The present invention pertains to the field of biological engineering and relates to a genetically engineered strain that produces N-acetylglucosamine as well as to a method of construction and use thereof.
N-acetylglucosamine (GlcNAc), a building block of various polysaccharides in organisms, is formed by replacing a hydroxyl group in glucose with an amino group, particularly rich in the exoskeleton of crustaceans and extensively used in the food, pharmaceutical and cosmetic industries. In the food industry, it can be used as a food antioxidant, an additive for food for infants and young children and a sweetener for diabetics. In the pharmaceutical industry, as a novel biochemical drug, it is clinically used to treat rheumatic and rheumatoid arthritis. Another important use is to enhance the functionality of the human immune system, suppress excessive growth of cancer cells or fibroblasts, and inhibit or treat cancer and malignant tumors. In addition, N-acetylglucosamine also has a therapeutic effect on osteoarthritis and joint pain. In the cosmetic industry, it can form with D-glucuronic acid macromolecular mucopolysaccharides for producing hyaluronic acid. This use is expected to have broad market prospects.
N-acetylglucosamine is produced primarily by chemical, enzymatic and microbial fermentation approaches. The chemical approach is to obtain N-acetylglucosamine from acid hydrolysis of chitin. It involves extracting chitin from crab and shrimp shells and then producing glucosamine by acid hydrolysis. Subsequently, N-acetylglucosamine is hydrolyzed and deacetylated by concentrated hydrochloric acid directly into glucosamine. Acetic anhydride can be used to acetylate glucosamine into N-acetylglucosamine. However, this approach is not environmentally friendly and highly polluting and precludes patients with seafood allergies. Compared with the chemical approach, both the enzymatic and microbial fermentation approaches are environmentally friendly. However, the enzymatic approach involves the use of enzymes for catalyzing the degradation of chitin and the synthesis of N-acetylglucosamine, and limited by high pre-treatment complexity of shrimp and crab shells as the substrate, low activity of predominant enzymes and difficulties in product separation and purification, it is very challenging to put it into mass production. Microbial fermentation is currently the most promising method for producing N-acetylglucosamine and is also a focus of research in the art to which the invention pertains.
Compared with low-temperature fermentation at 40° C. or below, high-temperature fermentation has the advantages of minimizing the risk of contamination, speeding up the conversion of raw materials, reducing the cost of heat exchange, etc. All the reports so far on production of N-acetylglucosamine by metabolically engineered microorganisms have utilized fermentation temperatures of 38° C. and lower, there is still no patent or report regarding high-temperature production of N-acetylglucosamine. Therefore, there is a need for developing a low-cost, robust microbial platform capable of high-temperature, high-yield production of N-acetylglucosamine. Thermophiles such as Bacillus coagulans, Bacillus licheniformis and Bacillus stearothermophilus can grow under high-temperature conditions (40° C. and above) and utilize organic carbon sources (glucose, xylose, arabinose, etc.) for fermentation. For example, Bacillus licheniformis (B. licheniformis) ATCC 14580 is a facultative anaerobic, Gram-positive, endospore-forming bacterium, which can utilize various five- and six-carbon sugars and requires a shorter fermentation cycle because of a fast cell growth rate. It allows for stable genetic manipulation and has been recognized by the US Food and Drug Administration as a “generally regarded as safe” (GRAS) strain. Moreover, this strain can ferment at a temperature as high as 50° C. These advantages suggest that ATCC 14580 can be used as an ideal platform strain.
In order to overcome the above-described problems, the present invention provides a genetically engineered strain capable of producing N-acetylglucosamine under high-temperature conditions, as well as a method of construction and use thereof. Taking a thermophilic B. licheniformis strain as an example, according to the present invention, an N-acetylglucosamine catabolism pathway is eliminated from, and an N-acetylglucosamine-producing metabolism pathway is introduced into, the B. licheniformis strain, enabling extracellular accumulation of N-acetylglucosamine and efficient production of N-acetylglucosamine under a high-temperature condition. The strain construction concept proposed in the present invention can be utilized to develop strains for high-temperature production of various products. The proposed strain and fermentation process have good application prospects in industrial high-temperature N-acetylglucosamine fermentation.
In one aspect of the present invention, there is provided a genetically engineered strain that produces N-acetylglucosamine, which can ferment N-acetylglucosamine under a condition of 40-50° C.
Additionally, an original strain of the genetically engineered strain is thermophilus.
Additionally, an original strain of the genetically engineered strain is bacillus.
Preferably, an original strain of the genetically engineered strain is Bacillus licheniformis, Bacillus coagulans, Bacillus methylotrophicus, thermophilic Bacillus inulinus, Geobacillus stearothermophilus or the like.
Preferably, an original strain of the genetically engineered strain is Bacillus licheniformis ATCC 14580, which is available for direct purchase from ATCC’s website.
Additionally, the genetically engineered strain is Bacillus licheniformis BNGS1, deposited in China Center for Type Culture Collection on Mar. 14, 2020 as CCTCC NO. M2020054.
Additionally, a catabolism pathway and an intracellular transport pathway of N-acetylglucosamine and N-acetylglucosamine intermediates in an original strain of the genetically engineered strain are blocked.
Preferably, the catabolism pathway for N-acetylglucosamine and N-acetylglucosamine intermediates is blocked by deactivation or deletion of one or more of the nagB and gamA genes for glucosamine 6-phosphate deaminase and the nagA gene for N-acetylglucosamine-6-phosphate deacetylase and the intracellular transport pathway for N-acetylglucosamine is blocked by deactivation or deletion of oneor both of the gamP and nagP genes for the N-acetylglucosamine transporter protein.
Additionally, over-expressing genes for glucosamine 6-phosphate synthase and glucosamine 6-phosphate acetylase are introduced into the genetically engineered strain.
Additionally, a sequence of the gene for glucosamine 6-phosphate acetylase is as shown in SEQ ID NO. 1, and a sequence of the gene for glucosamine 6-phosphate synthase is as shown in SEQ ID NO. 2.
