Patent Application
20240254201
The invention discloses an antibody, belonging to the technical field of polypeptides.
Ebola virus (EBOV) can cause acute severe hemorrhagic fever in humans and non-human primates, which is one of the viruses with the highest fatality rate found so far, with a fatality rate up to 90%. EBOV can be transmitted directly through contact, and is highly contagious and lethal. The glycoprotein (GP) spike on the surface of the Ebola virus envelope mediates the attachment and entry of the virus, and is an important target for neutralizing antibodies. The GP gene of Ebola virus is mainly processed into two proteins: one is non-structural GP (secreted glycoprotein, sGP), and the other is structural GP. GP is initially synthesized as a polypeptide, and then cleaved by Furin into subunits GP1 (1-501 amino acid) and GP2 (502-676 amino acid). The two subunits are linked by disulfide bonds, and the GP trimer is anchored on the surface of the particles by the transmembrane domain (TM) within GP2. GP1 consists of several domains including mucin, glycan cap (GC), head and base. The GP structure after Furin cleavage cannot directly induce the membrane fusion process between the EBOV and the host cell. The interactions between GP and several molecules on the surface of the cell membrane mediates the virus adhesion to host cells. However, these molecules are not critical receptors for virus entry. After adhesion, the virus entries cells through endocytosis and pinocytosis mediated by clathrin, and then undergo the transportation of early and late endosomes. GP is digested by cathepsin B and L in late endosomes to remove about 60% of the amino acids on the GP1, including mucin and glycan cap, forming an activated GP (primed GP, GPCL), then a critical process of membrane fusion is activated. GPCL binds to the C domain of endosomal membrane protein Niemann-Pick C1 (NPC1-C) to mediate membrane fusion, which makes the viral RNA enter the cytoplasm to complete viral genome replication and transcription. After the synthesis of the new viral protein, the progeny virions are assembled and budded from the surface of the host cell. Endosomal membrane protein NPC1 is an indispensable host factor in EBOV infection.
Ebola virus is listed as a category A biological/bioterrorism warfare agent by the US NIH and CDC, and it is also classified as one of the pathogens with major dangers and risks to national security and public health. There is still no approved drugs to treat Ebola virus infection. Since discovered in 1976, Ebola virus has caused 13 large-scale epidemics. In 2014, the largest and most difficult-to-control Ebola epidemic in history broke out in West Africa. The pathogen was identified as the Zaire Ebola virus and caused more than 10,000 deaths and more than 25,000 infections (according to The Ebola epidemic Report released by WHO on Feb. 17, 2016). The outbreak spreads outside the African continent for the first time and caused great panic around the world. The high attention of the public and the authorities has rapidly advanced the research on Ebola vaccine and antiviral drugs.
Several promising Ebola vaccine clinical trials including gorilla adenovirus type 3 vector vaccine, adenovirus type 5 vector vaccine, and vesicular stomatitis virus vector vaccine have been rapidly carried out domestically and globally. It is undeniable that the development of effective preventive drug measures is an important goal and it is considered that the preventive measures can save a large number of lives. However, vaccines are difficult to work in some cases, such as: 1) there may be differences among host individuals (such as the weak of immune system of the elderly, young people and immunocompromised persons); 2) the immune effect of the vaccine gradually weakens after prolonged immunization; 3) the immunity of the host stimulated by the vaccine cannot resist high dose of Ebola virus exposure; 4) As most patients seek drug help only after the Ebola virus infection signal appears, Vaccine is difficult to stimulate the effective immune response of the host in a short treatment window. Therefore, the research and development of drugs for the treatment of Ebola virus disease should not be ignored in the process of vaccine development. At present, neutralizing antibodies against Ebola virus may play a protective role in three ways: 1) inhibiting the hydrolysis of GP by cathepsins; 2) blocking the binding of activated GP to the NPC1 receptor; 3) affecting the allosteric process of GP from binding to NPC1 receptor to membrane fusion. Among them, the first two patterns have been confirmed in reports, and the third pattern is speculation in some literatures, and there is no direct proof yet.
