 15.1 in are numbered according to Table 15 as shown below.
In one embodiment, the VH domain comprises at least one antigen binding site comprising a CDR3 sequence comprising SEQ ID NO. 391 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology to SEQ ID NO. 391. In one embodiment, homology is at least 90%. In one embodiment, the VH domain comprises a CDR3 of SEQ ID NO. 391.
In one embodiment, the single VH domain antibody comprises at least one antigen binding site comprising hypervariable region CDR3 said CDR3 having the amino acid sequence SEQ ID NO. 391 or a sequence having at least 70%, at least 80%, at least 90%, or at least 95% homology thereto. In one embodiment, the family 15 or family 15-like sequence comprises a binding molecule comprising or consisting of at least one immunoglobulin single domain antibody capable of binding PSMA wherein said domain is a human VH domain and wherein said PSMA binding molecule comprises at least one antigen binding site comprising hypervariable regions CDR1, CDR2 and CDR3, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 389 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 390 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto, and said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 391 or a sequence with at least 70%, at least 80%, at least 90%, or at least 95% homology thereto.
In one embodiment, said CDR1 comprises or consists of the amino acid sequence SEQ ID NO. 389 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR2 comprises or consists of the amino acid sequence SEQ ID NO. 390 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, said CDR3 comprises or consists of the amino acid sequence SEQ ID NO. 391 or a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto. In one embodiment, the CDR sequences of the VH domain are as shown for clone 15.1 as in
In one embodiment, the VH domain comprises or consists of SEQ ID NO. 392 or a sequence with at least 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology thereto.
In another embodiment, the VH domain is selected from one of the sequences above, but comprises one or more amino acid substitutions, for example 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions. In one embodiment, the one or more amino acid substitution is in one or more of the framework areas. In another embodiment, the one or more amino acid substitution is in one or more of the CDRs. In one embodiment, the amino acid substitutions are in the framework and CDR sequences.
The family 15 or family 15-like binding molecules have KD, Koff, KA, Kd, EC50 and IC50 values as further described herein and as shown in the examples
In one aspect, the single VH domain antibody comprises a CDR3 sequence selected from a family 1 or family 1-like, family 2 or family 2-like, family 3 or family 3-like, family 4 or family 4-like, family 5 or family 5-like, family 6 or family 6-like, family 7 or family 7-like, family 8 or family 8-like, family 9 or family 9-like, family 10 or family 10-like, family 11 or family 11-like, family 12 or family 12-like, family 13 or family 13-like, family 14 or family 14-like or a family 15 or family 15-like CDR3 sequence combined with a CDR1 and CDR2 sequence from another family listed herein.
For example, the single VH domain antibody comprises a family 1 or family 1-like CDR3 sequence combined with a CDR1 and a CDR2 sequence from one or two other families as shown in any of Tables 2 to 15.
In another aspect, the single VH domain antibody comprises a family 2 or family 2-like CDR3 sequence combined with a CDR1 and a CDR2 sequence from one or two other families as shown in any of Tables 1, 3 to 15. Various combinations are possible as would be appreciated by a skilled person.
In another aspect, the single VH domain antibody comprises a family 3 or family 3-like CDR3 sequence combined with a CDR1 and a CDR2 sequence from one or two other families as shown in any of Tables 1, 2, 4 to 15. Various combinations are possible as would be appreciated by a skilled person.
In another aspect, the single VH domain antibody comprises a family 4 or family 4-like CDR3 sequence combined with a CDR1 and a CDR2 sequence from one or two other families as shown in Table 1 any of Tables 1 to 3, 5 to 15. Various combinations are possible as would be appreciated by a skilled person.
In another aspect, the single VH domain antibody comprises a family 5 or family 5-like CDR3 sequence combined with a CDR1 and a CDR2 sequence from one or two other families as shown in any of Tables 1 to 4, 6 to 15. Various combinations are possible as would be appreciated by a skilled person.
In another aspect, the single VH domain antibody comprises a family 6 or family 6-like CDR3 sequence combined with a CDR1 and a CDR2 sequence from one or two other families as shown in any of Tables 1 to 5, 7 to 15. Various combinations are possible as would be appreciated by a skilled person.
In another aspect, the single VH domain antibody comprises a family 7 or family 7-like CDR3 sequence combined with a CDR1 and a CDR2 sequence from one or two other families as shown in any of Tables 1 to 6, 8 to 15. Various combinations are possible as would be appreciated by a skilled person.
In another aspect, the single VH domain antibody comprises a family 8 or family 8-like CDR3 sequence combined with a CDR1 and a CDR2 sequence from one or two other families as shown in any of Tables 1 to 7, 9 to 15. Various combinations are possible as would be appreciated by a skilled person.
In another aspect, the single VH domain antibody comprises a family 9 or family 9-like CDR3 sequence combined with a CDR1 and a CDR2 sequence from one or two other families as shown in any of Tables 1 to 8, 10 to 15. Various combinations are possible as would be appreciated by a skilled person.
In another aspect, the single VH domain antibody comprises a family 10 family 10-like CDR3 sequence combined with a CDR1 and a CDR2 sequence from one or two other families as shown in any of Tables 1 to 4, 11 to 15. Various combinations are possible as would be appreciated by a skilled person.
In another aspect, the single VH domain antibody comprises a family 11 or family 11-like CDR3 sequence combined with a CDR1 and a CDR2 sequence from one or two other families as shown in any of Tables 1 to 10, 12 to 15. Various combinations are possible as would be appreciated by a skilled person.
In another aspect, the single VH domain antibody comprises a family 12 or family 12-like CDR3 sequence combined with a CDR1 and a CDR2 sequence from one or two other families as shown in any of Tables 1 to 11, 13 to 15. Various combinations are possible as would be appreciated by a skilled person.
In another aspect, the single VH domain antibody comprises a family 13 or family 13-like CDR3 sequence combined with a CDR1 and a CDR2 sequence from one or two other families as shown in any of Tables 1 to 12, 14 to 15. Various combinations are possible as would be appreciated by a skilled person.
In another aspect, the single VH domain antibody comprises a family 15 or family 15-like CDR3 sequence combined with a CDR1 and a CDR2 sequence from one or two other families as shown in any of Tables 1 to 14. Various combinations are possible as would be appreciated by a skilled person.
The invention also relates to a binding molecule comprising a first VH domain selected from one of the VH domains described above and listed in any of Tables 1 to 15 linked to a second VH domain selected from a described above and listed in any of Tables 1 to 15 wherein said first VH domain competes for binding to PSMA with the second VH domain in a competitive assay.
The invention also relates to a binding molecule comprising a first VH domain selected from one of the VH domains described above and listed in any of Tables 1 to 15 linked to a second VH domain selected from a described above and listed in any of Tables 1 to 15 wherein said first VH domain does not compete for binding to PSMA with the second VH domain in a competitive assay.
In preferred embodiment, the binding molecule is biparatopic or multiparatopic and comprises a first single VH domain antibody selected from single domain antibodies 1.1 to 1.20 as shown in Table 1, and a second single VH domain antibody selected from 2.1 to 2.25 as shown in Table 2. For example, the first single VH domain antibody is selected from single domain antibodies 1.1, 1.8-1.20 as shown in Table 1, and a second single VH domain antibody is selected from 2.1, 2.2, 2.11-2.19, 2.22-2.25 as shown in Table 2. In another embodiment, the binding molecule comprises a first single domain antibody selected from single domain antibodies 2.1 to 2.25 as shown in Table 2 and a second VH single domain antibody selected from 1.1 to 1.20 as shown in Table 1. For example, the first single VH domain antibody is selected from single domain antibodies 2.1, 2.2, 2.11-2.19, 2.22-2.25 as shown in Table 2, and the second single VH domain antibody is selected from 1.1, 1.8-1.20 as shown in Table 1. Single domain antibodies are linked with a (G4S)n linker, preferably a (G4S)n. In further preferred embodiments, the binding molecules is selected from a binding molecule that comprises the following components: single VH domain antibody-linker-single VH domain antibody as follows:
1.1-6GS-2.1, 1.8-6GS-2.1, 1.1-6GS-2.17, 1.1-6GS-2.15, 1.1-6GS-2.22, 1.16-6GS-2.1, 1.16-6GS-2.17, 1.16-6GS-2.15, 1.16-6GS-2.22, 1.11-6GS-2.1, 1.11-6GS-2.17, 1.11-6GS-2.15, 1.11-6GS-2.22, 1.18-6GS-2.1, 1.18-6GS-2.17, 1.18-6GS-2.15, 1.18-6GS-2.22, 1.17-6GS-2.1, 1.17-6GS-2.17, 1.17-6GS-2.15 or 1.17-6GS-2.22.
In another embodiment, single VH domain antibodies as described above can be replaced with
binding molecules, e.g. antibodies, antibody fragments or antibody mimetics, that bind to the same epitope on human PSMA as a single domain antibodies (i.e., antibodies that have the ability to cross-compete for binding to PSMA with any of the single domain antibodies described herein). The single domain antibodies described herein can thus be used as a reference antibody. In preferred embodiments, the reference antibody for cross-competition studies is single domain antibody 1.1, 2.1, 3.1, 4.1, 5.1, 6.1, 7.1, 8.1, 9.1, 10.1, 11.1, 12.1, 13.1, 14.1 or 15.1. Such cross-competing antibodies can be identified based on their ability to cross-compete with any of single domain antibodies described herein in standard PSMA binding assays. For example, BIAcore® analysis, ELISA assays or flow cytometry may be used to demonstrate cross-competition with the single domain antibodies of the current invention. In one embodiment, the invention provides a binding agent capable of binding human PSMA wherein any one of the single domain antibodies described above displaces the binding agent in a competitive assay.
A binding molecule described herein may be provided as a fusion protein with one or more additional protein moiety.
The second moiety may comprise a VH domain that is also specific for human PSMA thus providing a bivalent binding molecule. In one embodiment, the binding molecule is biparatopic. Biparatopic binding molecules comprise antigen-binding moieties that bind to different epitopes. Biparatopic binding molecules of the present invention can be constructed using methods known art.