Preferably, the gene for glucosamine 6-phosphate synthase can be obtained from PCR amplification using the DNA sequence of the whole genome of B. licheniformis (GenBank No. NC_006270.3) as a template.
Preferably, the gene for glucosamine 6-phosphate acetylase can be obtained by whole gene synthesis with codon optimization according to the whole genome of Saccharomyces cerevisiae (GenBank No. NM_001179949).
In another aspect of the present invention, there is provided a method of constructing the genetically engineered strain as defined above. In one specific embodiment, the method includes: deactivating or deleting one or more of the genes for glucosamine 6-phosphate deaminase, N-acetylglucosamine-6-phosphate deacetylase and the N-acetylglucosamine transporter protein in an N-acetylglucosamine catabolism pathway of an original strain; and introducing over-expressing genes for glucosamine 6-phosphate synthase and glucosamine 6-phosphate acetylase.
Additionally, the method includes the steps of:
Additionally, the double-expression vector is constructed by introducing promoters and expressing the expression vector in series with the promoters and the glmSandGNA1 genes.
Preferably, the expression vector is pHY300PLK.
Preferably, the promoters are Pals, P43, Pst and Papre.
Preferably, a sequence of the Pals promoter is as shown in SEQ ID NO. 3, a sequence of the P43 promoter is as shown in SEQ ID NO. 4, a sequence of the Pst promoter is as shown in SEQ ID NO. 5, and a sequence of the Papre promoter is as shown in SEQ ID NO. 6.
Preferably, the glmS gene for glucosamine 6-phosphate synthase originates from Bacillus licheniformis, Bacillus coagulans, Bacillus methylotrophicus, thermophilic Bacillus inulinus, Geobacillus stearothermophilusor the like.
Preferably, the GNA1 gene for glucosamine 6-phosphate acetylase originates from Saccharomyces cerevisiae or another microorganism that produces a thermophilic enzyme with the same functionality, such as Kluyveromycesmarxianus, Nadsoniafulvescens or the like.
Preferably, the original strain is Bacillus licheniformis ATCC 14580.
In a further aspect of the present invention, there is provided use of the genetically engineered strain as defined above, in particular for production of N-acetylglucosamine.
Additionally, a fermentation temperature of the production is25° C. to 50° C.
Preferably, a fermentation temperature of the production is40° C. to 50° C.
Additionally, a carbon source utilized in the production is glucose, glycerol, xylose, arabinose or the like.
Additionally, a seed culture is obtained from seed cultivation of the genetically engineered strain, followed by secondary activation in a fermentation medium using glucose as a carbon source. Finally, it is transferred into a fermenter for fermentation of N-acetylglucosamine. Specifically, this includes the steps of:
Preferably, the seed medium in step 1) comprises following components: peptone, yeast powder and sodium chloride. Preferably, it contains 10 g/l of peptone, 5 g/l of yeast powder and 10 g/l of sodium chloride.
Preferably, the fermentation medium in step 2) comprises following components: yeast powder, peptone, ammonium sulfate, dipotassium hydrogen phosphate trihydrate, potassium dihydrogen phosphate and glucose. Preferably, it contains 12 g/l of yeast powder, 6 g/l of peptone, 6 g/l of ammonium sulfate, 18.75 g/l of dipotassium hydrogen phosphate trihydrate, 2.5 g/l of potassium dihydrogen phosphate and 30 g/l of glucose.
Preferably, in step 2), the shake flask is a 500-mlErlenmeyer flask, and the fermentation medium is contained at an amount of 75 ml.
Preferably, the fermentation medium in step 3) comprises following components: yeast powder, corn steep liquor powder, ammonium sulfate, dipotassium hydrogen phosphate trihydrate, potassium dihydrogen phosphate and glucose. Preferably, it contains 12 g/l of yeast powder, 6 g/l of corn steep liquor powder, 6 g/l of ammonium sulfate, 18.75 g/l of dipotassium hydrogen phosphate trihydrate, 2.5 g/l of potassium dihydrogen phosphate and 30 g/l of glucose.
Preferably, fermentation conditions in step 3) are: a pH value maintained at 7.0 using a 3 mol/l hydrochloric acid solution and a 25%(v/v) ammonia solution; a ventilation rate of 1.5 vvm; an initial agitation rate of 600 rpm; a glucose concentration continuously controlled at 30 g/l by supplementing glucose upon it being consumed to 3-4 g/l.
The genetically engineered strain provided in the present application enables high-temperature production of N-acetylglucosamine. Moreover, during fermentation of the genetically engineered strain, the addition of an inducer is dispensed with because of constitutive expression. In addition, the fermentation process seldom requires temperature reduction, and fermentation is allowed to proceed at a significantly increased rate at the high temperature. Further, since the high temperature inhibits the growth of other microorganisms, open fermentation is possible, which can effectively reduce the production cost. The present invention enables fermentation of N-acetylglucosamine at a relatively high temperature of 40° C. to 50° C. and has high value in industrial applications. The strain construction concept proposed in the present invention can be utilized to develop strains for high-temperature production of various products. The proposed strain and fermentation process have good application prospects in industrial high-temperature N-acetylglucosamine fermentation.
The
An N-acetylglucosamine synthesis and metabolism pathway of an engineered strain described herein is as shown in the Figure, in which glutamine (Gln) serves as an amino acid donor, and glucosamine synthase encoded by the glmS gene converts fructose 6-phosphate (F-6-P) into glucosamine 6-phosphate (GlcN-6-P), which is in turn converted into N-acetyl-glucosamine 6-phosphate (GlcNAc-6-P) under the action of glucosamine 6-phosphate acetylase (GNA1). GlcNAc-6-P is dephosphorylated into N-acetylglucosamine under the catalysis of phosphorylase, which is then secreted to the outside of cells. Since the nagB and gamA genes that encode glucosamine 6-phosphate deaminase and the nagA gene that encodes N-acetylglucosamine-6-phosphate deacetylase are knocked out so as to be deactivated or so that the precursor of N-acetylglucosamine is less consumed in cells. Moreover, since the gamP and nagP genes encoding the N-acetylglucosamine transporter protein are knocked out, N-acetylglucosamine produced by the engineered strain cannot be transported and will accumulate to a high concentration outside cells.