Although there is no approved drug for Ebola virus disease, a number of experimental anti-Ebola drugs are being studied, including small interference RNA, antisense oligodeoxynucleotides, nucleotide analogues, antibodies and so on. In August 2018, the Ebola epidemic broke out again in the Democratic Republic of the Congo, resulting in 1154 infections and 731 deaths as of Apr. 7, 2019. Since the outbreak, WHO has approved five drugs in the research stage that can be used for emergency treatment of Ebola virus disease, including three antibody drugs (Zmapp, REGN3470-3471-3479, and mAb114) and two small molecule drugs (Remdesivir and Favipiravir). Among them, the antibody drug “Zmapp” made from a mixture of three monoclonal antibodies and its optimized option “MIL77” successfully saved many lives during the West Africa Ebola outbreak in 2014. They have far better effect and treatment window length than other kinds of antiviral drugs, the drug safety and patient cure rate being improved greatly, and the great encouragement being given to the people. The application of antibody drugs in the treatment of filovirus diseases has attracted worldwide attention and become a hot spot in the field of drugs for the treatment of Ebola virus diseases.
Zmapp is a cocktail treatment strategy composed of three human-mouse chimeric monoclonal antibodies (c2G4, c4G7, and c13C6) expressed by the tobacco system, in which c2G4 (epitopes are C511, N550, G553, C556) and c4G7 (epitopes are C511, D552, C556) bind to the GP2 subunit, both sharing with overlapped epitopes; c13C6 (epitopes are T270 and K272) binds to the glycan cap at an approximately vertical angle to GP trimer. MIL77 is an optimization of Zmapp. MIL77-1/-2/-3 contains the variable regions of c2G4, c4G7, and c13C6, respectively. However, MIL77-1/-2/-3 have humanized framework regions and are expressed in CHO cells. The cocktail combination therapy of MIL77-1 and ML77-3 can achieve 100% protective activity against EBOV in non-human primates 72 hours post infection.
However, the three anti-Ebola virus antibody drugs approved by the WHO for emergency use only target Zaire Ebola virus (ZEBOV). About 35% of Ebola outbreaks are caused by other types of ebolavirus such as Sudan ebolavirus (SUDV) and Bundibugyo ebolavirus (BDBV). Related research has reported some monoclonal antibodies that can broadly neutralize multiple types of Ebolavirus, bringing new enlightenment to the treatment of Ebola virus disease. The development of monoclonal antibodies with unique epitopes and capable of broadly neutralizing multiple ebolaviruses has become a major technical requirement in this field. If there are monoclonal antibodies against ebolavirus with conservative epitopes, broader spectrum and better protective activity, there will be better and more options for the treatment of Ebola virus disease. Therefore, the objective of the invention is to provide a broad spectrum monoclonal antibody against Ebolavirus which can target a unique epitope, and further to provide its application in the preparation of drugs for the treatment of Ebola virus disease.
For the above objective, the present invention firstly provides an isolated monoclonal antibody that specifically binds to Ebola virus glycoprotein GP2 subunit, wherein the CDR1, CDR2 and CDR3 of light chain variable domain of the said antibody has the amino acid sequence as 27-32 of SEQ ID NO. 1, 50-52 of SEQ ID NO. 1 and 89-96 of SEQ ID NO. 1 respectively; the CDR1, CDR2 and CDR3 of heavy chain variable domain of the said antibody has the amino acid sequence as 26-33 of SEQ ID NO. 5, 51-58 of SEQ ID NO. 5 and 97-113 of SEQ ID NO. 5.
In a preferred embodiment, the light chain variable domain of the said antibody has the amino acid sequence shown in SEQ ID NO. 1, the heavy chain variable domain of the said antibody has the amino acid sequence shown in SEQ ID NO. 5.
In a more preferred embodiment, the light chain constant region of the said antibody has the amino acid sequence shown in SEQ ID NO. 3, and the heavy chain constant region of the said antibody has the amino acid sequence as shown in SEQ ID NO. 7.
Secondly, the present invention also provides an isolated nucleic acid molecule encoding the light chain and heavy chain of the above-mentioned monoclonal antibody, the said isolated nucleic acid molecule encoding the light chain variable domain has the nucleotide sequence shown in SEQ ID NO. 2, and the isolated nucleic acid molecule encoding the heavy chain variable domain has the nucleotide sequence shown in SEQ ID NO. 6.
In a preferred embodiment, the said isolated nucleic acid molecule encoding the light chain constant region has the nucleotide sequence shown in SEQ ID NO. 4, and the isolated nucleic acid molecule encoding the heavy chain constant region has the nucleotide sequence shown in SEQ ID NO. 8.
Thirdly, the present invention also provides a functional element expressing the above-mentioned isolated nucleic acid molecule.