Suitable linkers to connect the moieties of the binding molecule include peptide linker, for example linkers that include GS residues such as (Gly4Ser)n, where n=from 1 to 10, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. As used herein, GS designates Gly4Ser. (Gly4Ser)n is also expressed as nGS herein.
In another embodiment, the binding molecule may comprise a further moiety that is specific for a different antigen to provide a bispecific binding molecule. As used herein, the term “bispecific binding molecule” thus refers to a polypeptide that comprises a binding molecule as described herein which has a binding site that has binding specificity for PSMA, and a second polypeptide domain which has a binding site that has binding specificity for a second target, i.e., the bispecific binding molecule has specificity for two targets. The first target and the second target are not the same, i.e. are different targets, e.g., proteins; both may be present on a cell surface. Accordingly, a bispecific binding molecule as described herein can selectively and specifically bind to a cell that expresses (or displays on its cell surface) the first target and the second target. In another embodiment, the binding molecule comprises more than two antigen-binding moieties.
In another embodiment, more than two moieties are joined together providing a multispecific binding molecule. A multispecific polypeptide agent as described herein can in addition to binding PSMA bind one or more additional targets, i.e., a multispecific polypeptide can bind at least two, at least three, at least four, at least five, at least six, or more targets, wherein the multispecific polypeptide agent has at least two, at least, at least three, at least four, at least five, at least six, or more target binding sites respectively.
As used herein, the term “target” refers to a biological molecule (e.g., antigen, peptide, polypeptide, protein, lipid, carbohydrate) to which a polypeptide domain which has a binding site can selectively bind. The target can be, for example, an intracellular target (such as an intracellular protein target) or a cell-surface target (such as a membrane protein, e.g., a receptor protein). Preferably, a target is a cell-surface target, such as a cell-surface protein. Preferably, the first cell-surface target and second cell-surface target are both present on a cell. In one embodiment, the target is an immunooncology target.
Multispecific antibodies of the present invention can be constructed using methods known art.
If desired, bispecific or multispecific binding molecules can be linked to an antibody Fc region or fragment thereof, comprising one or both of CH2 and CH3 domains, and optionally a hinge region. For example, vectors encoding bispecific or multispecific binding molecules linked as a single nucleotide sequence to an Fc region or fragment thereof can be used to prepare such polypeptides.
In one embodiment, the further moiety may serve to prolong the half-life of the binding molecule. The second moiety may comprise a protein, for example and antibody, or part thereof that binds a serum albumin, e.g., human serum albumin (HSA) or mouse serum albumin (MSA). The further moiety may comprise a VH domain that binds serum albumin, e.g., human serum albumin (HSA) or mouse serum albumin (MSA).
The further moiety may comprise a serum albumin, e.g. a human serum albumin (HSA) or a variant thereof such as HSA C34S. Further provided is binding molecule as described herein comprising a VH domain and an Fc domain, e.g., wherein the VH domain is fused to an Fc domain. Further provided is a binding molecule that comprises a second variable domain that specifically binds a second antigen, where the second antigen is an antigen other than human PSMA. The second antigen may be a cluster of differentiation (CD) molecule or a Major Histocompatibility Complex (MHC) Class II molecule.
In one embodiment, the binding molecule of the invention is labelled with a detectable or functional label. A label can be any molecule that produces or can be induced to produce a signal, including but not limited to fluorescers, radiolabels, enzymes, chemiluminescers, a nuclear magnetic resonance active label or photosensitizers. Thus, the binding may be detected and/or measured by detecting fluorescence or luminescence, radioactivity, enzyme activity or light absorbance.
In still other embodiments, the binding molecule of the invention is coupled to at least one therapeutic moiety, such as a drug, an enzyme or a toxin. In one embodiment, the therapeutic moiety is a toxin, for example a cytotoxic radionuclide, chemical toxin or protein toxin. For example, the PSMA binding molecule of the invention, can be coupled to a radioactive isotope such as an α-, β-, or γ-emitter, or a β- and γ-emitter.
The toxin may be selected from calicheamicin, esperamicin, methotrexate, doxorubicin, melphalan, chlorambucil, ARA-C, vindesine, mitomycin C, cis-platinum, etoposide, bleomycin, 5-fluorouracil, estramustine, vincristine, etoposide, doxorubicin, paclitaxel, docetaxel, dolastatin 10, auristatin E and auristatin PHE. In other embodiments, the therapeutic moiety is an immunostimulatory or immunomodulating agent.
In one aspect, the invention provides an immunoconjugate comprising more than one single VH domain antibody described herein.
Toxin-conjugated forms of the PSMA binding molecules of the present invention preferably mediate specific cell killing of PSMA-expressing cells at picomolar concentrations.
In another aspect, the PSMA binding molecules of the invention are modified to increase half-life, for example by a chemical modification, especially by PEGylation, or by incorporation in a liposome or using a serum albumin protein.
In one embodiment, the binding molecule of the invention is covalently modified. The term “covalently modified/covalent modification” includes modifications of a binding molecule according to the present invention, e.g., of a specified sequence herein; with an organic proteinaceous or non-proteinaceous derivatizing agent, fusions to heterologous polypeptide sequences, and post-translational modifications. Covalent modified polypeptides, e.g., of a specified sequence, still have the functional properties described herein, for example the ability to bind the human PSMA or, Covalent modifications are generally introduced by reacting targeted amino acid residues with an organic derivatizing agent that is capable of reacting with selected side chains or terminal residues, or by harnessing mechanisms of post-translational modifications that function in selected recombinant host cells. Certain post-translational modifications are the result of the action of recombinant host cells on the expressed polypeptide. Glutaminyl and asparaginyl residues are frequently post-translationally deamidated to the corresponding glutamyl and aspartyl residues. Alternatively, these residues are deaminated under mildly acidic conditions. Other post-translational modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl, tyrosine or threonyl residues, methylation of the [alpha]-amino groups of lysine, arginine, and histidine side chains. Covalent modifications, e.g., include fusion proteins comprising a PSMA binding molecule according to the present invention, e.g., of a specified sequence and their amino acid sequence variants, such as immunoadhesins, and N-terminal fusions to heterologous signal sequences.
The binding molecules of the invention have certain functional properties as further described below. These and other pharmacological activities of the binding molecules of the invention may be demonstrated in standard test methods for example as described in the art.
The binding molecules of the invention can be internalised into a cell along with the prostate-specific membrane antigen. Binding molecules of the invention bind specifically to epitopes on the extracellular domain of human PSMA. In one embodiment, binding molecules of the invention specifically bind PSMA in its dimeric form. Binding molecules of the invention can be conjugated to a toxic moiety and used to ablate or kill PSMA-expressing prostatic or cancerous cells.
Binding molecules of the invention can bind live cells, such as a tumor cell or a prostate cell, such as human PSMA expressing CHO cells, LNCaP cells as shown in the examples and accompanying Tables. In a further aspect, the present invention provides single domain antibodies that bind to PSMA with an EC50 value of between 100 nM and 100 pM, such as at an average EC50 value of 100 nM or less, even more preferably at an average EC50 value of 90 nM or less, such as less than 80, 70, 60, 50, 40, 30, 20, 10, 5 nM or even less, such as less than 4, 3, 2, or 1 nM or even less, such as less than 500, 400, 300, 200, 100 pM, or even less, such as less than 4 pM, preferably as measured in a FMAT binding assay. In particular, EC50 values are shown in Table 19. In one embodiment, binding molecules of the invention are capable of binding specifically to human PSMA and to cynomolgus monkey PSMA.
Potency is normally expressed as an IC50 value, in nM unless otherwise stated. In functional assays, IC50 is the concentration of a binding member that reduces a biological response by 50% of its maximum. IC50 may be calculated by plotting % of maximal biological response as a function of the log of the binding member concentration, and using a software program to fit a sigmoidal function to the data to generate IC50 values. Methods for measuring IC50 are well known in the art. For example, to determine the IC50, a HIS ZAP Cell Killing assay may be employed to determine IC50. EC50 designates the half maximal effective concentration.
In another aspect, the invention relates to a binding molecule comprising or consisting of at least one immunoglobulin single domain antibody directed against PSMA, preferably human PSMA, wherein said domain is a human VH domain and has an IC50 of about 0.2 to about 1000 nM or more, for example 0.2 to 900, 0.2 to 800, 0.2 to 700, 0.2 to 600, 0.2 to 500, 0.2 to 400, 0.2 to 300, 0.2 to 200, 0.2 to 100, 0.2 to 50, 0.2 to 40, 0.2 to 30, 0.2 to 20, 0.2 to 10, 0.2 to 9, 0.2 to 8, 0.2 to 7, 0.2 to 6, 0.2 to 5, 0.2 to 4, 0.2 to 3, 0.2 to 2 or 0.2 to 1 when tested as described in the examples.
Additionally, binding kinetics and affinity (expressed as the equilibrium dissociation constant, KD) of PSMA binding molecules of the invention for binding PSMA may be determined, e.g., using surface plasmon resonance such as BIAcore® or Octet, or KD may be estimated from pA2 analysis. In particular, the molecules of the invention are very potent (i.e., EC50 values as measured, e.g., in the experimental part in the pM range).
In a further aspect, the present invention provides a single domain antibody as described herein, wherein said sdAb binds to said PSMA with an average KD value of between 100 nM and 10 pM, such as at an average KD value of 90 nM or less, even more preferably at an average KD value of 80 nM or less, such as less than 70, 60, 50, 40, 30, 20, 10, 5 nM or even less, such as less than 4, 3, 2, or 1 nM, such as less than 500, 400, 300, 200, 100, 90, 80, 70, 60, 50, 40, 30, 20 pM, or even less such, as less than 10 pM. Preferably, the KD is determined as shown in the examples.
In one embodiment, a binding molecule according to the invention has a binding affinity to PSMA with an affinity constant of at least about 107 M−1, preferably about 109 M−1, and more preferably, about 1010 M−1 to 1011 M−1 or higher. In one embodiment, a binding molecule according to the invention has a Kon of 1.00E+04 to 1.00E+6 (1/Ms). In one embodiment, a binding molecule according to the invention has Koff of 1.00E-03 to 1.00E-05 (1/s).