According to the present application, a metabolism pathway for high-temperature fermentation of N-acetylglucosamine is established in a thermophilic B. licheniformis strain, in which the expression of a gene encoding a rate-limiting enzyme involved in N-acetylglucosamine synthesis is enhanced, and genes that may cause consumption and back diffusion of N-acetylglucosamine are deactivated or knocked out. Inhibiting consumption and back diffusion of N-acetylglucosamine enables N-acetylglucosamine produced by the engineered strain to accumulate to a high concentration.
In one aspect of the present invention, there is provided a genetically engineered strain that produces N-acetylglucosamine. This genetically engineered strain can ferment N-acetylglucosamine at 40-50° C.
In one specific embodiment, an N-acetylglucosamine catabolism pathway in an original strain of the genetically engineered strain is blocked.
In another specific embodiment, the N-acetylglucosamine catabolism pathway is blocked as a result of deactivation or loss of one or more of the nagB and gamA genes that encode glucosamine 6-phosphate deaminase, the nagA gene that decodes N-acetylglucosamine-6-phosphate deacetylase and the gamP and nagP genes that encode the N-acetylglucosamine transporter protein.
As used herein, the term “blocking” refers to blocking a pathway by various genetic engineering approaches, including making the pathway unable to carry on by deactivating or deleting genes encoding one or more catalytic enzymes necessary for the pathway.
Those skilled in the art would appreciate that it is also impossible that the original strain does not contain the deleted or deactivated genes, such as those of glucosamine 6-phosphate deaminase, N-acetylglucosamine-6-phosphate deacetylase and the N-acetylglucosamine transporter protein, or even the blocked pathway. In this case, due to absence of the genes or pathway, the construction of the genetically engineered strain would not involve the deactivation, deletion or blocking achieved by genetic engineering.
The present invention will be further described below by way of specific examples.
The following examples are illustrative and do not limit the scope of protection of the present invention in any sense. Experimental methods to which reference is made in the following description of the examples are all conventional methods, unless otherwise noted. Materials, reagents and the like to which reference is made in the following description of the examples are obtainable from commercial sources, unless otherwise noted.
1. Primers were designed according to the sequence of the B. licheniformis MW3 genome (GenBank No. NC_006270.3): nagP-U-F (upstream primer,
GGTACCCGGGAGCTCATGAATGAGGAGGATCACACAGTC, SEQ ID NO
and nagP-U-R (downstream primer,
GAAGGGGCTTATCTTAGTTAAAACCCCTTTCGATGATATT, SEQ ID N
800-bp fragment upstream of the nagP gene was obtained by PCR amplification using the DNA of the B. licheniformis MW3 genome as a template.
2. Primers were designed according to the sequence of the B. licheniformis MW3 genome (GenBank No. NC_006270.3): nagP-D-F (upstream primer,
and nagP-D-R (downstream primer,
. An 800-bp fragment downstream of the nagP gene was obtained by PCR amplification using the DNA of the B. licheniformis MW3 genome as a template.
3. After the two PCR products were purified, 1 µl of each was taken as a template and inserted into a pKVM vector using a seamless cloning technique. As a result, a knockout pKVM vector-ΔnagP was obtained.
4. The knockout pKVM vector-ΔnagPwas transformed into Escherichia coli S17-1 for conjugative transfer with B. licheniformis and for knockout of the nagP gene by homologous recombination. The primers used were nagP-U-F
and nagP-D-R
. Successful amplification of a 1600-bp fragment was considered as a sign of successful screening of a positive double crossover clone as well as of successful knockout of the gene. Finally, a knockout strain MW3 ΔnagP was obtained.
1. Primers were designed according to the sequence of the B. licheniformis MW3 genome (GenBank No. NC_006270.3): gamP-U-F (upstream primer,
GGTACCCGGGAGCTCTAGGGTAAAACCGTATGCCGC, SEQ ID NO. 1
and gamP-U-R (downstream primer,
AAGCAACTTCAGTTTTCCGGCATTCTCCTTATGTCAA, SEQ ID NO.
. An 800-bp fragment upstream of the gamP gene was obtained by PCR amplification using the DNA of the B. licheniformis MW3 genome as a template.
2. Primers were designed according to the sequence of the B. licheniformis MW3 genome (GenBank No. NC_006270.3): gamP-D-F (upstream primer,
AAGGAGAATGCCGGAAAACTGAAGTTGCTTTTGAGGAATC, SEQ ID N
and gamP-D-R (downstream primer,
GCGTCGGGCGATATCGGAAATTTCTCTGCCAGCTGC, SEQ ID NO. 1
. An 800-bp fragment downstream of the gamP gene was obtained by PCR amplification using the DNA of the B. licheniformis MW3 genome as a template.
3. After the two PCR products were purified, 1 µl of each was taken as a template and inserted into a pKVM vector using a seamless cloning technique. As a result, a knockout pKVM vector-ΔgamP was obtained.
4. The knockout pKVM vector-ΔgamP was transformed into Escherichia coli S17-1 for conjugative transfer with the knockout B. licheniformis strain MW3 ΔnagPand for knockout of the gamP gene by homologous recombination. The primers used were gamP-U-F
and gamP-D-R
. Successful amplification of a 1600-bp fragment was considered as a sign of successful screening of a positive double crossover clone as well as of successful knockout of the gene. Finally, a knockout strain MW3 ΔnagP ΔgamP was obtained.