In a preferred embodiment, the said functional element is a linear expression cassette.
Fourthly, the present invention provides a host cell comprising the above-mentioned linear expression cassette, wherein the host cell is 293T cell.
Finally, the present invention provides the above-mentioned monoclonal antibody for use as a drug for the treatment of Ebola virus disease.
The monoclonal antibody 2G1 against the envelope glycoprotein of ebolavirus provided by the invention has unique CDR regions, showing excellent sub-nanomolar affinity with GPdMucin. The association rate constant Ka=5.11×104 (1/Ms), the dissociation rate constant Kd=3.75×10−5 (1/s), and the affinity constant KD=7.34×10−10 (M). It has good binding activity to EBOV GP, BDBV GP, SUDV GP and RESTV GP, with EC50 values of 0.0059 μg/mL, 0.0075 μg/mL, 0.0048 μg/mL and 0.026 μg/mL respectively, showing excellent broad-spectrum in antigen binding ability. Compared with the control antibody, 2G1 can effectively neutralize EBOV, BDBV and SUDV pseudoviruses in vitro. The neutralizing activity of 2G1 increases with the increase of the concentration of 2G1, and nearly 100% protection against three Ebola pseudoviruses could be achieved at the concentration of 1 μg/mL. The neutralizing activity of 2G1 monoclonal antibody against EBOV-eGFP-Mayinga authentic virus is better than that of the positive control antibody in vitro. Neutralization assay in vitro shows that 2G1 is a good broad-spectrum neutralizing monoclonal antibody against Ebolavirus. The result of competitive binding assays shows that the binding epitopes of 2G1 are different from those of control antibodies, suggesting that 2G1 has the potential to form a cocktail therapy with other neutralizing antibodies.
The binding stability test shows that there is no obvious change in the binding activity of 2G1 to GPdMucin under four different pH conditions. The binding of 2G1 to GP is stable and not affected by the low pH environment of late endosomes, which lays a foundation for its neutralization.
Animal challenge experiments show that the 2G1 treatment groups can get complete protected after mice challenged with the EBOV (Mayinga) virus strain and guinea pigs challenged with SUDV.
The antibody provided by the invention also has unique interaction sites, which are different from the sites of antibodies against ebolavirus envelope glycoprotein previously reported, suggesting that 2G1 has the potential to form a cocktail therapy with other neutralizing antibodies.
The present invention is further described with specific examples below, and the advantages and features of the present invention will become clearer with the description. However, these examples are only exemplary, and do not constitute any limitation on the protection scope defined by the claims of the present invention.
After obtaining informed consent form, 5 mL of blood samples were collected from subjects in clinical trials of recombinant Ebola vaccine 28 days after the second immunization for subsequent studies.
As shown in
As shown in
4) Labeling of GPΔMuc with FITC
Fluorescence-labeled antigen is needed to sort specific memory B cells. The method of Fluorescein Isothiocyanate (FITC) labeling GPdMucin is described as follows:
PBMCs are isolated from blood samples using a Ficoll density gradient centrifugation method, details are described as follows:
The volume of separation solution, anticoagulant undiluted blood, and PBS is 1:1:1.
Cell sorting result is shown in
Eighty GPdMucin-specific memory B cells are sorted, and all of the following specific primers for heavy chain, kappa light chain, or lambda light chain are added to each reaction system (see Table 1 for primer sequences).
The PCR reaction system consists of 6 μL 5× buffer, 1.2 μL dNTP, 1.2 μL reverse transcriptase, primers as mentioned above, single cell as a template, and add water up to a final volume of 30 μL.
The PCR reaction procedures are described as follows: reverse transcription 30 min at 50° C.; pre-denaturation 15 min at 95° C.; denaturation 40 s at 95° C., annealing 30 s at 55° C., elongation 1 min at 72° C. (40 cycles); elongation 10 min at 72° C.
Using the reverse transcription product as a template to amplify H, K, and k genes through nested PCR (see Table 2 for primer sequences). The specific processes are described as follows:
The PCR reaction system contains: 2.5 μL of 10× buffer, 0.5 μL of 10 mM dNTP, 0.25 μL of DNA polymerase, primers as mentioned above, 1 μL of reverse transcription product, and add water up to a final volume of 25 μL. The PCR reaction procedures are described as follows: pre-denaturation 4 min at 94° C.; denaturation 30 s at 94° C., annealing 30 s at 57° C., elongation 45 s at 72° C. (40 cycles); elongation 10 min at 72° C.
