Multiplex capture of gene and protein expression from a biological sample

Information

  • Patent Grant
  • 11739381
  • Patent Number
    11,739,381
  • Date Filed
    Monday, July 18, 2022
    2 years ago
  • Date Issued
    Tuesday, August 29, 2023
    a year ago
Abstract
Provided herein are methods, compositions, and kits for preparing biological samples for multiplex spatial gene expression and proteomic analysis, such as determining a location of a nucleic acid analyte and a protein analyte in a biological sample.
Description
SEQUENCE LISTING

This application contains a Sequence Listing that has been submitted electronically as an XML file named 47706-0307001.xml. The XML file, created on Jul. 8, 2022, is 15000 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety.


BACKGROUND

Cells within a tissue of a subject have differences in cell morphology and/or function due to varied analyte levels (e.g., gene and/or protein expression) within the different cells. The specific position of a cell within a tissue (e.g., the cell's position relative to neighboring cells or the cell's position relative to the tissue microenvironment) can affect, e.g., the cell's morphology, differentiation, fate, viability, proliferation, behavior, and signaling and cross-talk with other cells in the tissue.


Spatial heterogeneity has been previously studied using techniques that only provide data for a small handful of analytes in the context of an intact tissue or a portion of a tissue, or provides substantial analyte data for dissociated tissue (i.e., single cells), but fail to provide information regarding the position of the single cell in a parent biological sample (e.g., tissue sample).


Moreover, multiplex detection of different analytes (e.g., nucleic acid, protein, etc.) in the same biological sample, while preserving spatial information remains a challenge in the field. Current methods include transcriptome wide spatial detection or various protein detection methods, however, methods that accomplish both within the spatial context of a biological sample are still needed.


SUMMARY

Multiplex detection of different analytes (e.g., nucleic acid, protein, etc.) in the same biological sample, while preserving spatial information remains a challenge in the field. As described above, current methods include transcriptome wide spatial detection or various protein detection methods, including immunofluorescence, however, methods that detect both spatial gene expression and spatial protein expression within the spatial context of a biological sample simultaneously are still needed.


Provided herein are methods for determining the spatial location of a nucleic acid and a protein from a biological sample including: a) providing a spatial array including a first and second plurality of capture probes where each plurality includes a spatial barcode and a capture domain, b) contacting the spatial array with a biological sample, c) contacting the biological sample with (i) a plurality of analyte capture agents, where an analyte capture agent includes an analyte binding moiety and an oligonucleotide including an analyte binding moiety barcode and an analyte capture sequence, where the analyte capture sequence includes a sequence complementary to a second plurality of capture domains, and (ii) a plurality of templated ligation probes, where one of the templated ligation probes includes a sequence complementary a first plurality of capture domains, d) binding the analyte binding moiety of the analyte capture agent to a target protein, e) hybridizing the templated ligation probes to a target nucleic acid and ligating the probes to produce ligation products, f) hybridizing the ligation products to the first plurality of capture domains and the analyte capture sequences of the bound analyte capture agents to the second plurality of capture domains on the spatial array, and g) determining the sequence or a portion thereof of a captured ligation product, or a complement thereof, and the sequence of the spatial barcode of the capture probe, or a complement thereof, that is associated with the ligation product, and the sequence of the analyte binding moiety barcode, or a complement thereof, of the bound analyte capture agent, thereby determining the spatial location of a nucleic acid and the protein from the biological sample.


In some embodiments, the capture domains of the first plurality of capture probes are defined non-homopolymeric capture sequences or homopolymeric sequences. In some embodiments, the capture domains of the second plurality of capture probes are defined non-homopolymeric sequences or homopolymeric capture sequences. In some embodiments, capture domains of the first plurality of capture probes are different from the capture domains of the second plurality of capture probes. In some embodiments, homopolymeric sequence includes a polyT sequence and the non-homopolymeric sequence includes a fixed sequence or a degenerate sequence. In some embodiments, the fixed sequence includes at least one sequence selected from SEQ ID NO: 1 through SEQ ID NO: 11.


In some embodiments, the nucleic acid is a RNA or DNA. In some embodiments, the RNA is a mRNA.


In some embodiments, the biological sample is a tissue sample. In some embodiments, tissue sample is a fresh-frozen tissue sample or a fixed tissue sample, where the fixed tissue sample is a formalin-fixed tissue sample, an acetone fixed tissue sample, a paraformaldehyde tissue sample, or a methanol fixed tissue sample. In some embodiments, the biological sample is a tissue section, where the tissue section is a fresh-frozen tissue section or a fixed section, and optionally, where the fixed tissue section is a formalin-fixed paraffin-embedded tissue section, an acetone fixed tissue section, a paraformaldehyde tissue section, or a methanol fixed tissue section. In some embodiments, the tissue sample is derived from a biopsy sample or a whole rodent embryo.


In some embodiments, before step (b) the biological sample is deparaffinized and decrosslinked. In some embodiments, the decrosslinking includes the use of a buffer. In some embodiments, the buffer includes Tris-EDTA buffer at a pH from about 8 to about 10 and a temperature from about 60° C. to about 80° C. In some embodiments, the buffer includes citrate buffer at a pH from about 5 to about 7 and a temperature from about 70° C. to about 100° C.


In some embodiments, the hybridizing the templated ligation products and the analyte capture sequences of the bound analyte capture agents includes permeabilizing the biological sample.


In some embodiments, the analyte capture sequence of the oligonucleotide is blocked prior to binding to the target protein. In some embodiments, the oligonucleotide of the analyte capture agent is blocked by a blocking probe. In some embodiments, the blocking probe is removed prior to hybridizing the analyte capture sequence of the oligonucleotide of the analyte capture sequence to the capture domain of the capture probe.


In some embodiments, the determining in step (g) includes: a) extending the captured ligation products and the captured oligonucleotides of the analyte capture agents, where the extension products include the spatial barcode or a complement thereof, b) releasing the extension products, or complements thereof, from the spatial array, c) producing a library from the released extension products or complements thereof, and d) sequencing the library.


In some embodiments, prior to step (c) the method includes pre-amplifying the extension products, or complements thereof.


In some embodiments, the complement of the oligonucleotide of the analyte capture agent includes an analyte binding moiety barcode specific to the analyte binding moiety of the analyte capture agent.


In some embodiments, the first and second plurality of capture probes include a cleavage domain, one or more functional domains, a unique molecular identifier, and combinations thereof.


In some embodiments, the method includes imaging the biological sample. In some embodiments, the imaging includes one or more of expansion microscopy, bright field microscopy, dark field microscopy, phase contrast microscopy, electron microscopy, fluorescence microscopy, reflection microscopy, interference microscopy and confocal microscopy.


In some embodiments, the method includes staining the biological sample. In some embodiments, the staining includes hematoxylin and eosin. In some embodiments, the staining includes the use of a detectable label selected from the group consisting of a radioisotope, a fluorophore, a chemiluminescent compound, a bioluminescent compound, or a combination thereof.


In some embodiments, the spatial array includes one or more protein dilution series.


Also provided herein are spatial array including: a) a plurality of capture probes including spatial barcodes and a first plurality of capture domains hybridized to a plurality of templated ligation products, and b) a plurality of capture probes including spatial barcodes and a second plurality of capture domains hybridized to a plurality of oligonucleotides from analyte capture agents, where the oligonucleotides include an analyte capture sequence and an analyte binding moiety barcode.


In some embodiments, the capture probes include cleavage domains, unique molecular identifiers, one or more functional sequences, or a combination thereof.


In some embodiments, the first plurality of capture domains are homopolymeric sequences or defined non-homopolymeric sequences. In some embodiments, the second plurality of capture domains are homopolymeric sequences or defined non-homopolymeric sequences. In some embodiments, the first plurality of capture domains are poly(T) sequences. In some embodiments, the spatial array includes one or more protein dilution series.


Also provided herein are kit including: a) a spatial array including a plurality of capture probes, where the capture probes include spatial barcodes and where the plurality of capture probes include a first plurality of first capture domains and a second plurality of second capture domains, b) one or more analyte capture agents, c) one or more nucleic acid templated ligation probe pairs, and d) one or more enzymes and buffers for practicing any of the methods described herein.


Also provided herein are methods for determining the spatial location of a nucleic acid and a protein in a diseased biological sample including: a) providing a spatial array including a first and a second plurality of capture probes where each plurality includes a spatial barcode and a capture domain, b) contacting the diseased biological sample with the spatial array, c) contacting the diseased biological sample with: (i) a plurality of analyte capture agents, where an analyte capture agent includes an analyte binding moiety and an oligonucleotide including an analyte binding moiety barcode and an analyte capture sequence, where the analyte capture sequence includes a sequence complementary to a second plurality of capture domains, and (ii) a plurality of templated ligation probes, where one of the templated ligation probes includes a sequence complementary a first plurality of capture domains, d) binding the analyte binding moiety of the analyte capture agent to a target protein, e) hybridizing the templated ligation probes to a target RNA and ligating the probes to produce templated ligation products, f) hybridizing the templated ligation products to the first plurality of capture domains and the analyte capture sequences of the bound analyte capture agents to the second plurality of capture domains on the spatial array, and g) determining the sequence or a portion thereof of a captured ligation product, or a complement, and the sequence of the spatial barcode of the capture probe, or a complement thereof, that is associated with the ligation product, and the sequence of the analyte binding moiety barcode, or a complement thereof, of the bound analyte capture agent, thereby determining the spatial location of a nucleic acid and the protein in the diseased biological sample.


In some embodiments, the diseased biological sample is a cancerous biological sample. In some embodiments, the cancerous biological sample is an ovarian cancer biological sample, a breast cancer biological sample, a lung cancer biological sample, or a melanoma. In some embodiments, the breast cancer sample is triple positive breast cancer or a ductal cell invasive carcinoma sample.


All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, patent application, or item of information was specifically and individually indicated to be incorporated by reference. To the extent publications, patents, patent applications, and items of information incorporated by reference contradict the disclosure contained in the specification, the specification is intended to supersede and/or take precedence over any such contradictory material.


Where values are described in terms of ranges, it should be understood that the description includes the disclosure of all possible sub-ranges within such ranges, as well as specific numerical values that fall within such ranges irrespective of whether a specific numerical value or specific sub-range is expressly stated.


The term “each,” when used in reference to a collection of items, is intended to identify an individual item in the collection but does not necessarily refer to every item in the collection, unless expressly stated otherwise, or unless the context of the usage clearly indicates otherwise.


Various embodiments of the features of this disclosure are described herein. However, it should be understood that such embodiments are provided merely by way of example, and numerous variations, changes, and substitutions can occur to those skilled in the art without departing from the scope of this disclosure. It should also be understood that various alternatives to the specific embodiments described herein are also within the scope of this disclosure.





DESCRIPTION OF DRAWINGS

The following drawings illustrate certain embodiments of the features and advantages of this disclosure. These embodiments are not intended to limit the scope of the appended claims in any manner. Like reference symbols in the drawings indicate like elements.



FIG. 1 is a schematic diagram showing an example of a barcoded capture probe, as described herein.



FIG. 2 is a schematic diagram of an exemplary analyte capture agent.



FIG. 3 is a schematic diagram depicting an exemplary interaction between a feature-immobilized capture probe 324 and an analyte capture agent 326.



FIGS. 4A-B shows exemplary clustering data for FFPE human lymph node sections using an eight-plex antibody-oligonucleotide conjugate test panel. FIG. 4A (RNA) displays clustering with respect to gene expression of the test panel and FIG. 4B (protein) shows the clustering with respect to the protein expression of the test panel.



FIG. 5 shows exemplary clustering data of spatial gene (top middle) and protein expression (top right) in FFPE tonsil tissue sections superimposed on the H&E image (top left). Bottom figures show visualization of PD-1, Ki67, and CD8A protein markers labeling the follicular T cells, individual follicles, and suppressor/cytotoxic T cells, respectively.



FIG. 6 shows exemplary H&E stained FFPE tonsil tissue section (top left), spatial gene expression data (top middle), and spatial protein expression data (top left). FIG. 6 also shows an expanded view of a section of the H&E stained FFPE tonsil tissue section (bottom left) and clustering of gene expression and protein expression of CD8a (bottom middle) and CD4 (bottom right) superimposed on the section of the H&E FFPE tonsil tissue section.



FIG. 7 shows exemplary spatial gene and protein expression from a subset of gene and protein expression data from tonsil tissue. A subset of eighteen different targeted gene and protein expression heat maps are shown.



FIG. 8 shows expanded views of exemplary heat map data for FFPE human tonsil tissue section using a 12-plex antibody-oligonucleotide conjugate test panel of several genes shown in FIG. 7.



FIGS. 9A-C show exemplary spatial gene and protein expression in FFPE triple positive breast cancer tissue sections. FIG. 9A shows an H&E stained FFPE triple positive breast cancer tissue section. FIG. 9B shows representative gene expression clusters and FIG. 9C shows representative protein expression clusters. The insets shown in FIGS. 9B and 9C show representative tSNE plots.



FIG. 10 shows an expanded view of Her2 and Vimentin RNA and protein expression in FFPE invasive ductal carcinoma tissue sections. Adjacent sections were immunofluorescently stained for Her2 (top) and Vimentin (bottom) demonstrating strong signal within the dashed box region of the biopsy sample.



FIGS. 11A-C show exemplary spatial gene and protein expression in FFPE invasive ductal carcinoma tissue sections. FIG. 11B shows representative gene expression clusters and FIG. 11C shows representative protein expression clusters superimposed on the H&E stained (FIG. 11A) invasive ductal carcinoma tissue sections.



FIG. 12 shows exemplary spatial gene and protein expression from a subset of the gene and protein expression data from FIGS. 11B-C. The biomarkers were used to identify two regions of interest in the invasive ductal carcinoma tissue sample.



FIG. 13 shows exemplary spatial gene and protein expression in FFPE invasive ductal carcinoma tissue section superimposed on the H&E image of the ACTA2 and Epcam gene and their corresponding proteins.



FIG. 14A shows an exemplary image of spatially-resolved information of gene expression of protein tyrosine phosphatase receptor type C (Ptprc) RNA using ligated probes in FFPE mouse spleen tissue under sandwich configuration conditions.



FIG. 14B shows an exemplary image of spatially-resolved information of gene expression of Ptprc RNA using ligated probes in FFPE spleen tissue under non-sandwich configuration control conditions



FIG. 14C shows an exemplary image of spatially-resolved information of protein expression of CD45R using analyte capture agents in FFPE mouse spleen tissue under sandwich configuration conditions.



FIG. 14D shows an exemplary image of spatially-resolved information of protein expression of CD45R using analyte capture agents in FFPE mouse spleen tissue under non-sandwich configuration control conditions.



FIG. 15A shows an exemplary image of spatially-resolved information of gene expression of tyrosine hydroxylase (Th) RNA using ligated probes in FFPE mouse brain tissue under sandwich configuration conditions.



FIG. 15B shows an exemplary image of spatially-resolved information of gene expression of Th RNA using ligated probes in FFPE mouse brain tissue under non-sandwich configuration control conditions.



FIG. 15C shows an exemplary image of spatially-resolved information of protein expression of tyrosine hydroxylase protein (TH) using analyte capture agents in FFPE mouse brain tissue under sandwich configuration conditions.



FIG. 15D shows an exemplary image of spatially-resolved information of protein expression of TH using analyte capture agents in FFPE mouse brain tissue under non-sandwich configuration control conditions.



FIG. 16A shows an exemplary image of spatially-resolved information of gene expression of Ter119 RNA using ligated probes in FFPE mouse embryo torso tissue under sandwich configuration conditions.



FIG. 16B shows an exemplary image of spatially-resolved information of gene expression of Ter119 RNA using ligated probes in FFPE mouse embryo torso tissue under non-sandwich configuration conditions.



FIG. 16C shows an exemplary image of spatially-resolved information of protein expression of Ter119 using an analyte capture agent in FFPE mouse embryo torso tissue under sandwich configuration conditions.



FIG. 16D shows an exemplary image of spatially-resolved information of protein expression of Ter119 using analyte capture agents in FFPE mouse embryo torso tissue under non-sandwich configuration conditions.



FIG. 17A shows an exemplary image of spatially-resolved information of gene expression of Ter119 RNA using ligated probes in FFPE mouse embryo head and upper torso tissue under sandwich configuration conditions.



FIG. 17B shows an exemplary image of spatially-resolved information of gene expression of Ter119 RNA using ligated probes in FFPE mouse embryo head and upper torso tissue under non-sandwich configuration conditions.



FIG. 17C shows an exemplary image of spatially-resolved information of protein expression of Ter119 using analyte capture agents in FFPE mouse embryo head and upper torso tissue under sandwich configuration conditions.



FIG. 17D shows an exemplary image of spatially-resolved information of protein expression of Ter119 using an analyte capture agent in FFPE mouse embryo head and upper torso tissue using non-sandwich configuration conditions.



FIGS. 18A, 19A, 20A, 21A, and 22A show exemplary images of spatially-resolved information of gene expression of Mpped1 (FIG. 18A), Tnnc1 (FIG. 19A), Fgf15 (FIG. 20A), Epyc (FIG. 21A), and Serpina1e (FIG. 22A) RNA using ligated probes in FFPE mouse embryo head and upper torso tissue under sandwich configuration conditions.



FIGS. 18B, 19B, 20B, 21B, and 22B show exemplary images of spatially-resolved information of gene expression of Mpped1 (FIG. 18B), Tnnc1 (FIG. 19B), Fgf15 (FIG. 20B), Epyc (FIG. 21B), and Serpina1e (FIG. 22B) RNA using ligated probes in FFPE mouse embryo torso tissue under sandwich configuration conditions.



FIGS. 18C, 19C, 20C, 21C, and 22C show exemplary images of spatially-resolved information of gene expression of Mpped1 (FIG. 18C), Tnnc1 (FIG. 19C), Fgf15 (FIG. 20C), Epyc (FIG. 21C), and Serpina1e (FIG. 22C) RNA using ligated probes in FFPE mouse embryo head and upper torso tissue under non-sandwich configuration conditions.



FIGS. 18D, 19D, 20D, 21D, and 22D show exemplary images of spatially-resolved information of gene expression of Mpped1 (FIG. 18D), Tnnc1 (FIG. 19D), Fgf15 (FIG. 20D), Epyc (FIG. 21D), and Serpina1e (FIG. 22D) RNA using ligated probes in FFPE mouse embryo torso tissue under non-sandwich configuration conditions.



FIGS. 18E, 19E, 20E, 21E, and 22E show exemplary images of spatially-resolved information of protein expression of Mpped1 (FIG. 18E), Tnnc1 (FIG. 19E), Fgf15 (FIG. 20E), Epyc (FIG. 21E), and Serpina1e (FIG. 22E) using analyte capture agents in FFPE mouse embryo head and upper torso tissue under sandwich configuration conditions.



FIGS. 18F, 19F, 20F, 21F, and 22F show exemplary images of spatially-resolved information of protein expression of Mpped1 (FIG. 18F), Tnnc1 (FIG. 19F), Fgf15 (FIG. 20F), Epyc (FIG. 21F), and Serpina1e (FIG. 22F) using analyte capture agents in FFPE mouse embryo head and upper torso tissue under non-sandwich configuration conditions.



FIGS. 18G, 19G, 20G, 21G, and 22G show exemplary images of spatially-resolved information of protein expression of Mpped1 (FIG. 18G), Tnnc1 (FIG. 19G), Fgf15 (FIG. 20G), Epyc (FIG. 21G), and Serpina1e (FIG. 22G) using analyte capture agents in FFPE mouse embryo torso tissue under non-sandwich configuration conditions.



FIGS. 18H, 19H, 20H, 21H, and 22H show exemplary images of spatially-resolved information of gene expression of Mpped1 (FIG. 18H), Tnnc1 (FIG. 19H), Fgf15 (FIG. 20H), Epyc (FIG. 21H), and Serpina1e (FIG. 22H) RNA using ligated probes in FFPE mouse embryo head and upper torso tissue under non-sandwich configuration conditions in which only RNA was detected.



FIGS. 18I, 19I, 20I, 21I, and 22I show exemplary images of spatially-resolved information of gene expression of Mpped1 (FIG. 18I), Tnnc1 (FIG. 19I), Fgf15 (FIG. 20I), Epyc (FIG. 21I), and Serpina1e (FIG. 22I) RNA using ligated probes in FFPE mouse embryo torso tissue under non-sandwich configuration conditions in which only RNA was detected.



FIGS. 23A-E show spatial immune cell infiltration in a breast cancer tissue section correlates with pathologist annotations. FIG. 23A shows an H&E stained human breast cancer FFPE tissue section. FIG. 23B shows the pathologist's annotations. FIG. 23C shows spatial protein expression of CD3 (e.g., a marker for T cells); FIG. 23D shows spatial protein expression of CD8A (e.g., a marker for cytotoxic T cells); and FIG. 23E shows spatial protein expression for HLA-DR (e.g., a marker for T cell activation).



FIGS. 24A-D show spatial immune cell infiltration in an ovarian cancer FFPE tissue section correlates with pathologist annotations. FIG. 24A shows a pathologist's annotation for invasive carcinoma and immune cells. FIG. 24B shows spatial protein expression of CD20 (e.g., a marker for B cells); FIG. 24C shows spatial protein expression of CD68 (e.g., a marker for monocytes); and FIG. 24D shows spatial protein expression of CD8A (e.g., a marker for cytotoxic T cells).



FIGS. 25A-D show differential spatial cytotoxic T cell infiltration within different regions of an ovarian cancer FFPE tissue section. FIG. 25A shows spatial protein expression of CD8A (e.g., a marker for cytotoxic T cells). FIG. 25B shows highly infiltrated (“hot”, CD3) and not filtrated (“cold”, CD8) areas of protein expression in the FFPE tissue section shown in FIG. 25A. FIG. 25C shows spatial protein expression of HLA-G and FIG. 25D shows spatial protein expression of IMPG2.



FIG. 26 shows an exemplary spatial array with multiple protein dilution series spotted on the spatial array.



FIGS. 27A-D show exemplary spatial gene (FIG. 27B) and protein expression (FIG. 27C) expression in lung cancer FFPE tissue. FIG. 27A shows an H&E stained lung cancer FFPE tissue and FIG. 27D shows a HLA-DR protein spatial UMI plot.



FIGS. 28A-D show exemplary spatial gene (FIG. 28B) and protein expression (FIG. 28C) expression in melanoma FFPE tissue. FIG. 28A shows an H&E stained melanoma cancer tissue and FIG. 28D shows a HLA-DR protein spatial UMI plot.



FIGS. 29A-C show exemplary Vimentin antibody immunofluorescence staining and DAPI staining (FIG. 29A), exemplary spatial protein expression (FIG. 29B), and exemplary Vimentin spatial protein expression (FIG. 29C) in a grade II invasive ductal carcinoma FFPE breast cancer tissue section.





DETAILED DESCRIPTION

The present disclosure features methods, compositions, and kits for spatial analysis of biological samples. More specifically, the present disclosure features methods, compositions, and kits for both spatial gene expression and spatial protein expression in a biological sample.


Spatial analysis methodologies and compositions described herein can provide a vast amount of analyte and/or expression data for a variety of analytes within a biological sample at high spatial resolution, while retaining native spatial context. Spatial analysis methods and compositions can include, e.g., the use of a capture probe including a spatial barcode (e.g., a nucleic acid sequence that provides information as to the location or position of an analyte within a cell or a tissue sample (e.g., mammalian cell or a mammalian tissue sample) and a capture domain that is capable of binding to an analyte (e.g., a protein and/or a nucleic acid) produced by and/or present in a cell. Spatial analysis methods and compositions can also include the use of a capture probe having a capture domain that captures an intermediate agent for indirect detection of an analyte. For example, the intermediate agent can include a nucleic acid sequence (e.g., a barcode) associated with the intermediate agent. Detection of the intermediate agent is therefore indicative of the analyte in the cell or tissue sample.