1. Primers were designed according to the sequence of the B. licheniformis MW3 genome (GenBank No. NC_006270.3): gamA-U-F (upstream primer,
GGTACCCGGGAGCTCGGTCAAGAGGGAGGGTTCACTT, SEQ ID NO.
and gamA-U-R (downstream primer,
TGTCAGTCATTCAATGTTTTTCTCCTTTCCACAAAATAAA, SEQ ID N
An 800-bp fragment upstream of the gamA gene was obtained by PCR amplification using the DNA of the B. licheniformis MW3 genome as a template.
2. Primers were designed according to the sequence of the B. licheniformis MW3 genome (GenBank No. NC_006270.3): gamA-D-F (upstream primer,
GGAAAGGAGAAAAACATTGAATGACTGACAAAATCGGTTA, SEQ ID N
and gamA-D-R (downstream primer,
GCGTCGGGCGATATCTCATATCGGGGATCGGCTT, SEQ ID NO. 18)
. An 800-bp fragment downstream of the gamA gene was obtained by PCR amplification using the DNA of the B. licheniformis MW3 genome as a template.
3. After the two PCR products were purified, 1 µl of each was taken as a template and inserted into a pKVM vector using a seamless cloning technique. As a result, a knockout pKVM vector-ΔgamA was obtained.
4. The knockout pKVM vector-ΔgamA was transformed into Escherichia coli S17-1 for conjugative transfer with the knockout B. licheniformis strain MW3 ΔnagP ΔgamP and for knockout of the gamA gene by homologous recombination. The primers used were gamA-U-F
and gamA-D-R
. Successful amplification of a 1600-bp fragment was considered as a sign of successful screening of a positive double crossover clone as well as of successful knockout of the gene. Finally, a knockout strain MW3 ΔnagP ΔgamP ΔgamA was obtained.
1. Primers were designed according to the sequence of the B. licheniformis MW3 genome (GenBank No. NC_006270.3): nagAB-U-F (upstream primer,
GGTACCCGGGAGCTCCCGCACGGTCAGCTTA, SEQ ID NO. 19)
and nagAB-U-R (downstream primer,
GGGAATCTTTTTTGATACAACTCTAGTTGTCTAGACCAAT, SEQ ID N
. An 800-bp fragment upstream of the nagAB gene cluster was obtained by PCR amplification using the DNA of the B. licheniformis MW3 genome as a template.
2. Primers were designed according to the sequence of the B. licheniformis MW3 genome (GenBank No. NC_006270.3): nagAB-D-F (upstream primer,
ACAACTAGAGTTGTATCAAAAAAGATTCCCACATT, SEQ ID NO. 21
and nagAB-D-R (downstream primer,
GCGTCGGGCGATATCCCTCTTCATATCAATGACGAA, SEQ ID NO. 2
. An 800-bp fragment downstream of the nagAB gene cluster was obtained by PCR amplification using the DNA of the B. licheniformis MW3 genome as a template.
3. After the two PCR products were purified, 1 µl of each was taken as a template and inserted into a pKVM vector using a seamless cloning technique. As a result, a knockout pKVM vector-ΔnagAB was obtained.
4. The knockout pKVM vector-ΔnagAB was transformed into Escherichia coli S17-1 for conjugative transfer with the knockout B. licheniformis strain MW3 ΔnagP ΔgamP ΔgamA and for knockout of the nagAB gene cluster by homologous recombination. The primers used were nagAB-U-F
and nagAB-D-R
. Successful amplification of a 1600-bp fragment was considered as a sign of successful screening of a positive double crossover clone as well as successful knockout of the gene. Finally, a knockout strain NM3 ΔnagP ΔgamP ΔgamA ΔnagAB was obtained.
Primers were designed according to the sequence of the B. licheniformis MW3 genome (GenBank No. NC_006270.3): Pals-F (upstream primer,
TATCGATAAGCTTGATATCGAAGGTGACGCCTATTTCACT, SEQ ID N
and Pals-R (downstream primer,
GTCCGGCAGGCTCATAGCCCTCACTCCTCCATT,SEQ ID NO. 24)
. The Pals promoter sequence was obtained by PCR amplification usingthe DNA of the B. licheniformis MW3 genome as a template.
Whole gene synthesis was carried out using the P43 promoter. The primers used were designed as P43-F (upstream primer,
TATCGATAAGCTTGATATCGTGTCGACGTGCATGCAG, SEQ ID NO.
P43-R▫(downstream▫primer,
GTCCGGCAGGCTCATAGCCCTCACTCCTCCTATAAT,SEQ ID NO. 26
. Moreover, the P43 promoter sequence was obtained through PCR amplification.
Whole gene synthesis was carried out using the Pst promoter. The primers used were designed as Pst-F (upstream primer,
TATCGATAAGCTTGATATCGCATGATGTGGGCGTTTTT, SEQ ID NO.
and Pst-R (downstream primer,
GTCCGGCAGGCTCATAGCCCTCACTCCTCCATT,SEQ ID NO. 28)
. Moreover, the Pst promoter sequence was obtained through PCR amplification.
Whole gene synthesis was carried out using the PaprE promoter. The primers used were designed as PaprE-F (upstream primer,
TATCGATAAGCTTGATATCGCAGCATAATGAACATTTACTCATG, SEQ
and PaprE-R (downstream primer,
GTCCGGCAGGCTCATAGCCCTCACTCCTCCATT, SEQ ID NO. 30)
. Moreover, the PaprE promoter sequence was obtained through PCR amplification.
The GNA1 gene that encodes glucosamine 6-phosphate acetylase was obtained from the whole genome of Saccharomyces cerevisiae (GenBank No. NM_001179949). Whole gene synthesis with codon optimization was carried out, and an optimized GNA1 sequence was obtained through PCR amplification. The primers used were designed as gna1-F (upstream primer,
GGAGGAGTGAGGGCTATGAGCCTGCCGGACG, SEQID NO. 31)
and gna1-R (downstream primer,
TACAATACCACACATTTTGCGGATCTGCATTTC, SEQ ID NO. 32)
.