Binding molecules of the invention have shown excellent stability, including heat and serum stability (see examples). Furthermore, binding molecules of the invention show rapid tumor targeting as shown in the examples. Furthermore, binding molecules of the invention also show high specificity for human PSMA and low uptake in non-target tissues (see examples).
In one embodiment, binding molecules of the invention show fast blood clearance. In one embodiment, binding molecules of the invention show low renal retention. In one embodiment, binding molecules can inhibit, e.g., competitively inhibit, the binding of another antibody e.g., J591, to human PSMA.
In one embodiment, a binding molecule of the invention may have one or more property select from the following non-limiting list:
The present invention further provides an isolated nucleic acid encoding a binding molecule of the present invention. Nucleic acid may include DNA and/or RNA. In one aspect, the present invention provides a nucleic acid that codes for a CDR or set of CDRs or a VH domain as defined above.
The nucleic acid of the single domain antibodies described herein are set out below. These can be combined using linkers described herein to generate a nucleic acid construct for expression.
Sequences comprising or consisting of SEQ ID NOs. 393 to 410 as shown below which encode VH domains of family 1 comprising or consisting of SEQ ID NO. 4 to 80.
A nucleic acid according to the present invention may comprise DNA or RNA and may be wholly or partially synthetic or recombinantly produced. Reference to a nucleotide sequence as set out herein encompasses a DNA molecule with the specified sequence, and encompasses a RNA molecule with the specified sequence in which U is substituted for T, unless context requires otherwise.
The nucleic acid may be in the form of a construct, for example a plasmid, vector, transcription or expression cassette.
The invention also relates to an isolated recombinant host cell comprising one or more nucleic acid construct as described above. The host cell may be a bacterial, viral, mammalian or other suitable host cell. In one embodiment, the cell is an E. coli cell. In another embodiment, the cell is a yeast cell. In another embodiment, the cell is a Chinese Hamster Ovary (CHO) cell.
Methods for preparing or generating the polypeptides, nucleic acids, host cells, products and compositions described herein using in vitro expression libraries can comprise the steps of:
In the above methods, the set, collection or library of amino acid sequences may be displayed on a phage, phagemid, ribosome or suitable micro-organism (such as yeast), such as to facilitate screening. Suitable methods, techniques and host organisms for displaying and screening (a set, collection or library of) amino acid sequences will be clear to the person skilled in the art (see for example Phage Display of Peptides and Proteins: A Laboratory Manual, Academic Press; 1st edition (Oct. 28, 1996) Brian K. Kay, Jill Winter, John McCafferty).
A binding molecule described herein, including a VH domain, can be expressed in a transgenic rodent. The transgenic rodent, for example a mouse, may have a reduced capacity to express endogenous antibody genes. Thus, in one embodiment, the rodent has a reduced capacity to express endogenous light and/or heavy chain antibody genes. The rodent may therefore comprise modifications to disrupt expression of endogenous light and/or heavy chain antibody genes so that no functional light and/or heavy chains are produced.
Human heavy chain only antibodies capable of binding human PSMA can be produced by a method comprising
VH domains can be produced by a method comprising
Further steps may include identifying a single VH domain antibody or heavy chain only antibody that binds to human PSMA, for example by using functional assays as shown in the examples.
In one embodiment, the rodent is a mouse. The mouse may comprise a non-functional endogenous lambda light chain locus. Thus, the mouse does not make a functional endogenous lambda light chain. In one embodiment, the lambda light chain locus is deleted in part or completely or rendered non-functional through insertion, inversion, a recombination event, gene editing or gene silencing. For example, at least the constant region genes C1, C2 and C3 may be deleted or rendered non-functional through insertion or other modification as described above. In one embodiment, the locus is functionally silenced so that the mouse does not make a functional lambda light chain.
Furthermore, the mouse may comprise a non-functional endogenous kappa light chain locus. Thus, the mouse does not make a functional endogenous kappa light chain. In one embodiment, the kappa light chain locus is deleted in part or completely or rendered non-functional through insertion, inversion, a recombination event, gene editing or gene silencing. In one embodiment, the locus is functionally silenced so that the mouse does not make a functional kappa light chain.
The mouse having functionally-silenced endogenous lambda and kappa L-chain loci may, for example, be made as disclosed in WO 2003/000737, which is hereby incorporated by reference in its entirety.
Furthermore, the mouse may comprise a non-functional endogenous heavy chain locus. Thus, the mouse does not make a functional endogenous heavy chain. In one embodiment, the heavy chain locus is deleted in part or completely or rendered non-functional through insertion, inversion, a recombination event, gene editing or gene silencing. In one embodiment, the locus is functionally silenced so that the mouse does not make a functional heavy chain.
For example, as described in WO 2004/076618 (hereby incorporated by reference in its entirety), all 8 endogenous heavy chain constant region immunoglobulin genes (μ, δ, γ3, γ1, γ2a, γ2b, ε and α) are absent in the mouse, or partially absent to the extent that they are non-functional, or genes δ, γ3, γ1, γ2a, γ2b and ε are absent and the flanking genes μ and α are partially absent to the extent that they are rendered non-functional, or genes μ, 8, γ3, γ1, γ2a, γ2b and ε are absent and a is partially absent to the extent that it is rendered non-functional, or δ, γ3, γ1, γ2a, γ2b, ε and α are absent and μ is partially absent to the extent that it is rendered non-functional. By deletion in part is meant that the endogenous locus gene sequence has been deleted or disrupted, for example by an insertion, to the extent that no functional endogenous gene product is encoded by the locus, i.e., that no functional product is expressed from the locus. In another embodiment, the locus is functionally silenced.
In one embodiment, the mouse comprises a non-functional endogenous heavy chain locus, a non-functional endogenous lambda light chain locus and a non-functional endogenous kappa light chain locus. The mouse therefore does not produce any functional endogenous light or heavy chains. Thus, the mouse is a triple knockout (TKO) mouse.
The transgenic mouse may comprise a vector, for example a Yeast Artificial Chromosome (YAC) for expressing a heterologous heavy chain locus. YACs are vectors that can be employed for the cloning of very large DNA inserts in yeast. As well as comprising all three cis-acting structural elements essential for behaving like natural yeast chromosomes (an autonomously replicating sequence (ARS), a centromere (CEN) and two telomeres (TEL)), their capacity to accept large DNA inserts enables them to reach the minimum size (150 kb) required for chromosome-like stability and for fidelity of transmission in yeast cells. The construction and use of YACs is well known in the art (e.g., Bruschi, C. V. and Gjuracic, K. Yeast Artificial Chromosomes, Encyclopedia of Life Sciences, 2002 Macmillan Publishers Ltd, Nature Publishing Group/www.els.net).
For example, the YAC may comprise a plethora of human VH, D and J genes in combination with mouse immunoglobulin constant region genes lacking CH1 domains, mouse enhancer and regulatory regions.
Alternative methods known in the art may be used for deletion or inactivation of endogenous mouse or rat immunoglobulin genes and introduction of human VH, D and J genes in combination with mouse immunoglobulin constant region genes lacking CH1 domains, mouse enhancer and regulatory regions.
Transgenic mice can be created according to standard techniques as illustrated in the examples. The two most characterised routes for creating transgenic mice are via pronuclear microinjection of genetic material into freshly fertilised oocytes or via the introduction of stably transfected embryonic stem cells into morula or blastocyst stage embryos. Regardless of how the genetic material is introduced, the manipulated embryos are transferred to pseudo-pregnant female recipients where pregnancy continues and candidate transgenic pups are born.
The main differences between these broad methods are that ES clones can be screened extensively before their use to create a transgenic animal. In contrast, pronuclear microinjection relies on the genetic material integrating to the host genome after its introduction and, generally speaking, the successful incorporation of the transgene cannot be confirmed until after pups are born.
There are many methods known in the art to both assist with and determine whether successful integration of transgenes occurs. Transgenic animals can be generated by multiple means including random integration of the construct into the genome, site-specific integration, or homologous recombination. There are various tools and techniques that can be used to both drive and select for transgene integration and subsequent modification including the use of drug resistance markers (positive selection), recombinases, recombination-mediated cassette exchange, negative selection techniques, and nucleases to improve the efficiency of recombination. Most of these methods are commonly used in the modification of ES cells. However, some of the techniques may have utility for enhancing transgenesis mediated via pronuclear injection.
Further refinements can be used to give more efficient generation of the transgenic line within the desired background. As described above, in preferred embodiments, the endogenous mouse immunoglobulin expression is silenced to permit sole use of the introduced transgene for the expression of the heavy-chain only repertoire that can be exploited for drug discovery. Genetically-manipulated mice, for example TKO mice that are silenced for all endogenous immunoglobulin loci (mouse heavy chain, mouse kappa chain and mouse lambda chain) can be used as described above. The transfer of any introduced transgene to this TKO background can be achieved via breeding, (either conventional or with the inclusion of an IVF step to give efficient scaling of the process). However, it is also possible to include the TKO background during the transgenesis procedure. For example, for microinjection, the oocytes may be derived from TKO donors. Similarly, ES cells from TKO embryos can be derived for use in transgenesis. Triple knock-out mice into which transgenes have been introduced are referred to herein as TKO/Tg. In one embodiment, the mouse is as described in WO2016/062990.
In another aspect of the present invention, there is provided a pharmaceutical composition comprising a PSMA binding molecule according to the present invention and optionally a pharmaceutically acceptable carrier. The binding molecule of the present invention or compositions can be administered by any convenient route. The compounds may be administered by any route, including oral and parenteral administration. Parenteral administration includes, for example, intravenous, intramuscular, intraarterial, intraperitoneal, intranasal, rectal, intravesical, intradermal, topical or subcutaneous administration. Compositions can take the form of one or more dosage units.
The composition of the invention can be in the form of a liquid, e.g., a solution, emulsion or suspension. The liquid can be useful for delivery by injection, infusion (e.g., IV infusion) or sub-cutaneously. The liquid compositions of the invention, whether they are solutions, suspensions or other like form, can also include one or more of the following: sterile diluents such as water, saline solution, preferably physiological saline, Ringer's solution, isotonic sodium chloride, fixed oils such as synthetic mono or diglycerides, polyethylene glycols, glycerin, or other solvents; antibacterial agents such as benzyl alcohol or methyl paraben; and agents for the adjustment of tonicity such as sodium chloride or dextrose. A composition can be enclosed in an ampoule, a disposable syringe or a multiple-dose vial made of glass, plastic or other material.
