Patent Application
20130326736
The sequence listing that is contained in the file named “52553—97808_ST25.txt”, which is 312332 bytes in size (measured in operating system MS-Windows), created on Jul. 13, 2011, is filed herewith by electronic submission and incorporated herein by reference in its entirety.
Obligate biotrophs are pathogens that establish intimate parasitic relationships with the host that they infect. Often times these relationships involve some kind of modification or reprogramming of the host cell(s) to accommodate the pathogen's subsequent growth and development. Plant-parasitic nematodes are obligate biotrophs that mainly attack the roots of plants and cause over $100 billion in crop damage annually (Sasser and Freckman, 1987). The most economically important plant-parasitic nematodes include the cyst forming nematodes of Heterodera and Globodera spp. These sedentary endoparasitic nematodes form intimate parasitic relationships with their hosts by penetrating the root as motile juveniles and migrating intracellularly until they reach the root vasculature where they select a single cell to initiate a feeding site. The initial syncytial cell undergoes developmental changes to re-differentiate into a syncytium to support subsequent nematode growth and development in later sedentary stages (Davis et al., 2004). The syncytium forms when neighboring cells fuse as a result of partial cell wall degradation (Endo, 1964), creating a permanent feeding cell that shares characteristics with plant cell types including meristematic cells, endosperm cells, transfer cells, and developing xylem (Mitchum et al., 2008). It has been proposed that the development and maintenance of the syncytium is dependent on the secretory effector proteins originating in the esophageal gland cells and delivered into the host root through the stylet of plant-parasitic nematodes (Davis et al., 2008). Recently, the cyst nematode secreted CLAVATA3/ESR(CLE)-like effector proteins have been shown to act as ligand mimics of plant CLE peptides, and are required for successful nematode infection (Wang et al., 2005; Patel et al., 2008; Lu et al., 2009; Wang et al., 2010a; Wang et al., 2010b).
Plant CLEs are small peptide ligands involved in regulating a population of specialized cells, called stem cells, which allow postembryonic organogenesis to occur (Simon and Stahl 2006). These stem cell pools can be found in the shoot apical meristem (SAM), the root apical meristem (RAM), and the vascular cambium. Whether or not these stems cells remain in an undifferentiated state or differentiate into new plant tissues is tightly controlled by CLE signaling pathways. In Arabidopsis, the population of stem cells which resides in the organizing center (OC) of the SAM is maintained by the expression of the transcription factor WUSCHEL (WUS) (Laux et al., 1996). Differentiation of those stems cells is promoted when the ligand-receptor pair of CLAVATA3 (CLV3), a small extracellular peptide ligand in the CLE family (Fletcher et al., 1999; Rojo et al., 2002), binds to CLV1 (Ogawa et al., 2008), a leucine-rich-repeat receptor like kinase (LRR-RLK) and downregulates WUS. Previous models have suggested that CLV1 forms a receptor complex with the LRR-receptor like protein (RLP) CLV2 (Clark et al., 1993; Kayes and Clark, 1998; Jeong et al., 1999; Trotochaud et al., 1999). More recently, it has been suggested that CLV1 acts in parallel or together with the heterodimer receptor complex of CLV2 and CORYNE (CRN) (Miwa et al., 2008; Muller, 2008; Bleckmann et al., 2010; Zhu et al., 2010). In comparison to the SAM, much less is known about the regulation of the stem cells in the RAM. The quiescent center (QC) is the equivalent to the OC in the SAM. However, there are significant differences between the OC and the QC. In contrast to the OC, the cells surrounding the QC are maintained as stem cells. In addition, stem cells are differentiated in both proximal and distal directions. This indicates that there is a signaling ligand involved in cell-cell communication to maintain the cells surrounding the QC as stem cells, and a signal to promote differentiation (Sarkar et al., 2007; Stahl et al., 2009). Previous reports have identified that the WUS-related homeobox 5 (WOX5) transcription factor is expressed in the QC of the RAM and is required to maintain the distal stem cell pool (Sarkar et al., 2007). Recently it has been shown that CLE40, the closest homolog to CLV3, is expressed in the columella cells and regulates expression of WOX5 (Stahl et al., 2009). The WOX5/CLE40 signaling pathway appears to only control the distal stem cell pool, indicating that other CLE signaling pathways may exist to control the proximal stem cell pool. Consistent with these observations, a number of Arabidopsis CLEs are expressed in roots (Sharma et al., 2003), and when some of these CLEs are overexpressed they have been shown to cause premature termination of the primary root meristem (Fiers et al., 2004; Strabala et al., 2006; Meng et al., 2010). In addition, the short root phenotype has been shown to be dependent on CLV2 and CRN perception (Casamitjana-Martinez et al., 2003; Fiers et al., 2005; Miwa et al., 2008; Meng et al., 2010). Taken together this indicates that a CLV-like and CLE-controlled signaling pathway can act in the root.