A clone that successfully amplified both the heavy chain and light chain genes from a single cell is considered to be a successfully paired antibody. Pipette 5 μL of the nested PCR amplification product and analyze in 1% agarose gel electrophoresis. The paired positive clones are sequenced, and then the antibody variable regions are determined using Vector NTI software and IMGT website. Antibodies are expressed and followed by functional verifications. The agarose gel electrophoresis identification results of nested PCR amplification products of H, κ, and λ genes are shown in
Through the above-mentioned reverse transcription reaction, 25 paired antibody sequences are obtained from single-cell clones. In view of the time-consuming and labor-intensive of traditional cloning and expression, the method of constructing linear expression cassettes can quickly express antibodies. The basic principle of this method is to directly fuse the promoter sequence (GenBank number: X03922.1), the coding sequence of the antibody leader sequence, the variable region sequence (obtained from single cell amplification), the constant region sequence (synthesized by Sangon Biotech), and a poly A tail (GenBank number: X03896.1). The linear forms of antibodies heavy and light chain genes are co-transfected into cells for expression. The specific method is described as follows:
a) Using pSec Tag2 (Invitrogen) as a Template to Amplify the Promoter-Leader Sequence Fragment and the Poly a Tail Fragment.
The PCR reaction system for amplifying the promoter-leader sequence fragment contains: 1 ng template plasmid pSec Tag2 (Invitrogen), 5 μL 10× buffer, 1 μL of 10 mM dNTP, 0.5 μL DNA polymerase, primer 5′CMV-F (CGATGTACGGGCCAGATATACGCGTTG), primer 3′leader-sequence (GTCACCAGTGGAACCTGGAACCCA), and add water up to 50 μL. The PCR reaction system for amplifying the poly A tail fragment contains: 1 ng template plasmid pSec Tag2 (Invitrogen), 5 μL 10× buffer, 1 μL of 10 mM dNTP, 0.5 μL DNA polymerase, primer 5′POLY(A) (GCCTCGACTGTGCCTTCTAGTTGC), primer 3′POLY(A) (TCCCCAGCATGCCTGCTATTGTCT), and add water up to 50 μL.
The PCR reaction procedures are: pre-denaturation at 94° C. for 4 min; followed by 94° C. for 30 s, 60° C. for 30 s, 72° C. for 1 min (30 cycles); and finally elongation at 72° C. for 10 min.
The PCR system contains for amplifying the H chain constant region contains: 10 ng heavy chain constant region template, 5 μL 10× buffer, 1 μL of 10 mM dNTP, 0.5 μL DNA polymerase, primer 5′CH (ACCAAGGGCCCATCGGTCTTCCCC), primer 3′CH (GCAACTAGAAGGCACAGTCGAGGCTTTACCCGGAGACAGGGA), and add water up to 50 μL.
The PCR system contains for amplifying the κ chain constant region contains: 10 ng κ chain constant region template, 5 μL 10× buffer, 1 μL of 10 mM dNTP, 0.5 μL DNA polymerase, primer 5′CK (ACTGTGGCTGCACCATCTGTCTTC), primer 3′CK (GCAACTAGAAGGCACAGTCGAGGCACACTCTCCCCTGTTGAAGCT), and add water up to 50 μL.
The PCR system contains for amplifying the λ chain constant region PCR system contains: 10 ng λ chain constant region template, 5 μL 10× buffer, 1 μL of 10 mM dNTP, 0.5 μL DNA polymerase, primer 5′CX (GAGGAGCTTCAAGCCAACAAGGCCACA), primer 3′CX (GCAACTAGAAGGCACAGTCGAGGCTGAACATTCTGTAGGGGCCAC), and add water up to 50 μL.
The PCR reaction procedures are: pre-denaturation 4 min at 94° C.; followed by 94° C. for 30 s, 60° C. for 60 s, 72° C. for 3 min (30 cycles); and finally elongation at 72° C. for 10 min.
The PCR system contains: 10 ng reverse transcription PCR product, 5 μL 10× buffer solution, 1 μL of 10 mM dNTP, 0.5 μL DNA polymerase, the primers are shown in Table 3, and add water up to 50 μL.
The PCR reaction procedures are: pre-denaturation 4 min at 94° C.; followed by 94° C. for 30 s, 60° C. for 30 s, 72° C. for 3 min (30 cycles); and finally elongation at 72° C. for 10 min.