Non-limiting aspects of spatial analysis methodologies and compositions are described in U.S. Pat. Nos. 10,774,374, 10,724,078, 10,480,022, 10,059,990, 10,041,949, 10,002,316, 9,879,313, 9,783,841, 9,727,810, 9,593,365, 8,951,726, 8,604,182, 7,709,198, U.S. Patent Application Publication Nos. 2020/239946, 2020/080136, 2020/0277663, 2020/024641, 2019/330617, 2019/264268, 2020/256867, 2020/224244, 2019/194709, 2019/161796, 2019/085383, 2019/055594, 2018/216161, 2018/051322, 2018/0245142, 2017/241911, 2017/089811, 2017/067096, 2017/029875, 2017/0016053, 2016/108458, 2015/000854, 2013/171621, WO 2018/091676, WO 2020/176788, Rodrigues et al., Science 363(6434):1463-1467, 2019; Lee et al., Nat. Protoc. 10(3):442-458, 2015; Trejo et al., PLoS ONE 14(2):e0212031, 2019; Chen et al., Science 348(6233):aaa6090, 2015; Gao et al., BMC Biol. 15:50, 2017; and Gupta et al., Nature Biotechnol. 36:1197-1202, 2018; the Visium Spatial Gene Expression Reagent Kits User Guide (e.g., Rev C, dated June 2020), and/or the Visium Spatial Tissue Optimization Reagent Kits User Guide (e.g., Rev C, dated July 2020), both of which are available at the 10× Genomics Support Documentation website, and can be used herein in any combination, and each of which is incorporated herein by reference in their entireties. Further non-limiting aspects of spatial analysis methodologies and compositions are described herein.


Some general terminology that may be used in this disclosure can be found in Section (I)(b) of WO 2020/176788 and/or U.S. Patent Application Publication No. 2020/0277663. Typically, a “barcode” is a label, or identifier, that conveys or is capable of conveying information (e.g., information about an analyte in a sample, a bead, and/or a capture probe). A barcode can be part of an analyte, or independent of an analyte. A barcode can be attached to an analyte. A particular barcode can be unique relative to other barcodes. For the purpose of this disclosure, an “analyte” can include any biological substance, structure, moiety, or component to be analyzed. The term “target” can similarly refer to an analyte of interest.


Analytes can be broadly classified into one of two groups: nucleic acid analytes, and non-nucleic acid analytes. Examples of non-nucleic acid analytes include, but are not limited to, lipids, carbohydrates, peptides, proteins, glycoproteins (N-linked or O-linked), lipoproteins, phosphoproteins, specific phosphorylated or acetylated variants of proteins, amidation variants of proteins, hydroxylation variants of proteins, methylation variants of proteins, ubiquitylation variants of proteins, sulfation variants of proteins, viral proteins (e.g., viral capsid, viral envelope, viral coat, viral accessory, viral glycoproteins, viral spike, etc.), extracellular and intracellular proteins, antibodies, and antigen binding fragments. In some embodiments, the analyte(s) can be localized to subcellular location(s), including, for example, organelles, e.g., mitochondria, Golgi apparatus, endoplasmic reticulum, chloroplasts, endocytic vesicles, exocytic vesicles, vacuoles, lysosomes, etc. In some embodiments, analyte(s) can be peptides or proteins, including without limitation antibodies and enzymes. Additional examples of analytes can be found in Section (I)(c) of WO 2020/176788 and/or U.S. Patent Application Publication No. 2020/0277663. In some embodiments, an analyte can be detected indirectly, such as through detection of an intermediate agent, for example, a ligation product or an analyte capture agent (e.g., an oligonucleotide-conjugated antibody), such as those described herein.


A “biological sample” is typically obtained from the subject for analysis using any of a variety of techniques including, but not limited to, biopsy, surgery, and laser capture microscopy (LCM), and generally includes cells and/or other biological material from the subject. In some embodiments, a biological sample can be a tissue section. In some embodiments, a biological sample can be a fixed and/or stained biological sample (e.g., a fixed and/or stained tissue section). Non-limiting examples of stains include histological stains (e.g., hematoxylin and/or eosin) and immunological stains (e.g., fluorescent stains). In some embodiments, a biological sample (e.g., a fixed and/or stained biological sample) can be imaged. Biological samples are also described in Section (I)(d) of WO 2020/176788 and/or U.S. Patent Application Publication No. 2020/0277663.


In some embodiments, a biological sample is permeabilized with one or more permeabilization reagents. For example, permeabilization of a biological sample can facilitate analyte capture. Exemplary permeabilization agents and conditions are described in Section (I)(d)(ii)(13) or the Exemplary Embodiments Section of WO 2020/176788 and/or U.S. Patent Application Publication No. 2020/0277663.


Array-based spatial analysis methods involve the transfer of one or more analytes from a biological sample to an array of features on a substrate, where each feature is associated with a unique spatial location on the array. Subsequent analysis of the transferred analytes includes determining the identity of the analytes and the spatial location of the analytes within the biological sample. The spatial location of an analyte within the biological sample is determined based on the feature to which the analyte is bound (e.g., directly or indirectly) on the array, and the feature's relative spatial location within the array.


A “capture probe” refers to any molecule capable of capturing (directly or indirectly) and/or labelling an analyte (e.g., an analyte of interest) in a biological sample. In some embodiments, the capture probe is a nucleic acid or a polypeptide. In some embodiments, the capture probe includes a barcode (e.g., a spatial barcode and/or a unique molecular identifier (UMI)) and a capture domain). In some embodiments, a capture probe can include a cleavage domain and/or a functional domain (e.g., a primer-binding site, such as for next-generation sequencing (NGS)). See, e.g., Section (II)(b) (e.g., subsections (i)-(vi)) of WO 2020/176788 and/or U.S. Patent Application Publication No. 2020/0277663. Generation of capture probes can be achieved by any appropriate method, including those described in Section (II)(d)(ii) of WO 2020/176788 and/or U.S. Patent Application Publication No. 2020/0277663.



FIG. 1 is a schematic diagram showing an exemplary capture probe, as described herein. As shown, the capture probe 102 is optionally coupled to a feature 101 by a cleavage domain 103, such as a disulfide linker. The capture probe can include a functional sequence 104 that are useful for subsequent processing. The functional sequence 104 can include all or a part of sequencer specific flow cell attachment sequence (e.g., a P5 or P7 sequence), all or a part of a sequencing primer sequence, (e.g., a R1 primer binding site, a R2 primer binding site), or combinations thereof. The capture probe can also include a spatial barcode 105. The capture probe can also include a unique molecular identifier (UMI) sequence 106. While FIG. 1 shows the spatial barcode 105 as being located upstream (5′) of UMI sequence 106, it is to be understood that capture probes wherein UMI sequence 106 is located upstream (5′) of the spatial barcode 105 is also suitable for use in any of the methods described herein. The capture probe can also include a capture domain 107 to facilitate capture of a target analyte. In some embodiments, the capture probe comprises one or more additional functional sequences that can be located, for example between the spatial barcode 105 and the UMI sequence 106, between the UMI sequence 106 and the capture domain 107, or following the capture domain 107. The capture domain can have a sequence complementary to a sequence of a nucleic acid analyte. The capture domain can have a sequence complementary to a connected probe described herein. The capture domain can have a sequence complementary to a capture handle sequence present in an analyte capture agent. The capture domain can have a sequence complementary to a splint oligonucleotide. Such splint oligonucleotide, in addition to having a sequence complementary to a capture domain of a capture probe, can have a sequence of a nucleic acid analyte, a sequence complementary to a portion of a connected probe described herein, and/or a capture handle sequence described herein.


The functional sequences can generally be selected for compatibility with any of a variety of different sequencing systems, e.g., Ion Torrent Proton or PGM, Illumina sequencing instruments, PacBio, Oxford Nanopore, etc., and the requirements thereof. In some embodiments, functional sequences can be selected for compatibility with non-commercialized sequencing systems. Examples of such sequencing systems and techniques, for which suitable functional sequences can be used, include (but are not limited to) Ion Torrent Proton or PGM sequencing, Illumina sequencing, PacBio SMRT sequencing, and Oxford Nanopore sequencing. Further, in some embodiments, functional sequences can be selected for compatibility with other sequencing systems, including non-commercialized sequencing systems.


In some embodiments, the spatial barcode 105 and functional sequences 104 is common to all of the probes attached to a given feature. In some embodiments, the UMI sequence 106 of a capture probe attached to a given feature is different from the UMI sequence of a different capture probe attached to the given feature.


In some embodiments, more than one analyte type (e.g., nucleic acids and proteins) from a biological sample can be detected (e.g., simultaneously or sequentially) using any appropriate multiplexing technique, such as those described in Section (IV) of WO 2020/176788 and/or U.S. Patent Application Publication No. 2020/0277663.


In some embodiments, detection of one or more analytes (e.g., protein analytes) can be performed using one or more analyte capture agents. As used herein, an “analyte capture agent” refers to an agent that interacts with an analyte (e.g., an analyte in a biological sample) and with a capture probe (e.g., a capture probe attached to a substrate or a feature) to identify the analyte. In some embodiments, the analyte capture agent includes: (i) an analyte binding moiety (e.g., that binds to an analyte), for example, an antibody or antigen-binding fragment thereof; (ii) analyte binding moiety barcode; and (iii) an analyte capture sequence. In some embodiments, the analyte capture agent includes a capture agent barcode domain that is conjugated or otherwise attached to the analyte binding moiety. In some embodiments, the capture agent barcode domain is covalently-linked to the analyte binding moiety. In some embodiments, a capture agent barcode domain is a nucleic acid sequence. In some embodiments, a capture agent barcode domain includes an analyte binding moiety barcode and an analyte capture sequence.


In some embodiments, analyte capture agents are capable of binding to analytes present inside a cell. In some embodiments, analyte capture agents are capable of binding to cell surface analytes that can include, without limitation, a receptor, an antigen, a surface protein, a transmembrane protein, a cluster of differentiation protein, a protein channel, a protein pump, a carrier protein, a phospholipid, a glycoprotein, a glycolipid, a cell-cell interaction protein complex, an antigen-presenting complex, a major histocompatibility complex, an engineered T-cell receptor, a T-cell receptor, a B-cell receptor, a chimeric antigen receptor, an extracellular matrix protein, a posttranslational modification (e.g., phosphorylation, glycosylation, ubiquitination, nitrosylation, methylation, acetylation or lipidation) state of a cell surface protein, a gap junction, and an adherens junction. In some embodiments, the analyte capture agents are capable of binding to cell surface analytes that are post-translationally modified. In such embodiments, analyte capture agents can be specific for cell surface analytes based on a given state of posttranslational modification (e.g., phosphorylation, glycosylation, ubiquitination, nitrosylation, methylation, acetylation or lipidation), such that a cell surface analyte profile can include posttranslational modification information of one or more analytes.


As used herein, the term “analyte binding moiety” refers to a molecule or moiety capable of binding to a macromolecular constituent (e.g., an analyte, e.g., a biological analyte). In some embodiments of any of the spatial profiling methods described herein, the analyte binding moiety of the analyte capture agent that binds to a biological analyte can include, but is not limited to, an antibody, or an epitope binding fragment thereof, a cell surface receptor binding molecule, a receptor ligand, a small molecule, a bi-specific antibody, a bi-specific T-cell engager, a T-cell receptor engager, a B-cell receptor engager, a pro-body, an aptamer, a monobody, an affimer, a darpin, and a protein scaffold, or any combination thereof. The analyte binding moiety can bind to the macromolecular constituent (e.g., analyte) with high affinity and/or with high specificity. The analyte binding moiety can include a nucleotide sequence (e.g., an oligonucleotide), which can correspond to at least a portion or an entirety of the analyte binding moiety. The analyte binding moiety can include a polypeptide and/or an aptamer (e.g., a polypeptide and/or an aptamer that binds to a specific target molecule, e.g., an analyte). The analyte binding moiety can include an antibody or antibody fragment (e.g., an antigen-binding fragment) that binds to a specific analyte (e.g., a polypeptide).


In some embodiments, an analyte binding moiety of an analyte capture agent includes one or more antibodies or antigen binding fragments thereof. The antibodies or antigen binding fragments including the analyte binding moiety can specifically bind to a target analyte. In some embodiments, the analyte is a protein (e.g., a protein on a surface of the biological sample (e.g., a cell) or an intracellular protein). In some embodiments, a plurality of analyte capture agents comprising a plurality of analyte binding moieties bind a plurality of analytes present in a biological sample. In some embodiments, the plurality of analytes includes a single species of analyte (e.g., a single species of polypeptide). In some embodiments in which the plurality of analytes includes a single species of analyte, the analyte binding moieties of the plurality of analyte capture agents are the same. In some embodiments in which the plurality of analytes includes a single species of analyte, the analyte binding moieties of the plurality of analyte capture agents are the different (e.g., members of the plurality of analyte capture agents can have two or more species of analyte binding moieties, wherein each of the two or more species of analyte binding moieties binds a single species of analyte, e.g., at different binding sites). In some embodiments, the plurality of analytes includes multiple different species of analyte (e.g., multiple different species of polypeptides).


As used herein, the term “analyte binding moiety barcode” refers to a barcode that is associated with or otherwise identifies the analyte binding moiety. In some cases, an analyte binding moiety barcode (or portion thereof) may be able to be removed (e.g., cleaved) from the analyte capture agent. In some embodiments, by identifying an analyte binding moiety and its associated analyte binding moiety barcode, the analyte to which the analyte binding moiety binds can also be identified. An analyte binding moiety barcode can be a nucleic acid sequence of a given length and/or sequence that is associated with the analyte binding moiety. An analyte binding moiety barcode can generally include any of the variety of aspects of barcodes described herein. For example, an analyte capture agent that is specific to one type of analyte can have coupled thereto a first capture agent barcode domain (e.g., that includes a first analyte binding moiety barcode), while an analyte capture agent that is specific to a different analyte can have a different capture agent barcode domain (e.g., that includes a second barcode analyte binding moiety barcode) coupled thereto. In some aspects, such a capture agent barcode domain can include an analyte binding moiety barcode that permits identification of the analyte binding moiety to which the capture agent barcode domain is coupled. The selection of the capture agent barcode domain can allow significant diversity in terms of sequence, while also being readily attachable to most analyte binding moieties (e.g., antibodies or aptamers) as well as being readily detected, (e.g., using sequencing or array technologies). Additional description of analyte capture agents can be found in Section (II)(b)(ix) of WO 2020/176788 and/or Section (II)(b)(viii) U.S. Patent Application Publication No. 2020/0277663.


In some embodiments, the capture agent barcode domain of an analyte capture agent includes an analyte capture sequence. As used herein, the term “analyte capture sequence” refers to a region or moiety configured to hybridize to, bind to, couple to, or otherwise interact with a capture domain of a capture probe. In some embodiments, an analyte capture sequence includes a nucleic acid sequence that is complementary to or substantially complementary to the capture domain of a capture probe such that the analyte capture sequence hybridizes to the capture domain of the capture probe. In some embodiments, an analyte capture sequence comprises a poly(A) nucleic acid sequence that hybridizes to a capture domain that comprises a poly(T) nucleic acid sequence. In some embodiments, an analyte capture sequence comprises a poly(T) nucleic acid sequence that hybridizes to a capture domain that comprises a poly(A) nucleic acid sequence. In some embodiments, an analyte capture sequence comprises a non-homopolymeric nucleic acid sequence that hybridizes to a capture domain that comprises a non-homopolymeric nucleic acid sequence that is complementary (or substantially complementary) to the non-homopolymeric nucleic acid sequence of the analyte capture region.



FIG. 2 is a schematic diagram of an exemplary analyte capture agent 202 comprised of an analyte binding moiety 204 and a capture agent barcode domain 208. An analyte binding moiety 204 is a molecule capable of binding to an analyte 206 and interacting with a spatially-barcoded capture probe. The analyte binding moiety can bind to the analyte 206 with high affinity and/or with high specificity. The analyte capture agent can include a capture agent barcode domain 208, a nucleotide sequence (e.g., an oligonucleotide), which can hybridize to at least a portion or an entirety of a capture domain of a capture probe. The analyte binding moiety 204 can include a polypeptide and/or an aptamer (e.g., an oligonucleotide or peptide molecule that binds to a specific target analyte). The analyte binding moiety 204 can include an antibody or antibody fragment (e.g., an antigen-binding fragment).



FIG. 3 is a schematic diagram depicting an exemplary interaction between a feature-immobilized capture probe 324 and an analyte capture agent 326. The feature-immobilized capture probe 324 can include a spatial barcode 308 as well as one or more functional sequences 306 and 310, as described elsewhere herein. The capture probe can also include a capture domain 312 that is capable of binding to an analyte capture agent 326. The analyte capture agent 326 can include a functional sequence 318, capture agent barcode domain 316, and an analyte capture sequence 314 that is capable of binding to the capture domain 312 of the capture probe 324. The analyte capture agent can also include a linker 320 that allows the capture agent barcode domain 316 to couple to the analyte binding moiety 322.


There are at least two methods to associate a spatial barcode with one or more neighboring cells, such that the spatial barcode identifies the one or more cells, and/or contents of the one or more cells, as associated with a particular spatial location. One method is to promote analytes or analyte proxies (e.g., intermediate agents) out of a cell and towards a spatially-barcoded array (e.g., including spatially-barcoded capture probes). Another method is to cleave spatially-barcoded capture probes from an array and promote the spatially-barcoded capture probes towards and/or into or onto the biological sample.


In some cases, capture probes may be configured to prime, replicate, and consequently yield optionally barcoded extension products from a template (e.g., a DNA or RNA template, such as an analyte or an intermediate agent (e.g., a ligation product or an analyte capture agent), or a portion thereof), or derivatives thereof (see, e.g., Section (II)(b)(vii) of WO 2020/176788 and/or U.S. Patent Application Publication No. 2020/0277663 regarding extended capture probes). In some cases, capture probes may be configured to form ligation products with a template (e.g., a DNA or RNA template, such as an analyte or an intermediate agent, or portion thereof), thereby creating ligations products that serve as proxies for a template.


As used herein, an “extended capture probe” refers to a capture probe having additional nucleotides added to the terminus (e.g., 3′ or 5′ end) of the capture probe thereby extending the overall length of the capture probe. For example, an “extended 3′ end” indicates additional nucleotides were added to the most 3′ nucleotide of the capture probe to extend the length of the capture probe, for example, by polymerization reactions used to extend nucleic acid molecules including templated polymerization catalyzed by a polymerase (e.g., a DNA polymerase or a reverse transcriptase). In some embodiments, extending the capture probe includes adding to a 3′ end of a capture probe a nucleic acid sequence that is complementary to a nucleic acid sequence of an analyte or intermediate agent specifically bound to the capture domain of the capture probe. In some embodiments, the capture probe is extended using reverse transcription. In some embodiments, the capture probe is extended using one or more DNA polymerases. The extended capture probes include the sequence of the capture probe and the sequence of the spatial barcode of the capture probe.


In some embodiments, extended capture probes are amplified (e.g., in bulk solution or on the array) to yield quantities that are sufficient for downstream analysis, e.g., via DNA sequencing. In some embodiments, extended capture probes (e.g., DNA molecules) act as templates for an amplification reaction (e.g., a polymerase chain reaction).


Additional variants of spatial analysis methods, including in some embodiments, an imaging step, are described in Section (II)(a) of WO 2020/176788 and/or U.S. Patent Application Publication No. 2020/0277663. Analysis of captured analytes (and/or intermediate agents or portions thereof), for example, including sample removal, extension of capture probes, sequencing (e.g., of a cleaved extended capture probe and/or a cDNA molecule complementary to an extended capture probe), sequencing on the array (e.g., using, for example, in situ hybridization or in situ ligation approaches), temporal analysis, and/or proximity capture, is described in Section (II)(g) of WO 2020/176788 and/or U.S. Patent Application Publication No. 2020/0277663. Some quality control measures are described in Section (II)(h) of WO 2020/176788 and/or U.S. Patent Application Publication No. 2020/0277663.


Spatial information can provide information of biological and/or medical importance. For example, the methods and compositions described herein can allow for: identification of one or more biomarkers (e.g., diagnostic, prognostic, and/or for determination of efficacy of a treatment) of a disease or disorder; identification of a candidate drug target for treatment of a disease or disorder; identification (e.g., diagnosis) of a subject as having a disease or disorder; identification of stage and/or prognosis of a disease or disorder in a subject; identification of a subject as having an increased likelihood of developing a disease or disorder; monitoring of progression of a disease or disorder in a subject; determination of efficacy of a treatment of a disease or disorder in a subject; identification of a patient subpopulation for which a treatment is effective for a disease or disorder; modification of a treatment of a subject with a disease or disorder; selection of a subject for participation in a clinical trial; and/or selection of a treatment for a subject with a disease or disorder. Exemplary methods for identifying spatial information of biological and/or medical importance can be found in U.S. Patent Application Publication No. 2021/0140982A1, U.S. Patent Application No. 2021/0198741A1, and/or U.S. Patent Application No. 2021/0199660.


Spatial information can provide information of biological importance. For example, the methods and compositions described herein can allow for: identification of transcriptome and/or proteome expression profiles (e.g., in healthy and/or diseased tissue); identification of multiple analyte types in close proximity (e.g., nearest neighbor analysis); determination of up- and/or down-regulated genes and/or proteins in diseased tissue; characterization of tumor microenvironments; characterization of tumor immune responses; characterization of cells types and their co-localization in tissue; and identification of genetic variants within tissues (e.g., based on gene and/or protein expression profiles associated with specific disease or disorder biomarkers).


Typically, for spatial array-based methods, a substrate functions as a support for direct or indirect attachment of capture probes to features of the array. A “feature” is an entity that acts as a support or repository for various molecular entities used in spatial analysis. In some embodiments, some or all of the features in an array are functionalized for analyte capture. Exemplary substrates are described in Section (II)(c) of WO 2020/176788 and/or U.S. Patent Application Publication No. 2020/0277663. Exemplary features and geometric attributes of an array can be found in Sections (II)(d)(i), (II)(d)(iii), and (II)(d)(iv) of WO 2020/176788 and/or U.S. Patent Application Publication No. 2020/0277663.


Generally, analytes and/or intermediate agents (or portions thereof) can be captured when contacting a biological sample with a substrate including capture probes (e.g., a substrate with capture probes embedded, spotted, printed, fabricated on the substrate, or a substrate with features (e.g., beads, wells) comprising capture probes). As used herein, “contact,” “contacted,” and/or “contacting,” a biological sample with a substrate refers to any contact (e.g., direct or indirect) such that capture probes can interact (e.g., bind covalently or non-covalently (e.g., hybridize)) with analytes from the biological sample. Capture can be achieved actively (e.g., using electrophoresis) or passively (e.g., using diffusion). Analyte capture is further described in Section (II)(e) of WO 2020/176788 and/or U.S. Patent Application Publication No. 2020/0277663.


In some cases, spatial analysis can be performed by attaching and/or introducing a molecule (e.g., a peptide, a lipid, or a nucleic acid molecule) having a barcode (e.g., a spatial barcode) to a biological sample (e.g., to a cell in a biological sample). In some embodiments, a plurality of molecules (e.g., a plurality of nucleic acid molecules) having a plurality of barcodes (e.g., a plurality of spatial barcodes) are introduced to a biological sample (e.g., to a plurality of cells in a biological sample) for use in spatial analysis. In some embodiments, after attaching and/or introducing a molecule having a barcode to a biological sample, the biological sample can be physically separated (e.g., dissociated) into single cells or cell groups for analysis. Some such methods of spatial analysis are described in Section (III) of WO 2020/176788 and/or U.S. Patent Application Publication No. 2020/0277663.


In some cases, spatial analysis can be performed by detecting multiple oligonucleotides that hybridize to an analyte. In some instances, for example, spatial analysis can be performed using RNA-templated ligation (RTL). Methods of RTL have been described previously. See, e.g., Credle et al., Nucleic Acids Res. 2017 Aug. 21; 45(14):e128. Typically, RTL includes hybridization of two oligonucleotides to adjacent sequences on an analyte (e.g., an RNA molecule, such as an mRNA molecule). In some instances, the oligonucleotides are DNA molecules. In some instances, one of the oligonucleotides includes at least two ribonucleic acid bases at the 3′ end and/or the other oligonucleotide includes a phosphorylated nucleotide at the 5′ end. In some instances, one of the two oligonucleotides includes a capture domain (e.g., a poly(A) sequence, a non-homopolymeric sequence). After hybridization to the analyte, a ligase (e.g., SplintR ligase) ligates the two oligonucleotides together, creating a ligation product. In some instances, the two oligonucleotides hybridize to sequences that are not adjacent to one another. For example, hybridization of the two oligonucleotides creates a gap between the hybridized oligonucleotides. In some instances, a polymerase (e.g., a DNA polymerase) can extend one of the oligonucleotides prior to ligation. After ligation, the ligation product is released from the analyte. In some instances, the ligation product is released using an endonuclease (e.g., RNAse H). The released ligation product can then be captured by capture probes (e.g., instead of direct capture of an analyte) on an array, optionally amplified, and sequenced, thus determining the location and optionally the abundance of the analyte in the biological sample.