Primers were designed according to the sequence of the B. licheniformis MW3 genome (GenBank No. NC_006270.3): glmS-F (upstream primer,
ATGCAGATCCGCAAAATGTGTGGTATTGTAGGTTATATTG, SEQ ID N
and glmS-R (downstream primer,
CGGCCGCTCTAGAACTAGTGCTACTCCACCGTCACACTCTT, SEQ ID
. The glmS gene sequence was obtained by PCR amplification using the DNA of the B. licheniformis MW3 genome as a template.
Fragments of the three genes, Pals promoter sequence, GNA1 and glmS, collected from PCR amplification were taken, 1 µl for each gene, and inserted into a pHY300PLK vector by seamless cloning to construct a vector pHY300PLK-Pals-GNA1-glmS.
Fragments of the three genes, P43 promoter sequence, GNA1 and glmS, collected from PCR amplification were taken, 1 µl for each gene, and inserted into a pHY300PLK vector by seamless cloning to construct a vector pHY300PLK-P43-GNA1-glmS.
Fragments of the three genes, Pst promoter sequence, GNA1 and glmS, collected from PCR amplification were taken, 1 µl for each gene, and inserted into a pHY300PLK vector by seamless cloning to construct a vector pHY300PLK-Pst-GNA1-glmS.
Fragments of the three genes, PaprE promoter sequence, GNA1 and glmS, collected from PCR amplification were taken, 1 µl for each gene, and inserted into a pHY300PLK vector by seamless cloning to construct a vector pHY300PLK-PaprE-GNA1-glmS.
The vector pHY300PLK-Pals-GNA1-glmS was introduced by electroporation into the knockout strain MW3 ΔnagP ΔgamP ΔgamA ΔnagAB, resulting in a new B. licheniformis strain capable of synthesizing N-acetylglucosamine, named BNGS1.
The vector pHY300PLK-P43-GNA1-glmS was introduced by electroporation into the knockout strain MW3 ΔnagP ΔgamP ΔgamA ΔnagAB, resulting in a new B. licheniformis strain capable of synthesizing N-acetylglucosamine, named BNGS2.
The vector pHY300PLK-Pst-GNA1-glmS was introduced by electroporation into the knockout strain MW3 ΔnagP ΔgamP ΔgamA ΔnagAB, resulting in a new B. licheniformis strain capable of synthesizing N-acetylglucosamine, named BNGS3.
The vector pHY300PLK-PaprE-GNA1-glmS was introduced by electroporation into the knockout strain MW3 ΔnagP ΔgamP ΔgamA ΔnagAB. resulting in a new B. licheniformis strain capable of synthesizing N-acetylglucosamine, named BNGS4.
An LB medium (containing10 g/l of sodium chloride, 5 g/l of yeast powder and 10 g/l of peptone) was used as a seed medium. During liquid cultivation, 25 mg/l of tetracycline resistance was added.
A fermentation medium includes following components: 12 g/l of yeast powder; 6 g/l of peptone; 6 g/l of ammonium sulfate; 18.75 g/l of dipotassium hydrogen phosphate trihydrate; 2.5 g/l of potassium dihydrogen phosphate; and 30 g/l of glucose.
A seed solution containing the BNGS1 strain was inoculated into 5 ml of the LB medium and incubated at 50° C. and 200 rpmfor 12-16 h.During cultivation,25 mg/l of tetracycline resistance was added. It was transferred at an inoculation rate of 5% to a 500-mlErlenmeyer flask containing 75 ml of the fermentation medium for shake flask fermentation. During cultivation, 25 mg/l of tetracycline resistance was added. The fermentation was run at 40° C. for 50 h, and a 1-ml sample was then taken and centrifuged for 5 min at 12000 rpm. The sample was subjected to filtering by a 0.22-µm aqueous membrane and detection by high-performance liquid chromatography.
The detection results showed that, after50 hours of shake flask fermentation, N-acetylglucosamine was present at 2.3 g/l in the fermentation broth.
A seed solution containing the BNGS2 strain was inoculated into5ml of the LB medium and incubated at 50° C. and 200 rpmfor 12-16 h. During cultivation, 25 mg/l of tetracycline resistance was added. It was transferred at an inoculation rate of 5% to a 500-mlErlenmeyer flask containing 75 ml of the fermentation medium for shake flask fermentation. During cultivation, 25 mg/l of tetracycline resistance was added. The fermentation was run at 40° C. for 50 h, and a 1-ml sample was then taken and centrifuged for 5 min at 12000 rpm. The sample was subjected to filtering by a 0.22-µm aqueous membrane and detection by high-performance liquid chromatography.
The detection results showed that, after50 hours of shake flask fermentation, N-acetylglucosamine was present at 1.5 g/l in the fermentation broth.
A seed solution containing the BNGS3 strain was inoculated into 5 ml of the LB medium and incubated at 50° C. and 200 rpmfor 12-16 h. During cultivation, 25 mg/l of tetracycline resistance was added. It was transferred at an inoculation rate of 5% to a 500-mlErlenmeyer flask containing 75 ml of the fermentation medium for shake flask fermentation. During cultivation, 25 mg/l of tetracycline resistance was added. The fermentation was run at 40° C. for 50 h, and a 1-ml sample was then taken and centrifuged for 5 min at 12000 rpm. The sample was subjected to filtering by a 0.22-µm aqueous membrane and detection by high-performance liquid chromatography.
The detection results showed that, after50 hours of shake flask fermentation, N-acetylglucosamine was present at 0.57 g/l in the fermentation broth.