CLE-like genes from nematodes have been reported in the soybean cyst nematode (SCN, H. glycines) (Wang et al., 2005; Wang et al., 2010a), the beet cyst nematode (BCN, H. schachtii) (Patel et al., 2008; Wang et al., 2010b), and the potato cyst nematode (PCN, G. rostochiensis) (Lu et al., 2009). BCN CLEs have been detected in the dorsal gland ampulla indicating they are likely secreted from the stylet into host cells (Patel et al., 2008). More recently, SCN CLEs have been shown to be secreted directly to the syncytial cytoplasm where the variable domain is thought to redirect the nematode CLE peptides to the apoplast (Wang et al., 2010a). These findings suggest that when delivered to the apoplast, nematode CLEs would be available to interact with extracellular receptors to function as ligand mimics of plant CLE signaling pathways. Overexpression studies have shown that nematode CLEs can trigger plant CLE signaling pathways (Wang et al., 2005; Lu et al., 2009; Wang et al., 2010a; Wang et al., 2010b), but the identity of the receptors and downstream signaling pathways that are activated to initiate developmental cascades required for the re-differentiation of root cells to form syncytia, are currently unknown.
US Patent Applications 20090077687 and 20090012029, identified nematode parasitism (effector) genes and described potential mechanisms to disrupt their expression and the function of their products to inhibit nematode parasitism of plants.
This invention provides for methods of inhibiting plant parasitic nematodes, methods of obtaining transgenic plants useful for inhibiting such nematodes, methods for expressing genes at plant parasitic nematode feeding sites, and transgenic plants that are resistant to plant parasitic nematodes. Also provided are promoters including, but not limited to a BAM1 promoter, that are useful for expressing genes in nematode feeding sites as well as transgenic plants and nematode resistant transgenic plants comprising the same. It is anticipated that the BAM1 and other promoters provided herewith can in certain embodiments be operably linked to genes that provide for inhibition of plant parasitic nematodes when introduced into transgenic plants and for plants that display such inhibition. Such genes that provide for inhibition of plant parasitic nematodes that can be used with the promoters provided herewith are disclosed in US Patent Application 20090012029, which is specifically incorporated herein by reference in its entirety.
In certain embodiments, a method for inhibiting plant parasitic nematode damage to a plant comprising growing a plant comprising a mutation or a transgene that provides for inhibition of at least one endogenous plant gene encoding a receptor for a nematode CLE peptide in the presence of plant parasitic nematodes is provided. In certain embodiments of these methods, the plant gene encoding a receptor for a nematode CLE peptide is selected from the group consisting of a CLV1-like gene, a CLV2-like gene, a BAM1-like gene, a BAM2-like gene, a CRN-like gene, a ACR4-like gene, an ER-like gene, and an ERL2-like gene. In certain embodiments of these methods, CLV1-like gene, said CLV2-like gene, BAM1-like gene, a BAM2-like gene, a CRN-like gene, a ACR4-like gene, an ER-like gene, or an ERL2-like gene is an ortholog of a corresponding Arabidopsis, soybean, or potato CLV1, CLV2, BAM1, BAM2, CRN, ACR4, ER, or ERL2 gene. In certain embodiments of these methods, the methods can further comprise the step of harvesting a product of said plant. In certain embodiments of these methods, the harvested product is a leaf, stem, flower, seed, root, or tuber. In certain embodiments of these methods, the yield and/or quality of said product is increased relative to a control plant that is grown in presence of plant parasitic nematodes and that lacks said mutation or said transgene that provides for inhibition of at least one endogenous plant gene encoding a receptor for a nematode CLE peptide. In certain embodiments of these methods, the transgene comprises: i) an siRNA directed against said plant gene; ii) an artificial microRNA targeting said plant gene; iii) a dominant negative form of said plant gene; iv) an antisense or sense form of said plant gene; or v) a genomic insertion that disrupts said plant gene.