In specific embodiments, it can be desirable to administer one or more binding molecule of the present invention or compositions locally to the area in need of treatment, or by intravenous injection or infusion.
The amount of the binding molecule of the present invention that is effective/active in the treatment of a particular disorder or condition will depend on the nature of the disorder or condition, and can be determined by standard clinical techniques. In addition, in vitro or in vivo assays can optionally be employed to help identify optimal dosage ranges. The precise dose to be employed in the compositions will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and each patient's circumstances.
The compositions of the invention comprise an effective amount of a binding molecule of the present invention such that a suitable dosage will be obtained. The correct dosage of the compounds will vary according to the particular formulation, the mode of application, and its particular site, host and the disease being treated. Other factors like age, body weight, sex, diet, time of administration, rate of excretion, condition of the host, drug combinations, reaction sensitivities and severity of the disease shall be taken into account. Administration can be carried out continuously or periodically within the maximum tolerated dose.
Typically, this amount is at least about 0.01% of a binding molecule of the present invention by weight of the composition.
Preferred compositions of the present invention are prepared so that a parenteral dosage unit contains from about 0.01% to about 2% by weight of the binding molecule of the present invention.
For intravenous administration, the composition can comprise from about typically about 0.1 mg/kg to about 250 mg/kg of the animal's body weight, preferably, between about 0.1 mg/kg and about 20 mg/kg of the animal's body weight, and more preferably about 1 mg/kg to about 10 mg/kg of the animal's body weight.
The present compositions can take the form of suitable carriers, such aerosols, sprays, suspensions, or any other form suitable for use. Other examples of suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences” by E. W. Martin.
The pharmaceutical compositions can be prepared using methodology well known in the pharmaceutical art. For example, a composition intended to be administered by injection can be prepared by combining a binding molecule of the present invention with water so as to form a solution. A surfactant can be added to facilitate the formation of a homogeneous solution or suspension.
The invention furthermore relates to a method for the prevention and/or treatment of cancer, in particular prostate cancer, comprising administering a binding molecule of the invention to a patient, said method comprising administering, to a subject in need thereof, a pharmaceutically active amount of a binding molecule and/or of a pharmaceutical composition of the invention. In particular, the invention relates to a method for the prevention and/or treatment of cancer, in particular prostate cancer, said method comprising administering, to a subject in need thereof, a pharmaceutically active amount of a binding molecule or a pharmaceutical composition of the invention.
The invention also relates to a binding molecule of the invention for use in the treatment of disease. The invention also relates to a binding molecule of the invention for use in the treatment of cancer, in particular prostate cancer or a prostatic disorder. “Prostate cancer” refers to all stages and all forms of cancer arising from the tissue of the prostate gland. The invention also relates to the treatment of a disease characterized by aberrant expression of PSMA.
In another aspect, the invention relates to the use of a binding molecule of the invention in the treatment of disease. In another aspect, the invention relates to the use of a binding molecule of the invention in the manufacture of a medicament for the treatment of cancer, in particular prostate cancer or a prostatic disorder.
The binding molecules of the invention are also useful for the treatment, prevention, or amelioration of cancer, in particular prostate cancer or a prostatic disorder. A prostatic disorder refers to any disease that afflicts the prostate gland in the male reproductive system. The prostate gland is dependent on the hormonal secretions of the testes. Expression of PSMA has been detected in other cancers, more specifically in the neovasculature associated with these cancers. A wide range of carcinomas, including conventional (clear cell) renal cell, transitional cell of the bladder, testicular-embryonal, neuroendocrine, colon, and breast, and the different types of malignancies were found consistently and strongly to express PSMA in their neovasculature.
The binding molecule of the invention may be administered as the sole active ingredient or in combination with one or more other therapeutic and/or cytotoxic moiety. In one embodiment, the binding molecule may be conjugated to a toxic moiety.
In therapies of prostatic disorders, e.g., prostate cancer, the anti-PSMA binding molecule can be used in combination with existing therapies. In one embodiment, the single domain antibody is used in combination with an existing therapy or therapeutic agent, for example an anti-cancer therapy. Thus, in another aspect, the invention also relates to a combination therapy comprising administration of a single domain antibody or pharmaceutical composition of the invention and an anti-cancer therapy. The anti-cancer therapy may include a therapeutic agent or radiation therapy and includes gene therapy, viral therapy, RNA therapy bone marrow transplantation, nanotherapy, targeted anti-cancer therapies or oncolytic drugs. Examples of other therapeutic agents include other checkpoint inhibitors, antineoplastic agents, immunogenic agents, attenuated cancerous cells, tumor antigens, antigen presenting cells such as dendritic cells pulsed with tumor-derived antigen or nucleic acids, immune stimulating cytokines (e.g., IL-2, IFNa2, GM-CSF), targeted small molecules and biological molecules (such as components of signal transduction pathways, e.g. modulators of tyrosine kinases and inhibitors of receptor tyrosine kinases, and agents that bind to tumor-specific antigens, including EGFR antagonists), an anti-inflammatory agent, a cytotoxic agent, a radiotoxic agent, or an immunosuppressive agent and cells transfected with a gene encoding an immune stimulating cytokine (e.g., GM-CSF), chemotherapy. In one embodiment, the single domain antibody is used in combination with surgery. The binding molecule of the invention may be administered at the same time or at a different time as the other therapy, e.g., simultaneously, separately or sequentially.
In another aspect, the invention provides a kit for detecting prostate cancer for diagnosis, treatment, prognosis or monitoring comprising a binding molecule of the invention. The kit may also comprise instructions for use. The kits may include a labeled binding molecule of the invention as described above and one or more compounds for detecting the label. The invention in another aspect provides a binding molecule of the invention packaged in lyophilized form, or packaged in an aqueous medium.
The invention also relates to detection methods using the binding molecule of the invention. Given their ability to bind to human PSMA, the human-PSMA-binding molecules, disclosed herein can be used to detect PSMA (e.g., in a biological sample, such as serum or plasma), using a conventional immunoassay, such as an enzyme linked immunosorbent assays (ELISA), an radioimmunoassay (RIA) or tissue immunohistochemistry. In particular, the invention also relates to in vitro or in vivo methods for diagnosing or monitoring progression of a cancer, in particular prostate cancer. In vitro methods comprise detecting the presence of a PSMA protein in a test sample and comparing this with control sample from a normal subject or with a standard value or standard value range for a normal subject. The sample may be selected from blood, plasma, serum, semen, urine or a tissue biopsy.
The method may include: (a) contacting the sample (and optionally, a reference, e.g., a positive and/or negative control sample) with a PSMA binding molecule of the invention and (b) detecting either the binding molecule bound to PSMA or unbound binding molecule in the sample, to thereby detect PSMA in the biological sample. The binding molecule can be directly or indirectly labeled with a detectable substance to facilitate detection of the bound or unbound antibody. Suitable detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials and radioactive materials.
The invention also relates to an assay for assessing the internalization of PSMA binding molecule of the invention by labelling said binding molecule. Such an assay is described in the examples.
In vivo methods may comprise detecting the presence of PSMA in vivo, for example by imaging in a subject. In this method, a PSMA binding molecule of the invention is labeled to detect binding.
As an alternative to labeling the binding molecule of the invention, human PSMA can be assayed in biological fluids by a competition immunoassay utilizing PSMA standards labeled with a detectable substance and an unlabeled human PSMA binding molecule. In this assay, the biological sample, the labeled PSMA standards and the human PSMA binding molecule are combined and the amount of labeled PSMA standard bound to the unlabeled binding molecule is determined. The amount of human PSMA in the biological sample is inversely proportional to the amount of labeled PSMA standard bound to the PSMA binding molecule. Similarly, human PSMA can also be assayed in biological fluids by a competition immunoassay utilizing PSMA standards labeled with a detectable substance and an unlabeled human PSMA binding molecule.
Binding molecules disclosed herein can be used to inhibit PSMA activity, e.g., in a cell culture containing PSMA, in human subjects or in other mammalian subjects having PSMA with which a binding molecule disclosed herein cross-reacts. In one embodiment, a method for inhibiting or increasing PSMA activity is provided comprising contacting PSMA with a binding molecule disclosed herein such that PSMA activity is inhibited or increased. For example, in a cell culture containing, or suspected of containing PSMA, a binding molecule disclosed herein can be added to the culture medium to inhibit PSMA activity in the culture.
Therefore, in one embodiment, the invention also relates to a method of ablating or killing a cell that expresses PSMA, e.g., a cancerous or non-cancerous prostatic cell. Methods of the invention include contacting the cell, with PSMA binding molecule of the invention, in an amount sufficient to ablate or kill, the cell. The methods can be used on cells in culture, e.g., in vitro or ex vivo.
Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. While the foregoing disclosure provides a general description of the subject matter encompassed within the scope of the present invention, including methods, as well as the best mode thereof, of making and using this invention, the following examples are provided to further enable those skilled in the art to practice this invention and to provide a complete written description thereof. However, those skilled in the art will appreciate that the specifics of these examples should not be read as limiting on the invention, the scope of which should be apprehended from the claims and equivalents thereof appended to this disclosure. Various further aspects and embodiments of the present invention will be apparent to those skilled in the art in view of the present disclosure.
All documents mentioned in this specification are incorporated herein by reference in their entirety, including references to gene accession numbers.
“and/or” where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. For example “A and/or B” is to be taken as specific disclosure of each of (i) A, (ii) B and (iii) A and B, just as if each is set out individually herein. Unless context dictates otherwise, the descriptions and definitions of the features set out above are not limited to any particular aspect or embodiment of the invention and apply equally to all aspects and embodiments which are described.
The invention is further described in the non-limiting examples.