A seed solution containing the BNGS4 strain was inoculated into 5 ml of the LB medium and incubated at 50° C. and 200 rpmfor 12-16 h. During cultivation, 25 mg/l of tetracycline resistance was added. It was transferred at an inoculation rate of 5% to a 500-mlErlenmeyer flask containing 75 ml of the fermentation medium for shake flask fermentation. During cultivation, 25 mg/l of tetracycline resistance was added. The fermentation was run at 40° C. for 50 h, and a 1-ml sample was then taken and centrifuged for 5 min at 12000 rpm. The sample was subjected to filtering by a 0.22-µm aqueous membrane and detection by high-performance liquid chromatography.
The detection results showed that, after50 hours of shake flask fermentation, N-acetylglucosamine was present at 0.32 g/l in the fermentation broth.
1. Seed cultivation: a seed solution containing the BNGS1 strain was inoculated into 5 ml of the LB medium and incubated at 50° C. and 200 rpmfor 12-16 h. During cultivation, 25 mg/l of tetracycline resistance was added.
2. Shake flask cultivation: it was transferred at an inoculation rate of 5% to 75 ml of the fermentation medium (contained in a 500-mlshake flask). During shake flask cultivation, 25 mg/l of tetracycline resistance was added. The cultivation was conducted at 50° C. and 200 rpmovernight.
3. Fermentation cultivation: the activated seed solution was transferred at an inoculation rate of 4%(v/v) into a 1-Lfully automatic fermenter and incubated at a temperature of 37° C. Tetracycline resistance was added until a working concentration of 25 mg/l was achieved, and a 3 mol·l-1hydrochloric acid solution and a 25% (v/v) ammonia solution were added to adjust and maintain the pH at 7.0. A ventilation rate was kept at 1.5vvm, and agitation was carried out initially at a speed of 600 r·min-1. Glucose should be continuously controlled at a concentration of 30 g/l. To this end, glucose was supplemented continuously at a constant flow rate upon it being consumed to 3-4 g/l. Cultivation continued until the end of fermentation. A sample was taken therefrom and subjected to detection by high-performance liquid chromatography.
The detection results showed that, after 70 hours of fermentation, acetylglucosamine was present at 12 g/l in the fermentation broth.
1. Seed cultivation: the same as Example 11.
2. Shake flask cultivation: the same as Example 11.
3. Fermentation cultivation: the activated seed solution was transferred at an inoculation rate of 4%(v/v) into a 1-Lfully automatic fermenter and incubated at a temperature of 50° C. Tetracycline resistance was added until a working concentration of 25 mg/l was achieved, and a 3 mol·l-1hydrochloric acid solution and a 25% (v/v) ammonia solution were added to adjust and maintain the pH at 7.0. A ventilation rate was kept at 1.5vvm, and agitation was carried out initially at a speed of 600 r·min-1. Glucose should be continuously controlled at a concentration of 30 g/l. To this end, glucose was supplemented continuously at a constant flow rate upon it being consumed to 3-4 g/l. Cultivation continued until the end of fermentation. A sample was taken therefrom and subjected to detection by high-performance liquid chromatography.
The detection results showed that, after 70 hours of fermentation, acetylglucosamine was present at 2.8 g/l in the fermentation broth.
1. Seed cultivation: the same as Example 11.
2. Shake flask cultivation: the same as Example 11.
3. Fermentation cultivation: the activated seed solution was transferred at an inoculation rate of 4%(v/v) into a 50-L fully automatic fermenter and incubated at a temperature of 37° C. Tetracycline resistance was added until a working concentration of 25 mg/l was achieved, and a 3 mol·l-1hydrochloric acid solution and a 25% (v/v) ammonia solution were added to adjust and maintain the pH at 7.0. A ventilation rate was kept at 1.5 vvm, and agitation was carried out initially at a speed of 600 r·min-1. Glucose should be continuously controlled at a concentration of 30 g/l. To this end, glucose was supplemented continuously at a constant flow rate upon it being consumed to 3-4 g/l. Cultivation continued until the end of fermentation. A sample was taken therefrom and subjected to detection by high-performance liquid chromatography.
The detection results showed that, after69.5 hours of fermentation, acetylglucosamine was present at 50.9 g/l in the fermentation broth.
1. Seed cultivation: the same as Example 11.
2. Shake flask cultivation: the same as Example 11.
3. Fermentation cultivation: the activated seed solution was transferred at an inoculation rate of 4%(v/v) into a 50-L fully automatic fermenter and incubated at a temperature of 37° C. Tetracycline resistance was added until a working concentration of 25 mg/l was achieved, and a 3 mol·l-1hydrochloric acid solution and a 25% (v/v) ammonia solution were added to adjust and maintain the pH at 7.0. A ventilation rate was kept at 1.5 vvm, and agitation was carried out initially at a speed of 600 r·min-1. Glucose should be continuously controlled at a concentration of 30 g/l. To this end, glucose was supplemented continuously at a constant flow rate upon it being consumed to 3-4 g/l. Cultivation continued until the end of fermentation. A sample was taken therefrom and subjected to detection by high-performance liquid chromatography.
The detection results showed that, after73 hours of fermentation, acetylglucosamine was present at 52.5 g/l in the fermentation broth.
1. Seed cultivation: the same as Example 11.
2. Shake flask cultivation: the same as Example 11.
3. Fermentation cultivation: the activated seed solution was transferred at an inoculation rate of 4%(v/v) into a 50-L fully automatic fermenter and incubated at a temperature of 40° C. Tetracycline resistance was added until a working concentration of 25 mg/l was achieved, and a 3 mol·l-1hydrochloric acid solution and a 25% (v/v) ammonia solution were added to adjust and maintain the pH at 7.0. A ventilation rate was kept at 1.5 vvm, and agitation was carried out initially at a speed of 600 r·min-1. Glucose should be continuously controlled at a concentration of 30 g/l. To this end, glucose was supplemented continuously at a constant flow rate upon it being consumed to 3-4 g/l. Cultivation continued until the end of fermentation. A sample was taken therefrom and subjected to detection by high-performance liquid chromatography.
The detection results showed that, after 54 hours of fermentation, acetylglucosamine was present at 28.1 g/l in the fermentation broth.