During analysis of spatial information, sequence information for a spatial barcode associated with an analyte is obtained, and the sequence information can be used to provide information about the spatial distribution of the analyte in the biological sample. Various methods can be used to obtain the spatial information. In some embodiments, specific capture probes and the analytes they capture are associated with specific locations in an array of features on a substrate. For example, specific spatial barcodes can be associated with specific array locations prior to array fabrication, and the sequences of the spatial barcodes can be stored (e.g., in a database) along with specific array location information, so that each spatial barcode uniquely maps to a particular array location.


Alternatively, specific spatial barcodes can be deposited at predetermined locations in an array of features during fabrication such that at each location, only one type of spatial barcode is present so that spatial barcodes are uniquely associated with a single feature of the array. Where necessary, the arrays can be decoded using any of the methods described herein so that spatial barcodes are uniquely associated with array feature locations, and this mapping can be stored as described above.


When sequence information is obtained for capture probes and/or analytes during analysis of spatial information, the locations of the capture probes and/or analytes can be determined by referring to the stored information that uniquely associates each spatial barcode with an array feature location. In this manner, specific capture probes and captured analytes are associated with specific locations in the array of features. Each array feature location represents a position relative to a coordinate reference point (e.g., an array location, a fiducial marker) for the array. Accordingly, each feature location has an “address” or location in the coordinate space of the array.


Some exemplary spatial analysis workflows are described in the Exemplary Embodiments section of WO 2020/176788 and/or U.S. Patent Application Publication No. 2020/0277663. See, for example, the Exemplary embodiment starting with “In some non-limiting examples of the workflows described herein, the sample can be immersed . . . ” of WO 2020/176788 and/or U.S. Patent Application Publication No. 2020/0277663. See also, e.g., the Visium Spatial Gene Expression Reagent Kits User Guide (e.g., Rev C, dated June 2020), and/or the Visium Spatial Tissue Optimization Reagent Kits User Guide (e.g., Rev C, dated July 2020).


In some embodiments, spatial analysis can be performed using dedicated hardware and/or software, such as any of the systems described in Sections (II)(e)(ii) and/or (V) of WO 2020/176788 and/or U.S. Patent Application Publication No. 2020/0277663, or any of one or more of the devices or methods described in Sections Control Slide for Imaging, Methods of Using Control Slides and Substrates for, Systems of Using Control Slides and Substrates for Imaging, and/or Sample and Array Alignment Devices and Methods, Informational labels of WO 2020/123320.


Suitable systems for performing spatial analysis can include components such as a chamber (e.g., a flow cell or sealable, fluid-tight chamber) for containing a biological sample. The biological sample can be mounted for example, in a biological sample holder. One or more fluid chambers can be connected to the chamber and/or the sample holder via fluid conduits, and fluids can be delivered into the chamber and/or sample holder via fluidic pumps, vacuum sources, or other devices coupled to the fluid conduits that create a pressure gradient to drive fluid flow. One or more valves can also be connected to fluid conduits to regulate the flow of reagents from reservoirs to the chamber and/or sample holder.


The systems can optionally include a control unit that includes one or more electronic processors, an input interface, an output interface (such as a display), and a storage unit (e.g., a solid state storage medium such as, but not limited to, a magnetic, optical, or other solid state, persistent, writeable and/or re-writeable storage medium). The control unit can optionally be connected to one or more remote devices via a network. The control unit (and components thereof) can generally perform any of the steps and functions described herein. Where the system is connected to a remote device, the remote device (or devices) can perform any of the steps or features described herein. The systems can optionally include one or more detectors (e.g., CCD, CMOS) used to capture images. The systems can also optionally include one or more light sources (e.g., LED-based, diode-based, lasers) for illuminating a sample, a substrate with features, analytes from a biological sample captured on a substrate, and various control and calibration media.


The systems can optionally include software instructions encoded and/or implemented in one or more of tangible storage media and hardware components such as application specific integrated circuits. The software instructions, when executed by a control unit (and in particular, an electronic processor) or an integrated circuit, can cause the control unit, integrated circuit, or other component executing the software instructions to perform any of the method steps or functions described herein.


In some cases, the systems described herein can detect (e.g., register an image) the biological sample on the array. Exemplary methods to detect the biological sample on an array are described in WO 2021/102003 and/or U.S. patent application Ser. No. 16/951,854, each of which is incorporated herein by reference in their entireties.


Prior to transferring analytes from the biological sample to the array of features on the substrate, the biological sample can be aligned with the array. Alignment of a biological sample and an array of features including capture probes can facilitate spatial analysis, which can be used to detect differences in analyte presence and/or level within different positions in the biological sample, for example, to generate a three-dimensional map of the analyte presence and/or level. Exemplary methods to generate a two- and/or three-dimensional map of the analyte presence and/or level are described in PCT Application No. 2020/053655 and spatial analysis methods are generally described in WO 2021/102039 and/or U.S. patent application Ser. No. 16/951,864, each of which is incorporated herein by reference in their entireties.


In some cases, a map of analyte presence and/or level can be aligned to an image of a biological sample using one or more fiducial markers, e.g., objects placed in the field of view of an imaging system which appear in the image produced, as described in the Substrate Attributes Section, Control Slide for Imaging Section of WO 2020/123320, WO 2021/102005, and/or U.S. patent application Ser. No. 16/951,843, each of which is incorporated herein by reference in their entireties. Fiducial markers can be used as a point of reference or measurement scale for alignment (e.g., to align a sample and an array, to align two substrates, to determine a location of a sample or array on a substrate relative to a fiducial marker) and/or for quantitative measurements of sizes and/or distances.


Multiplex Gene Expression and Protein Analysis


Understanding both gene and protein expression in biological systems can be helpful for gaining insights into normal, developing, and diseased tissues. While single cell RNA-seq (scRNA-seq) makes it possible to obtain high-resolution gene expression measurements, the technique requires cells to be dissociated, thereby losing anatomical and organizational information. Similarly, numerous protein detection techniques are known and can provide spatial information of proteins in a biological sample, however, methods of simultaneously detecting levels of gene expression (e.g., mRNA) of the protein, or even the entire transcriptome are still needed.


Thus, disclosed herein are “multi-omics” approaches that can provide a powerful complement to traditional methodologies, enabling a greater understanding of cellular heterogeneity and organization within biological samples. The combination of protein detection using analyte capture agents on a spatial array allows for the simultaneous examination of protein and gene expression from the same biological sample (e.g., tissue section). For example, an array comprising capture probes (e.g., any of the capture probes described herein) can be contacted with a biological sample, a plurality of templated ligation probes, and a plurality of analyte capture agents that result in simultaneous gene and protein expression analysis.


In some embodiments, the plurality of templated ligation probes include a pair of probes for a target nucleic acid (e.g., DNA, RNA). The probes are complementary to portions of the target nucleic acid, however, when both probes hybridize to the target nucleic acid a gap is present between the two probes. In some embodiments, the gap is ligated, thereby generating a templated ligation product (e.g., DNA or RNA templated ligation product). In some embodiments, one of the pair of probes includes a flanking sequence complementary to a capture domain of the array. In some embodiments, the sequence complementary to the capture domain of the templated ligation product hybridizes to the capture domain of the capture probe.


In some embodiments, analyte capture agents, as described herein, can also be contacted with the biological sample. In some embodiments, the analyte capture agents are contacted with the biological sample before the biological sample is contacted with an array. In some embodiments, the analyte capture agents are contacted with the biological sample after the biological sample is contacted with the array. In some embodiments, the analyte binding moiety of the analyte capture agent interacts (e.g., binds) to an analyte (e.g., protein) in a biological sample. In some embodiments, the analyte binding moiety is an antibody or antigen-binding fragment.


Analyte capture agents can also include a conjugated oligonucleotide that can comprise one or more domains. For example, the conjugated oligonucleotide can include an analyte binding moiety barcode and an analyte capture sequence. In some embodiments, the analyte binding moiety barcode, or a complement thereof, refers to (e.g., identifies) a barcode that is associated with or otherwise identifies the analyte binding moiety. In some embodiments, the conjugated oligonucleotide can include an analyte capture sequence. In some embodiments, the analyte capture sequence is capable of interacting with (e.g., hybridizing) to a capture domain of a capture probe on a substrate.


In some embodiments, the templated ligation probes are allowed to bind the target nucleic acid before the analyte capture agents are delivered to the biological sample. In some embodiments, the templated ligation probes can be ligated together before, concurrently, or after the analyte capture agents are delivered to the biological sample. In some embodiments, the analyte capture agents are delivered to the biological sample and the analyte binding moiety is allowed to bind the target analyte (e.g., protein) before the templated ligation probes are delivered. In some embodiments, the analyte capture agents are delivered to the biological sample and the analyte capture sequence is blocked (e.g., blocked by any of the methods described herein). In some embodiments, the analyte capture sequence of the analyte capture agents is unblocked (e.g., unblocked by any of the methods described herein) before, concurrently, or after the templated ligation probes (e.g., RNA templated ligation probes) are delivered and/or before, concurrently, or after the templated ligation probes are ligated together.


Thus, provided herein are methods for determining the spatial location of a nucleic acid and a protein from a biological sample including: a) providing a spatial array including a first and second plurality of capture probes where each plurality includes a spatial barcode and a capture domain, b) contacting the spatial array with a biological sample, c) contacting the biological sample with (i) a plurality of analyte capture agents, where an analyte capture agent includes an analyte binding moiety and an oligonucleotide including an analyte binding moiety barcode and an analyte capture sequence, where the analyte capture sequence includes a sequence complementary to a second plurality of capture domains, and (ii) a plurality of templated ligation probes, where one of the templated ligation probes includes a sequence complementary a first plurality of capture domains, d) binding the analyte binding moiety of the analyte capture agent to a target protein, e) hybridizing the templated ligation probes to a target nucleic acid and ligating the probes to produce ligation products, f) hybridizing the ligation products to the first plurality of capture domains and the analyte capture sequences of the bound analyte capture agents to the second plurality of capture domains on the spatial array, and g) determining the sequence or a portion thereof of a captured ligation product, or a complement thereof, and the sequence of the spatial barcode of the capture probe, or a complement thereof, that is associated with the ligation product, and the sequence of the analyte binding moiety barcode, or a complement thereof, of the bound analyte capture agent, thereby determining the spatial location of a nucleic acid and the protein from the biological sample.


Also provided herein are methods for determining the spatial location of a nucleic acid and a protein in a diseased biological sample including: a) providing a spatial array including a first and a second plurality of capture probes where each plurality includes a spatial barcode and a capture domain, b) contacting the diseased biological sample with the spatial array, c) contacting the diseased biological sample with: (i) a plurality of analyte capture agents, where an analyte capture agent includes an analyte binding moiety and an oligonucleotide including an analyte binding moiety barcode and an analyte capture sequence, where the analyte capture sequence includes a sequence complementary to a second plurality of capture domains, and (ii) a plurality of templated ligation probes, where one of the templated ligation probes includes a sequence complementary a first plurality of capture domains, d) binding the analyte binding moiety of the analyte capture agent to a target protein, e) hybridizing the templated ligation probes to a target RNA and ligating the probes to produce templated ligation products, f) hybridizing the templated ligation products to the first plurality of capture domains and the analyte capture sequences of the bound analyte capture agents to the second plurality of capture domains on the spatial array, and g) determining the sequence or a portion thereof of a captured ligation product, or a complement, and the sequence of the spatial barcode of the capture probe, or a complement thereof, that is associated with the ligation product, and the sequence of the analyte binding moiety barcode, or a complement thereof, of the bound analyte capture agent, thereby determining the spatial location of a nucleic acid and the protein in the diseased biological sample.


In some embodiments, the nucleic acid is RNA. In some embodiments, the RNA is mRNA. In some embodiments, the nucleic acid is DNA.


In some embodiments, the diseased biological sample is a cancerous biological sample. In some embodiments, the cancerous biological sample is an ovarian cancer biological sample or a breast cancer biological sample. In some embodiments, the breast cancer sample is triple positive breast cancer. In some embodiments, the breast cancer is invasive ductal cell carcinoma breast cancer. In some embodiments, the invasive ductal cell carcinoma is grade II invasive ductal carcinoma. In some embodiments, the invasive ductal cell carcinoma is grade III invasive ductal carcinoma. In some embodiments, the breast cancer is invasive lobular carcinoma. In some embodiments, the cancerous biological sample is lung cancer. In some embodiments, the cancerous biological sample is melanoma. In some embodiments, the cancerous biological sample is colon cancer. In some embodiments, the cancerous biological sample is glioblastoma. In some embodiments, the cancerous biological sample is prostate cancer.


In some embodiments, the capture probes include unique molecular identifiers, functional sequences, or combinations thereof.


In some embodiments, the first plurality of capture domains are homopolymeric sequences. In some embodiments, the first plurality of capture domains comprise poly(T) sequences. In some embodiments, the first plurality of capture domains are defined non-homopolymeric sequences. In some embodiments, the first plurality of capture domains includes a degenerate sequence. In some embodiments, the first plurality of capture domains includes a fixed sequence. For example, the first plurality of capture domains can comprises one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, or SEQ ID NO: 11.


In some embodiments, the second plurality of capture domains are homopolymeric sequences. In some embodiments, the second plurality of capture domains are defined non-homopolymeric sequences. In some embodiments, the second plurality of capture domains comprise poly(T) sequences. In some embodiments, the second plurality of capture domains includes a degenerate sequence. In some embodiments, the second plurality of capture domains includes a fixed sequence. For example, the second plurality of capture domains can comprise one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, or SEQ ID NO: 11.


In some embodiments, the first plurality of capture domains and the second plurality of capture domains include the same sequence. In some embodiments, the first plurality of capture domains and the second plurality of capture domains include different sequences.


Generally, the methods of the present disclosure can be used with any biological sample (e.g., any biological sample described herein). In some embodiments, the biological sample is a tissue section. In some embodiments, the biological sample is a tissue sample. In some embodiments, the biological sample is a fresh-frozen biological sample. In some embodiments, the biological sample is a fixed biological sample (e.g., formalin-fixed paraffin embedded (FFPE), paraformaldehyde, acetone, or methanol). In some embodiments, the biological sample is an FFPE sample. In some embodiments, the biological sample is an FFPE tissue section. In some embodiments, the tissue sample is a tumor sample. In some embodiment, the tissue section is a tumor tissue section. In some embodiments, the tumor tissue section is a fixed tumor tissue section (e.g., a formal-fixed paraffin-embedded tumor tissue section). In some embodiments, the tumor sample comprises one or more cancer tumors. Numerous types of cancer are known in the art. In some embodiments, the tissue sample is derived from a biopsy sample. In some embodiments, the tissue sample is derived from a whole rodent embryo. In some embodiments, the tissue is selected from, but not limited to, brain tissue, breast tissue, colon tissue, heart tissue, lung tissue, spleen tissue, testes tissue, inflamed tonsil tissue, cervix tissue, and lymph node tissue.


In some embodiments, an FFPE sample is deparaffinized and decrosslinked prior to delivering a plurality of templated ligation probes (e.g., RNA templated ligation probes) and analyte capture agents. In some embodiments, an FFPE biological sample is deparaffinized and decrosslinked before step (b). For example, the paraffin-embedding material can be removed (e.g., deparaffinization) from the biological sample (e.g., tissue section) by incubating the biological sample in an appropriate solvent (e.g., xylene), followed by a series of rinses (e.g., ethanol of varying concentrations), and rehydration in water. In some embodiments, the biological sample can be dried following deparaffinization. In some embodiments, after the step of drying the biological sample, the biological sample can be stained (e.g., H&E stain, any of the variety of stains described herein).


In some embodiments, the method includes staining the biological sample. In some embodiments, the staining includes the use of hematoxylin and eosin. In some embodiments, a biological sample can be stained using any number of biological stains, including but not limited to, acridine orange, Bismarck brown, carmine, coomassie blue, cresyl violet, DAPI, eosin, ethidium bromide, acid fuchsine, hematoxylin, Hoechst stains, iodine, methyl green, methylene blue, neutral red, Nile blue, Nile red, osmium tetroxide, propidium iodide, rhodamine, or safranin.


The biological sample can be stained using known staining techniques, including Can-Grunwald, Giemsa, hematoxylin and eosin (H&E), Jenner's, Leishman, Masson's trichrome, Papanicolaou, Romanowsky, silver, Sudan, Wright's, and/or Periodic Acid Schiff (PAS) staining techniques. PAS staining is typically performed after formalin or acetone fixation.


In some embodiments, the staining includes the use of a detectable label selected from the group consisting of a radioisotope, a fluorophore, a chemiluminescent compound, a bioluminescent compound, or a combination thereof.


In some embodiments, the biological sample is imaged after staining the biological sample. In some embodiments, the biological sample is imaged prior to staining the biological sample. In some embodiments, the biological sample is visualized or imaged using bright field microscopy. In some embodiments, the biological sample is visualized or imaged using fluorescence microscopy. Additional methods of visualization and imaging are known in the art. Non-limiting examples of visualization and imaging include expansion microscopy, bright field microscopy, dark field microscopy, phase contrast microscopy, electron microscopy, fluorescence microscopy, reflection microscopy, interference microscopy and confocal microscopy. In some embodiments, the sample is stained and imaged prior to adding the first and/or second primer to the biological sample on the array.


After a fixed (e.g., FFPE, PFA, acetone, methanol) biological sample has undergone deparaffinization, the fixed (e.g., FFPE, PFA) biological sample can be further processed. For example, fixed (e.g., FFPE, PFA) biological samples can be treated to remove crosslinks (e.g., formaldehyde-induced crosslinks (e.g., decrosslinking)). In some embodiments, decrosslinking the crosslinks (e.g., formaldehyde-induced crosslinks) in the fixed (e.g., FFPE, PFA) biological sample can include treating the sample with heat. In some embodiments, decrosslinking the formaldehyde-induced crosslinks can include performing a chemical reaction. In some embodiments, decrosslinking the formaldehyde-induced crosslinks, can include treating the sample with a permeabilization reagent. In some embodiments, decrosslinking the formaldehyde-induced crosslinks can include heat, a chemical reaction, and/or permeabilization reagents.


In some embodiments, decrosslinking crosslinks (e.g., formaldehyde-induced crosslinks) can be performed in the presence of a buffer. In some embodiments, the buffer is Tris-EDTA (TE) buffer (e.g., TE buffer for FFPE biological samples). In some embodiments, the buffer is citrate buffer (e.g., citrate buffer for FFPE biological samples). In some embodiments, the buffer is Tris-HCl buffer (e.g., Tris-HCl buffer for PFA fixed biological samples). In some embodiments, the buffer (e.g., TE buffer, Tris-HCl buffer) has a pH of about 5.0 to about 10.0 and a temperature between about 60° C. to about 100° C.


In some embodiments, the biological sample is permeabilized (e.g., permeabilized by any of the methods described herein). In some embodiments, the permeabilization is an enzymatic permeabilization. In some embodiments, the permeabilization is a chemical permeabilization. In some embodiments, the biological sample is permeabilized before delivering the RNA templated ligation probes and analyte capture agents to the biological sample. In some embodiments, the biological sample is permeabilized at the same time as the RNA templated ligation probes and analyte capture agents are delivered to the biological sample. In some embodiments, the biological sample is permeabilized after the RNA templated ligation probes and analyte capture agents are delivered to the biological sample. In some embodiments, hybridizing the RNA templated ligation products to the second capture domains and the analyte capture sequences of the bound analyte capture agents to the first capture domains further comprises permeabilizing the biological sample.


In some embodiments, the biological sample is permeabilized from about 30 to about 120 minutes, from about 40 to about 110 minutes, from about 50 to about 100 minutes, from about 60 to about 90 minutes, or from about 70 to 80 minutes. In some embodiments, the biological samples is permeabilized about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 90, about 95, about 100, about 105, about 110, about 115, or about 130 minutes.


In some embodiments, the permeabilization buffer comprises urea. In some embodiments, the urea is at a concentration of about 0.5M to 3.0M. In some embodiments, the concentration of the urea is about 0.5, 1.0, 1.5, 2.0, 2.5, or about 3.0M. In some embodiments, the permeabilization buffer includes a detergent. In some embodiments, the detergent is sarkosyl. In some embodiments, the sarkosyl is present at about 2% to about 10% (v/v). In some embodiments, the sarkosyl is present at about 3%, 4%, 5%, 6%, 7%, 8%, or 9% (v/v). In some embodiments, the permeabilization buffer comprises polyethylene glycol (PEG). In some embodiments, the PEG is from about PEG 2K to about PEG 16K. In some embodiments, the PEG is PEG 2K, 3K, 4K, 5K, 6K, 7K, 8K, 9K, 10K, 11K, 12K, 13K, 14K, 15K, or 16K. In some embodiments, the PEG is present at a concentration from about 2% to 25%, from about 4% to about 23%, from about 6% to about 21%, or from about 8% to about 20% (v/v).


In some embodiments, the method includes a step of permeabilizing the biological sample (e.g., a tissue section). For example, the biological sample can be permeabilized to facilitate transfer of the extended products to the capture probes on the array. In some embodiments, the permeabilizing includes the use of an organic solvent (e.g., acetone, ethanol, and methanol), a detergent (e.g., saponin, Triton X-100™, Tween-20™, or sodium dodecyl sulfate (SDS)), and an enzyme (an endopeptidase, an exopeptidase, a protease), or combinations thereof. In some embodiments, the permeabilizing includes the use of an endopeptidase, a protease, SDS, polyethylene glycol tert-octylphenyl ether, polysorbate 80, and polysorbate 20, N-lauroylsarcosine sodium salt solution, saponin, Triton X100™, Tween-20™, or combinations thereof. In some embodiments, the endopeptidase is pepsin. In some embodiments, the endopeptidase is Proteinase K. Additional methods for sample permeabilization are described, for example, in Jamur et al., Method Mol. Biol. 588:63-66, 2010, the entire contents of which are incorporated herein by reference.


The methods provided herein can also include antibody staining. In some embodiment, antibody staining includes the use of an antibody staining buffer. In some embodiments, the antibody staining buffer (e.g., a PBS-based buffer) includes a detergent (e.g., Tween-20, SDS, sarkosyl). In some embodiments, the antibody staining buffer includes a serum, such as for example, a goat serum. In some embodiments, the goat serum is from about 1% to about 10% (v/v), from about 2% to about 9% (v/v), from about 3% to about 8% (v/v), or about 4% to about 7% (v/v). In some embodiments, the antibody staining buffer includes dextran sulfate. In some embodiments, the dextran sulfate is at a concentration of about 1 mg/ml to about 20 mg/ml, from about 5 mg/ml to about 15 mg/ml, or from about 8 mg/ml to about 12 mg/ml.


The methods provided herein can also utilize blocking probes to block the non-specific binding (e.g., hybridization) of the analyte capture sequence and the capture domain of a capture probe on an array. In some embodiments, following contact between the biological sample and the array, the biological sample is contacted with a plurality of analyte capture agents, where an analyte capture agent includes an analyte capture sequence that is reversibly blocked with a blocking probe. In some embodiments, the analyte capture sequence is reversibly blocked with more than one blocking probe (e.g., 2, 3, 4, or more blocking probes). In some embodiments, the analyte capture agent is blocked prior to binding the target analyte (e.g., a target protein).


In some embodiments, the oligonucleotide of the analyte capture agent (e.g., analyte capture sequence) is blocked by a blocking probe. In some embodiments, blocking probes are hybridized to the analyte capture sequence of the analyte capture agents before introducing the analyte capture agents to a biological sample. In some embodiments, blocking probes are hybridized to the analyte capture sequence of the analyte capture agents after introducing the analyte capture agents to the biological sample. In such embodiments, the capture domain can also be blocked to prevent non-specific binding, and/or to control the time of binding, between the analyte capture sequence and the capture domain. In some embodiments, the blocking probes can be alternatively or additionally introduced during staining of the biological sample. In some embodiments, the analyte capture sequence is blocked prior to binding to the capture domain, where the blocking probe includes a sequence complementary or substantially complementary to the analyte capture sequence.