Mice carrying a heavy-chain antibody transgenic locus in germline configuration within a background that is silenced for endogenous heavy and light chain antibody expression (triple knock-out, or TKO) were created as previously described (WO2004/076618 and WO2003/000737, Ren et al., Genomics, 84, 686, 2004; Zou et al., J. Immunol., 170, 1354, 2003). Briefly, transgenic mice were derived following pronuclear microinjection of freshly fertilised oocytes with a yeast artificial chromosome (YAC) comprising a plethora of human VH, D and J genes in combination with mouse immunoglobulin constant region genes lacking CH1 domains, mouse enhancer and regulatory regions. Yeast artificial chromosomes (YACs) are vectors that can be employed for the cloning of very large DNA inserts in yeast. As well as comprising all three cis-acting structural elements essential for behaving like natural yeast chromosomes (an autonomously replicating sequence (ARS), a centromere (CEN) and two telomeres (TEL)), their capacity to accept large DNA inserts enables them to reach the minimum size (150 kb) required for chromosome-like stability and for fidelity of transmission in yeast cells. The construction and use of YACs is well known in the art (e.g., Bruschi, C. V. and Gjuracic, K. Yeast Artificial Chromosomes, Encyclopedia of Life Sciences, 2002, Macmillan Publishers Ltd., Nature Publishing Group/www.els.net).
The transgenic founder mice were back crossed with animals that lacked endogenous immunoglobulin expression to create the Tg/TKO lines used in the immunisation studies described.
The immunisations used recombinant purified protein or Human Cell Line LNCap. Recombinant human PMSA was purchased from R&D, (cat. no. 4234-ZN), while the LNCap cells were from Sigma Aldrich (cat. no. 89110211-1VL).
Briefly, Tg/TKO mice aged 8-12 weeks of age each received a total of 50 μg of recombinant purified human PSMA protein, emulsified in Complete Freund's Adjuvant and delivered subcutaneously, or 10 million LNCap cells in PBS delivered intraperitoneally, followed by boosts of 1-10 μg of the recombinant protein, emulsified in Incomplete Freund's Adjuvant, also administered subcutaneously, given at various intervals following the initial priming. A final dose of the recombinant purified human PSMA protein antigen was administered intraperitoneally, in phosphate buffered saline, in the absence of adjuvant.
Alternative immunisation routes and procedures can also be employed. For example, different adjuvants or immune potentiating procedures may be used instead of Freund's adjuvant. DNA immunisations are often delivered intramuscularly or via a Genegun. Transfected cells or membrane preparations from such cells are often, although not exclusively, administered intraperitoneally.
During and following immunisation, serum was collected from mice and checked for the presence of heavy-chain antibody responses to the immunogen by ELISA. Nunc Maxisorp plates (Nunc cat. no. 443404) were coated overnight at 4° C. with 50 μl/well of a 1 μg recombinant antigen/ml of PBS solution. Following decanting of the antigen solution, plates were washed using PBS (prepared from PBS Tablets, Oxoid cat. no. BR0014G) supplemented with 0.05% (v/v) Tween® 20 (Sigma P1379), followed by washes with PBS without added Tween 20. To block non-specific protein interactions, a solution of 3% (w/v) skimmed milk powder (Marvel®) in PBS was added to the wells and the plate was incubated for at least one hour at room temperature. Dilutions of serum in 3% Marvel™/PBS were prepared in polypropylene tubes or plates and incubated for at least one hour at room temperature prior to transfer to the blocked ELISA plate where a further incubation of at least one hour took place. Unbound protein was then washed away using repetitive washes with PBS/Tween 20 followed by PBS. A solution of biotin-conjugated, goat anti-mouse IgG, Fcgamma subclass 1 specific antibody (Jackson cat. no. 115-065-205), prepared in PBS/3% Marvel was then added to each well and a further incubation at room temperature for at least one hour took place. Unbound detection antibody was removed by repeated washing using PBS/Tween 20 and PBS. Neutravidin-HRP solution (Pierce cat. no. 31030) in 3% Marvel/PBS was then added to the ELISA plates and allowed to bind for at least 30 minutes. Following further washing, the ELISA was developed using TMB substrate (Sigma cat. no. T0440) and the reaction was stopped after 10 minutes by the addition of 0.5M H2SO4 solution (Sigma cat. no. 320501). Absorbances were determined by reading at an optical density of 450 nm. Alternative assays, such as ELISPOT assays, may also be used to check for immunisation induced heavy-chain antibody responses.
a) Processing Tissues, RNA Extraction and cDNA Manufacture
Spleen, inguinal and brachial lymph nodes were collected into RNAlate® from each immunised animal. For each animal, ½ of the spleen and 4 lymph nodes were processed separately. Initially, the tissues were homogenised; following transfer of tissues to Lysing matrix D bead tubes (MP Bio. Cat. no. 116983001), 600 μl of RLT buffer containing β-mercaptoethanol (from Qiagen RNeas® kit cat. no. 74104) was added before homogenisation in a MP Bio Fastprep96 homogeniser (cat#116010500) at 1600 rpm for 60 seconds. The tubes containing the homogenised tissues were transferred to ice and debris was pelleted by centrifugation at 1200 rpm for 5 minutes. A 400 μl sample of the supernatant was removed and used for RT-PCR.
Initially, RNA was extracted using Qiagen RNeasy® kit (cat. no. 74104) following the manufacturer's protocol. Each RNA sample was then used to make cDNA using Superscript III RT-PCR high-fidelity kit (Invitrogen cat. no. 12574-035). For each spleen and lymph nodes RNA sample, 5 RT-PCR reactions were performed, each with VH_J/F (long) primer in combination with a primer for VH1, VH2, VH3, VH4 or VH6 family. Details of the primers are below.
GCCGCTGGATTGTTATTACTCGCGGCCCAGCCGGCCA
TGGCCCAGGTBCAGCTGGTGCAGTCTGGGGCTGAGG
GCCGCTGGATTGTTATTACTCGCGGCCCAGCCGGCCA
TGGCCCAGATCACCTTGAAGGAGTCTGG
GCCGCTGGATTGTTATTACTCGCGGCCCAGCCGGCCA
TGGCCSAGGTGCAGCTGGTGGAGTCTGGGGGAGG
GCCGCTGGATTGTTATTACTCGCGGCCCAGCCGGC
CATGGCCCAGGTGCAGCTGCAGGAGTCGGG
GCCGCTGGATTGTTATTACTCGCGGCCCAGCCGGCCA
TGGCCCAGGTACAGCTGCAGCAGTCAGG
CCGTGGTGATGGTGGTGATGGCTACCGCCACCCTC
GAGTGARGAGACRGTGACC SEQ ID No. 496
GCCGCTGGATTGTTATTACTCGCGGCCCAGCCGGCCATGGCC
GCCGCTGGATTGTTATTACTCGCGGCCCAGCCGGCCATGGCC
GCCGCTGGATTGTTATTACTCGCGGCCCAGCCGGCCATGGCC
GCCGCTGGATTGTTATTACTCGCGGCCCAGCCGGCCATGGCC
GCCGCTGGATTGTTATTACTCGCGGCCCAGCCGGCCATGGCC
GCCGCTGGATTGTTATTACTCGCGGCCCAGCCGGCCATGGCC
GCCGCTGGATTGTTATTACTCGCGGCCCAGCCGGCCATGGCC
GCCGCTGGATTGTTATTACTCGCGGCCCAGCCGGCCATGGCC
GCCGCTGGATTGTTATTACTCGCGGCCCAGCCGGCCATGGCC
GCCGCTGGATTGTTATTACTCGCGGCCCAGCCGGCCATGGCC
GCCGCTGGATTGTTATTACTCGCGGCCCAGCCGGCCATGGCC
GCCGCTGGATTGTTATTACTCGCGGCCCAGCCGGCCATGGCC
CCGTGGTGATGGTGGTGATGGCTACCGCCACCCTCGAG
Residues in bold have homology with pUCG3
The code for the choice of nucleotide for degenerate primer is shown below.
Mastermixes were prepared for the RT-PCR reactions, based on the following tube reaction components:
The RT-PCR reactions were carried out in a thermal cycler using the following conditions:
35 cycles of 94° C. 15 sec
Products in the range of 370 bp were confirmed by gel electrophoresis.
For each mouse, the VH products amplified for a given family from the ½ spleen and each of the 4 lymph nodes were then pooled for purification using Thermo/Fermentas GeneJet PCR purification kit (cat. no. K0702) which was used according to the manufacturer's instructions, with the products eluted in 50 μl of water.
a) Cloning into Phagemid Vector
The phagemid vector, pUCG3, was employed in these studies. A PCR-based method was used to construct the VH phagemid libraries from the amplified VH sequences. The following procedure was used:
A linearised version of pUCG3 was created using PCR; with the following primers:
Phusion High fidelity PCR master mix with GC buffer (cat. no. F532L, NEB) was used for the PCR reactions which comprised the following reagents:
The cycling conditions used were:
The PCR product (3152 bp) was gel purified using Fermentas GeneJet Gel purification kit (cat. no. K0691), according to the manufacturer's instructions, with final elution in 40 μl of elution buffer.
The purified VH RT-PCR products were employed as megaprimers with the linearised pUCG3 to give phagemid products for transformation and library creation, based on the following reactions;
Linearised pUCG3 800 ng
VH PCR product 200 ng
Nuclease-free H2O to 50 μl final volume
PCR was performed as follows:
The products of PCR were analysed on a 1% (w/v) agarose gel.
The various family VH/phagemid products were purified using Fermentas PCR purification kit (cat. no. K0702) according to the manufacturer's instructions with the final elution being in 25 μl H2O; this eluate was used for transformations of TG1 E. coli (Lucigen, cat. no. 60502-2) by electroporation using BioRad 2×0.2 cm cuvettes (BioRad cat. no. 165-2086) in a Bio-Rad GenePulser Xcell and pre-warmed recovery medium (Lucigen, proprietary mix). 22 μl of the purified products were added to 160 μl of cells for the electroporation, with 2 electroporations being performed for each VH/phagemid product at 2000 v. Electroporated cells were pooled and recovered in 50 ml Falcon tubes incubated for 1 hour at 37° C. with shaking at 150 rpm. A 10-fold dilution series of an aliquot of the transformations was performed and plated in petri dishes containing 2×TY agar supplemented with 2% (w/v) glucose and 100 μg/ml ampicillin. Resulting colonies on these dishes were used to estimate the library size. The remainder of the transformation was plated on large format Bioassay dishes containing 2×TY agar supplemented with 2% (w/v) glucose and 100 μg/ml ampicillin. All agar plates were incubated overnight at 30° C. 10 ml of 2×TY broth was added to the large format bioassay dishes and colonies were scraped and OD600 measured (OD of 1.0=5×108 cells/ml). Aliquots were stored at −80° C. in cryovials after addition of 50% (v/v) glycerol solution or used directly in a phage selection process.