1. Seed cultivation: the same as Example 11.
2. Shake flask cultivation: the same as Example 11.
3. Fermentation cultivation: the activated seed solution was transferred at an inoculation rate of 4%(v/v) into a 50-Lfully automatic fermenter and incubated at a temperature of 40° C. Tetracycline resistance was added until a working concentration of 25 mg/l was achieved, and a 3 mol·l-1hydrochloric acid solution and a 25% (v/v) ammonia solution were added to adjust and maintain the pH at 7.0. A ventilation rate was kept at 1.5 vvm, and agitation was carried out initially at a speed of 600 r·min-1. Glucose should be continuously controlled at a concentration of 30 g/l. To this end, glucose was supplemented continuously at a constant flow rate upon it being consumed to 3-4 g/l. Cultivation continued until the end of fermentation. A sample was taken therefrom and subjected to detection by high-performance liquid chromatography.
The detection results showed that, after 56 hours of fermentation, acetylglucosamine was present at 34.6 g/l in the fermentation broth.
1. Seed cultivation: the same as Example 11.
2. Shake flask cultivation: the same as Example 11.
3. Fermentation cultivation: the activated seed solution was transferred at an inoculation rate of 4%(v/v) into a 50-L fully automatic fermenter and incubated at a temperature of 45° C. Tetracycline resistance was added until a working concentration of 25 mg/l was achieved, and a 3 mol·l-1hydrochloric acid solution and a 25% (v/v) ammonia solution were added to adjust and maintain the pH at 7.0. A ventilation rate was kept at 1.5 vvm, and agitation was carried out initially at a speed of 600 r·min-1. Glucose should be continuously controlled at a concentration of 30 g/l. To this end, glucose was supplemented continuously at a constant flow rate upon it being consumed to 3-4 g/l. Cultivation continued until the end of fermentation. A sample was taken therefrom and subjected to detection by high-performance liquid chromatography.
The detection results showed that, after 50 hours of fermentation, acetylglucosamine was present at 24 g/l in the fermentation broth.
1. Seed cultivation: the same as Example 11.
2. Shake flask cultivation: the same as Example 11.
3. Fermentation cultivation: the activated seed solution was transferred at an inoculation rate of 4%(v/v) into a 50-L fully automatic fermenter and incubated at a temperature of 50° C. Tetracycline resistance was added until a working concentration of 25 mg/l was achieved, and a 3 mol·l-1hydrochloric acid solution and a 25% (v/v) ammonia solution were added to adjust and maintain the pH at 7.0. A ventilation rate was kept at 1.5 vvm, and agitation was carried out initially at a speed of 600 r·min-1. Glucose should be continuously controlled at a concentration of 30 g/l. To this end, glucose was supplemented continuously at a constant flow rate upon it being consumed to 3-4 g/l. Cultivation continued until the end of fermentation. A sample was taken therefrom and subjected to detection by high-performance liquid chromatography.
The detection results showed that, after 24 hours of fermentation, acetylglucosamine was present at 4.1 g/l in the fermentation broth.
1. Seed cultivation: a seed solution containing the BNGS2 strain was inoculated into 5 ml of the LB medium and incubated at 50° C. and 200 rpmfor 12-16 h. During cultivation, 25 mg/l of tetracycline resistance was added.
2. Shake flask cultivation: it was transferred at an inoculation rate of 5% to 75 ml of the fermentation medium (contained in a 500-mlshake flask). During shake flask cultivation, 25 mg/l of tetracycline resistance was added. The cultivation was conducted at 50° C. and 200 rpmovernight.
3. Fermentation cultivation: the activated seed solution was transferred at an inoculation rate of 4%(v/v) into a 50-L fully automatic fermenter and incubated at a temperature of 37° C. Tetracycline resistance was added until a working concentration of 25 mg/l was achieved, and a 3 mol·l-1hydrochloric acid solution and a 25% (v/v) ammonia solution were added to adjust and maintain the pH at 7.0. A ventilation rate was kept at 1.5 vvm, and agitation was carried out initially at a speed of 600 r·min-1. Glucose should be continuously controlled at a concentration of 30 g/l. To this end, glucose was supplemented continuously at a constant flow rate upon it being consumed to 3-4 g/l. Cultivation continued until the end of fermentation. A sample was taken therefrom and subjected to detection by high-performance liquid chromatography.
The detection results showed that, after 64 hours of fermentation, acetylglucosamine was present at 23.6 g/l in the fermentation broth.
1. Seed cultivation: the same as Example 19.
2. Shake flask cultivation: the same as Example 19.
3. Fermentation cultivation: the activated seed solution was transferred at an inoculation rate of 4%(v/v) into a 50-L fully automatic fermenter and incubated at a temperature of 45° C. Tetracycline resistance was added until a working concentration of 25 mg/l was achieved, and a 3 mol·l-1hydrochloric acid solution and a 25% (v/v) ammonia solution were added to adjust and maintain the pH at 7.0. A ventilation rate was kept at 1.5 vvm, and agitation was carried out initially at a speed of 600 r·min-1. Glucose should be continuously controlled at a concentration of 30 g/l. To this end, glucose was supplemented continuously at a constant flow rate upon it being consumed to 3-4 g/l. Cultivation continued until the end of fermentation. A sample was taken therefrom and subjected to detection by high-performance liquid chromatography.
The detection results showed that, after 49 hours of fermentation, acetylglucosamine was present at 11.6 g/l in the fermentation broth.
1. Seed cultivation: a seed solution containing the BNGS3 strain was inoculated into 5 ml of the LB medium and incubated at 50° C. and 200 rpmfor 12-16 h. During cultivation, 25 mg/l of tetracycline resistance was added.
2. Shake flask cultivation: it was transferred at an inoculation rate of 5% to 75 ml of the fermentation medium (contained in a 500-mlshake flask). During shake flask cultivation, 25 mg/l of tetracycline resistance was added. The cultivation was conducted at 50° C. and 200 rpmovernight.