In some embodiments, the analyte capture sequence is blocked with one blocking probe. In some embodiments, the analyte capture sequence is blocked with two blocking probes. In some embodiments, the analyte capture sequence is blocked with more than two blocking probes (e.g., 3, 4, 5, or more blocking probes). In some embodiments, a blocking probe is used to block the free 3′ end of the analyte capture sequence. In some embodiments, a blocking probe is used to block the 5′ end of the analyte capture sequence. In some embodiments, two blocking probes are used to block both 5′ and 3′ ends of the analyte capture sequence. In some embodiments, both the analyte capture sequence and the capture probe domain are blocked.


In some embodiments, the blocking probes can differ in length and/or complexity. In some embodiments, the blocking probe can include a nucleotide sequence of about 8 to about 24 nucleotides in length (e.g., about 8 to about 22, about 8 to about 20, about 8 to about 18, about 8 to about 16, about 8 to about 14, about 8 to about 12, about 8 to about 10, about 10 to about 24, about 10 to about 22, about 10 to about 20, about 10 to about 18, about 10 to about 16, about 10 to about 14, about 10 to about 12, about 12 to about 24, about 12 to about 22, about 12 to about 20, about 12 to about 18, about 12 to about 16, about 12 to about 14, about 14 to about 24, about 14 to about 22, about 14 to about 20, about 14 to about 18, about 14 to about 16, about 16 to about 24, about 16 to about 22, about 16 to about 20, about 16 to about 18, about 18 to about 24, about 18 to about 22, about 18 to about 20, about 20 to about 24, about 20 to about 22, or about 22 to about 24 nucleotides in length).


In some embodiments, the blocking probe is removed prior to hybridizing the analyte capture sequence of the oligonucleotide of the analyte capture sequence to the first capture domain. For example, once the blocking probe is released from the analyte capture sequence, the analyte capture sequence can bind to the first capture domain on the array. In some embodiments, blocking the analyte capture sequence reduces non-specific background staining. In some embodiments, blocking the analyte capture sequence allows for control over when to allow the binding of the analyte capture sequence to the capture domain of a capture probe during a spatial workflow, thereby controlling the time of capture of the analyte capture sequence on the array. In some embodiments, the blocking probes are reversibly bound, such that the blocking probes can be removed from the analyte capture sequence during or after the time that analyte capture agents are in contact with the biological sample. In some embodiments, the blocking probe can be removed with RNAse treatment (e.g., RNAse H treatment). In some embodiments, the blocking probes are removed by increasing the temperature (e.g., heating) the biological sample. In some embodiments, the blocking probes are removed enzymatically (e.g., cleaved). In some embodiments, the blocking probes are removed by a USER enzyme. In some embodiments, the blocking probes are removed by an endonuclease. In some embodiments, the endonuclease is endonuclease IV. In some embodiments, the endonuclease is endonuclease V.


In some embodiments, the determining in step (g) includes a) extending the captured ligation products and the captured oligonucleotides of the analyte capture agents, wherein the extension products comprise the spatial barcode or a complement thereof, b) releasing the extension products, or complements thereof, from the spatial array, c) producing a library from the released extension products or complements thereof, and d) sequencing the library. In some embodiments, extension (e.g., extension of captured nucleic acid ligation products and the captured oligonucleotides of the analyte capture agents and/or extension of the plurality of captures probes) is performed with a polymerase (e.g., any suitable polymerase, e.g., T4 polymerase).


In some embodiments, the released extension products can be prepared for downstream applications, such as generation of a sequencing library and next-generation sequencing. Producing sequencing libraries are known in the art. For example, the released extension products can be purified and collected for downstream amplification steps. The released extension products can be amplified using PCR, where primer binding sites flank the spatial barcode and ligation product or analyte binding moiety barcode, or complements thereof, generating a library associated with a particular spatial barcode. In some embodiments, the library preparation can be quantitated and/or quality controlled to verify the success of the library preparation steps. The library amplicons are sequenced and analyzed to decode spatial information and the ligation product or analyte binding moiety barcode, or complements thereof.


Alternatively or additionally, the amplicons can then be enzymatically fragmented and/or size-selected in order to provide for desired amplicon size. In some embodiments, when utilizing an Illumina® library preparation methodology, for example, P5 and P7, sequences can be added to the amplicons thereby allowing for capture of the library preparation on a sequencing flowcell (e.g., on Illumina sequencing instruments). Additionally, i7 and i5 can index sequences be added as sample indexes if multiple libraries are to be pooled and sequenced together. Further, Read 1 and Read 2 sequences can be added to the library preparation for sequencing purposes. The aforementioned sequences can be added to a library preparation sample, for example, via End Repair, A-tailing, Adaptor Ligation, and/or PCR. The cDNA fragments can then be sequenced using, for example, paired-end sequencing using TruSeq Read 1 and TruSeq Read 2 as sequencing primer sites, although other methods are known in the art.


In some embodiments, the determining in step (g) can include a pre-amplification step. For example, a complementary strand to the extended RNA ligation products and/or the extension product of the captured oligonucleotides of the analyte capture agents the step can be generated and further include a pre-amplification step of the extension products or complements thereof (e.g., extended products) prior to library production (e.g., RTL library production; captured oligonucleotide of the analyte capture agent production).


Compositions


Also provided herein are spatial arrays, including spatial arrays described in the methods herein, that include a dilution series of protein standards directly on the array. In general, protein quantification with antibodies can be difficult due to the varying affinity antibodies have for their protein targets. In order to accurately quantify protein abundance with antibodies, standard curves with the protein of interest (e.g., similar to an ELISA assay) can be applied to a spatial array in parallel with spatial proteomic analysis. In some embodiments, a protein standard is spotted on the array (e.g., on top of the features of the array). In some embodiments, more than one protein standard is spotted on the array (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more protein standards are spotted on the array). Readout from the internal protein standard series allows for quantification of proteins of interest in parallel from the biological sample (e.g., a tissue section) directly on the array which can lead to increased accuracy when determining protein concentration. FIG. 26 shows an exemplary substrate with an exemplary configuration that includes a dilution series for two different proteins spotted on the margins of a spatial array. FIG. 26 shows a dilution series for two proteins of interest, however, as described herein more than two protein dilution series can be spotted on the spatial array.


Provided herein are compositions such as spatial arrays including a) a plurality of capture probes including spatial barcodes and a first plurality of capture domains hybridized to a plurality of templated ligation products, and b) a plurality of capture probes comprising spatial barcodes and a second plurality of capture domains hybridized to a plurality of oligonucleotides from analyte capture agents, wherein the oligonucleotides comprise an analyte capture sequence and an analyte binding moiety barcode. In some compositions, the analyte capture sequences of the oligonucleotides are hybridized to the second plurality of capture domains.


In some compositions, the capture probes include cleavage domains, unique molecular identifiers, functional sequences, or combinations thereof. In some compositions, the first plurality of capture domains are homopolymeric sequences. In some compositions, the first plurality of capture domains comprise poly(T) sequences. In some compositions, the first plurality of capture domains are defined non-homopolymeric sequences. In some compositions the first plurality of capture domains comprise a degenerate sequence. In some compositions, the first plurality of capture domains comprise a fixed sequence. For example, the first plurality of capture domains can comprise one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, or SEQ ID NO: 11.


In some compositions, the second plurality of capture domains are homopolymeric sequences. In some compositions, the second plurality of capture domains are defined non-homopolymeric sequences. In some compositions, the second plurality of capture domains comprise poly(T) sequences. In some compositions the second plurality of capture domains comprise a degenerate sequence. In some compositions, the second plurality of capture domains comprise a fixed sequence. For example, the second plurality of capture domains can comprise one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, or SEQ ID NO: 11.


In some compositions, the spatial array comprises one or more protein dilution series.


Kits


Also provided herein are kits including a) a spatial array comprising a plurality of capture probes, where the capture probes include spatial barcodes and wherein the plurality of capture probes comprise a first plurality of first capture domains and a second plurality of second capture domains, b) one or more analyte capture agents, c) one or more RNA templated ligation probe pairs, and d) one or more enzymes and buffers for practicing any of the methods described herein. In some kits, one or more enzymes includes polymerases, RNases, DNases, proteases, lipases, or combinations thereof.











SEQUENCE LISTING



Capture Domain 22mer



SEQ ID NO: 1



TTGCTAGGACCGGCCTTAAAGC







Capture Domain 21mer



SEQ ID NO: 2



TTGCTAGGACCGGCCTTAAAG







Capture Domain 20mer



SEQ ID NO: 3



TTGCTAGGACCGGCCTTAAA







Capture Domain 19mer



SEQ ID NO: 4



TTGCTAGGACCGGCCTTAA







Capture Domain 18mer



SEQ ID NO: 5



TTGCTAGGACCGGCCTTA







Capture Domain 17mer



SEQ ID NO: 6



TTGCTAGGACCGGCCTT







Capture Domain 16mer



SEQ ID NO: 7



TTGCTAGGACCGGCCT







Capture Domain 15mer



SEQ ID NO: 8



TTGCTAGGACCGGCC







Capture Domain 14mer



SEQ ID NO: 9



TTGCTAGGACCGGC







Capture Domain 13mer



SEQ ID NO: 10



TTGCTAGGACCGG







Capture Domain 12mer



SEQ ID NO: 11



TTGCTAGGACCG






EXAMPLES
Example 1. Spatial Proteomics and Gene Expression on FFPE Human Lymph Nodes

Experiments were undertaken to determine whether analyte capture agents could provide for protein expression analysis concurrently with associated gene expression. In these experiments, the analyte capture agent includes an antibody as the analyte binding moiety and the analyte capture sequence that comprises a barcode sequence that identifies the antibody as well as the capture sequence that is complementary to the associated capture probe capture domain on the array.


Templated ligation probes were allowed to hybridize to their target mRNAs and antibody-oligonucleotide conjugates were incubated with the samples wherein the antibodies were allowed to bind to their protein targets (as described in PCT/US2020/66720). Briefly, FFPE human lymph nodes tissues were sectioned, mounted on spatial array slides and deparaffinized using a series of xylene and ethanol washes prior to brightfield imaging. Tissues were washed and decrosslinked by incubating the tissues in TE (pH 9.0) buffer for 1 hr at 70° C. After decrosslinking the tissues, the targeted templated ligation probes were added to the tissues and probe hybridization ran overnight at 50° C. Post hybridization, the probes were ligated together at 37° C. for 1 hr. Following templated ligation probe hybridization the analyte capture agents were added to the tissues, which were incubated in an antibody staining buffer with the tissues overnight at room temperature. The tissue samples were washed four times with the antibody staining buffer without antibodies.


Tissues were permeabilized and the ligated probe products, or ligation products, were allowed to migrate for hybridization to the capture domains of the capture probes on the spatial array surface. The oligonucleotides of the analyte capture agents also migrated in parallel and were captured via their capture sequences that hybridized to capture probe capture domains on the spatial array that are complementary to the capture sequences. As such, the ligation products representing the target mRNAs and the oligonucleotides of the analyte capture agents representing the binding of the antibodies to the targeted proteins were concurrently captured on the array surface. To allow for probe and oligonucleotide release and capture, the tissues were incubated with RNAse H and an associated buffer for 30 min at 37° C., tissues permeabilized using a protease for an additional 40 min., followed by washing to remove the enzymes from the tissues.


The captured ligation products and the analyte binding agent oligonucleotides were extended to create extended products of the captured molecules including the spatial barcode or a complement thereof, the analyte binding moiety barcode if present and other functional sequences from the capture probe. Library preparations were made, the libraries sequenced on an Illumina sequencing instrument, and spatial locations determined using Space Ranger and Loupe Browser (10× Genomics). The antibody sequences (e.g., the complement of the captured oligonucleotide from the analyte binding agents) were amplified with Truseq_pR1 and Truseq_pR2. For protein localization, sequences relating to the analyte binding moiety barcode were used to determine abundance and location of the labeled protein by the analyte binding agents. Spatial expression patterns were determined using SpaceRanger data analysis software and Loupe browser visualization software (10× Genomics).



FIGS. 4A-B demonstrates the results of an experiment where analyte capture agents were combined to determine whether multiple targets could be identified concurrently in a tissue. In this experiment, eight different antibodies were conjugated to oligonucleotides comprising analyte binding moiety barcodes and capture sequences targeting eight proteins: NCAM1, Ki67, CD8A, PDL1, CD20, CD11B, CD45RA and CD66B. FIG. 4A (RNA) shows the spatial gene expression clustering of the associated protein in the lymph node tissue sample, whereas FIG. 4B (protein) shows the spatial protein expression clustering of the eight targets. This experiment demonstrates that it is feasible to multiplex different analyte capture agents to concurrently identify the spatial gene and protein expression patterns of multiplex targets in a tissue sample.


Additional experimental results from the multiplexed experiment shown in FIG. 4A included targeting CD20 and CD20 mRNA when only one protein is targeted with an analyte capture agent. These results (data not shown) show a lymph node tissue sample where an antibody directed to CD20 was conjugated to an oligonucleotide for subsequent capture on a spatial array. mRNA from the tissue section was successfully captured and extended thereby providing CD20 spatial gene expression analysis (data not shown). Concurrently, spatially presented protein array demonstrates that the CD20 antibody of the analyte capture agent was able to bind to the CD20 protein followed by oligonucleotide capture on the spatial array, extension and spatial determination of the location of the CD20 protein via the analyte binding moiety barcode (data not shown). Gene expression and protein expression patterns for CD20 overlap and were localized to B-cells in the lymph nodes (data not shown). As such, the methods demonstrate the utility of the analyte capture agents to target a protein of interest and simultaneously detect spatial gene expression and protein expression in a tissue sample.


Additional data was generated with the target CD8A (e.g., using a CD8A antibody) similar to CD20 described above. The spatial gene expression and protein expression patterns were consistent with the targeting of cytotoxic CD8 positive T cells in the lymph node tissue (data not shown), again demonstrating the utility of the methods and analyte binding agents that target specific proteins of interest for simultaneously determining spatial gene and protein expression of a given target.


Example 2. Spatial Proteomics and Gene Expression on FFPE Human Tonsil Tissue

As described above experiments were undertaken to determine whether analyte capture agents could provide for protein expression analysis concurrently with associated gene expression in FFPE human tonsil tissue.


Briefly, FFPE human tonsil tissues were sectioned, mounted on spatial array slides and deparaffinized using a series of xylene and ethanol washes prior to H&E staining and brightfield imaging. Tissues were washed and decrosslinked by incubating the tissues in citrate buffer (pH 6.0) for 1 hour at 90° C. After decrosslinking the tissues, the targeted ligation probes were applied to the tissues and probe hybridization ran overnight at 50° C. Post hybridization, the probes were ligated together at 37° C. for 1 hour to generate ligation products. Following ligation probe hybridization the analyte capture agents were applied to the tissues, which were incubated in an antibody staining buffer (PBS-based buffer, 5% goat serum, salmon sperm DNA and dextran sulfate) with the tissues overnight at 4° C. The tissue samples were washed four times with antibody-free antibody staining buffer.


Tissues were permeabilized and the ligation products were allowed to migrate for capture by hybridization to the capture domains of the capture probes on the spatial array surface. The oligonucleotides of the analyte capture agents complementary to the alternative capture sequences of the second set of capture probes on the array were also captured by hybridization. As such, both ligation products representing the mRNA of the targeted protein and the oligonucleotide of the analyte capture agent representing the binding of the antibody to the targeted protein were concurrently captured on the array surface. To allow for probe and oligonucleotide release and capture, the tissues were incubated with RNase H and an associated buffer, and polyethylene glycol (PEG) for 30 minutes at 37° C. Tissues were permeabilized using a permeabilization buffer comprising a protease (e.g., Proteinase K), PEG, 1M urea, for an additional 60 minutes, followed by washing to remove the enzymes from the tissues.


The captured ligation products and the analyte binding agent oligonucleotides were extended to include the spatial barcode or a complement thereof, the analyte binding moiety barcode or a complement thereof if present and other functional sequences from the capture probe. Additionally, said products were pre-amplified prior to library preparation.


Library preparations were made from the extended products, the libraries sequenced on an Illumina sequencing instrument, and spatial locations determined and visualized. The antibody sequences (e.g., the complement of the captured oligonucleotide from the analyte binding agents) were amplified with Truseq_pR1 and Truseq_pR2. For protein localization, sequences relating to the analyte binding moiety barcode were used to determine abundance and location of the labeled protein by the analyte binding agents. Spatial expression patterns were determined using SpaceRanger data analysis software and Loupe browser visualization software (10× Genomics).



FIG. 5 shows exemplary clustering data of spatial gene (top middle) and protein expression (top right) in FFPE tonsil tissue sections superimposed on the H&E image (top left). FIG. 5 (bottom) shows visualization of PD-1, Ki67, and CD8A protein markers labeling the follicular T cells, individual follicles, and suppressor/cytotoxic T cells, respectively. The data demonstrate the utility of analyte capture agents to target a protein of interest and simultaneously detect spatial gene expression in FFPE tonsil tissue samples. In addition, the data demonstrate the specificity of the protein markers (e.g., antibodies) to identify different cell types within a heterogeneous tissue section and simultaneously detect spatial gene expression.


In another experiment performed on FFPE tonsil tissue sections exemplary spatial gene and protein expression for a 20-plex antibody-oligonucleotide conjugate targeting proteins of interest and RNA templated probes targeting 18,000 mRNA targets was performed. The FFPE human tonsil tissue section was H&E stained which identified where follicles containing maturing immune cells and the epithelial layer can be seen (data not shown). Representative gene expression cluster data and representative protein expression cluster data align with the macroscopic structures visible in the H&E image shown (data not shown).


The data demonstrate the feasibility of multiplexing different analyte capture agents to concurrently identify the spatial gene and protein expression patterns of multiplex targets in a tissue sample.



FIG. 6 shows an exemplary H&E stained FFPE tonsil tissue section and spatial and gene expression data (top). FIG. 6 also shows an expanded view of the H&E stained FFPE tonsil tissue section and clustering of gene expression and protein expression of CD8a and CD4 superimposed on the H&E FFPE tonsil tissue section (bottom). Visualization of the CD8a and CD4 markers coincide with the follicles shown in the H&E staining where CD8a localizes to the edge of the follicles and CD4 localizes outside the follicles.


Additional exemplary clustering data of spatial gene and protein expression was performed on a different FFPE tonsil tissue sections. Spatial gene expression clustering, spatial protein clustering was performed on the FFPE tonsil tissue sample which was also H&E stained (data not shown). The results demonstrate an experiment where analyte capture agents were combined to determine whether multiple targets could be identified concurrently in FFPE tonsil tissue. In this experiment 21 different antibodies were conjugated to oligonucleotides comprising analyte binding moiety barcodes and capture sequences (e.g., analyte capture sequences) targeting 21 proteins (18 shown in FIG. 7): Ki67, NCAM1, BCL, CD138, CD21, CD268, CD11b, LAG3, CD4, CD20, PD-L1, CD45RA, CD68, PanCK, CD66b, PCNA, CD235a/b and CD79a.



FIG. 7 shows a panel of 18 of the 21 targeted proteins including specifically genes: Ki67, NCAM1, BCL, CD138, CD21, CD268, CD11b, LAG3, CD4, CD20, PD-L1, CD45RA, CD68, PanCK, CD66b, PCNA, CD235a/b and CD79a. In the panel the top row shows protein expression and the bottom panel shows RNA expression. Expanded views of exemplary spatial gene and protein expression from a subset of seven different targeted gene and protein expression heat maps, including specifically: PanCK, PD-L1, Ki67, CD4, CD68, CD20, and CD11b. Gene expression (RNA) and protein expression for Ki67, NCAM1, BCI, CD138, CD11b, LAG, CD4, CD20, PD-L1, PanCK, CD66b, and CD79a as shown in FIG. 7 overlap, demonstrating the utility of the analyte capture agents to target a protein of interest and simultaneously detect spatial gene expression in FFPE tonsil tissue samples (data not shown).



FIG. 8 shows expanded views of exemplary clustering data for FFPE human tonsil tissue using a 12-plex antibody-oligonucleotide conjugate test panel of nine genes shown in FIG. 7, including specifically: CD4, PD-L1, CD20, CD11b, BCL-2, CD21, CD791, CD45RA, PCNA, Ki67, PanCK, and CD235a/b.


Collectively, the data demonstrate the utility of the methods and analyte binding agents that target specific proteins of interest for simultaneously determining spatial gene and protein expression of a given target.


Example 3. Spatial Proteomics and Gene Expression on FFPE Breast Cancer Tissue

Human Triple Positive Breast Cancer Tissue


As described above experiments were undertaken to determine whether analyte capture agents could provide for protein expression analysis concurrently with associated gene expression in FFPE human triple positive breast cancer tissue.


Briefly, FFPE human triple positive breast cancer tissues were sectioned, mounted on spatial array slides and deparaffinized using a series of xylene and ethanol washes prior to drying at room temperature. Next, the slides were heated at 37° C. for 15 minutes, followed by a series of ethanol washes (100%, 96%, 96%, and 70% ethanol). Next, the tissues were H&E stained and brightfield imaged. Alternatively, tissues can be stained (e.g., immunofluorescence stained) instead of H&E staining.


Tissues were washed and decrosslinked by incubating the tissues in Tris-EDTA (TE) buffer (pH 9.0) for 1 hour at 95° C. followed by a series of washes with 0.1 N HCl. After decrosslinking the tissues, the targeted ligation probes were added to the tissues and probe hybridization ran overnight at 50° C. The tissues were washed in a post-hybridization buffer including 3×SSC, Baker's yeast tRNA, and nuclease free water and followed by a 2×SSC buffer wash. Post-hybridization, the probes were ligated together at 37° C. for 1 hour. Following probe hybridization, the tissues were incubated in an antibody blocking buffer (PBS-based buffer (pH 7.4), goat serum, salmon sperm DNA, Tween-20, an RNase inhibitor, and dextran sulfate) at room temperature for 60 minutes. The blocking buffer was removed from the tissues and the tissues were incubated overnight at 4° C. with the analyte capture agents in an antibody staining mixture (PBS-based buffer (pH 7.4), 5% goat serum, 0.1 μg/μL salmon sperm DNA, 0.1% Tween-20, 1 U/μL RNase inhibitor, blocking oligonucleotides, analyte capture agents (e.g., antibodies with a conjugated oligonucleotide) and 10 mg/mL dextran sulfate)). The tissue samples were washed several times with antibody staining buffer without antibodies.


Tissues were permeabilized and the ligated probes were released for capture by hybridization to the capture domains of the capture probes on the spatial array surface. The oligonucleotides of the analyte capture agents complementary to the alternative capture sequences of the second set of capture probes on the array were also captured by hybridization. As such, both ligation products representing the target mRNA and the oligonucleotide of the analyte capture agent representing the binding of the antibody to the targeted protein were concurrently captured on the array surface. To allow for probe and oligonucleotide release and capture, the tissues were incubated with an RNase (e.g., RNase H), an associated buffer, and polyethylene glycol (PEG) for 30 minutes at 37° C. Tissues were permeabilized using a permeabilization buffer comprising a protease (e.g., Proteinase K), PEG, 3M urea, for an additional 60 minutes, followed by washing to remove the enzymes from the tissues. After permeabilization the tissues were washed in 2×SSC several times.


The captured ligation products and the analyte binding agent oligonucleotides were extended to create extended products of the captured molecules including the complement of the spatial barcode, the analyte binding moiety barcode if present and other functional sequences from the capture probe. Additionally, said products were pre-amplified prior to library preparation.


Library preparations were made from the extended products, sequenced on an Illumina sequencing instrument, and spatial locations were determined and visualized. The antibody sequences (e.g., the complement of the captured oligonucleotide from the analyte binding agents) were amplified with Truseq_pR1 and Truseq_pR2. For protein localization, sequences relating to the analyte binding moiety barcode were used to determine abundance and location of the labeled protein by the analyte binding agents. Spatial expression patterns were determined using SpaceRanger data analysis software and Loupe browser visualization software (10× Genomics).