Preparation of library phage stocks and phage display selections were performed according to published methods (Antibody Engineering, edited by Benny Lo, chapter 8, p 161-176, 2004). In most cases, phage display combined with a panning approach was used to isolate binding VH domains. However, a variety of different selection methods are well described in the art, including soluble selection and selections performed under stress (e.g. heat). Selections to promote internalising anti-PSMA VH were also conducted with monovalent and multivalent phage (patent US2009170792 (A1)—2009 Jul. 2002). Briefly, blocked phage in ice-cold cell media were added to 4 ml ice-cold cell media containing 2.5×106 LnCAP cells. Phage and cells were incubated on ice for 2 hours, mixing occasionally to prevent cell clumping. Unbound or weakly bound phage were removed by washing five times in ice-cold PBS. The phage were then allowed to internalise by incubating the cells in media at 37° C. before removing phage bound to the outside of the cells with a 5 minutes wash step in a low pH cell-stripping buffer at 4° C. The cells were then lysed to harvest internalised phage using trimethylamine. Both the stripped and internalised fractions were neutralised with Tris buffer before being used to infect E. coli. The phage outputs were analysed as described for panning selections on recombinant proteins.
VH from the different selections were screened in one or more of the following assays to identify specific VH capable of binding PMSA.
a) Binding ELISA
Following selections of the libraries, specific VH antibodies were identified by phage ELISA following published methods (Antibody Engineering, edited by Benny Lo, chapter 8, p 161-176, 2004). Phage ELISAs were performed against target protein and an unrelated antigen as control. In some cases, purified or crude extracts of VH domains were assayed by ELISA instead of using a phage ELISA. In these cases, bacterial periplasmic extracts or purified VH were used.
Small-scale bacterial periplasmic extracts were prepared from 1 ml cultures, grown in deep well plates. Starter cultures were used to inoculate 96-well deep well plates (Fisher, cat. no. MPA-600-030X) containing 2×TY broth (Melford cat. no. M2130), supplemented with 0.1% (w/v) glucose+100 μg/ml ampicillin at 37° C. with 250 rpm shaking. When OD600 had reached 0.6-1, VH production was induced by adding 100 μl of 2×TY, supplemented with IPTG (final concentration 1 mM) and ampicillin and the cultures were grown overnight at 30° C. with shaking at 250 rpm. E. coli were pelleted by centrifugation at 3200 rpm for 10 mins and supernatants discarded. Cell pellets were resuspended in 30-100 μl of ice cold extraction buffer (20% (w/v) sucrose, 1 mM EDTA & 50 mM Tris-HCl pH 8.0) by gently pipetting. Cells were incubated on ice for 30 minutes and then centrifuged at 4500 rpm for 15 mins at 4° C. Supernatants were transferred to polypropylene plates and used, following incubation in Marvel/PBS blocking solution, in the ELISA.
The purified VH were obtained by using the VH C-terminal 6×HIS tag for Ni-NTA affinity chromatographic purification of the periplasmic extracts. A starter culture of each VH was grown overnight in 5 ml 2×TY broth (Melford cat. no. M2103) supplemented with 2% (w/v) glucose+100 μg/ml ampicillin at 30° C. with 250 rpm shaking. 50 μl of this overnight culture was then used to inoculate 50 ml 2×TY supplemented with 2% (w/v) glucose+100 μg/ml ampicillin and incubated at 37° C. with 250 rpm shaking for approximately 6-8 hours (until OD600=0.6-1.0). Cultures were then centrifuged at 3200 rpm for 10 mins and the cell pellets resuspended in 50 ml fresh 2×TY broth containing 100 μg/ml ampicillin+1 mM IPTG. Shake flasks were then incubated overnight at 30° C. and 250 rpm. Cultures were again centrifuged at 3200 rpm for 10 mins and supernatants discarded. Cell pellets were resuspended in 1 ml ice cold extraction buffer (20% (w/v) sucrose, 1 mM EDTA & 50 mM Tris-HCl pH 8.0) by gently pipetting and then a further 1.5 ml of 1:5 diluted ice cold extraction buffer added. Cells were incubated on ice for 30 minutes and then centrifuged at 4500 rpm for 15 mins at 4° C. Supernatants were transferred to 50 ml Falcon tubes containing imidazole (Sigma cat. no. I2399-final concentration 10 mM) and 0.5 ml of nickel agarose beads (Qiagen, Ni-NTA 50% soln, cat. no. 30210) pre-equilibrated with PBS buffer. VH binding to the nickel agarose beads was allowed to proceed for 2 hours at 4° C. with gentle shaking. The nickel agarose beads were then transferred to a polyprep column (BioRad cat. no. 731-1550) and the supernatant discarded by gravity flow. The columns were then washed 3 times with 5 ml of PBS+0.05% Tween® followed by 3 washes with 5 ml of PBS containing imidazole at a concentration of 20 mM. VH were then eluted from the columns by the addition of 250 μl of PBS containing imidazole at a concentration of 250 mM. Imidazole was then removed from the purified VH preparations by buffer exchange with NAP-5 columns (GE Healthcare, 17-0853-01) and then eluting with 1 ml of PBS. Yields of purified VH were estimated spectrophotometrically and purity was assessed using SDS PAGE.
Alternatively anti-PSMA VH were purified from the supernatants of W3110 E coli with pJExpress vector. For this procedure up to 400 ml cultures were grown at 37° C. with 250 rpm shaking in TB media before being induced overnight with 1 mM IPTG overnight. The resulting supernatants were harvested and VH purified on AKTA Pure using a Ni-Sepharose excel column (HiScale 16, GE Healthcare). Yields of purified VH were estimated spectrophotometrically and purity was assessed using SDS PAGE.
The binding ELISA for crude or purified VH was similar to the serum ELISA and phage ELISA, previously described, mostly differing in the final detection steps. Briefly, antigen was immobilised on Maxisorb plates (Nunc 443404) by adding 50 μl volumes at 0.1-2 μg/ml in PBS and incubating at 4° C. overnight. Following coating, the antigen solution was aspirated and the plates were washed using PBS (prepared from PBS Tablets, Oxoid cat. no. BR0014G) supplemented with 0.05% Tween® 20 (Sigma cat. no. P1379), followed by washes with PBS without added Tween® 20. To block non-specific protein interactions, a solution of 3% skimmed milk powder (Marvel®) in PBS was added to the wells and the plate was incubated for at least one hour at room temperature. Dilutions of periplasmic extract or purified VH in 3% Marvel®/PBS were prepared in polypropylene tubes or plates and incubated for at least one hour at room temperature prior to transfer to the blocked ELISA plate where a further incubation of at least one hour took place. Unbound protein was then washed away using repetitive washes with PBS/Tween followed by PBS. A solution of HRP-conjugated anti-Myc Ab (Santa Cruz cat. no. SC-40), prepared at 1:50 dilution in PBS/3% Marvel was then added to each well and a further incubation at room temperature for at least one hour took place. Unbound detection antibody was removed by repeated washing using PBS/Tween® and PBS. The ELISA was then developed using TMB substrate (Sigma cat. no. T0440) and the reaction was stopped after 10 minutes by the addition of 0.5M H2SO4 solution (Sigma cat. no. 320501). Absorbances were determined by reading at 450 nm.
b) FMAT Direct Cell Binding Assay
Periplasmic extracts from E. coli were screened for production of PSMA-binding-His-tagged VH using Fluorescence Microvolume Assay Technology (FMAT), a fluorescence-based platform that detects fluorescence localized to beads or cells settled at the bottom of microwells (Dietz et al., Cytometry 23:177-186 (1996), Miraglia et al., J. Biomol. Screening 4:193-204 (1999). CHO TREX human and cynomolgus cell lines were generated in-house using full-length human and cynomolgus PSMA using standard procedures. LnCAP cells were purchased from Sigma Aldrich.
Peripreps were tested by single point screening for the presence of VH that bound specifically to CHO human PSMA, CHO cyno PSMA and LnCAP cells with no binding to CHO parental cells in an FMAT Direct Binding Assay. Cells were resuspended at 0.1×106 cells/ml in FMAT assay buffer (pH 7.4) containing PBS, 0.1% Bovine Serum Albumin, 0.01% Sodium Azide and 120 nM DRAQ5 (Thermo Scientific cat. no. 62251) added to the cell suspension. Peripreps (10 μl) were transferred into 384 well black clear-bottomed assay plates (Costar cat. no. 3655) and 10 μl of 6 nM mouse Anti-His (Millipore cat. no. 05-949)/12 nM Goat Anti-Mouse Alexa Fluor-488 (Jackson Immunolabs cat. no. 115-545-071) mix added. The DRAQ5 stained cells (20 μl per well) were then added and the assay plates incubated for 2 hours at room temperature. Plates were read in the FL2 (502 nm-537 nm) and FL5 (677-800 nm) channels on the TIP Mirrorball plate reader following excitation at 488 nm and 640 nm. Data was gated on FL5 perimeter and peak intensity and the FL2 median mean fluorescence intensity of the gated data used for determination of VH binding.