In certain embodiments, a method for obtaining a transgenic plant that exhibits resistance to a plant parasitic nematode comprising the steps of: a) introducing a transgene that provides for inhibition of at least one endogenous plant gene encoding a receptor for a nematode CLE peptide into a plant cell or a transgene that provides for inhibition of at least one CLV1-like, a CLV2-like, a BAM1-like, a BAM2-like, a CRN-like, a ACR4-like, an ER-like, and/or an ERL2-like gene; and b) selecting a transgenic plant obtained from said plant cell, wherein said selected transgenic plant comprises said transgene and exhibits resistance to a plant nematode is provided. In certain embodiments of these methods, CLV1-like gene, said CLV2-like gene, BAM1-like gene, a BAM2-like gene, a CRN-like gene, a ACR4-like gene, an ER-like gene, or an ERL2-like gene is an ortholog of a corresponding Arabidopsis, soybean, or potato CLV1, CLV2, BAM1, BAM2, CRN, ACR4, ER, or ERL2 gene.
In certain embodiments, a method for obtaining a transgenic plant expressing a gene product at a plant parasitic nematode feeding site, comprising the steps of: a) introducing a transgene wherein a CRN, CLV, or BAM promoter is operably linked to a gene encoding said gene product into a plant cell; and, b) selecting a transgenic plant obtained from said plant cell, wherein said selected transgenic plant comprises said transgene and exhibits expression of said gene product at said nematode feeding site is provided. In certain embodiments of these methods, the gene product is inhibitory to the plant parasitic nematode. In certain embodiments of these methods, the inhibitory gene product is a siRNA directed against a plant parasitic nematode gene. In certain embodiments of these aforementioned methods, an ACR4, BAM1, BAM2, CLV1, CLV2, CRN, ER, or ERL2 promoter is operably linked to a gene encoding the gene product. In certain embodiments of these aforementioned methods, an ACR4, BAM1, BAM2, CLV1, CLV2, CRN, ER, or ERL2 promoter is operably linked to a gene product that is inhibitory to a plant parasitic nematode. In certain embodiments of these methods, the inhibitory gene product is an amiRNA directed against a plant parasitic nematode gene.
In certain embodiments of any of the aforementioned methods of inhibiting plant parasitic nematode damage, obtaining a transgenic plant that exhibits resistance to a plant parasitic nematode, or obtaining a transgenic plant expressing a gene product at a plant parasitic nematode feeding site, the plant nematode is a cyst nematode. In certain embodiments of these methods, the cyst nematode is a Heterodera or Globodera spp. In certain embodiments of these methods, the Heterodera spp. is H. avenae, H. bifenestra, H cajani. H. carotae, H. ciceri, H. cruciferae, H. cynodontis, H. cyperi, H. davert, H. elachista, H. fii, H. galeopsidis, H. goettingiana, H. graminis, H. hordecalis, H. humuli, H. iri, H. latipons, H. lespedeza, H. leucilyma, H. Iongicaudata, H. mani, H. maydis, H. medicaginis, H. oryzae, H. oryzicola, H. sacchari, H. salixophila, H. schachtii, H. sorghii, H. trifoii, H. urticae, H. vigna, or H. zeae. In certain embodiments of these methods, the Globodera spp. is G. achilleae, G. artemisiae, G. hypolysi, G. leptonepia, G. mali, G. pallida, G. rostochiensis, G. tabacum, or G. zeylandica.
In certain embodiments of any of the aforementioned methods of inhibiting plant parasitic nematode damage, obtaining a transgenic plant that exhibits resistance to a plant parasitic nematode, or obtaining a transgenic plant expressing a gene product at a plant parasitic nematode feeding site, the plant is a monocot or dicot plant, or is selected from the group consisting of a tobacco, cereal, sugar beet, cotton, fruit, fiber, oilseed, potato, rice, corn, soybean, vegetable, and wheat plant.