FIGS. 9A-C demonstrate the results of an experiment where analyte capture agents were combined to determine whether targets could be identified concurrently in grade II FFPE triple positive invasive ductal carcinoma breast cancer tissue. In this experiment 11 different antibodies were conjugated to oligonucleotides comprising analyte binding moiety barcodes and capture sequences (e.g., analyte capture sequences) targeting eleven proteins: Her2, EpCAM, PanCK, N-Cadherin, PCNA, AlphaSMA, Vimentin, CD8a, CD4, CD68, CD20, and HLA-DR. FIG. 9B (RNA) shows the spatial gene expression clustering, whereas FIG. 9C (protein) shows clustering of the associated protein in the FFPE triple positive breast cancer tissue sample. The data demonstrate the feasibility of multiplexing different analyte capture agents to concurrently identify the spatial gene and protein expression clusters patterns of multiplex targets in triple positive breast cancer tissue samples.


A panel of 11 targeted proteins including specifically genes: Her2, EpCAM, PanCK, N-Cadherin, PCNA, AlphaSMA, Vimentin, CD8a, CD4, CD68, CD20, and HLA-DR was generated where for each target RNA expression and protein expression was generated (data not shown). Exemplary spatial gene and protein expression for KRT10, KRT18, and PanCK Ab was also generated and unbiased clustering of gene and protein expression superimposed on the H&E image demonstrate similar patterns (data not shown). An expanded view of Her2 and Vimentin RNA expression and protein expression is shown in FIG. 10. Adjacent sections were immunofluorescently stained for HER2 (top) and Vimentin (bottom) demonstrating strong signal within the dashed box region of the biopsy sample. Antibody staining for two biomarkers, HER2 and Vimentin, from adjacent tissue sections correlate with tumors in triple positive breast cancer tissue. Gene expression (RNA) and protein expression for Her2, EpCAM, PanCK, N-Cadherin, PCNA, AlphaSMA, Vimentin, CD8a, CD4, CD68, CD20, and HLA-DR also overlap (data not shown) demonstrating the utility of the analyte capture agents to target a protein of interest and simultaneously detect spatial gene expression in triple positive breast cancer tissue samples.


As described above experiments were undertaken to determine whether analyte capture agents could provide for protein expression analysis concurrently with associated gene expression in FFPE invasive ductal carcinoma breast cancer tissue.


The samples were prepared as described above in the FFPE triple positive breast cancer example. FIGS. 11A-C show H&E-stained human invasive ductal carcinoma tissue (FIG. 11A). FIGS. 11B and 11C show gene expression clustering and protein expression clustering, respectively, superimposed on the H&E image with similar patterns. FIG. 12 shows additional examination of different biomarkers: CD11b, PD-L1, and alpha-SMA exhibit regional variation within the tissue sample. These protein biomarkers were used to define the region of interest (e.g., shown as region 1 and region 2). The identified regions of interest specific gene expression patterns were identified with the top 50 highly expressed genes. The data demonstrate the feasibility of multiplexing different analyte capture agents to concurrently identify the spatial gene and protein expression cluster patterns of multiplex targets in invasive ductal carcinoma tissue samples.



FIG. 13 shows exemplary spatial gene and protein expression for Acta2 (top) and Epcam (bottom). Unbiased clustering of gene and protein expression superimposed on an H&E image of the same tissue sample demonstrate similar patterns. Plots showing the correlation between Acta2 gene expression and Alpha-SMA protein expression (encoded by the Acta2 gene) and Epcam gene expression and EPCAM protein expression (encoded by the EPCAM gene) were also generated (data not shown). A similar experiment was performed as described in FIG. 13 on a different FFPE invasive ductal carcinoma breast cancer tissue and the exemplary spatial gene and protein expression for Acta2 and separately HLA-DRA (gene) and HLA-DR (protein) correlated with one another (data not shown).


Collectively, the data demonstrate the feasibility of multiplexing different analyte capture agents to concurrently identify the spatial gene and protein expression in triple positive FFPE invasive ductal carcinoma tissue samples.


Example 4. Spatial Proteomics and Gene Expression on FFPE Mouse Spleen, Brain, Head, and Torso Sections in a Mouse Embryo Sample

Experiments were undertaken to determine whether analyte capture agents could provide for protein expression analysis concurrently with associated gene expression in FFPE mouse tissues, including whole mouse embryos or portions thereof. The following experiments tested spatial gene and protein expression in sandwiching and non-sandwiching formats. In some examples, the alignment of a first substrate with a biological sample and a second substrate with a spatial array thereon is facilitated by a sandwiching process. Accordingly, described herein are methods of sandwiching together the first substrate with a biological sample with a second substrate comprising an array with a plurality of capture probes, where the capture probe includes a spatial barcode and a capture domain.


In a non-limiting example, FFPE mouse spleen samples, FFPE mouse samples, FFPE mouse embryo torso samples, FFPE mouse embryo head samples were placed onto standard slides (for sandwich conditions) or spatial expression (GEx) slides (as non-sandwich conditions). GEx slides include an array of spatially barcoded capture probes. Briefly, tissues were sectioned and mounted on slides and dried overnight in a desiccator. The following day, the tissues were heated to 60° C., followed by deparaffinization and rehydration. Tissues were H&E stained and bright-field imaged. Tissues were destained using HCl and decrosslinked for 1 hour in citrate buffer (pH 6.0) at 95° C. After decrosslinking, tissues were incubated overnight with whole mouse transcriptome (RNA templated ligation) probe sets at 50° C. The following day, tissues were washed to remove un-hybridized probes, then treated with ligase to ligate together the RTL probes. After another wash step, the tissues were blocked with antibody blocking buffer. Tissues were incubated overnight with a library of conjugated antibodies (e.g., a library comprising a plurality of analyte capture agents, each comprising an antigen specific antibody conjugated to an oligonucleotide). The following day, tissues were subjected to sandwiching or non-sandwich conditions as follows.


Tissues placed on standard slides for the sandwiching conditions were washed with PBS-T, subjected to an eosin stain, and washed with SSC. The tissues were subjected to sandwiching conditions. Briefly, the tissue slides were mounted in a sandwiching instrument along with a GEx slide and a reagent solution including an RNAse and Proteinase K. Upon closure in the instrument, the tissue sections were permeabilized for 30 min. allowing the ligation products and the oligonucleotides from the analyte capture agents to migrate to the GEx slide for capture by the capture probes. Following permeabilization and capture, the GEx slides were removed from the instrument.


Tissues placed on GEx slides for non-sandwiching conditions were washed with PBS-T and SSC. The tissues were subjected to a 30 min probe release step with an RNase, followed by permeabilization with a permeabilization buffer including Proteinase K. Accordingly, the ligation products and analyte capture agents were captured by the capture probes on the GEx slide.


Regardless of conditions, GEx slides were washed twice with 2×SSC, and subjected to probe extension, denaturation, and pre-amplification followed by amplification and sequencing of the templated ligation and analyte capture agent libraries.


After sequencing, the quality, sensitivity, and detection under each condition (sandwiching and non-sandwiching conditions) was evaluated. As shown in Table 1, the quality, sensitivity, and detection of globally-detected transcripts (i.e., mRNA) and proteins were comparable across the sandwich and non-sandwich conditions.












TABLE 1







Sandwiching
Non-Sandwiching



Metric
Conditions
Conditions







Templated
Valid barcodes
99.00%
98.90%


Ligation
Fraction reads on
85.60%
82.10%


Quality
target





Fraction reads usable
79.80%
78.70%



Fraction reads in
81.60%
81.00%



spots





Fraction reads
 0.90%
 1.00%



unmapped




Templated
Median genes (20K
4856
4705


Ligation
prps)




Sensitivity
Median UMIs (20K
16966
15156



prps)




Protein
Fraction reads usable
75.20%
67.10%


Detection
Fraction reads in spot
78.70%
70.10%


using
Fraction unknown
 3.70%
 3.60%


Analyte
Median UMIs per
4632
4114


Capture
spot (5K reads usable




Agents
per spot)





Correlation of
0.77
0.76



selected Templated





Ligation/Analyte





Capture Agent









Images were generated to evaluate the overlap of gene expression and gene protein profiles in mouse spleen tissue and mouse brain tissue for individual biomarkers. As shown in FIG. 14A (sandwiching conditions) and FIG. 14B (non-sandwiching conditions), tyrosine phosphatase receptor type C (Ptprc; e.g., Ensembl: ENSMUSG00000026395) mRNA expression was detected in a spleen tissue sample. Further, gene product (e.g., protein) CD45R was also detected both in sandwiching conditions (FIG. 14C) and in non-sandwiching conditions (FIG. 14D). CD45R is the protein name of Ptprc, and it was determined whether there was overlap of mRNA expression of Ptprc and protein expression of CD45R. As shown in FIGS. 14A-14D, both sandwiching (77% correlation) and non-sandwiching conditions (76% correlation), respectively, demonstrates overlap of transcript and protein, indicating that transcript (i.e., mRNA) and protein detection (1) was identified in similar areas of the tissues and (2) was comparable across the sandwich and non-sandwich conditions in mouse spleen samples.


The quality, sensitivity, and detection under each condition (sandwiching and non-sandwiching conditions) were evaluated globally in mouse brain samples. As shown in Table 2, the quality, sensitivity, and detection of globally-detected transcripts (i.e., mRNA) and proteins were comparable across the sandwich and non-sandwich conditions in mouse brain samples.












TABLE 2







Sandwiching
Non-Sandwiching



Metric
Conditions
Conditions







Templated
Valid barcodes
99.00%
98.90%


Ligation
Fraction reads on
92.00%
87.30%


Quality
target





Fraction reads usable
88.80%
72.30%



Fraction reads in
91.80%
79.10%



spots





Fraction reads
 1.10%
 1.90%



unmapped




Templated
Median genes (10K
4405
3185


Ligation
prps)




Sensitivity
Median UMIs (10K
9386
5553



prps)




Protein
Fraction reads usable
80.70%
62.30%


Detection
Fraction reads in spot
84.40%
65.10%


using
Fraction unknown
 3.70%
 3.70%


Analyte
Median UMIs per
3232
3221


Capture
spot (5K reads usable




Agents
per spot)





Correlation of
0.63
0.63



selected Templated





Ligation/Analyte





Capture Agent









Similar to the mouse spleen sample images described above, individual gene expression and protein products were evaluated in mouse brain samples. As shown in FIG. 15A (sandwiching conditions) and FIG. 15B (non-sandwiching conditions), tyrosine hydroxylase (Th; e.g., Ensembl: ENSMUSG00000000214) mRNA expression was detected in brain. Further, the gene product (e.g., protein) TH was also detected in sandwiching conditions (FIG. 15C) and non-sandwiching conditions (FIG. 15D). Since TH is the protein made by Th, it was determined whether there was overlap of mRNA expression of Th and protein expression of TH. As shown in FIGS. 15A-15D, both sandwiching (63% correlation) and non-sandwiching conditions (63% correlation), respectively, saw overlap of transcript and protein, demonstrating that transcript (i.e., mRNA) and protein detection was comparable across the sandwich and non-sandwich conditions in mouse brain samples.


Experiments using the same methods (i.e., testing sandwiching conditions versus non-sandwiching conditions while detecting both RNA and protein) were performed on whole mouse embryo torso and head sections. In addition to conditions in which both RNA and protein were detected, a third condition was included as a control. This third condition (Condition 3 in Tables 3 and 4) detected the presence and abundance of only RNA. In each condition, RNA was detected using templated ligation as previously described. For Conditions 1 and 2 as shown in Tables 3 and 4 below, protein was also detected using analyte capture agent methods as previously described. The quality, sensitivity, and detection under each condition (sandwiching versus non-sandwiching conditions) were evaluated in mouse embryo torso and head samples. As shown in Tables 3 and 4, the quality, sensitivity, and detection of globally-detected transcripts (i.e., mRNA) and proteins were comparable across the sandwich and non-sandwich conditions in mouse embryo torso and head/upper torso samples. Further, the quality, sensitivity, and detection of globally-detected transcripts (i.e., mRNA) was roughly the same between Conditions 1 and 3, demonstrating that both protein capture and sandwiching methods did not interfere with RNA capture using templated ligation methods.









TABLE 3







Whole Mouse Embryo Torso Sample Data














Condition 2:





Condition 1:
Non-
Condition 3:




Sandwiching
Sandwiching
Non-




Conditions
Conditions
Sandwiching




Detecting
Detecting
Conditions




both RNA
both RNA
Detecting



Metric
and Protein
and Protein
RNA





Templated
Valid barcodes
98.9%
99.0%
98.5%


Ligation
Fraction reads on
88.5%
88.5%
87.9%


Quality
target






Fraction reads
81.5%
77.7%
84.8%



usable






Fraction reads in
84.0%
79.9%
88.4%



spots






Fraction reads
 1.0%
 1.0%
 1.4%



unmapped





Templated
Median genes
4144
4356
3562


Ligation
(10K prps)





Sensitivity
Median UMIs
8767
8176
6121



(10K prps)





Protein
Fraction reads
77.3%
72.6%



Detection
usable





using
Fraction reads in
80.8%
75.9%



Analyte
spot





Capture
Fraction unknown
 3.7%
 3.7%



Agents
Median UMIs per
3358
3264




spot (5K reads






usable per spot)






Correlation of
0.90
0.80




selected






Templated






Ligation/Analyte






Capture Agent
















TABLE 4







Whole Mouse Embryo Head/Upper Torso Sample Data














Condition 2:





Condition 1:
Non-
Condition 3:




Sandwiching
Sandwiching
Non-




Conditions
Conditions
Sandwiching




Detecting
Detecting
Conditions




both RNA
both RNA
Detecting



Metric
and Protein
and Protein
RNA





Templated
Valid barcodes
99.0%
99.0%
98.5%


Ligation
Fraction reads on
89.1%
89.4%
89.0%


Quality
target






Fraction reads
86.7%
82.9%
82.2%



usable






Fraction reads in
89.5%
85.2%
85.2%



spots






Fraction reads
 1.0%
 1.0%
 1.5%



unmapped





Templated
Median genes
4400
4708
3562


Ligation
(10K prps)





Sensitivity
Median UMIs
9077
8431
6571



(10K prps)





Protein
Fraction reads
84.3%
77.9%



Detection
usable





using
Fraction reads in
88.2%
81.5%



Analyte
spot





Capture
Fraction unknown
 3.7%
 3.8%



Agents
Median UMIs per
3358
3349




spot (5K reads






usable per spot)






Correlation of
0.72
0.59




selected






Templated






Ligation/Analyte






Capture Agent









In addition to performing global expression analysis on each group, individual targets were analyzed for the location and abundance of spatial gene expression (e.g., mRNA) and spatial protein expression of single targets in the mouse embryo torso and head/upper torso samples. FIGS. 16A and 16C show mRNA (FIG. 16A) and protein (FIG. 16C) detection of lymphocyte antigen 76 (Ter119) (e.g., NCBI Gene ID: 104231), of mouse embryo torso samples in Condition 1 (i.e., in sandwiching conditions). FIGS. 16B and 16D show mRNA (FIG. 16B) and protein (FIG. 16D) detection of Ter119 of mouse embryo torso samples in Condition 2 (i.e., in non-sandwiching conditions). FIGS. 17A and 17C show mRNA (FIG. 17A) and protein (FIG. 17C) detection of Ter119 of mouse embryo head samples in Condition 1 (i.e., in sandwiching conditions). FIGS. 17B and 17D show mRNA (FIG. 17B) and protein (FIG. 17D) detection of Ter119 of mouse embryo head samples in Condition 2 (i.e., in non-sandwiching conditions). As shown in FIGS. 17A-17D, Ter119 mRNA and protein was readily detected with considerable overlap of mRNA and protein detection in both sandwiching conditions and non-sandwiching conditions, demonstrating the adaptability and reproducibility of the methods regardless of condition.


Additional single biomarkers were analyzed in the mouse embryo torso and head samples. As shown in FIGS. 18A-18I, metallophosphoesterase domain containing 1 (Mpped1; Ensembl: ENSMUSG00000041708) mRNA and protein was analyzed. Mpped1 was readily detected in the brain region of mouse embryo head samples. FIG. 18A shows detection of Mpped1 RNA in a mouse embryo head sample using sandwiching conditions (Condition 1 of Tables 3 and 4). FIG. 18E shows detection of Mpped1 protein in a mouse embryo head sample using sandwiching conditions (Condition 1 of Tables 3 and 4). However, Mpped1 RNA was not readily detected in a mouse embryo torso sample (FIG. 18B). Consistent with these observations, Mpped1 has metallophosphoesterase activity, which could have a role in brain development, as such was expected to be present in the embryo head sample and not in the embryo torso sample. Consistent with the sandwiching conditions data, Mpped1 mRNA and protein was detected in non-sandwiching conditions in the head (FIG. 18C (mRNA) and FIG. 18F (protein)) but not in the torso (FIG. 18D (mRNA) and FIG. 18G (protein)). Similarly, in non-sandwiching conditions in which only RNA was detected, Mpped1 RNA was detected in the head (FIG. 18H) but not in the torso (FIG. 18I). As such, regardless of conditions, both gene and protein expression, down to the single biomarker level, can be detected concurrently in the same sample.


Four additional biomarkers—troponin C1, slow skeletal and cardiac type (Tnnc1; e.g., Ensembl: ENSMUSG00000091898); fibroblast growth factor 15 (Fgf15; e.g., Ensembl: ENSMUSG00000031073); epiphycan (Epyc e.g., Ensembl: ENSMUSG00000019936); and serine (or cysteine) peptidase inhibitor, Glade A, member 1E (Serpina1e; e.g., Ensembl: ENSMUSG00000072849) were examined in head/upper torso and torso mouse embryo samples under Conditions 1, 2, and 3 from Tables 3 and 4. See FIGS. 19A-22I. Tnnc1 is involved in muscle contraction regulation and its expression was readily detected in all samples under each Condition. See FIGS. 19A-19I. Fgf15 functions in retinal neurogenesis and as a cell fate determination factor. Indeed, its expression was found in the eye of the embryo in each head sample, but was not detected in the torso. See FIGS. 20A-20I. Epyc functions in bone formation and in cartilage structure and was detected in each sample (head and torso). See FIGS. 21A-21I. Finally, Serpina1e is active in the liver as it functions in alpha-1 antitrypsin protein production. As shown in FIGS. 22A-22I, Serpina1e was detected in the torso of mouse embryos but was not detected in the head/upper torso samples. Consistent among each of these biomarker images, the non-sandwiching methods readily detected individual mRNA and protein biomarkers compared to sandwiching methods.


As such, using sandwiching or non-sandwiching conditions, both gene and protein expression, down to the single biomarker level, can be detected concurrently across multiple tissue types using the methods described herein.


Example 5. Spatial Proteomics, Spatial Gene Expression, and Immune Cell Identification in FFPE Cancer Tissue Sections

Experiments were undertaken to determine whether analyte capture agents could provide for spatial protein and gene expression analysis in FFPE cancer tissue sections. Additionally, experiments were undertaken to identify various types of immune cells in breast cancer FFPE tissue sections and ovarian cancer FFPE tissue sections. The tissue sections were prepared and analysis was performed by the methods described in Example 4.


Invasive Ductal Carcinoma Breast Cancer


As shown in FIGS. 23A-E a 25-plex antibody panel was used to study the tumor microenvironment and show spatial immune cell infiltration in a breast cancer FFPE tissue section. The data shown in FIGS. 23A-E are from cored samples from larger tissue sections which demonstrated consistent spatial gene and spatial protein expression as shown in FIGS. 23C-E and described herein (data not shown). FIG. 23A shows an H&E stained human invasive ductal carcinoma grade III breast cancer FFPE tissue section and FIG. 23B shows the H&E image of FIG. 23A annotated by a pathologist. The pathologist annotations are outlined in the image and correspond to either Blood Vessel, DCIS (ductal carcinoma in situ), Immune Cells, Invasive Carcinoma, Necrosis, or Normal Gland. The pathologist identified ductal carcinoma in situ as well as areas of tissue with immune cell infiltrates.


The spatial gene and spatial protein expression clustering superimposed on the H&E stained image shown in FIG. 23A demonstrated similar expression patterns delineating the tumor and stromal region (data not shown). More specifically, protein immune markers were used to identify infiltrating immune cells. For example, FIG. 23C shows spatial protein expression of CD3 (e.g., a marker for T cells) and FIG. 23D shows spatial protein expression of CD8A (e.g., a marker for cytotoxic T cells). Moreover, within an infiltrate, spatial orientation of different types of immune cells were distinguishable. An example of this is shown in FIG. 23E where an accumulation of cytotoxic T cells expressing human leukocyte antigen-DR isotype (HLA-DR) (e.g., a marker of T cell activation) were observed.


Additionally, spatial gene and protein expression of additional genes and proteins were examined from the same tissue section shown in FIG. 23A. More specifically, gene ACTA2 and its corresponding protein, alpha-smooth muscle actin (SMA), demonstrated similar expression patterns with positive gene-protein UMI count correlations (data not shown). Further examination of cytokeratin gene, KRT18, also demonstrated similar patterns to a PanCK antibody and again positive gene-protein UMI correlations were observed (data not shown).


In a different grade II invasive ductal carcinoma FFPE breast cancer tissue section the tissue section was H&E stained and spatial protein expression of PanCK and HLA-DR within the tissue section. Manual selection of the HLA-DR and PanCK positive regions was performed with the 10× Loupe Browser showing contrasting regions within the tissue section. Local differential expression analysis of both regions generated the top 50 genes associated with expression in the HLA-DR or PanCK selected regions identified and are shown in Table 5.
