For titrations, VH purified via the terminal His tag were serially diluted in FMAT assay buffer then binding was measured as described above (
Each individual VH clone as identified above was sequenced from the phagemid and grouped based on VH germline and CDR3 amino acid similarity into separate families. Representative clones were further characterised. Variants, including germlined variants, were generated by standard methods of parent clones e.g 1.1 and 2.1.
a) Specificity of Anti-PMSA
The specificity of individual VH for target antigen was confirmed by ELISA, following the methods described in Example 7(a). VH were tested for binding to PMSA and shown not to cross react with irrelevant proteins.
b) Measurement of Binding Kinetics and Epitope Binding Using Octet
Binding kinetics of purified anti-PSMA VH antibodies were measured on a ForteBio Octet RED 384 instrument. Recombinant PMSA was diluted to 20 μg/ml in sodium acetate buffer, pH 5 (ForteBio, cat. no. 18-1069) and coupled to ARG2G biosensors (ForteBio cat. no. 18-5092) using amine-coupling chemistry (NHS-EDC amine-coupling, ForteBio cat. nos. 18-1067 and 18-1033), followed by quenching in ethanolamine (ForteBio cat. no. 18-1071). Binding kinetics of anti-PSMA VH antibodies were then determined by preparing each VH antibody in dilution series (typically 1:2 dilution series starting with 15 μg/ml, VH at the highest concentration), and then measuring binding of the different VH concentrations to the PSMA-coupled biosensors. VH binding kinetics were then determined from the (blank subtracted) sensorgram trace using 1:1 binding models and ForteBio Octet DataAnalysis software. Binding affinities from 1-150 nM and in the subnanomolar range were detected and examples of the binding parameters are shown in Table 21 below.
Further family members in particular variants of parent molecules were also tested as below using 1:2 dilution series starting with 0.375 μg/ml. Binding affinities in the nanomolar and picomolar range were detected as shown in Tables 22 and 23.
Single domain antibodies purified from periplasmic extracts using Ni-NTA chromatography (via the C-terminal His-tag) as in example 7a were also tested. Results are shown in the Table below. Binding affinities in the nanomolar range were detected.
c) Measurement of Internalization of Cynomolgus PSMA-Binding VH Using Fluorescence Microvolume Assay Technology
Internalization of purified VH was measured using the pH-sensitive fluorescent dye pHrodo® green. Anti-His antibody (Millipore cat. no. 05-949) was labelled with pHrodo® Green STP ester (Molecular Probes cat. no. P35369) according to the manufacturer's instructions. All samples and reagents were prepared in internalization buffer (pH 7.4) containing PBS and 0.1% Bovine Serum Albumin. CHO cells expressing cynomolgus PSMA were resuspended at 0.1×106 cells/ml and 120 nM DRAQ5 added to the cell suspension. VH (10 μl) were transferred into 384-well black clear-bottomed assay plates (Costar cat. no. 3655) and 10 μl of 40 nM pHrodo® green labelled Anti-His antibody added followed by 20 μl DRAQ5 stained cells. Plates were incubated at 37° C. for 2 hr then equilibrated to room temperature. Fluorescence emission in the FL2 (502 nm-537 nm) and FL5 (677-800 nm) channels were measured on TTP Mirrorball plate reader following excitation at 488 nm and 640 nm. Data was gated on FL5 perimeter and peak intensity and the FL2 median mean fluorescence intensity of the gated data used for determination of VH internalization (
Internalization of variants of single domain antibodies 1.1 and 1.2 was measured using the pH sensitive fluorescent dye pHrodo® green as described above except serially diluted VH were pre-incubated with pHrodo® green labelled Anti His antibody for 30 minutes at room temperature prior to addition of DRAQ5 stained CHO human PSMA clone 1A10 cells (20 μl). Plates were incubated for 2 hour at room temperature then fluorescent emission measured. Activity of the VH in the assay is shown in Table 25 below.
d) Measurement of Internalization of PSMA Binding VH Using the his-ZAP Assay
Internalization of His tagged PSMA binding VH was assessed using an anti-His antibody conjugated to saporin toxin (His-ZAP Advanced targeting Systems IT52). The His-ZAP reagent binds to the VH and is internalized through the VH interaction with PSMA on the cell surface. Saporin toxin is released from the complex in the endosome and inactivates ribosomes eventually resulting in cell death.
CHO cells expressing mouse or cynomolgus PSMA (400 cells per well in a 30 μl volume) were seeded into 384-well black clear-bottomed tissue culture-treated assay plates (Costar cat. no. 3712) in Hams F12 (Sigma cat. no. N6658) media containing 10% foetal bovine serum, 2 mM L-glutamine, 10 μg/ml blasticidin, 300 μg/ml Zeocin, penicillin/streptomycin, 1 μg/ml tetracycline and incubated overnight in a CO2 incubator at 37° C. Purified VH were serially diluted in media then an equal volume of 40 nM His-ZAP added. Following incubation for 30 minutes at 37° C. the VH/His-ZAP samples (10 μl) were transferred to the cell assay plates and incubated for 48 hours in a CO2 incubator at 37° C. His-ZAP control wells (cells with His-ZAP reagent) and background controls (media only) were set up on each plate for data normalization. Cell viability was determined following the 48 hour incubation using the Cell Titer-Glo Cell Viability assay (Promega cat. no. G7571) according to the manufacturer's instructions. Relative luminescent signal (RLU) was measured using the BMG PHERAstar plate reader. The data was normalized by subtraction of the RLU signal obtained in the absence of cells and expression as a percentage of the background-corrected signal of the His-ZAP control wells (
For LnCAP assays, cells (2000 per well in a 100 μl volume) were seeded into 96-well TC-treated plates (Costar 3340) in RPMI 1640 media containing 10% foetal bovine serum, 2 mM L-glutamine and penicillin/streptomycin. Purified VH were serially diluted in media, then an equal volume of 60 nM His-ZAP was added. Following incubation for 30 minutes at 37° C. the VH/His-ZAP samples (100 μl) were transferred to the cell assay plates and incubated for 96 hours in CO2 incubator at 37° C. Cell viability was measured using the Cell Titer-Glo Cell Viability assay and data analysed as described above. Examples are given in
The ability of variants of single domain antibodies 1.1 and 2.1 to internalize with a bound saporin conjugated anti His antibody, resulting in toxin mediated cell death, was determined. Assays were performed as described above except CHO human PSMA clone 1A10 cells were used for human PSMA assays and plates were incubated for 72 hours in a CO2 incubator at 37° C. prior to measurement of cell viability. Activity of the single domain antibodies tested in the assay is shown in Table 26 below.
Biparatopic molecules were tested and showed the following EC50 values.
VH from the different CDR3 families were tested for developability characteristics.
a) Heat Stability: HPLC Size Exclusion Chromatography
Purified VH were subjected to size exclusion chromatography. Briefly, purified VH were stored in PBS buffer for 0-14 days at either 4° C. or 40° C., and then analysed at various time points using a Waters H-Class Bio UPLC containing a PDA detector (detection at 280 nm) with separation on a Waters ACQUITY BEH 125 Å SEC column. Samples were injected in 10 μl volumes and were run in a mobile phase containing 200 mM NaCl, 100 mM sodium phosphate, pH 7.4+5% propan-1-ol at a flow rate of 0.4 ml/min. Data were collected for 6 minutes and the percentage of monomer remaining after storage as compared to that present at the start (T=0) was calculated. Parent molecules showed high stability. Variants were also tested.
It should be noted that these data were collected under non-optimised buffer conditions.
Concentration of samples varied: Monovalent 1.1 variants: 5.0 mg/ml
Monovalent 2.1 variants: 3.5 mg/ml
Results are shown in the Tables below.
Long term stability of monovalent single domain antibodies up to 35 days was also tested and showed a good profile.
b) Heat Stability: Mirror Ball
Purified VH samples were incubated for 0-8 days at 40° C. and then tested for binding to CHO cells expressing cynomolgus PSMA using the FMAT Direct Binding Assay as detailed in Examples 7(b). Molecules tested showed good stability.
c) Assessment of VH Serum Stability Using a Homogenous Time Resolved Fluorescence (HTRF) Assay.
Purified VH were mixed with cynomolgus monkey serum and incubated for 0-7 days at 37° C. Samples were then assessed for binding to PSMA using an HTRF assay. Briefly, PSMA (R&D Systems cat. no. 4234-ZN) was biotinylated using the Pierce EZ-Link Micro-Sulfo-NHS-LC-Biotinylation kit. (Thermo Scientific cat. no. 21935). For HTRF binding assays all samples and reagents were prepared in HTRF assay buffer containing PBS, 0.1% (w/v) BSA and 0.4M Potassium Fluoride. VH (C-terminally His-Myc tagged) were incubated with 3 nM biotinylated PSMA, 1.5 nM Streptavidin cryptate (Cisbio cat. no. 610SAKLA) and 10 nM Anti-Myc-Alexa Fluor-647 (AbD Serotec cat. no. MCA2200AF647) in a total assay volume of 10 μl in black 384-shallow-well plates (Costar cat. no. 3676) for a minimum of 3 hours at room temperature. Time-resolved fluorescent emission at 620 nm and 665 nm was measured following excitation at 337 nm on the BMG PHERAstar plate reader.
In another experiment, purified VH were mixed with human serum for 0-7 days at 37° C. and then assessed for binding to huPSMA CHO 1A10 cells as described in examples' 7(b) FMAT Direct cell Binding Assay. Data obtained is shown in and EC50 values are shown in Tables 29 and 30 below.
To assess the serum stability of the different biapartopic combinations the purified biparatopic VH were mixed with human serum for 0-7 days at 37° C. and then assessed for binding to huPSMA CHO cells as described in examples 7(b) FMAT Direct cell Binding Assay. Table 31 shows the EC50 values for the cell binding.
d) Assessment of VH Thermal Stability
Differential scanning calorimetry (DSC) was conducted using a MicroCal VP-Capillary DSC (Malvern). 300 μl of protein at 0.25 mg/ml in PBS was run using a scan rate of 60° C. per minute between 10 and 90° C. Data was analysed using the MicroCal software. Results are shown in Table 32 for monovalent single domain antibodies and in Table 33 for biparatopic binding molecules.
VH were injected in mice (VH1.1, VH2.1 and VH2.1 with half-life extension). The mice contain PSMA positive (+) and PSMA negative (−) tumours. Studies were carried out as follows:
The half-life extended VH comprises an anti-mouse serum albumin (anti-MSA) VH with the following sequence:
The experiments showed high levels of specific tumor targeting, faster penetration and greater accumulation of the injected dose to PSMA+ tumor, in particular compared to a control monoclonal IgG anti-PSMA antibody. This can be further improved by extending the half life of the VH. Furthermore, the data shows quick clearance of the naked Humabody® VH.