In certain embodiments of any of the aforementioned methods of inhibiting plant parasitic nematode damage or obtaining a transgenic plant that exhibits resistance to a plant parasitic nematode, the endogenous plant gene encoding a receptor for a nematode CLE is a potato StCLV1, StCLV2, StBAM1, StBAM2, StCRN, StACR4, StER, or StERL2 gene and the plant is a potato plant. In certain embodiments of these methods, the plant parasitic nematode is G. rostochiensis or G. pallida.
In certain embodiments of any of the aforementioned methods of inhibiting plant parasitic nematode damage or obtaining a transgenic plant that exhibits resistance to a plant parasitic nematode, the endogenous plant gene encoding a receptor for a nematode CLE is selected from the group consisting of soybean genes provided in Table 3 of Example 2 and said plant is a soybean plant. In certain embodiments of any of the aforementioned methods of inhibiting plant parasitic nematode damage, the plant parasitic nematode is Heterodera glycines or H. schachtii.
In certain embodiments, a plant parasitic nematode resistant transgenic plant comprising a transgene that provides for inhibition of at least one endogenous plant gene encoding a receptor for a nematode CLE peptide is provided. In certain embodiments, the transgene comprises: i) an siRNA directed against said plant gene; ii) an artificial microRNA targeting said plant gene; iii) a dominant negative form of said plant gene; iv) an antisense or sense form of said plant gene; or v) a genomic insertion that disrupts said plant gene. In certain embodiments of any of the aforementioned transgenic plants, the endogenous plant gene encoding a receptor for a nematode CLE is selected from the group consisting of soybean genes of provided in Table 3 of Example 2 and the plant is a soybean plant. In certain embodiments of any of the aforementioned transgenic plants, the endogenous plant gene encoding a receptor for a nematode CLE is a potato StCLV1, StCLV2, StBAM1, StBAM2, StCRN, StACR4, StER, or StERL2 gene and the plant is a potato plant.
In certain embodiments, a plant parasitic nematode resistant transgenic plant comprising a transgene wherein a CRN, CLV, or BAM promoter is operably linked to a gene encoding a gene product that is inhibitory to a plant parasitic nematode is provided. In certain embodiments, the gene product is an siRNA directed against a plant parasitic nematode gene. In certain embodiments of any of the aforementioned plants, the CRN, CLV, or BAM promoter is the CRN1, CLV2, or BAM1 promoter sequence provided in Example 3. In certain embodiments of these aforementioned methods, an ACR4, BAM1, BAM2, CLV1, CLV2, CRN, ER, or ERL2 promoter is operably linked to a gene product that is inhibitory to a plant parasitic nematode. In certain embodiments, the gene product is a siRNA or an amiRNA directed against a plant parasitic nematode gene.
In certain embodiments, a recombinant DNA construct comprising a BAM1 promoter that is operably linked to a heterologous gene, wherein said BAM1 promoter comprises any one of: i) the BAM1 promoter sequence provided in Example 3; ii) a promoter that has at least 70%, 85%, 90%, 95%, or 99% sequence identity to the BAM1 promoter sequence provided in Example 3; or ii) a promoter comprising a deletion of about up to about 10, 50, 100, 200, 500, 700, 1000, or 1500 nucleotides of the 5′ nucleotides of the BAM1 promoter sequence provided in Example 3 is provided. In certain embodiments, the BAM promoter is operably linked to a gene encoding a gene product that is inhibitory to a plant parasitic nematode.
(a) Average root length wild-type (Ler), clv2-1, and crn-1 seedlings grown for 9 days on media with or without the synthetic nematode dodecapeptide CLE motif Data represent the mean±SE, n=10. (b)-(d) Representative roots tips of seedlings grown on media with or without synthetic CLE peptides for 10 days and visualized with differential interference microscopy. (b) No peptide, (c) Sensitive to peptide, and (d) Resistant to peptide. (Scale bar, 50 μm).