After analyzed in 1% agarose gel electrophoresis, the above PCR products are purified using the Gel Extraction Kit (OMEGA).
A schematic diagram of the linear expression cassette is shown in
The PCR reaction system contains:
10 ng purified promoter-leader sequence fragment, 10 ng heavy chain/light chain variable region fragment, 10 ng heavy chain/light chain constant region fragment, 10 ng poly A tail fragment, 2.5 μL 10× buffer, 0.5 μL of 10 mM dNTP, 0.25 μL DNA polymerase, primer 5′CMV-F (CGATGTACGGGCCAGATATACGCGTTG), 3′POLY(A) (TCCCCAGCATGCCTGCTATTGTCT), and add water up to 25 μL.
The PCR reaction procedures are: pre-denaturation 4 min at 94° C.; followed by 94° C. for 30 s, 60° C. for 30 s, 72° C. for 3 min (30 cycles); and finally elongation at 72° C. for 10 min.
PCR products are directly purified using Gel Extraction Kit (OMEGA).
PCR products are quantified using NanoVue Plus (GE Healthcare).
293T cells are seeded into 24-well cell culture plates at a density of 2×105/mL and then incubated overnight at 37° C. in a cell incubator containing 5% CO2.
On the next day, 1 μg each of the paired heavy and light chain linear expression cassettes is mixed with 4 μL of Turbofect (Thermo Scientific, R0531) transfection reagent in 200 μL serum-free MEM medium. The mixture is incubated for 15-20 min at room temperature and added dropwise to the 293T cells that are cultured overnight. After expression for 48 hours at 37° C., 5% CO2, the supernatant is collected for binding identification.
Among 25 antibodies, 10 Ebola GP specific antibodies are identified, including 2A1, 2G1, 2F4, 2E5, 2G5, 2C6, 2A7, 2C7, 2H7, and 2A10. The relative binding activities of 25 monoclonal antibodies is shown in
9) Screening of Antibodies with Broad-Spectrum Binding Activity by ELISA
In order to obtain antibodies with a broad spectrum of binding to multiple Ebolaviruses, the cross-reactivity of antibodies is analyzed. The day before the experiment, 96-well ELISA plates are coated with 1 μg/mL EBOV GP, BDBV GP, SUDV GP or RESTV GP. The subsequent procedures are same as described in step 8).
The results are shown in
2G1 has good broad-spectrum binding activity, and its sequence is described as follows:
The amino acid sequence of the light chain variable region is shown in SEQ ID NO. 1. CDR1, CDR2, and CDR3 of the light chain variable region have the amino acids 27-32, 50-52, and 89-96 of SEQ ID NO. 1, respectively. The coding sequence of variable region of light chain is shown in SEQ ID NO. 2. The amino acid sequence of the light chain constant region is shown in SEQ ID NO. 3, and the coding sequence of the light chain constant region is shown in SEQ ID NO. 4.
The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO. 5. CDR1, CDR2, and CDR3 of the heavy chain variable region have the amino acids 26-33, 51-58, and 97-113 of SEQ ID NO. 5, respectively. The coding sequence of variable region of heavy chain is shown in SEQ ID NO. 6. The amino acid sequence of the heavy chain constant region is shown in SEQ ID NO. 7, and the coding sequence of the heavy chain constant region is shown in SEQ ID NO. 8.
The expression plasmid of 2G1 is constructed and then expressed for antibody preparation. The method is described as follows:
Monoclonal antibody 2G1 has good binding activity to EBOV GP, BDBV GP, SUDV GP, and RESTV GP, with EC50 values of 0.0059 μg/mL, 0.0075 μg/mL, 0.0048 μg/mL, and 0.026 μg/mL, respectively (data as shown in
The affinity of 2G1 to GPdMucin is determined by BIACORE 3000. Firstly, the anti-human IgG Fc antibody is covalently coupled to a CM5 sensor chip. 2G1 is used as a ligand at a concentration of 1 μg/mL and bind for 30 s at a flow rate of 10 L/min. The injection needle and integrated fluidic circuit (IFC) microfluidic system are cleaned with HEPES buffer at a flow rate of 30 L/min. GPdMucin is used as an analyte at seven concentrations of 800 nM, 400 nM, 200 nM, 100 nM, 50 nM, 25 nM, and 12.5 nM, respectively. Each concentration of GPdMucin binds for 6 min at a flow rate of 30 μL/min and then dissociates for 30 min. The chip is regenerated before the concentration of analyte is changed. The final data curves are fitted and analyzed by BIA evaluation software (as shown in
The software analysis calculated the association rate constant (Ka) of 2G1 is 5.11×104 (1/Ms), the dissociation rate constant (Kd) is 3.75×10−5 (1/s), and the affinity constant KD=7.34×10−10 (M). 2G1 has a level of sub-nanomolar affinity to GPdMucin.