In tandem epitope mapping of PSMA binding VH against each other was carried out using Octet RED 384. VH binding was then determined from the (reference sensor subtracted) sensorgram trace using 1:1 binding models and ForteBio Octet DataAnalysis software. See also example 8b. The epitope binning results are shown in Table 33. Some clones showed partial blocking.
In a further experiment, epitope competition between single domain antibodies 1.1 and 2.1 was further characterised. PSMA was coupled onto AR2G biosensors using the amine coupling second generation kit (ForteBio) and then used for epitope binning experiments conducted using the Octet RED384. In these experiments each VH was diluted to a concentration of 4 ug/ml. Biosensors were loaded with no VH or either 2.1 or 1.1 until binding to PSMA reached saturation level. These sensors were then briefly dipped into PBS/Tween before undergoing a second association step. The second association step involved dipping biosensors into wells containing the same VH only or both 2.1 and 1.1. The presence of the first VH in the later combination ensured that it continued to saturate its PSMA binding sites. The binding profiles were then studied using the ForteBio Analysis software. These data obtained demonstrate that single domain antibodies 2.1 and 1.2 bind distinct epitopes on PSMA.
The following constructs were tested in these studies:
All VH domains used in this study were expressed in E. coli. The proteins were purified from filtered supernatant using nickel affinity chromatography and size exclusion chromatography (SEC) as described in example 7a. After buffer exchange into storage buffer, the some proteins were concentrated using spin concentrators. The protein purity was analysed using SDS-PAGE and analytical SEC. Binding to PSMA was checked using recombinant protein and/or cells expressing PSMA. Stability was checked by heating the protein to 40° C. for an extended period of time (ranging from overnight to 4 weeks) and measuring the degree of protein degradation. Aliquots of the proteins were stored at −80° C. until use.
Confocal fluorescence microscopy method to test the occurrence of co-localization between the VH of interest (in a monovalent, bivalent and biparatopic format) and the markers of endocytosis LAMP-1 (staining lysosome) and EEA-1 (staining early endosome) in a PSMA expressing cell line. An IgG benchmark antibody that binds to PSMA was used as a positive control. The results are shown in
The cell line used was a CHO T-REx huPSMA cell line.
1) CHO T-REx huPSMA cells were induced with tetracycline for PSMA expression the day before the experiment and plated on coverslips.
2) On the following day cells were incubated with media comprising the test VH (either in their monovalent, bivalent or biparatopic format) at 500 nM or with the positive control.
3) Samples were first incubated on ice for 30 min to block endocytosis and then fixed with 4% PFA 10 min at RT, followed by 3 washes in PBS. Duplicate samples are further incubate at 37° C. for 2 hrs to trigger endocytosis, then fixed.
4) After fixation samples, were permeabilized with buffer.
5) Cells that were incubated with the positive control were stained using an anti-human-488 antibody diluted 1:2000 in 0.5% BSA/PBS+0.05% Tween for 1 hr, followed by three washes in PBS+0.05% Tween (5 min each).
6) Cells that were incubated with monovalent or bivalent/biparatopic test VH were stained using a primary anti-HIS antibody (mouse) for 1 hr, followed by washes, and then incubated with the secondary anti-mouse 488 antibody for 1 hr, followed by washes.
7) Lysosomes and endosomes are stained using a primary antibody against either the early endosome antigen 1 (EEA-1) or the lysosome membrane antigen 1 (LAMP-1) (both rabbit) for 1 hr. Cells are further incubated for 1 hr RT with anti-rabbit-647 secondary antibody, followed by washes.
8) All samples are also stained with HOECHST 1:1000 (0.5 ug/ml) for 5 min then washed.
9) Coverslips are mounted into frosty end slides and imaged using a NIKON A1R confocal system.
Pictures were taken using the program NIS-ELEMENTS AR.
Laser lines used were: 407.7 nm (HOECHST), 487.7 nm (VH/monoclonal benchmark), 639.7 (LAMP-1, EEA-1)
For confocal mode: Pinhole Size (um): 39.6, Z step: 0.49 um.
Further imaging studies were conducted using CHO cells expressing human PSMA (15000/well) were seeded onto 96 well Poly-L-Lysine (Sigma P4707) coated plates (Perkin Elmer 6005550) in Hams F12 (Sigma N6658) media containing 10% Foetal Bovine Serum, 2 mM L-Glutamine, 10 μg/ml Blasticidin, 300 μg/ml Zeocin, penicillin/streptomycin, 1 μg/ml Tetracycline and incubated overnight in a CO2 incubator at 37° C. VH were added to the plates and incubated at 4° C. for 30 minutes following by 37° C. for 2 hours. Plates were washed three times with PBS then the cells fixed in 4% paraformaldehyde and permeabilised with 0.5% saponin. Internalized VH were detected by staining with anti-His (Millipore 05-949) and anti-mouse AF488 (Jackson ImmunoResearch 115-545-098). Lysosomes were stained with LAMP-1 (Abcam Ab24170) and anti-rabbit AF647 (Jackson ImmunoResearch 111-605-008). Nuclei were stained using Hoescht stain (Life technologies H3570). Plates were imaged using the IN Cell Analyzer 6000 and Images processed using ImageJ software. The results are shown in
The ability of MMAE-toxin-conjugated VH to internalize into PSMA-expressing cells resulting in cell killing was determined using an in vitro cytotoxicity assay.
Human cells (DU-145, ATCC HTB-81) stably expressing human PSMA or matched PSMA negative cells were seeded into 384-well black clear-bottomed tissue culture treated assay plates at 3000 cells per well in RPMI 1640 medium containing 10% foetal bovine serum, 2 mM L-Glutamine, 1× penicillin/streptomycin, and incubated overnight in a CO2 incubator at 37° C. Cells were then incubated with serially-diluted MMAE-toxin-conjugated VH for 48 or 72 hours. Untreated control wells (cells in the absence of toxin-conjugated VH) and background control wells (media only) were set up on each plate for data normalization. Cell killing was determined following the incubation using the Cell Titer-Glo Cell Viability assay (Promega G7571) according to the manufacturer's instructions. Relative luminescent signal (RLU) was measured using the BMG PHERAstar plate reader. The data was normalized by subtraction of the RLU signal obtained in the background control wells then expressed as a % of the untreated control wells (% survival).
The order of potency observed for the monovalent constructs was VH2.1>VH1.1>VH3.1.
The VH2.1 bivalent construct was observed to be approximately 3-fold more potent than the VH2.1 monovalent construct, however the max kill % was reduced when using the bivalent construct.
The VH1.1 bivalent construct was observed to be approximately 6-fold less potent than the VH1.1 monovalent construct.
The VH3.1 bivalent construct had comparable activity to the VH3.1 monovalent construct, with a slightly improved max kill % being observed.
The order of the VH in the biparatopic construct was found to impact on activity, with 2.5 to 4.6-fold differences being observed. The biparatopic construct in the orientation (N-C) VH2.1-VH1.1 was observed to be less active than when in the orientation VH1.1-VH2.1.
The linker length was observed to have a minimal impact on activity (1.2 to 2.2 fold) in the experiments performed. However for some constructs tested the (G4S)6 linker version was slightly more active.
The biparatopic constructs showed improved activity over the monovalent constructs. The most active biparatopic was found to be approximately 7-fold more active than the most active monovalent.
The most active biparatopic was 4.7-fold less active than the control anti-PSMA mAb; however the DAR for the mAb was 4, whereas the DAR for the biparatopic construct was 1. All constructs showed the expected potency, with the biparatopic 1.1-2.1HDC being of comparable potency when compared to the control ADC, when calculating the IC50 with respect to the toxin concentration.
A stock solution of conjugation reagent, HiPEG™ val-cit-PAB-MMAE (
The HiPEG val-cit-PAB-MMAE moiety is attached via a C terminal His6-tag on a VH. Two histidines are needed for attachment of each “payload” toxin molecule. Humabody VH, DAR=1 species were purified for use in cytotoxicity studies, in some instances an exact DAR of 1 was not achieved (see table below). In the examples herein a single MMAE moiety was attached, but multiple payloads are possible (DARs>1).
Procedure for the Preparation of Control ADC with Drug: Antibody Ratio (DAR) of 3.5
Positive control antibody Pro_006 is an anti-PSMA antibody composed of heavy and light chain sequences described within U.S. Pat. No. 8,470,330 and exemplified as antibody 006.
Conjugation 1:
A solution of mAb Pro_006 (5.07 mg/mL) in reaction buffer (20 mM sodium phosphate, 150 mM NaCl; 20 mM EDTA, pH 7.5), was warmed to 40° C. for 15 min. TCEP (5 mM, 2 equiv. per mAb) was added to the mAb solution, mixed gently and incubated at 40° C. for 1 h. A stock solution of conjugation reagent, mc-val-cit-PAB-MMAE (
Conjugation 2:
A solution of mAb Pro_006 (5.07 mg/mL) in reaction buffer (20 mM sodium phosphate 150 mM NaCl; 20 mM EDTA), pH 7.5 was warmed to 40° C. for 15 min. TCEP (5 mM, 2.75 equiv. per mAb) was added to the mAb solution, mixed gently and incubated at 40° C. for 1 h. A stock solution of conjugation reagent, mc-val-cit-PAB-MMAE (
Production of average DAR 3.5 ADC: ADC 1 (DAR 3.21) and ADC 2 (DAR 4.52) were mixed in a 4:1 mol ratio to prepare an ADC with intermediate DAR. The resulting sample was sterile filtered using 0.2 μm PVDF syringe filtration unit. The DAR of the sample was assessed by HIC (average DAR=3.45).
The in vitro potency of half-life extended HDCs was assessed using the DU145 cell killing assay (72 h).
This material described in Table 36 was generated to test the effect of adding a half-life extension moiety to the HDCs. Half-life-extended versions (HLE) were generated using the MSA-binding VH (SEQ ID No. 528). In vitro potency was assessed using the DU145 cell killing assay (72 h).
Number | Date | Country | Kind |
---|---|---|---|
1600559.7 | Jan 2016 | GB | national |
1605763.0 | Apr 2016 | GB | national |
1605770.5 | Apr 2016 | GB | national |
Filing Document | Filing Date | Country | Kind |
---|---|---|---|
PCT/GB2017/050075 | 1/12/2017 | WO | 00 |