TABLE 5








HLA-DR



PanCK



Marker
HLA-DR
Log2 Fold
HLA-DR
PanCK
PanCK Log2
P-


Marker ID
Name
Average
Change
P-Value
Average
Fold Change
Value







ENSG00000106483
SFRP4
11.59067363
2.58736286
3.34E−49
1.926061057
−2.58736286
3.34E−49


ENSG00000168685
IL7R
3.519297315
2.433061874
1.02E−40
0.650696303
−2.433061874
1.02E−40


ENSG00000011465
DCN
29.40019273
2.218895222
4.74E−39
6.307770284
−2.218895222
4.74E−39


ENSG00000091986
CCDC80
3.432380045
2.310230989
7.36E−39
0.691066033
−2.310230989
7.36E−39


ENSG00000139329
LUM
33.17683334
2.178290672
9.94E−38
7.321262975
−2.178290672
9.94E−38


ENSG00000197614
MFAP5
3.117091908
2.247513206
2.12E−36
0.655476929
−2.247513206
2.12E−36


ENSG00000211772
TRBC2
4.483908589
2.20449644
3.84E−36
0.971529419
−2.20449644
3.84E−36


ENSG00000087245
MMP2
9.819947279
2.17666454
3.84E−36
2.169341797
−2.17666454
3.84E−36


ENSG00000182326
C1S
7.999797384
2.155136429
4.02E−36
1.793797074
−2.155136429
4.02E−36


ENSG00000108821
COL1A1
150.9804112
2.114722952
4.02E−36
34.81889197
−2.114722952
4.02E−36


ENSG00000136235
GPNMB
5.620650143
2.161589748
2.39E−34
1.254648708
−2.161589748
2.39E−34


ENSG00000090382
LYZ
5.075286879
2.204681169
3.37E−34
1.099543957
−2.204681169
3.37E−34


ENSG00000064205
CCN5
3.718695759
2.138373605
4.86E−34
0.843514881
−2.138373605
4.86E−34


ENSG00000211751
TRBC1
4.436189304
2.185129984
7.54E−34
0.974185322
−2.185129984
7.54E−34


ENSG00000164692
COL1A2
97.7921546
2.041795601
8.18E−34
23.72199689
−2.041795601
8.18E−34


ENSG00000277734
TRAC
4.685011293
2.099070424
4.58E−33
1.092107428
−2.099070424
4.58E−33


ENSG00000211592
IGKC
190.0999999
2.203176006
9.62E−33
41.23342956
−2.203176006
9.62E−33


ENSG00000271503
CCL5
4.115788386
2.085695324
1.34E−32
0.968342335
−2.085695324
1.34E−32


ENSG00000158747
NBL1
8.572428812
2.007423552
1.09E−31
2.129503248
−2.007423552
1.09E−31


ENSG00000106624
AEBP1
24.52600855
1.986108768
1.64E−31
6.183474011
−1.986108768
1.64E−31


ENSG00000169442
CD52
2.54616474
2.103282373
1.85E−31
0.59173525
−2.103282373
1.85E−31


ENSG00000168542
COL3A1
55.19587513
1.945997239
8.85E−31
14.30841332
−1.945997239
8.85E−31


ENSG00000163520
FBLN2
4.983256828
1.994115903
8.85E−31
1.249336902
−1.994115903
8.85E−31


ENSG00000172724
CCL19
4.214635477
2.569106092
1.13E−30
0.709126175
−2.569106092
1.13E−30


ENSG00000145423
SFRP2
12.30135013
1.975672819
1.40E−30
3.123873435
−1.975672819
1.40E−30


ENSG00000140937
CDH11
6.69433407
1.973568341
1.57E−30
1.702434001
−1.973568341
1.57E−30


ENSG00000106565
TMEM176B
2.784761169
2.020982234
4.69E−30
0.685223046
−2.020982234
4.69E−30


ENSG00000172061
LRRC15
6.252930678
1.96380266
5.20E−30
1.600978496
−1.96380266
5.20E−30


ENSG00000166741
NNMT
3.541452698
1.979047111
1.90E−29
0.897164127
−1.979047111
1.90E−29


ENSG00000184347
SLIT3
2.425162266
2.012530816
3.18E−29
0.600234141
−2.012530816
3.18E−29


ENSG00000107562
CXCL12
6.52390805
1.925167509
5.56E−29
1.715713517
−1.925167509
5.56E−29


ENSG00000149131
SERPING1
7.503857666
1.912104472
5.56E−29
1.991396278
−1.912104472
5.56E−29


ENSG00000123500
COL10A1
6.305762744
1.924239545
7.60E−29
1.659408368
−1.924239545
7.60E−29


ENSG00000140285
FGF7
1.174235279
2.165189314
8.22E−29
0.261340883
−2.165189314
8.22E−29


ENSG00000115594
IL1R1
2.104761348
2.001816916
1.23E−28
0.524806488
−2.001816916
1.23E−28


ENSG00000159403
C1R
10.59027289
1.895587338
2.40E−28
2.842878868
−1.895587338
2.40E−28


ENSG00000165507
DEPP1
5.92741698
2.006365507
2.68E−28
1.473495138
−2.006365507
2.68E−28


ENSG00000142871
CCN1
11.35378146
1.8940456
3.90E−28
3.051101685
−1.8940456
3.90E−28


ENSG00000143196
DPT
2.212129741
1.984447325
3.90E−28
0.558270869
−1.984447325
3.90E−28


ENSG00000213886
UBD
1.508270278
2.211600224
3.90E−28
0.325082561
−2.211600224
3.90E−28


ENSG00000186340
THBS2
6.307467004
1.90036637
3.90E−28
1.687560943
−1.90036637
3.90E−28


ENSG00000060718
COL11A1
5.138344506
1.953199093
1.11E−27
1.325295736
−1.953199093
1.11E−27


ENSG00000197747
S100A10
6.643206264
1.86886665
1.72E−27
1.816637842
−1.86886665
1.72E−27


ENSG00000132386
SERPINF1
11.63498439
1.853278452
1.80E−27
3.216298869
−1.853278452
1.80E−27


ENSG00000118523
CCN2
16.70174997
1.860743031
3.07E−27
4.593119128
−1.860743031
3.07E−27


ENSG00000127083
OMD
1.624159972
2.000597227
4.93E−27
0.40529084
−2.000597227
4.93E−27


ENSG00000084636
COL16A1
3.253432724
1.891287213
6.63E−27
0.875916901
−1.891287213
6.63E−27


ENSG00000180447
GAS1
2.45413469
1.901572191
2.20E−26
0.65600811
−1.901572191
2.20E−26


ENSG00000163430
FSTL1
10.87829286
1.80177238
6.32E−26
3.116436906
−1.80177238
6.32E−26


ENSG00000227507
LTB
2.731929102
1.888847173
8.98E−26
0.736747569
−1.888847173
8.98E−26









The data demonstrate that spatial protein expression can identify immune cell infiltration in breast cancer FFPE tissue sections and moreover the spatial protein expression correlates with annotations by a pathologist which demonstrates the utility of the methods described herein in identifying immune cells within a tumor microenvironment can be used as a diagnostic tool.


Ovarian Carcinoma


As shown in FIGS. 24A-D a 25-plex antibody panel was used to study an FFPE ovarian cancer (e.g., carcinoma) tissue section and show spatial immune cell infiltration. The antibody panel included antibodies for both intracellular and extracellular markers. FIG. 24A shows a pathologist's annotation for invasive carcinoma and immune cells in an H&E stained ovarian cancer FFPE tissue section. The pathologist annotations are outlined in the image and correspond to either Blood Vessel, DCIS (ductal carcinoma in situ), Immune Cells, Invasive Carcinoma, or Necrosis.


The 25-plex antibody panel included antibodies for protein immune markers which confirmed the presence of immune cells within the ovarian cancer FFPE tissue section. Further, the antibody panel distinguished (e.g., subtyped) the immune cells based on their characteristic surface markers. For example, FIG. 24B shows spatial protein expression of CD20 (e.g., a marker for B cells) and FIG. 24C shows spatial protein expression of CD68 (e.g., a marker for monocytes). FIG. 24D shows spatial protein expression of CD8A (e.g., a marker for cytotoxic T cells) and a small region of the ovarian carcinoma includes cytotoxic T cell infiltration (arrow) while the larger carcinoma does not.



FIGS. 25A-D show differential spatial cytotoxic T cell infiltration within different regions of an ovarian cancer FFPE tissue section. Gene expression profiles of the large and small carcinoma regions were compared to find differences that may be correlated to varying immune cell infiltration observed in the protein expression data. FIG. 25A shows spatial protein expression of CD8A (e.g., a marker for cytotoxic T cells) and FIG. 25B shows highly infiltrated (“hot”) and non-infiltrated (“cold”) areas of the ovarian cancer FFPE tissue section. The infiltration mapping is based on protein detection of CD3 protein expression for the “hot” or high cytotoxic T cell infiltration, and CD8 protein expression for the “cold” or minimal to no cytotoxic T cell infiltration. FIGS. 25C and 25D show spatial gene expression of immune response genes. For example, FIG. 25C shows spatial gene expression of HLA class I histocompatibility antigen, alpha chain G (HLA-G; also known as human leukocyte antigen G) in the small carcinoma which correlates with protein expression data and FIG. 25D shows spatial gene expression in the large carcinoma of interphotoreceptor matrix proteoglycan 2 (IMPG2), which is known to be involved in tumor growth, which also correlates with protein expression data. The data demonstrate that spatial protein expression can identify immune cell infiltration in ovarian cancer FFPE tissues sections and moreover the spatial protein expression correlates with annotations by a pathologist and with gene expression data which demonstrates the utility of the methods described herein in identifying immune cells within a tumor microenvironment. The methods described herein can also be used as a diagnostic tool and/or screening method. Additionally, spatial gene expression correlating to different ovarian carcinomas within a tissue section are distinguishable by the methods described herein.


Example 6. Spatial Proteomics and Spatial Gene Expression in FFPE Cancer Tissue Sections

Experiments were undertaken to determine whether analyte capture agents could provide for spatial protein and gene expression analysis in FFPE cancer tissue sections. The tissue sections were prepared and analysis was performed by the methods described in Example 4.


Lung Cancer


As shown in FIGS. 27A-D spatial gene and spatial protein expression analysis in a FFPE lung cancer tissue section. FIG. 27A shows an H&E stained lung cancer FFPE tissue section and FIGS. 27B and 27C, show spatial gene expression clustering (FIG. 27B) and spatial protein expression clustering (FIG. 27C), respectively. FIG. 27D shows a HLA-DR protein spatial UMI plot. As described herein, HLA-DR is a marker of T cell activation and FIG. 27D


The data demonstrate that spatial gene and spatial protein expression correlate with each other which demonstrates the utility of the methods described herein in identifying spatial gene and protein expression in lung cancer FFPE tissue sections which can be used as a diagnostic tool.


Melanoma


As shown in FIGS. 28A-D spatial gene and spatial protein expression analysis in a FFPE melanoma tissue section. FIG. 28A shows an H&E stained lung cancer FFPE tissue section and FIGS. 28B and 28C, show spatial gene expression clustering (FIG. 28B) and spatial protein expression clustering (FIG. 28C), respectively. FIG. 28D shows HLA-DR protein spatial UMI plot. As described herein, HLA-DR is a marker of T cell activation and FIG. 28D


The data demonstrate that spatial gene and spatial protein expression correlate with each other which demonstrates the utility of the methods described herein in identifying spatial gene and protein expression in melanoma FFPE tissue sections which can be used as a diagnostic tool.


Other Tissues Assayed


In addition to the various FFPE tissue sections assayed as described herein, other tissue types were assayed including: healthy brain tissue, breast cancer invasive lobular carcinoma tissue, healthy breast tissue, colon cancer tissue, healthy colon tissue, glioblastoma tissue, heart tissue, healthy lung tissue, prostate cancer tissue, healthy spleen tissue, testes tissue, inflamed tonsil tissue, cervix tissue, and lymph node tissue (data not shown).


Example 7. Spatial Protein Expression Correlates with Immunofluorescence Staining


FIGS. 29A-C show Vimentin (VIM) antibody immunofluorescence staining (FIG. 29A) and DAPI staining in a grade II invasive ductal carcinoma FFPE breast cancer tissue section. FIG. 29B shows spatial protein expression superimposed on the fluorescent image in FIG. 29A. FIG. 29C shows spatial protein expression with a VIM specific analyte capture agent in the same tissue section. The data demonstrate a similar spatial distribution between Vimentin antibody immunofluorescent staining (FIG. 29A) and spatial protein expression with a VIM specific analyte capture agent (FIG. 29C) and demonstrates the utility of the methods described herein to recapitulate spatial protein expression with analyte capture agents relative to immunofluorescent antibody staining.


OTHER EMBODIMENTS

It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims
  • 1. A method for determining the spatial location of a nucleic acid and a protein from a biological sample comprising: a) providing a spatial array comprising a first and second plurality of capture probes wherein each of the first and second plurality of capture probes comprises a spatial barcode and a capture domain,b) contacting the biological sample with (i) a plurality of analyte capture agents, wherein an analyte capture agent comprises an analyte binding moiety and an oligonucleotide comprising an analyte binding moiety barcode and an analyte capture sequence, wherein the analyte capture sequence comprises a sequence complementary to a second plurality of capture domains, and(ii) a plurality of templated ligation probe pairs, wherein one of the templated ligation probes in the probe pair comprises a sequence complementary to a first plurality of capture domains,c) binding the analyte binding moiety of the analyte capture agent to a target protein,d) hybridizing the templated ligation probe pairs to a target nucleic acid and ligating the probe pairs to produce ligation products,e) hybridizing the ligation products to the first plurality of capture domains and the analyte capture sequences of the bound analyte capture agents to the second plurality of capture domains on the spatial array, andf) determining the sequence or a portion thereof of (i) the ligation product, or a complement thereof, (ii) the spatial barcode of the capture probe hybridized to the ligation product, or a complement thereof, (iii) the analyte binding moiety barcode of the analyte capture agent bound to the target protein, or a complement thereof, and (iv) the spatial barcode of the capture probe hybridized to the oligonucleotide comprising the analyte binding moiety barcode the analyte capture sequence, thereby determining the spatial location of the nucleic acid and the protein from the biological sample.
  • 2. The method of claim 1, wherein the biological sample is placed on the spatial array prior to step b).
  • 3. The method of claim 1, wherein the biological sample is on a substrate without a spatial array, and wherein prior to step e) the ligation products and the analyte capture sequences of the bound analyte capture agents are migrated to the spatial array.
  • 4. The method of claim 1, wherein the capture domains of the first plurality of capture probes are non-homopolymeric capture sequences or homopolymeric sequences, and the capture domains of the second plurality of capture probes are non-homopolymeric sequences or homopolymeric capture sequences.
  • 5. The method of claim 4, wherein the capture domains of the first plurality of capture probes are different from the capture domains of the second plurality of capture probes.
  • 6. The method of claim 4, wherein the homopolymeric sequences comprise a polyT sequence and the non-homopolymeric sequences comprise a fixed sequence.
  • 7. The method of claim 6, wherein the fixed sequence comprises at least one sequence selected from SEQ ID NO: 1 through SEQ ID NO: 11.
  • 8. The method of claim 1, wherein the biological sample is a tissue sample, and wherein the tissue sample is a fresh-frozen tissue sample or a fixed tissue sample, wherein the fixed tissue sample is a formalin-fixed tissue sample, an acetone fixed tissue sample, a paraformaldehyde tissue sample, or a methanol fixed tissue sample.
  • 9. The method of claim 8, wherein the tissue sample is obtained from a normal tissue sample, a tissue biopsy sample, a diseased tissue sample, or a rodent tissue.
  • 10. The method of claim 1, wherein before step (b) the biological sample is deparaffinized and decrosslinked, and wherein the decrosslinking comprises the use of a buffer.
  • 11. The method of claim 10, wherein the buffer comprises Tris-EDTA buffer at a pH from about 8 to about 10 and a temperature from about 60° C. to about 90° C.
  • 12. The method of claim 10, wherein the buffer comprises citrate buffer at a pH from about 5 to about 7 and a temperature from about 70° C. to about 100° C.
  • 13. The method of claim 1, wherein hybridizing the ligation products to the first plurality of capture domains and hybridizing the analyte capture sequences of the bound analyte capture agents to the second plurality of capture domains comprises permeabilizing the biological sample.
  • 14. The method of claim 1, wherein the analyte capture sequence of the analyte capture agent is blocked prior to binding the analyte capture agent to the target protein.
  • 15. The method of claim 14, wherein the analyte capture sequence of the analyte capture agent is blocked by a blocking probe, and wherein the blocking probe is removed prior to hybridizing the analyte capture sequence of the analyte capture agent to the capture domain of the capture probe.
  • 16. The method of claim 1, wherein the determining in step (f) further comprises: g) extending the ligation products and the oligonucleotides of the analyte capture agents, wherein the extension products comprise the spatial barcode or a complement thereof,h) releasing the extension products, or complements thereof, from the spatial array,i) producing a nucleic acid library from the released extension products or complements thereof; andj) sequencing the library.
  • 17. The method of claim 16, wherein prior to step (i) the method further comprises pre-amplifying the extension products, or complements thereof.
  • 18. The method of claim 16, wherein the complement of the oligonucleotide of the analyte capture agent comprises an analyte binding moiety barcode specific to the analyte binding moiety of the analyte capture agent.
  • 19. The method of claim 1, wherein the first and second plurality of capture probes further comprise a cleavage domain, one or more functional domains, a unique molecular identifier, and combinations thereof.
  • 20. The method of claim 1, wherein the method further comprises imaging the biological sample.
  • 21. The method of claim 20, wherein the imaging comprises one or more of expansion microscopy, bright field microscopy, dark field microscopy, phase contrast microscopy, electron microscopy, fluorescence microscopy, reflection microscopy, interference microscopy and confocal microscopy.
  • 22. The method of claim 1, wherein the method further comprises staining the biological sample, wherein the staining comprises hematoxylin and eosin, or the use of a detectable label selected from the group consisting of a radioisotope, a fluorophore, a chemiluminescent compound, a bioluminescent compound, or a combination thereof.
  • 23. The method of claim 1, wherein the spatial array further comprises one or more protein dilution series.
CROSS-REFERENCE TO RELATED APPLICATIONS

Pursuant to 35 U.S.C. § 119(e), this application is a continuation of International Application PCT/US2022/020985, with an international filing date of Mar. 18, 2022, which claims priority to U.S. Provisional Patent Application No. 63/162,870, filed on Mar. 18, 2021, U.S. Provisional Patent Application No. 63/214,058, filed on Jun. 23, 2021, U.S. Provisional Patent Application No. 63/245,697, filed on Sep. 17, 2021, U.S. Provisional Patent Application No. 63/252,335, filed on Oct. 5, 2021, U.S. Provisional Patent Application No. 63/270,230, filed on Oct. 21, 2021, and U.S. Provisional Patent Application No. 63/311,703, filed on Feb. 18, 2022. The contents of each of these applications is incorporated herein by reference in their entireties.