Packaged EBOV, BDBV and SUDV pseudoviruses based on HIV backbone to evaluate the neutralizing activity of 2G1 in vitro. The evaluation method is described as below:
Compared with the control antibody, 2G1 can effectively neutralize EBOV, BDBV, and SUDV pseudoviruses in vitro. The neutralizing ability of 2G1 increases with the increase of concentration, and the protection of 2G1 to three pseudotyped Ebolaviruses can nearly reach to 100% at a concentration of 1 μg/mL (as shown in
Seed Vero E6 cells into 96-well tissue culture plates (Corning) and ready to infect when density reach to 85%˜90%. Pre-incubate 100 PFU of EBOV-eGFP-Mayinga virus with antibodies 2G1, CA45, and MIL77-1, respectively, in blank DMEM at 37° C. for 1 h. Antibodies are diluted at 1:3 ratio starting at 100 μg/mL. Add the virus-antibody mixture to Vero E6 cells and infect at 37° C., 5% CO2 for 1 h before replace medium with fresh DMEM containing 12% FBS. After incubating for 48 h, cells are fixed with 10% phosphate buffered formalin (Fisher). Use iSpot FluoroSpot Reader System (Advanced Imaging Devices) to count fluorescent plaques.
In the EBOV-eGFP-Mayinga authentic virus neutralization test, the IC50/IC 90 value of 2G1 is 2.80 μg/mL and 3.23 μg/mL, respectively; the IC50/IC90 value of CA45 is 8.51 μg/mL and 12.99 μg/mL, respectively; the IC50/IC90 value of MIL77-1 is 3.12 μg/mL and 82.01 μg/mL, respectively. For EBOV-eGFP-Mayinga authentic virus, 2G1 shows better in vitro neutralization ability than control antibodies (as shown in
According to the structural and functional characteristics, GP can be divided into multiple domains including glycan cap, mucin like domain, receptor binding region, internal fusion loop, HR region, and so on. Since 2G1 exhibits a good broad-spectrum neutralization ability, and several truncated GPs are designed to analyze its approximate binding region. In addition to the well-known GPdTM, GPdMucin, GP1, sGP and GPCL in the reports, several new forms are produced including: GP33-310; 463-558, GP33-227, GP33-158, GP95-295, GP227-295. GP33-310; 463-558, resulting from a removal of the heptad repeat region on GPdMucin backbone; GP33-227, comprising a truncated sGP without the glycan cap (GC) domain; GP33-158, comprising most of the base and head domains; GP95-295, a sGP variant without the base region; GP158-295, a sGP variant without the base region and the head region; GP227-295, comprising only the most part of the glycan cap. GPCL is obtained by removing the glycan cap by thermolysin on the basis of GPdMucin, without the need to construct an expression plasmid. The structure diagram of truncated GPs are shown in
The method using truncated GPs to analyze the 2G1 binding region is described as follows:
The binding EC50 value of 2G1 to GPdMucin is 0.0037 μg/mL, which is basically same as the value to GPdTM. The binding EC50 value of 2G1 to GP1 is 0.8075 μg/mL, which is more than 100 times lower than GPdTM and GPdMucin, suggesting that the GP2 subunit plays a key role for binding of 2G1. Although the maximum binding of 2G1 to GPCL is reduced to about half of the maximum binding to GPdTM, its EC50 value is 0.019 μg/mL without obvious reduce. GPCL contains the whole GP2 subunit and part of the GP1 subunit, while sGP contains the part of GPCL on the GP1 subunit. However, 2G1 cannot bind sGP, which further emphasizes the importance of GP2 for 2G1 recognition. Relativities of 2G1 to truncated GPs are shown in
Competitive binding ELISA is conducted to analyze the epitopes of 2G1. Other neutralizing antibodies and MIL77-1/2/3 with the known binding epitopes are used as contrasts. Whether or not there is overlapped epitopes between the detecting antibody and the competitive antibody incubated together is determined by the result whether or not the binding of the detecting antibody to GP is blocked by the competitive antibody. Methods are described as below:
The competitive binding value is calculated through following formula:
There is a strong competition if the value is <30, weak competition if the value is between 30 and 60, and non-competition if the value is >60. Antibodies can be well blocked by themselves, and these antibodies can be divided into four groups based on the competition data. Among them, there are two groups bind to the GP1 and GP2 subunit, respectively. There is barely no competition between 2G1 and other antibodies binding to the GP2 subunit, including the non-neutralizing antibody 5B12 and the neutralizing antibody MIL77-1/2. The competition data indicates that the epitopes of 2G1 are different from control antibodies, suggesting that 2G1 has the potential to form a cocktail combination therapy with other neutralizing antibodies. (Competition data as shown in
Dock the antigen with antibody molecules using a Dock Proteins (ZDOCK) protocol in Discovery Studio 4.5. The structure of EBOV GP (PDB ID: 5KEL) is used as the receptor and the homologous constructed model of antibody 2G1-Fab is defined as the ligand. A total of 54,000 docking simulation poses of antigen-antibody complexes are generated following the ZDOCK rigid docking algorithm. Combined with the ZRANK scoring algorithm for ranking, 2000 poses are selected.