3. Fermentation cultivation: the activated seed solution was transferred at an inoculation rate of 4%(v/v) into a 50-L fully automatic fermenter and incubated at a temperature of 37° C. Tetracycline resistance was added until a working concentration of 25 mg/l was achieved, and a 3 mol·l-1hydrochloric acid solution and a 25% (v/v) ammonia solution were added to adjust and maintain the pH at 7.0. A ventilation rate was kept at 1.5 vvm, and agitation was carried out initially at a speed of 600 r·min-1. Glucose should be continuously controlled at a concentration of 30 g/l. To this end, glucose was supplemented continuously at a constant flow rate upon it being consumed to 3-4 g/l. Cultivation continued until the end of fermentation. A sample was taken therefrom and subjected to detection by high-performance liquid chromatography.
The detection results showed that, after 64 hours of fermentation, acetylglucosamine was present at 10.8 g/l in the fermentation broth.
1. Seed cultivation: the same as Example 21.
2. Shake flask cultivation: the same as Example 21.
3. Fermentation cultivation: the activated seed solution was transferred at an inoculation rate of 4%(v/v) into a 50-L fully automatic fermenter and incubated at a temperature of 45° C. Tetracycline resistance was added until a working concentration of 25 mg/l was achieved, and a 3 mol·l-1hydrochloric acid solution and a 25% (v/v) ammonia solution were added to adjust and maintain the pH at 7.0. A ventilation rate was kept at 1.5 vvm, and agitation was carried out initially at a speed of 600 r·min-1. Glucose should be continuously controlled at a concentration of 30 g/l. To this end, glucose was supplemented continuously at a constant flow rate upon it being consumed to 3-4 g/l. Cultivation continued until the end of fermentation. A sample was taken therefrom and subjected to detection by high-performance liquid chromatography.
The detection results showed that, after58 hoursoffermentation, acetylglucosamine was present at 7.2 g/l in the fermentation broth.
1. Seed cultivation: a seed solution containing the BNGS4 strain was inoculated into 5 ml of the LB medium and incubated at 50° C. and 200 rpmfor 12-16 h. During cultivation, 25 mg/l of tetracycline resistance was added.
2. Shake flask cultivation: it was transferred at an inoculation rate of 5% to 75 ml of the fermentation medium (contained in a 500-mlshake flask). During shake flask cultivation, 25 mg/l of tetracycline resistance was added. The cultivation was conducted at 50° C. and 200 rpmovernight.
3. Fermentation cultivation: the activated seed solution was transferred at an inoculation rate of 4%(v/v) into a 50-L fully automatic fermenter and incubated at a temperature of 37° C. Tetracycline resistance was added until a working concentration of 25 mg/l was achieved, and a 3 mol·l-1hydrochloric acid solution and a 25% (v/v) ammonia solution were added to adjust and maintain the pH at 7.0. A ventilation rate was kept at 1.5 vvm, and agitation was carried out initially at a speed of 600 r·min-1. Glucose should be continuously controlled at a concentration of 30 g/l. To this end, glucose was supplemented continuously at a constant flow rate upon it being consumed to 3-4 g/l. Cultivation continued until the end of fermentation. A sample was taken therefrom and subjected to detection by high-performance liquid chromatography.
The detection results showed that, after 64 hours of fermentation, acetylglucosamine was present at 6.1 g/l in the fermentation broth.
1. Seed cultivation: the same as Example 23.
2. Shake flask cultivation: the same as Example 23.
3. Fermentation cultivation: the activated seed solution was transferred at an inoculation rate of 4%(v/v) into a 50-L fully automatic fermenter and incubated at a temperature of 45° C. Tetracycline resistance was added until a working concentration of 25 mg/l was achieved, and a 3 mol·l-1hydrochloric acid solution and a 25% (v/v) ammonia solution were added to adjust and maintain the pH at 7.0. A ventilation rate was kept at 1.5 vvm, and agitation was carried out initially at a speed of 600 r·min-1. Glucose should be continuously controlled at a concentration of 30 g/l. To this end, glucose was supplemented continuously at a constant flow rate upon it being consumed to 3-4 g/l. Cultivation continued until the end of fermentation. A sample was taken therefrom and subjected to detection by high-performance liquid chromatography.
The detection results showed that, after 58 hours of fermentation, acetylglucosamine was present at 2.9 g/l in the fermentation broth.
Lines were drawn on a 25 mg/ml solid LB medium plate with a fermentation broth containing a BNGS1 strain. After cultivation for 18 h at 50° C., 10 single colonies were picked and inoculated into respective 500-ml shake flasks each containing 75 ml of the fermentation medium. The flasks were shaken at a shaker temperature of 40° C. and 200 rpm, and glucose was present at a concentration of 30 g/l. N-acetylglucosamine production stability was assessed using HPLC70 hours after the inoculation, and the product was determined to be present at a concentration ranging from 2.24 g/l to 2.41 g/l.
Preferred specific embodiments of the present invention have been described in detail above. It is to be understood that, those of ordinary skill in the art can make various modifications and changes based on the concept of the present invention without exerting any creative effort. Accordingly, all the technical solutions that can be obtained by those skilled in the art by logical analysis, inference or limited experimentation in accordance with the concept of the present invention on the basis of the prior art are intended to fall within the protection scope as defined by the claims.
Number | Date | Country | Kind |
---|---|---|---|
202010725842.9 | Jul 2020 | CN | national |
This application is a continuation-in-part (CIP) application claiming benefit of PCT/CN2020/109480 filed on Aug. 17, 2020, which claims priority to Chinese Patent Application No. 202010725842.9 filed on Jul. 24, 2020, the disclosures of which are incorporated herein in their entirety by reference.
Number | Date | Country | |
---|---|---|---|
Parent | PCT/CN2020/109480 | Aug 2020 | WO |
Child | 18158343 | US |