US Referenced Citations (458)
Number Name Date Kind
4683195 Mullis Jul 1987 A
4683202 Mullis Jul 1987 A
4800159 Mullis Jan 1989 A
4883867 Lee Nov 1989 A
4965188 Mullis Oct 1990 A
5002882 Lunnen Mar 1991 A
5130238 Malek Jul 1992 A
5308751 Ohkawa May 1994 A
5321130 Yue Jun 1994 A
5410030 Yue Apr 1995 A
5436134 Haugland Jul 1995 A
5455166 Walker Oct 1995 A
5494810 Barany et al. Feb 1996 A
5503980 Cantor Apr 1996 A
5512439 Hornes Apr 1996 A
5512462 Cheng Apr 1996 A
5582977 Yue Dec 1996 A
5599675 Brenner Feb 1997 A
5641658 Adams Jun 1997 A
5648245 Fire et al. Jul 1997 A
5658751 Yue Aug 1997 A
5750341 Macevicz May 1998 A
5763175 Brenner Jun 1998 A
5830711 Barany et al. Nov 1998 A
5837832 Chee et al. Nov 1998 A
5854033 Lizardi Dec 1998 A
5863753 Haugland Jan 1999 A
5871921 Landegren et al. Feb 1999 A
5912148 Eggerding Jun 1999 A
6013440 Lipshutz Jan 2000 A
6027889 Barany et al. Feb 2000 A
6060240 Kamb et al. May 2000 A
6130073 Eggerding Oct 2000 A
6143496 Brown Nov 2000 A
6153389 Haarer Nov 2000 A
6165714 Lane et al. Dec 2000 A
6210891 Nyren Apr 2001 B1
6210894 Brennan Apr 2001 B1
6214587 Dattagupta Apr 2001 B1
6258568 Nyren Jul 2001 B1
6266459 Walt Jul 2001 B1
6274320 Rothberg Aug 2001 B1
6300063 Lipshutz et al. Oct 2001 B1
6309824 Drmanac Oct 2001 B1
6344316 Lockhart Feb 2002 B1
6355431 Chee Mar 2002 B1
6368801 Faruqi Apr 2002 B1
6401267 Drmanac Jun 2002 B1
6404907 Gilchrist Jun 2002 B1
6432360 Church et al. Aug 2002 B1
6503713 Rana Jan 2003 B1
6506561 Cheval et al. Jan 2003 B1
6544732 Chee Apr 2003 B1
6579695 Lambalot Jun 2003 B1
6620584 Chee Sep 2003 B1
6632641 Brennan Oct 2003 B1
6699710 Kononen Mar 2004 B1
6737236 Pieken et al. May 2004 B1
6770441 Dickinson Aug 2004 B2
6773886 Kaufman Aug 2004 B2
6787308 Balasubramanian Sep 2004 B2
6800453 Labaer Oct 2004 B2
6812005 Fan et al. Nov 2004 B2
6828100 Ronaghi Dec 2004 B1
6833246 Balasubramanian Dec 2004 B2
6859570 Walt Feb 2005 B2
6864052 Drmanac Mar 2005 B1
6897023 Fu May 2005 B2
6942968 Dickinson et al. Sep 2005 B1
7057026 Barnes Jun 2006 B2
7115400 Adessi Oct 2006 B1
7118883 Inoue Oct 2006 B2
7166431 Chee et al. Jan 2007 B2
7192735 Lambalot Mar 2007 B2
7211414 Hardin May 2007 B2
7255994 Lao Aug 2007 B2
7258976 Mitsuhashi Aug 2007 B2
7297518 Quake Nov 2007 B2
7329492 Hardin Feb 2008 B2
7361488 Fan et al. Apr 2008 B2
7378242 Hurt May 2008 B2
7393665 Brenner Jul 2008 B2
7405281 Xu Jul 2008 B2
7407757 Brenner Aug 2008 B2
7537897 Brenner May 2009 B2
7563576 Chee Jul 2009 B2
7582420 Oliphant et al. Sep 2009 B2
7601498 Mao Oct 2009 B2
7635566 Brenner Dec 2009 B2
7674752 He Mar 2010 B2
7700286 Stroun et al. Apr 2010 B2
7709198 Luo et al. May 2010 B2
7776567 Mao Aug 2010 B2
7803943 Mao Sep 2010 B2
7910304 Drmanac Mar 2011 B2
7955794 Shen et al. Jun 2011 B2
7960119 Chee Jun 2011 B2
8003354 Shen et al. Aug 2011 B2
8148068 Brenner Apr 2012 B2
8206917 Chee Jun 2012 B2
8207093 Szostak Jun 2012 B2
8288103 Oliphant Oct 2012 B2
8460865 Chee Jun 2013 B2
8481257 Van Eijk Jul 2013 B2
8603743 Liu et al. Dec 2013 B2
8604182 Luo et al. Dec 2013 B2
8815512 Van Eijk Aug 2014 B2
8835358 Fodor Sep 2014 B2
8911945 Van Eijk Dec 2014 B2
8951726 Luo et al. Feb 2015 B2
9062348 Van Eijk Jun 2015 B1
9194001 Brenner Nov 2015 B2
9290808 Fodor Mar 2016 B2
9290809 Fodor Mar 2016 B2
9328383 Van Eijk May 2016 B2
9334536 Van Eijk May 2016 B2
9371598 Chee Jun 2016 B2
9506061 Brown et al. Nov 2016 B2
9593365 Frisen et al. Mar 2017 B2
9644204 Hindson et al. May 2017 B2
9694361 Bharadwaj Jul 2017 B2
9702004 Van Eijk Jul 2017 B2
9727810 Fodor et al. Aug 2017 B2
9777324 Van Eijk Oct 2017 B2
9783841 Nolan et al. Oct 2017 B2
9834814 Peter et al. Dec 2017 B2
9850536 Oliphant et al. Dec 2017 B2
9868979 Chee et al. Jan 2018 B2
9879313 Chee et al. Jan 2018 B2
10002316 Fodor et al. Jun 2018 B2
10023907 Van Eijk Jul 2018 B2
10030261 Frisen et al. Jul 2018 B2
10041949 Bendall et al. Aug 2018 B2
10059990 Boyden et al. Aug 2018 B2
10208982 Bannish et al. Feb 2019 B2
10273541 Hindson et al. Apr 2019 B2
10357771 Bharadwaj Jul 2019 B2
10472669 Chee Nov 2019 B2
10480022 Chee Nov 2019 B2
10480029 Bent et al. Nov 2019 B2
10494667 Chee Dec 2019 B2
10550429 Harada et al. Feb 2020 B2
10590244 Delaney et al. Mar 2020 B2
10724078 Van Driel et al. Jul 2020 B2
10725027 Bell Jul 2020 B2
10774372 Chee et al. Sep 2020 B2
10774374 Frisen et al. Sep 2020 B2
10787701 Chee Sep 2020 B2
10858702 Lucero et al. Dec 2020 B2
10913975 So et al. Feb 2021 B2
10914730 Chee et al. Feb 2021 B2
10927403 Chee et al. Feb 2021 B2
10961566 Chee Mar 2021 B2
11008607 Chee May 2021 B2
11046996 Chee et al. Jun 2021 B1
11067567 Chee Jul 2021 B2
11156603 Chee Oct 2021 B2
11162132 Frisen et al. Nov 2021 B2
11208684 Chee Dec 2021 B2
11286515 Chee et al. Mar 2022 B2
11293917 Chee Apr 2022 B2
11299774 Frisen et al. Apr 2022 B2
11313856 Chee Apr 2022 B2
11332790 Chell et al. May 2022 B2
11352659 Frisen et al. Jun 2022 B2
11352667 Hauling et al. Jun 2022 B2
11359228 Chee et al. Jun 2022 B2
11365442 Chee Jun 2022 B2
11371086 Chee Jun 2022 B2
11384386 Chee Jul 2022 B2
11390912 Frisen et al. Jul 2022 B2
11401545 Chee Aug 2022 B2
11407992 Dadhwal Aug 2022 B2
11408029 Katiraee et al. Aug 2022 B2
11434524 Ramachandran Iyer et al. Sep 2022 B2
11479809 Frisen et al. Oct 2022 B2
11479810 Chee Oct 2022 B1
11492612 Dadhwal Nov 2022 B1
11505828 Chell et al. Nov 2022 B2
11512308 Gallant et al. Nov 2022 B2
11519022 Chee Dec 2022 B2
11519033 Schnall-Levin et al. Dec 2022 B2
11535887 Gallant et al. Dec 2022 B2
11542543 Chee Jan 2023 B2
11549138 Chee Jan 2023 B2
11560587 Chee Jan 2023 B2
11560592 Chew et al. Jan 2023 B2
11560593 Chell et al. Jan 2023 B2
11592447 Uytingco et al. Feb 2023 B2
11608498 Gallant et al. Mar 2023 B2
11608520 Galonska et al. Mar 2023 B2
11613773 Frisen et al. Mar 2023 B2
11618897 Kim et al. Apr 2023 B2
11618918 Chee et al. Apr 2023 B2
11624063 Dadhwal Apr 2023 B2
11624086 Uytingco et al. Apr 2023 B2
11634756 Chee Apr 2023 B2
20020040275 Cravatt Apr 2002 A1
20020164611 Bamdad Nov 2002 A1
20030017451 Wang et al. Jan 2003 A1
20030022207 Balasubramanian Jan 2003 A1
20030040035 Slamon Feb 2003 A1
20030148335 Shen et al. Aug 2003 A1
20030162216 Gold Aug 2003 A1
20030224419 Corcoran Dec 2003 A1
20030232348 Jones et al. Dec 2003 A1
20030232382 Brennan Dec 2003 A1
20040033499 Ilsley et al. Feb 2004 A1
20040067492 Peng et al. Apr 2004 A1
20040096853 Mayer May 2004 A1
20040106110 Balasubramanian Jun 2004 A1
20050037393 Gunderson et al. Feb 2005 A1
20050048580 Labaer Mar 2005 A1
20050100900 Kawashima et al. May 2005 A1
20050130173 Leamon et al. Jun 2005 A1
20050136414 Gunderson et al. Jun 2005 A1
20050191656 Drmanac et al. Sep 2005 A1
20050191698 Chee et al. Sep 2005 A1
20050202433 Van Beuningen Sep 2005 A1
20050227271 Kwon Oct 2005 A1
20050260653 LaBaer Nov 2005 A1
20060211001 Yu et al. Sep 2006 A1
20060216775 Burkart et al. Sep 2006 A1
20060263789 Kincaid Nov 2006 A1
20070020640 McCloskey et al. Jan 2007 A1
20070054288 Su et al. Mar 2007 A1
20070099208 Drmanac et al. May 2007 A1
20070128624 Gormley et al. Jun 2007 A1
20070128656 Agrawal Jun 2007 A1
20070172873 Brenner et al. Jul 2007 A1
20070207482 Church et al. Sep 2007 A1
20070254305 Paik et al. Nov 2007 A1
20070269805 Hogers Nov 2007 A1
20080009420 Schroth et al. Jan 2008 A1
20080108804 Hayashizaki et al. May 2008 A1
20080160580 Adessi et al. Jul 2008 A1
20080220434 Thomas Sep 2008 A1
20080261204 Lexow Oct 2008 A1
20080286795 Kawashima et al. Nov 2008 A1
20090005252 Drmanac et al. Jan 2009 A1
20090006002 Honisch et al. Jan 2009 A1
20090018024 Church et al. Jan 2009 A1
20090026082 Rothberg et al. Jan 2009 A1
20090082212 Williams Mar 2009 A1
20090099041 Church et al. Apr 2009 A1
20090105959 Braverman et al. Apr 2009 A1
20090117573 Fu et al. May 2009 A1
20090127589 Rothberg et al. May 2009 A1
20090155781 Drmanac et al. Jun 2009 A1
20090233802 Bignell et al. Sep 2009 A1
20090253581 van Eijk et al. Oct 2009 A1
20090291854 Weisinger-Mayr et al. Nov 2009 A1
20090312193 Kim et al. Dec 2009 A1
20100035249 Hayashizaki et al. Feb 2010 A1
20100120043 Sood et al. May 2010 A1
20100120097 Matz et al. May 2010 A1
20100120098 Grunenwald et al. May 2010 A1
20100145037 Brive et al. Jun 2010 A1
20110028685 Purkayastha et al. Feb 2011 A1
20110059436 Hardin et al. Mar 2011 A1
20110245111 Chee Oct 2011 A1
20120135871 van Eijk et al. May 2012 A1
20120202698 van Eijk et al. Aug 2012 A1
20130171621 Luo et al. Jul 2013 A1
20140066318 Frisen et al. Mar 2014 A1
20140270435 Dunn Sep 2014 A1
20140274731 Raymond et al. Sep 2014 A1
20140323330 Glezer et al. Oct 2014 A1
20150000854 Gann-Fetter et al. Jan 2015 A1
20150292988 Bharadwaj et al. Oct 2015 A1
20150344942 Frisen et al. Dec 2015 A1
20160108458 Frei et al. Apr 2016 A1
20160138091 Chee et al. May 2016 A1
20160145677 Chee et al. May 2016 A1
20160253584 Fodor et al. Sep 2016 A1
20160289740 Fu et al. Oct 2016 A1
20160298180 Chee Oct 2016 A1
20170016053 Beechem et al. Jan 2017 A1
20170029875 Zhang et al. Feb 2017 A1
20170067096 Wassie et al. Mar 2017 A1
20170089811 Tillberg et al. Mar 2017 A1
20170220733 Zhuang et al. Aug 2017 A1
20170241911 Rockel et al. Aug 2017 A1
20170275669 Weissleder et al. Sep 2017 A1
20180051322 Church et al. Feb 2018 A1
20180057873 Zhou et al. Mar 2018 A1
20180112261 Van Driel et al. Apr 2018 A1
20180201980 Chee et al. Jul 2018 A1
20180216161 Chen et al. Aug 2018 A1
20180216162 Belhocine et al. Aug 2018 A1
20180245142 So et al. Aug 2018 A1
20180291439 van Eijk et al. Oct 2018 A1
20180305681 Jovanovich et al. Oct 2018 A1
20190032128 Chen et al. Jan 2019 A1
20190055594 Samusik et al. Feb 2019 A1
20190064173 Bharadwaj et al. Feb 2019 A1
20190085383 Church et al. Mar 2019 A1
20190161796 Hauling et al. May 2019 A1
20190177777 Chee Jun 2019 A1
20190177778 Chee Jun 2019 A1
20190177789 Hindson et al. Jun 2019 A1
20190177800 Boutet et al. Jun 2019 A1
20190194709 Church et al. Jun 2019 A1
20190203275 Frisen et al. Jul 2019 A1
20190233878 Delaney et al. Aug 2019 A1
20190249226 Bent Aug 2019 A1
20190249248 Beechem et al. Aug 2019 A1
20190262831 West et al. Aug 2019 A1
20190264268 Frisen et al. Aug 2019 A1
20190271030 Chee Sep 2019 A1
20190271031 Chee Sep 2019 A1
20190300943 Chee et al. Oct 2019 A1
20190300944 Chee et al. Oct 2019 A1
20190300945 Chee et al. Oct 2019 A1
20190309353 Chee Oct 2019 A1
20190309354 Chee Oct 2019 A1
20190309355 Chee Oct 2019 A1
20190323071 Chee Oct 2019 A1
20190323088 Boutet et al. Oct 2019 A1
20190330617 Church et al. Oct 2019 A1
20190338353 Belgrader et al. Nov 2019 A1
20190352708 Gaige et al. Nov 2019 A1
20190367969 Belhocine et al. Dec 2019 A1
20190367982 Belhocine et al. Dec 2019 A1
20190367997 Bent et al. Dec 2019 A1
20200002763 Belgrader et al. Jan 2020 A1
20200024641 Nolan et al. Jan 2020 A1
20200047010 Lee et al. Feb 2020 A1
20200048690 Chee Feb 2020 A1
20200063191 Kennedy-Darling et al. Feb 2020 A1
20200063195 Chee Feb 2020 A1
20200063196 Chee Feb 2020 A1
20200071751 Daugharthy et al. Mar 2020 A1
20200080136 Zhang et al. Mar 2020 A1
20200109443 Chee Apr 2020 A1
20200224244 Nilsson et al. Jul 2020 A1
20200239946 Dewal Jul 2020 A1
20200256867 Hennek et al. Aug 2020 A1
20200277663 Iyer Sep 2020 A1
20200277664 Frenz Sep 2020 A1
20200299757 Chee et al. Sep 2020 A1
20200325531 Chee Oct 2020 A1
20200370095 Farmer et al. Nov 2020 A1
20200399687 Frisen et al. Dec 2020 A1
20200407781 Schnall-Levin Dec 2020 A1
20210010068 Chee et al. Jan 2021 A1
20210010070 Schnall-Levin et al. Jan 2021 A1
20210095331 Fan et al. Apr 2021 A1
20210123040 Macosko Apr 2021 A1
20210140982 Uytingco et al. May 2021 A1
20210150707 Weisenfeld et al. May 2021 A1
20210155982 Yin et al. May 2021 A1
20210158522 Weisenfeld et al. May 2021 A1
20210172007 Chee et al. Jun 2021 A1
20210189475 Tentori et al. Jun 2021 A1
20210190770 Delaney et al. Jun 2021 A1
20210198741 Williams Jul 2021 A1
20210199660 Williams et al. Jul 2021 A1
20210207202 Chee Jul 2021 A1
20210214785 Stoeckius Jul 2021 A1
20210222235 Chee Jul 2021 A1
20210222241 Bharadwaj Jul 2021 A1
20210222242 Ramachandran Iyer Jul 2021 A1
20210222253 Uytingco Jul 2021 A1
20210223227 Stoeckius Jul 2021 A1
20210230584 Mikkelsen et al. Jul 2021 A1
20210230681 Patterson et al. Jul 2021 A1
20210230692 Daugharthy et al. Jul 2021 A1
20210237022 Bava Aug 2021 A1
20210238664 Bava et al. Aug 2021 A1
20210238675 Bava Aug 2021 A1
20210238680 Bava Aug 2021 A1
20210247316 Bava Aug 2021 A1
20210255175 Chee et al. Aug 2021 A1
20210262018 Bava et al. Aug 2021 A1
20210262019 Alvarado Martinez et al. Aug 2021 A1
20210269864 Chee Sep 2021 A1
20210270822 Chee Sep 2021 A1
20210285036 Yin et al. Sep 2021 A1
20210285046 Chell et al. Sep 2021 A1
20210292748 Frisen et al. Sep 2021 A1
20210292822 Frisen et al. Sep 2021 A1
20210317510 Chee et al. Oct 2021 A1
20210317524 Lucero et al. Oct 2021 A1
20210324457 Ramachandran Iyer et al. Oct 2021 A1
20210332424 Schnall-Levin Oct 2021 A1
20210332425 Pfeiffer et al. Oct 2021 A1
20210003482 Chell et al. Nov 2021 A1
20220002791 Frisen et al. Jan 2022 A1
20220003755 Chee Jan 2022 A1
20220010367 Ramachandran Iyer et al. Jan 2022 A1
20220017951 Ramachandran Iyer et al. Jan 2022 A1
20220025446 Shah Jan 2022 A1
20220025447 Tentori et al. Jan 2022 A1
20220033888 Schnall-Levin et al. Feb 2022 A1
20220049293 Frenz et al. Feb 2022 A1
20220064630 Bent et al. Mar 2022 A1
20220081728 Williams Mar 2022 A1
20220090058 Frisen et al. Mar 2022 A1
20220090175 Uytingco et al. Mar 2022 A1
20220090181 Gallant et al. Mar 2022 A1
20220098576 Dadhwal Mar 2022 A1
20220098661 Chew et al. Mar 2022 A1
20220106632 Galonska et al. Apr 2022 A1
20220106633 Engblom et al. Apr 2022 A1
20220112486 Ramachandran Iyer et al. Apr 2022 A1
20220112545 Chee Apr 2022 A1
20220119869 Ramachandran Iyer et al. Apr 2022 A1
20220127659 Frisen et al. Apr 2022 A1
20220127666 Katiraee et al. Apr 2022 A1
20220127672 Stoeckius Apr 2022 A1
20220145361 Frenz et al. May 2022 A1
20220154255 Chee et al. May 2022 A1
20220170083 Khaled et al. Jun 2022 A1
20220195422 Gallant et al. Jun 2022 A1
20220195505 Frisen et al. Jun 2022 A1
20220196644 Chee Jun 2022 A1
20220213526 Frisen et al. Jul 2022 A1
20220220544 Ach Jul 2022 A1
20220241780 Tentori et al. Aug 2022 A1
20220267844 Ramachandran Iyer et al. Aug 2022 A1
20220282329 Chell et al. Sep 2022 A1
20220290217 Frenz et al. Sep 2022 A1
20220290219 Chee Sep 2022 A1
20220298560 Frisen et al. Sep 2022 A1
20220325325 Chee et al. Oct 2022 A1
20220326251 Uytingco et al. Oct 2022 A1
20220333171 Chee Oct 2022 A1
20220333192 Uytingco Oct 2022 A1
20220333195 Schnall-Levin et al. Oct 2022 A1
20220334031 Delaney et al. Oct 2022 A1
20220348905 Dadhwal Nov 2022 A1
20220348992 Stoeckius et al. Nov 2022 A1
20220356464 Kim et al. Nov 2022 A1
20220364163 Stahl et al. Nov 2022 A1
20220389491 Chee Dec 2022 A1
20220403455 Ramachandran Iyer et al. Dec 2022 A1
20220404245 Chell et al. Dec 2022 A1
20230002812 Stoeckius et al. Jan 2023 A1
20230014008 Shastry Jan 2023 A1
20230033960 Gallant et al. Feb 2023 A1
20230034039 Shahjamali Feb 2023 A1
20230034216 Bava Feb 2023 A1
20230040363 Chee Feb 2023 A1
20230042088 Chee Feb 2023 A1
20230042817 Mignardi Feb 2023 A1
20230047782 Tentori et al. Feb 2023 A1
20230056549 Dadhwal Feb 2023 A1
20230064372 Chell et al. Mar 2023 A1
20230069046 Chew et al. Mar 2023 A1
20230077364 Patterson et al. Mar 2023 A1
20230080543 Katiraee et al. Mar 2023 A1
20230081381 Chew et al. Mar 2023 A1
20230100497 Frisen et al. Mar 2023 A1
20230107023 Chee Apr 2023 A1
20230111225 Chew et al. Apr 2023 A1
20230113230 Kim et al. Apr 2023 A1
20230135010 Tentori et al. May 2023 A1
Foreign Referenced Citations (126)
Number Date Country
1680604 Oct 2005 CN
1712623 Oct 2006 EP
1923471 May 2008 EP
2002017 Dec 2008 EP
2881465 Jun 2015 EP
3013984 May 2016 EP
3511423 Jul 2019 EP
3541956 Sep 2019 EP
WO 1989010977 Nov 1989 WO
WO 1991006678 May 1991 WO
WO 1995025116 Sep 1995 WO
WO 1995035505 Dec 1995 WO
WO 2000063437 Oct 2000 WO
WO 2002059355 Aug 2002 WO
WO 2002077283 Oct 2002 WO
WO 2003002979 Jan 2003 WO
WO 2003010176 Feb 2003 WO
WO 2005007814 Jan 2005 WO
WO 2007073171 Jun 2007 WO
WO 2007076726 Jul 2007 WO
WO 2007145612 Dec 2007 WO
WO 2009032167 Mar 2009 WO
WO 2009152928 Dec 2009 WO
WO 2010126614 Nov 2010 WO
WO 2011068088 Jun 2011 WO
WO 2012159089 Nov 2012 WO
WO 2013123442 Aug 2013 WO
WO 2013131962 Sep 2013 WO
WO 2013138510 Sep 2013 WO
WO 2013150082 Oct 2013 WO
WO 2013150083 Oct 2013 WO
WO 2014060483 Apr 2014 WO
WO 2014210223 Dec 2014 WO
WO 2014210225 Dec 2014 WO
WO 2015031691 Mar 2015 WO
WO 2016138496 Sep 2016 WO
WO 2016138500 Sep 2016 WO
WO 2016162309 Oct 2016 WO
WO 2016166128 Oct 2016 WO
WO 2016168825 Oct 2016 WO
WO 2017019456 Feb 2017 WO
WO 2017027367 Feb 2017 WO
WO 2017075293 May 2017 WO
WO 2017096158 Jul 2017 WO
WO 2018064640 Apr 2018 WO
WO 2018091676 May 2018 WO
WO 2019213254 Nov 2019 WO
WO 2019213294 Nov 2019 WO
WO 2020028194 Feb 2020 WO
WO 2020047002 Mar 2020 WO
WO 2020047005 Mar 2020 WO
WO 2020047010 Mar 2020 WO
WO 2020053655 Mar 2020 WO
WO 2020066720 Apr 2020 WO
WO 2020076979 Apr 2020 WO
WO 2020099640 May 2020 WO
WO 2020112604 Jun 2020 WO
WO 2020123301 Jun 2020 WO
WO 2020123305 Jun 2020 WO
WO 2020123309 Jun 2020 WO
WO 2020123311 Jun 2020 WO
WO 2020123316 Jun 2020 WO
WO 2020123317 Jun 2020 WO
WO 2020123318 Jun 2020 WO
WO 2020123319 Jun 2020 WO
WO 2020123320 Jul 2020 WO
WO 2020160044 Aug 2020 WO
WO 2020167862 Aug 2020 WO
WO 2020176788 Sep 2020 WO
WO 2020176882 Sep 2020 WO
WO 2020190509 Sep 2020 WO
WO 2020198071 Oct 2020 WO
WO 2020206285 Oct 2020 WO
WO 2020219901 Oct 2020 WO
WO 2020243579 Dec 2020 WO
WO 2021041974 Mar 2021 WO
WO 2021067246 Apr 2021 WO
WO 2021067514 Apr 2021 WO
WO 2021091611 May 2021 WO
WO 2021092433 May 2021 WO
WO 2021097255 May 2021 WO
WO 2021102003 May 2021 WO
WO 2021102005 May 2021 WO
WO 2021102039 May 2021 WO
WO 2021133842 Jul 2021 WO
WO 2021133845 Jul 2021 WO
WO 2021133849 Jul 2021 WO
WO 2021142233 Jul 2021 WO
WO 2021168261 Aug 2021 WO
WO 2021168278 Aug 2021 WO
WO 2021216708 Oct 2021 WO
WO 2021225900 Nov 2021 WO
WO 2021236625 Nov 2021 WO
WO 2021236929 Nov 2021 WO
WO 2021237056 Nov 2021 WO
WO 2021237087 Nov 2021 WO
WO 2021242834 Dec 2021 WO
WO 2021247543 Dec 2021 WO
WO 2021247568 Dec 2021 WO
WO 2021252499 Dec 2021 WO
WO 2021252576 Dec 2021 WO
WO 2021252591 Dec 2021 WO
WO 2021252747 Dec 2021 WO
WO 2021263111 Dec 2021 WO
WO 2022025965 Feb 2022 WO
WO 2022060798 Mar 2022 WO
WO 2022060953 Mar 2022 WO
WO 2022061152 Mar 2022 WO
WO 2022087273 Apr 2022 WO
WO 2022098810 May 2022 WO
WO 2022099037 May 2022 WO
WO 2022109181 May 2022 WO
WO 2022140028 Jun 2022 WO
WO 2022147005 Jul 2022 WO
WO 2022147296 Jul 2022 WO
WO 2022164615 Aug 2022 WO
WO 2022178267 Aug 2022 WO
WO 2022198068 Sep 2022 WO
WO 2022221425 Oct 2022 WO
WO 2022226057 Oct 2022 WO
WO 2022236054 Nov 2022 WO
WO 2022256503 Dec 2022 WO
WO 2022271820 Dec 2022 WO
WO 2023287765 Jan 2023 WO
WO 2023018799 Feb 2023 WO
WO 2023034489 Mar 2023 WO
Non-Patent Literature Citations (168)
Entry
U.S. Appl. No. 63/033,348, filed Jun. 2, 2020, Bent.
Borm et al., “High throughput Human embryo spatial transcriptome mapping by surface transfer of tissue RNA,” Abstracts Selected Talks, Single Cell Genomics mtg, (SCG2019), 2019, 1 pages (Abstract Only).
Chen et al., “Large field of view-spatially resolved transcriptomics at nanoscale resolution,” bioRxiv, Jan. 19, 2021, retrieved from URL <https://www.biorxiv.org/node/1751045.abstract>, 37 pages.
Cho et al., “Seq-Scope: Submicrometer-resolution spatial transcriptomics for single cell and subcellular studies,” bioRxiv, Jan. 27, 2021, retrieved from URL <https://www.biorxiv.org/node/1754517.abstract>, 50 pages.
Codeluppi et al., “Spatial organization of the somatosensory cortex revealed by osmFISH,” Nature Methods, Nov. 2018, 15:932-935.
Eng et al., “Transcriptome-scale super-resolved imaging in tissues by RNA seqFISH+,” Nature, Apr. 2019, 568(7751):235-239, 37 pages.
Goh et al., “Highly Specific Multiplexed RNA Imaging in Tissues With Split-FISH,” Nat Methods, Jun. 15, 2020, 17(7):689-693, 21 pages.
Liu et al., “High-Spatial-Resolution Multi-Omnics Sequencing via Deterministic Barcoding in Tissue,” Cell, Nov. 13, 2020, 183(6):1665-1681, 36 pages.
Liu et al., “Spatial transcriptome sequencing of FFPE tissues at cellular level,” bioRxiv 788992, Oct. 14, 2020, 39 pages.
Takei et al., “Integrated Spatial Genomics Reveals Global Architecture of Single Nuclei,” Nature, Jan. 27, 2021, 590(7845):344-350, 53 pages.
Xia et al., “Spatial transcriptome profiling by MERFISH reveals subcellular RNA compartmentalization and cell cycle-dependent gene expression”, Proceedings of the National Academy of Sciences, Sep. 2019, 116(39):19490-19499.
U.S. Appl. No. 16/353,937, Frisen et al., filed Mar. 14, 2019.
U.S. Appl. No. 16/876,709, Schnall-Levin et al., filed May 18, 2020.
U.S. Appl. No. 17/707,189, Chell et al., filed Mar. 29, 2022.
U.S. Appl. No. 61/902,105, Kozlov et al., filed Nov. 8, 2013.
[No Author Listed], “Chromium Next GEM Single Cell 3′ Reagent Kits v3.1—User Guide,” 10x Genomics, Document No. CG000204, Nov. 2019, 58 pages.
[No Author Listed], “Chromium Next GEM Single Cell 3′ Reagent Kits v3.1 (Dual Index)—User Guide,” 10x Genomics, Mar. 2021, Document No. CG000315, 61 pages.
[No Author Listed], “HuSNP Mapping Assay User's Manual,” Affymetrix Part No. 90094 (Affymetrix, Santa Clara, Calif.), GeneChip, 2000, 104 pages.
[No Author Listed], “Microarray technologies have excellent, possibilities in genomics-related researches,” Science Tools From Amersham Pharmacia Biotech, 1998, 3(4): 8 pages (with English Translation).
10xGenomics.com, [online], “Visium Spatial Gene Expression Reagent Kits—Tissue Optimization—User Guide,” Jul. 2020, retrieved on May 25, 2021, retrieved from URL<https://assets.ctfassets.net/an68im79xiti/5UJrN0cHl7rEk0UXwdl9It/e54d99fb08a8fl500aba503005a04a56/CG000238_VisiumSpatialTissueOptimizationUserGuide_RevD.pdf>, 42 pages.