Calculate the following characteristic values of the antigen-antibody interface of each docking simulation conformation.
Take the ZDOCK score and ZRANK score given by Discovery Studio 4.5 as the feature values X1 and X2, respectively. The probability value of the multiple linear regression (MLR probability) is calculated according to the following formula:
The 2,000 docking simulation conformations are reordered in descending order of MLR probability, and the first 10 poses are listed. Among them, pose_96 ranks first, and the score value is much higher than other poses (as shown in
The pose_96 is further analyzed with LigPlot+ software, and the amino acids and possible interactions on the binding interface of GP and 2G1 are predicted (as shown in
In
Analyze the VH/Vκ of 2G1 on the IMGT website (http://www.imgt.org/), and design and synthesize the 2G1 heavy and light chain inferred germline (IGL) gene VH/Vκ-IGL.
Cross-pair the 2G1 light and heavy chain germline genes (VH/Vκ-IGL) with the wild-type sequence (VH/Vκ-WT) to produce 2G1 reassortants. The difference of binding ability between the 2G1 reassortants to GP and the wild type to GP is detected through ELISA to analyze the effect of the heavy chain and light chain playing on the antibody binding.
The binding EC50 values of 2G1-WT, 2G1-HWT/κIGL, 2G1-HIGL/κWT and 2G1-IGL to GP are 2.7 ng/mL, 12.1 ng/mL, 152.3 ng/mL and 251.2 ng/mL, respectively. Compared with 2G1-WT, the binding activity of 2G1-HWT/κIGL with light chain rematched to GP decreased by 4.4 times, while that of 2G1-IGL and 2G1-HIGL/κWT with heavy chain rematched decreased by 55.4 times and 91.4 times, respectively. The results indicate that the heavy chain plays a critical role for 2G1 binding to GP (as shown in
The heavy chain of 2G1 is more important for its binding, and the key amino acids in CDR regions are further analyzed by alanine scanning mutation. The amino acids of the 2G1 heavy chain CDR1/2/3 are mutated to alanine (alanine to serine) to produce 2G1 mutants, and the change in binding and neutralizing activities of these mutants comparing with the wild type 2G1 is determined. As shown in
After binding to the GP on the surface of the virus, antibodies enter the host cell together with the virus particle. In the acidic environment (pH≈5.5) of the late endosome, GP binds to the receptor NPC1-C after being hydrolyzed. The binding promote the fusion of the virus with the endosomal membrane and the viral genome is released. In order to further study whether the interaction of 2G1 with GP is affected by acidic environment, the binding ability of 2G1 to GP under conditions of pH 7.5, pH 6.5, pH 5.5, and pH 4.5 in vitro is determined. The ELISA method is the same as that described in example 2.
Under four different pH conditions, the binding ability of 2G1 to GPdMucin is basically unreduced. The binding of 2G1 to GP is stable and not easily affected by the low pH environment of the late endosomes, providing a basis for its neutralization capacity (curves as shown in
After ebolavirus enters host cells, the glycan cap and mucin domain are removed from GP by enzymes in the acidic environment of the late endosome, and the GPCL structure is formed. Compared with native GP, the epitopes of GPCL for recognition of receptor NPC1-C are exposed. If 2G1 exerts protective effect by blocking the binding of GPCL to the receptor, then after GPCL binds to 2G1, it will not be able to bind to NPC1-C.
Adjust the concentration of GPdMucin to 2 mg/mL with PBS (pH 7.5), and add thermolysin (SIGMA, T7902-25MG) at a final concentration of 0.5 mg/mL, and incubate at 37° C. for 1 h. Add 0.5 mM Phosphoramidon (Sigma-Aldrich, R7385) to stop the reaction. Use a 0.5 mL Millipore centrifugal filter tube with 50 kDa molecule cut-off to concentrate and buffer-exchange the reaction system. Protein sample is filtered through a 0.20 μm micro filter (Millex-LG, SLLGR04NL) and purified with a Superdex 200 Increase 10/300 GL gel column (GE Healthcare).
Plates are coated overnight with 1 μg/mL GPCL at 4° C. After blocking for 1 h, plates are incubated with antibodies in 3-fold dilutions starting at 50 μg/mL for 30 min at 37° C. Plates are washed and incubated with 5 μg/mL biotinylated NPC1-C at 37° C. for 30 min. Bound NPC1-C is detected at 450/630 nm using HRP-conjugated streptavidin. MR72, a previously reported competitive antibody against NPC1-C, is used as a positive control.
The control antibody MR72 can block the binding of GPCL with NPC1-C to 30% at a concentration of 50 μg/mL. However, 2G1 does not show an obvious inhibiting effect, indicating that it does not exert a protective effect by blocking the binding of GPCL to the receptor (results as shown in
Mix 2 μg of GPdmucin-His6 expressed by Expi293 with 0.5 μg, 5 μg and 50 μg of 2G1 in 20 μL PBS, respectively, and incubate at 37° C. for 30 min. Add 1 μL of thermolysin at 1 mg/mL to a final concentration of 50 μg/mL, and incubate at 37° C. for 30 min. Boil the protein sample in a metal bath at 99° C. for 10 min immediately after adding the non-reduced loading buffer. Dilute 1 μL of reaction system (containing about 80 ng of initial GPdMucin) with 1× loading buffer to 5 μL, and then electrophoresis in 8-16% gel (GenScript, M00660). Transfer the protein to nitrocellulose membrane and use Rb pAb to 6× His taq-HRP (Abcam) to detect uncleaved GPdMucin.
2G1 can effectively block GPdMucin from being cleaved by thermolysin. With the increase of the concentration of 2G1, the amount of uncleaved GPdMucin (about 70 kDa) and the intermediate digestion product of GPdMucin-IMF (about 50 kDa) increase significantly, and the sum of the two forms is close to the initial amount of GPdMucin, while the complete cleaved product GPCL (about 38 kDa) are barely undetectable. This suggests that 2G1 might play a protective role in vivo by blocking the digestion of GP by enzymes (as shown in
Female BALB/c healthy mice aged 6-8 weeks are randomly assigned to several groups with 10 mice in each group. Mice are challenged with 100 PFU mice adapted EBOV virus (Mayinga) via the intraperitoneal route, and treated with 100 μg of 2G1 or the same volume of PBS 1 day or 2 days post challenge.
The two groups of mice treated with 100 μg of 2G1 on the 1 day or 2 days post challenge all survived, while all mice treated with PBS died within seven days (as shown in
Female Hartley guinea pigs (250-300 g) aged 4-6 weeks are randomly assigned to several groups with 6 animals in each group. Guinea pigs are challenged with 1000×LD50 guinea pig adapted SUDV virus in 1 mL DMEM medium via the intraperitoneal route. Guinea pigs are treated with a single dose of 5 mg or 2.5 mg of 2G1 on 3 or 4 days post challenge. Guinea pigs in the control group are treated with equal volume of PBS. The clinical symptoms of guinea pigs such as disease, survival and weight change are observed lasting for 28 days.
Regardless of whether treated with a single dose of 5 mg or 2.5 mg 2G1 on the 3rd or 4th day after SUDV challenge, all guinea pigs survived (as shown in
The monoclonal antibody provided by the present invention is easy for industrial production, so the present invention is industrially applicable.
| Number | Date | Country | Kind |
|---|---|---|---|
| 201811309856.1 | Nov 2018 | CN | national |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/CN2019/086336 | 5/10/2019 | WO |