10xGenomics.com, [online], “Visium Spatial Gene Expression Reagent Kits—Tissue Optimization,” Nov. 2019, retrieved on Jan. 25, 2022, retrieved from URL<https://assets.ctfassets.net/an68im79xiti/4q03w6959AJFxffSw5lee9/6a2ac61cf6388a72564eeb96bc294967/CG000238_VisiumSpatialTissueOptimizationUserGuide_Rev_A.pdf>, 46 pages.
10xGenomics.com, [online], “Visium Spatial Gene Expression Reagent Kits—Tissue Optimization,” Oct. 2020, retrieved on Dec. 28, 2021, retrieved from URL<https://assets.ctfassets.net/an68im79xiti/5UJrN0cH17rEk0UXwdl9It/e54d99fb08a8fl500aba503005a04a56/CG000238_VisiumSpatialTissueOptimizationUserGuide_RevD.pdf>, 43 pages.
10xGenomics.com, [online], “Visium Spatial Gene Expression Reagent Kits—User Guide,” Jun. 2020, retrieved on May 25, 2021, retrieved from URL<https://assets.ctfassets.net/an68im79xiti/3GGIfH3RWpdlbFVhalpexR/8baa08d9007157592b65b2cdc7130990/CG000239_VisiumSpatialGeneExpression_UserGuide_RevD.pdf>, 69 pages.
10xGenomics.com, [online], “Visium Spatial Gene Expression Reagent Kits—User Guide,” Oct. 2020, retrieved on Dec. 28, 2021, retrieved from URL<https://assets.ctfassets.net/an68im79xiti/3GGIfH3RWpdlbFVhalpexR/8baa08d9007157592b65b2cdc7130990/CG000239_VisiumSpatialGeneExpression_UserGuide_RevD.pdf>, 70 pages.
Adessi et al., “Solid phase DNA amplification: characterisation of primer attachment and amplification mechanisms,” Nucl. Acids Res., 2000, 28(20):E87, 8 pages.
Affymetrix, “GeneChip Human Genome U133 Set,” retrieved from the Internet: on the World Wide Web at affymetrix.com/support/technical/datasheets/hgu133_datasheet.pdf, retrieved on Feb. 26, 2003, 2 pages.
Affymetrix, “Human Genome U95Av2,” Internet Citation, retrieved from the internet: on the World Wide Web affymetrix.com, retrieved on Oct. 2, 2002, 1 page.
Albretsen et al., “Applications of magnetic beads with covalently attached oligonucleotides in hvbridization: Isolation and detection of specific measles virus mRNA from a crude cell lysate,” Anal. Biochem., 1990, 189(1):40-50.
Allawi et al., “Thermodynamics and NMR of Internal GâT Mismatches in DNA,” Biochemistry, 1996, 36(34):10581-10594.
Armani et al, “2D-PCR: a method of mapping DNA in tissue sections,” Lab Chip, 2009, 9(24):3526-34.
Asp et al., “Spatially Resolved Transcriptomes-Next Generation Tools for Tissue Exploration,” Bioessays, Oct. 2020, 42(10):e1900221, 16 pages.
Atkinson et al., “An Updated Protocol for High Throughput Plant Tissue Sectioning,” Front Plant Sci, 2017, 8:1721, 8 pages.
Atkinson, “Overview of Translation: Lecture Manuscript,” U of Texas, 2000, DD, pp. 6.1-6.8.
Bains et al., “A novel method for nucleic acid sequence determination,” Journal of Theoretical Biology, 1988, 135(3), 303-7.
Barnes, “PCR amplification of up to 35-kb DNA with high fidelity and high yield from lambda bacteriophage templates,” Proc. Natl. Acad. Sci USA, 1994, 91(6):2216-2220.
Beattie et al., “Advances in genosensor research,” Clin Chem., May 1995, 41(5):700-6.
Beechem et al., “High-Plex Spatially Resolved RNA and Protein Detection Using Digital Spatial Profiling: A Technology Designed for Immuno-oncology Biomarker Discovery and Translational Research,” Methods Mol Biol, 2020, Chapter 25, 2055:563-583.
Bergenstråhle et al., “Seamless integration of image and molecular analysis for spatial transcriptomics workflows,” BMC Genomics, Jul. 2020, 21(1):482, 7 pages.
Birney et al., “Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project,” Nature, 2007, 447(7146):799-816.
Blanchard et al., “High-density oligonucleotide arrays,” Biosensors & Bioelectronics, 1996, 11(6-7):687-690.
Blokzijl et al., “Profiling protein expression and interactions: proximity ligation as a tool for personalized medicine,” J Intern. Med., 2010, 268(3):232-245.
Blow, “Tissue Issues,” Nature, 2007, 448(7156):959-962.
Bolotin et al., “MiXCR: software for comprehensive adaptive immunity profiling,” Nat Methods., May 2015, 12(5):380-1.
Brandon et al., “Mitochondrial mutations in cancer,” Oncogene, 2006, 25(34):4647-4662.
Brenner et al., “Gene expression analysis by massively parallel signature sequencing (MPSS) on microbead arrays,” Nat. Biotech., 2000, 18(6):630-634.
Brenner et al., “In vitro cloning of complex mixtures of DNA on microbeads: physical separation of differentially expressed cDNAs,” Proc. Natl. Acad. Sci. USA, 2000, 97(4):1665-1670.
Brow, “35—The Cleavase I enzyme for mutation and polymorphism scanning,” PCR Applications Protocols for Functional Genomics, 1999, pp. 537-550.
Brown et al., “Retroviral integration: structure of the initial covalent product and its precursor, and a role for the viral IN protein,” Proc Natl Acad Sci USA, Apr. 1989, 86(8):2525-9.
Buenrostro et al., “Transposition of native chromatin for multimodal regulator analysis and personal epigenomics,” Nat Methods, Dec. 2013, 10(12):1213-1218.
Bullard et al., “Direct comparison of nick-joining activity of the nucleic acid ligases from bacteriophage T4,” Biochem. J. 2006, 398(1):135-144.
Burgess, “A space for transcriptomics,” Nature Reviews Genetics, 2016, 17(8):436-7.
Burgess, “Finding structure in gene expression,” Nature Reviews Genetics, 2018, 19(5):249, 1 page.
Burgess, “Spatial transcriptomics coming of age,” Nat Rev Genet., Jun. 2019, 20(6):317, 1 page.
Burton et al., “Coverslip Mounted-Immersion Cycled in Situ RT-PCR for the Localization of mRNA in Tissue Sections,” Biotechniques, 1998, 24(1):92-100.
Cha et al., “Specificity, efficiency, and fidelity of PCR,” Genome Res., 1993, 3(3):S18-29.
Chandra et al., “Cell-free synthesis-based protein microarrays and their applications,” Proteomics, 2009, 5(6):717-30.
Chatterjee et al., “Mitochondrial DNA mutations in human cancer. Oncogene,” 2006, 25(34):4663-4674.
Chen et al., “RNA imaging. Spatially resolved, highly multiplexed RNA profiling in single cells,” Science, Apr. 2015, 348(6233):aaa6090, 21 pages.
Chen et al., “Spatial Transcriptomics and In Situ Sequencing to Study Alzheimer's Disease,” Cell, Aug. 2020, 182(4):976-991.
Chen et al., “μCB-seq: microfluidic cell barcoding and sequencing for high-resolution imaging and sequencing of single cells,” Lab Chip, Nov. 2020, 20(21):3899-3913.
Constantine et al., “Use of genechip high-density oligonucleotide arrays for gene expression monitoring,” Life Science News, Amersham Life Science, 1998, pp. 11-14.
Credle et al., “Multiplexed analvsis of fixed tissue RNA using Ligation in situ Hybridization,” Nucleic Acids Research, 2017, 45(14):e128, 9 pages.
Crosetto et al., “Spatially resolved transcriptomics and beyond,” Nature Review Genetics, 2015, 16(1):57-66.
Czarnik “Encoding methods for combinatorial chemistry,” Curr Opin Chem Biol., Jun. 1997, 1(1):60-6.
Dahl et al., “Circle-to-circle amplification for precise and sensitive DNA analysis,” Proc. Natl. Acad. Sci., 2004, 101(13):4548-4553.
Dalma-Weiszhausz et al., “The affymetrix GeneChip platform: an overview,” Methods Enzymol., 2006, 410:3-28.
Daubendiek et al., “Rolling-Circle RNA Synthesis: Circular Oligonucleotides as Efficient Substrates for T7 RNA Polymerase,” J. Am. Chem. Soc., 1995, 117(29):7818-7819.
Davies et al., “How best to identify chromosomal interactions: a comparison of approaches,” Nat. Methods, 2017, 14(2):125-134.
Dean et al., “Comprehensive human genome amplification using multiple displacement amplification,” Proc Natl. Acad. Sci. USA, 2002, 99(8):5261-66.
Duncan et al., “Affinity chromatography of a sequence-specific DNA binding protein using Teflon-linked oligonucleotides,” Anal. Biochem., 1988, 169(1):104-108.
Eguiluz et al., “Multitissue array review: a chronological description of tissue array techniques, applications and procedures,” Pathology Research and Practice, 2006, 202(8):561-568.
Eldridge et al., “An in vitro selection strategy for conferring protease resistance to ligand binding peptides,” Protein Eng Des Sel., 2009, 22(11):691-698.
Ellington et al., “Antibody-based protein multiplex platforms: technical and operational challenges,” Clin Chem, 2010, 56(2):186-193.
Fire et al., “Rolling replication of short DNA circles,” Proc. Natl. Acad. Sci., 1995, 92(10):4641-4645.
Flanigon et al., “Multiplex protein detection with DNA readout via mass spectrometry,” N. Biotechnol., 2013, 30(2):153-158.
Fodor et al., “Light-directed, spatially addressable parallel chemical synthesis,” Science, 1995, 251(4995):767-773.
Forster et al., “A human gut bacterial genome and culture collection for improved metagenornic analyses,” Nature Biotechnology, 2019, 37(2):186-192.
Fredriksson et al., “Protein detection using proximity-dependent DNA ligation assays,” Nature Biotech., 20: 473-77, 2002.
Frese et al., “Formylglycine aldehyde Tag-protein engineering through a novel post-translational modification,” ChemBioChem., 2009, 10(3):425-27.
Fu et al., “Counting individual DNA molecules by the stochastic attachment of diverse labels,” PNAS, 2011, 108(22):9026-9031.
Fu et al., “Continuous Polony Gels for Tissue Mapping with High Resolution and RNA Capture Efficiency,” bioRxiv, 2021, 20 pages.
Fullwood et al., “Next-generation DNA sequencing of paired-end tags (PET) for transcriptome and genome analyses,” Genome Res., 2009, 19(4):521-532.
Ganguli et al., “Pixelated spatial gene expression analysis from tissue,” Nat Commun., Jan. 2018, 9(1):202, 9 pages.
Gao et al., “Q&A: Expansion microscopy,” BMC Biology, 15:50, 9 pages, 2017.
Gene@arrays[online], BeadArray Technology, available on or before Feb. 14, 2015, via Internet Archive: Wavback Machine URL <https://web.archive.org/web/20150214084616/http://genearrays.com/services/microarrays/illumina/beadarray-technology/>, [retrieved on Jan. 30, 2020], 3 pages.
Gnanapragasam, “Unlocking the molecular archive: the emerging use of formalin-fixed paraffin-embedded tissue for biomarker research in urological cancer,” BJU International, 2009, 105(2):274-278.
Goldkorn et al., “A simple and efficient enzymatic method for covalent attachment of DNA to cellulose. Application for hybridization-restriction analysis and for in vitro synthesis of DNA probes,” Nucleic Acids Res., 1986, 14(22):9171-9191.
Gracia Villacampa et al., “Genome-wide Spatial Expression Profiling in FFPE Tissues,” bioRxiv, 2020, pp. 38 pages.
Gunderson et al., “Decoding randomly ordered DNA arrays,” Genome Research, 2004, 14(5):870-877.
Guo et al., “Direct fluorescence analysis of genetic polymorphisms by hybridization with oligonucleotide arrays on glass supports,” Nucleic Acids Res., Dec. 1994, 22(24):5456-65.
Gupta et al., “Single-cell isoform RNA sequencing characterizes isoforms in thousands of cerebellar cells,” Nature Biotechnol., Oct. 2018, 36:1197-1202.
Hamaguchi et al., “Direct reverse transcription-PCR on oligo(dT)-immobilized polypropylene microplates after capturing total mRNA from crude cell lysates,” Clin Chem., Nov. 1998, 44(11):2256-63.
Hayes et al., “Electrophoresis of proteins and nucleic acids: I-Theory,” BMJ, Sep. 1989, 299(6703):843-6.
He et al., “In situ synthesis of protein arrays,” Current Opinion in Biotechnology, 2008, 19(1):4-9.
He et al., “Printing protein arrays from DNA arrays,” Nature Methods, 2008, 5(2):175-77.
He, “Cell-free protein synthesis: applications in proteomics and biotechnology,” New Biotechnology, 2008, 25(2-3):126-132.
Hejatko et al., “In situ hybridization technique for mRNA detection in whole mount Arabidopsis samples,” Nature Protocols, 2006, 1(4):1939-1946.
Hiatt et al., “Parallel, tag-directed assembly of locally derived short sequence reads,” Nature Methods, 2010, 7(2):119-25.
Hua et al., “Multi-level transcriptome sequencing identifies COLIA1 as a candidate marker in human heart failure progression,” BMC Med., Jan. 2020, 18(1):2, 16 pages.
Jamur et al., “Permeabilization of cell membranes.,” Method Mol. Biol., 2010, 588:63-66.
Jemt et al., “An automated approach to prepare tissue-derived spatially barcoded RNA-sequencing libraries,” Scientific Reports, 2016, 6:37137, 10 pages.
Kapteyn et al., “Incorporation of non-natural nucleotides into template-switching oligonucleotides reduces background and improves cDNA synthesis from very small RNA samples,” BMC Genomics, Jul. 2010, 11:413, 9 pages.
Korbel et al., “Paired-end mapping reveals extensive structural variation in the human genome,” Science, 2007, 318(5849):420-426.
Kozlov et al., “A highly scalable peptide-based assay system for proteomics,” PLoS ONE, 2012, 7(6):e37441, 10 pages.
Kristensen et al., “High-Throughput Methods for Detection of Genetic Variation,” BioTechniques, Feb. 2001, 30(2):318-332.
Kurz et al., “cDNA—protein fusions: covalent protein—gene conjugates for the in vitro selection of peptides and proteins,” ChemBioChem., 2001, 2(9):666-72.
Kwok, “High-throughput genotyping assay approaches,” Pharmocogenomics, Feb. 2000, 1(1):95-100.
Lage et al., “Whole genome analysis of genetic alterations in small DNA samples using hyperbranched strand displacement amplification and array-CGH,” Genome Research, 2003, 13(2):294-307.
Landegren et al., “Reading bits of genetic information: methods for single-nucleotide polymorphism analysis,” Genome Res., Aug. 1998, 8(8):769-76.
Langdale et al., “A rapid method of gene detection using DNA bound to Sephacryl,” Gene, 1985, 36(3):201-210.
Lee et al., “Fluorescent in situ sequencing (FISSEQ) of RNA for gene expression profiling in intact cells and tissues,” Nature Protocols, 2015, 10(3):442-458.
Leriche et al., “Cleavable linkers in chemical biology,” Bioorganic & Medicinal Chemistry, 2012, 20:571-582.
Linnarsson, “Recent advances in DNA sequencing methods—general principles of sample preparation,” Experimental Cell Research, 2010, 316(8):1339-1343.
Liu et al., “High-Spatial-Resolution Multi-Omics Atlas Sequencing of Mouse Embryos via Deterministic Barcoding in Tissue,” BioRxiv, 2019, 55 pages.
Lizardi et al., “Mutation detection and single-molecule counting using isothermal rolling-circle amplification,” Nat. Genet., 1998, 19(3):225-232.
Lundberg et al., “Multiplexed homogeneous proximity ligation assays for high-throughput protein biomarker research in serological material,” Mol Cell Proteomics, 2011, 10(4):M110.004978, 11 pages.
MacBeath et al., “Printing proteins as microarrays for high-throughput function determination,” Science, Sep. 2000, 289(5485):1760-1763.
Maniatis et al., “Spatiotemporal Dynamics of Molecular Pathology in Amyotrophic Lateral Sclerosis”, 54 pages, 2018.
Marx, “Method of the Year: spatially resolved transcriptomics,” Nature Methods, 2021, 18(1):9-14.
Merritt et al., “Multiplex digital spatial profiling of proteins and RNA in fixed tissue,” Nat Biotechnol, May 2020, 38(5):586-599.
Metzker, “Sequencing technologies—the next generation,” Nature Reviews Genetics, 2010, 11(1):31-46.
Miller et al., “Basic concepts of microarrays and potential applications in clinical microbiology,” Clinical Microbiology Reviews, 2009, 22(4):611-633.
Miller et al., “Chapter 11—Solid and Suspension Microarrays for Microbial Diagnostics,” Methods in Microbiology, 2015, 42:395-431.
Mishra et al., “Three-dimensional genome architecture and emerging technologies: looping in disease,” Genome Medicine, 2017, 9(1):87, 14 pages.
Mitra et al., “Digital genotyping and haplotyping with polymerase colonies,” Proc. Natl. Acad. Sci. USA, May 2003, 100(10):5926-593.
Mizusawa et al., “A bacteriophage lambda vector for cloning with BamHI and Sau3A,” Gene, 1982, 20(3):317-322.
Moncada et al., “Building a tumor atlas: integrating single-cell RNA-Seq data with spatial transcriptomics in pancreatic ductal adenocarcinoma”, Institute for Computational Medicine, bioRxiv, 28 pages, 2018.
Nikiforov et al., “The use of 96-well polystyrene plates for DNA hybridization-based assays: an evaluation of different approaches to oligonucleotide immobilization,” Anal Biochem, May 1995, 227(1):201-9.
Nowak et al., “Entering the Postgenome Era,” Science, 1995, 270(5235):368-71.
PCT International Search Report and Written Opinion in International Appln. No. PCT/US2022/020985, dated May 25, 2022, 15 pages.
Pemov et al., “DNA analysis with multiplex microarray-enhanced PCR,” Nucl. Acids Res., Jan. 2005, 33(2):e11, 9 pages.
Perler et al., “Intervening sequences in an Archaea DNA polymerase gen,” Proc Natl Acad Sci USA, Jun. 1992, 89(12):5577-5581.
Petterson et al., “Generations of sequencing technologies,” Genomics, 2009, 93(2):105-111.
Polsky-Cynkin et al., “Use of DNA immobilized on plastic and agarose supports to detect DNA by sandwich hybridization,” Clin. Chem., 1985, 31(9):1438-1443.
Ranki et al., “Sandwich hybridization as a convenient method for the detection of nucleic acids in crude samples,” Gene, 1983, 21(1-2):77-85.
Reinartz et al., “Massively parallel signature sequencing (MPSS) as a tool for in-depth quantitative gene expression profiling in all organisms,” Brief Funct Genomic Proteomic, Feb. 2002, 1(1):95-104.
Rodriques et al., “Slide-seq: A scalable technology for measuring genome-wide expression at high spatial resolution,” Science, 2019, 363(6434):1463-1467.
Ronaghi et al., “A sequencing method based on real-time pyrophosphate,” Science, Jul. 1998, 281(5375):363-365.
Ronaghi et al., “Real-time DNA sequencing using detection of pyrophosphate release,” Analytical Biochemistry, Nov. 1996, 242(1):84-89.
Ronaghi, “Pyrosequencing sheds light on DNA sequencing,” Genome Res, Jan. 2001, 11(1):3-11.
Salmén et al., “Barcoded solid-phase RNA capture for Spatial Transoriptomics profiling in mammalian tissue sections,” Nature Protocols, Oct. 2018, 13(11):2501-2534.
Saxonov et al., “10x Genomics, Mastering Biology to Advance Human Health,” PowerPoint, 10x, 2020, 41 pages.
Schena et al., “Quantitative monitoring of gene expression patterns with a complementary DNA microarray,” Science, Oct. 1995, 270(5235):467-470.
Shalon et al., “A DNA microarray system for analyzing complex DNA samples using two-color fluorescent probe hybridization,” Genome Res., Jul. 1996, 6(7):639-45.
Stahl et al., “Visualization and analysis of gene expression in tissue sections by spatial transcriptomics,” Science, Jul. 2016, 353(6294):78-82.
Stahl et al., “Visualization and analysis of gene expression in tissue sections by spatial transcriptomics,” Supplementary Materials, Science, Jul. 2016, 353(6294):78-82, 41 pages.
Stimpson et al., “Real-time detection of DNA hybridization and melting on oligonucleotide arrays by using optical wave guides,” Proc Natl Acad Sci USA, Jul. 1995, 92(14):6379-83.
Strell et al., “Placing RNA in context and space—methods for spatially resolved transcriptomics,” The FEBS Journal, 2019, 286(8):1468-1481.
Tijssen et al., “Overview of principles of hybridization and the strategy of nucleic acid assays” in Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Acid Probes, 1993, 24(Chapter 2), 65 pages.
Trejo et al., “Extraction-free whole transcriptome gene expression analysis of FFPE sections and histology-directed subareas of tissue,” PLoS ONE, Feb. 2019, 14(2):e0212031, 22 pages.
Twyman et al., “Techniques Patents for SNP Genotyping,” Pharmacogenomics, Jan. 2003, 4(1):67-79.
Van Gelder et al., “Amplified RNA synthesized from limited quantities of heterogeneous cDNA,” Proc. Natl. Acad. Sci. USA, 1990, 87(5):1663-1667.
Vasiliskov et al., “Fabrication of microarray of gel-immobilized compounds on a chip by copolymerization,” Biotechniques, Sep. 1999, 27(3):592-606.
Vickovic et al., “High-definition spatial transcriptomics for in situ tissue profiling,” Nat Methods, Oct. 2019, 16(10):987-990.
Vickovic et al., “SM-Omics: An automated Platform for High-Throughput Spatial Multi-Omics,” bioRxiv, Oct. 2020, 40 pages.
Vogelstein et al., “Digital PCR,” Proceedings of the National Academy of Sciences, Aug. 1999, 96(16):9236-9241.
Waichman et al., “Functional immobilization and patterning of proteins by an enzymatic transfer reaction,” Analytical chemistry, 2010, 82(4):1478-85.
Walker et al., “Strand displacement amplification—an isothermal, in vitro DNA amplification technique,” Nucleic Acids Research, 1992, 20(7):1691-1696.
Wang et al., “Imaging-based pooled CRISPR screening reveals regulators of IncRNA localization,” Proc Natl Acad Sci USA, May 2019, 116(22):10842-10851.
Wang et al., “High-fidelity mRNA amplification for gene profiling,” Nature Biotechnology, Apr. 2000, 18(4):457-459.
Wong et al., “Direct Site-Selective Covalent Protein Immobilization Catalyzed by a Phosphopantetheinyl Transferase,” J. Am. Chem Soc., 2008, 130(37):12456-64.
Worthington et al., “Cloning of random oligonucleotides to create single-insert plasmid libraries,” Anal Biochem, 2001, 294(2):169-175.
Yershov et al., “DNA analysis and diagnostics on oligonucleotide microchips,” Proc. Natl. Acad. Sci. USA, May 1996, 93(10):4913-4918.
Yin et al., “Genetically encoded short peptide tag for versatile protein labeling by Sfp phosphopantetheinyl transferase,” PNAS, 2005, 102(44):15815-20.
Zhou et al., “Genetically encoded short peptide tags for orthogonal protein labeling by Sfp and AcpS phosphopantetheinyl transferases,” ACS Chemical Biol., 2007, 2(5):337-346.
Zhu et al., “Reverse transcriptase template switching: a SMART approach for full-length cDNA library construction,” Biotechniques, Apr. 2001, 30(4):892-897.
Ncbi.nlm.nih.gov, [online], “Molecular Inversion Probe Assay,” available on or before Oct. 14, 2014, via Internet Archive: Wayback Machine URL<https://web.archive.org/web/20141014124037/https://www.ncbi.nlm.nih.gov/probe/docs/techmip/>, retrieved on Jun. 16, 2021, retrieved from URL<https://www.ncbi.nlm.nih.gov/probe/docs/techmip/>, 2 pages.
Stoeckius et al., “Simultaneous epitope and transcriptome measurement in single cells,” Nature Methods, Jul. 31, 2017, 14(9):865-868.
Related Publications (1)
Number Date Country
20220389504 A1 Dec 2022 US
Provisional Applications (6)
Number Date Country
63311703 Feb 2022 US
63270230 Oct 2021 US
63252335 Oct 2021 US
63245697 Sep 2021 US
63214058 Jun 2021 US
63162870 Mar 2021 US
Continuations (1)
Number Date Country
Parent PCT/US2022/020985 Mar 2022 US
Child 17867223 US