(a) J4 females were counted at 14 dpi and adult females were counted at 30 dpi. Data represent mean±SE, n=35 for Ler, 32 for crn-1, 34 for clv2-1, and 29 for crn-1 clv2-1. Data are representative of three independent experiments.
(b) Seedlings were grown on vertical square plates for 10 days and inoculated with 10 J2s/root. At 14 dpi, syncytia that fed only one nematode and appeared translucent were microscopically examined and their area was determined. Data represent mean±SE, n=11 for Ler and crn-1, 14 for clv2-1, and 12 for crn-1 clv2-1.
Asterisks indicate statistically significant differences compared to Ler by Student's t test (P<0.05)
We describe the use of synthetic CLE peptides, nematode CLE overexpression lines, promoter-reporter lines, and nematode infection assays of receptor mutants to investigate a role for CLV2 and CRN in nematode CLE signaling. Our results indicate that the CLV2/CRN signaling pathway is required for successful nematode infection and syncytium development.
Plant-parasitic cyst nematodes secrete CLAVATA3 (CLV3)/ESR(CLE)-like effector proteins. These proteins have been shown to act as ligand mimics of plant CLE peptides and are required for successful nematode infection; however, the receptors for nematode CLE-like peptides have not been identified. Here we demonstrate that CLV2 and CORYNE (CRN), members of the receptor kinase family, are required for nematode CLE signaling. Exogenous peptide assays and overexpression of nematode CLEs in Arabidopsis showed that CLV2 and CRN are required for nematode CLE perception. In addition, promoter-reporter assays showed that both receptors are expressed in nematode-induced syncytia. Lastly, infection assays with receptor mutants revealed a decrease in both nematode infection and syncytia size. Taken together, our results indicate that nematode CLE perception by CLV2 and CRN is not only required for successful nematode infection, but is also involved in the formation or maintenance of nematode-induced syncytia.
Plant Nematode CLE Receptor Genes that can be Used to Obtain Nematode Resistant Plants and Methods of Use
A variety of plant nematode CLE peptide receptor genes (hereinafter referred to as “PNCLEPRG”) that provide for inhibition of plant parasitic nematode infections are provided herewith, along with associated methods of use, and plants comprising transgenes or mutations wherein expression of the PNCLEPRG are inhibited. Reduced expression of the PNCLEPRG in plants inhibits infection of the plants by nematodes. Such reductions in nematode infection result in improved plant yield and plant product quality.
Reductions in expression of the endogenous PNCLEPRG can be effected by any method that at least provides for reductions in the amount or activity of the PNCLEPRG at the site of nematode infection in the plant. Such sites of infection are commonly the plant roots, but can also comprise other plant parts such as tubers.
In certain embodiments, inhibition of PNCLEPRG expression in a plant can be effected by transgenes. Such transgenes include, but are not limited to, transgenes that: i) produce an siRNA directed against the PNCLEPRG; ii) produce an artificial microRNA targeting the PNCLEPRG; iii) produce a dominant negative form of the protein product of the PNCLEPRG; iv) produce an antisense or sense form of the PNCLEPRG; or v) comprise a genomic insertion that disrupts the endogenous PNCLEPRG.
Exemplary vector systems that can provide for production of siRNA in plants include, but are not limited to, vectors disclosed by Dafny-Yelin, et al. (Plant Physiology, 2007, Vol. 145, pp. 1272-1281), Wesley et al. 2001, Plant J. 27: 581-590, and Miki and Shimamoto, (2004) Plant Physiol 138: 1903-1913. Vectors for producing an siRNA are also described in U.S. Pat. No. 6,635,805, incorporated herein by reference in its entirety.
Exemplary vector systems that can provide for production of artificial miRNA in plants include, but are not limited to, vectors disclosed by Warthmann et al. (2008) PLoS ONE 3(3): e1829. doi:10.1371/journal.pone.0001829; and Alvarez et al. (2006) Plant Cell 18: 1134-1151. Vectors for effecting efficient inhibition of endogenous plant genes by expression of hairpin RNAs are also disclosed in U.S. Patent Application Nos. 20050164394, 20050160490, and 20040231016, each of which is incorporated herein by reference in their entirety. Exemplary dominant negative mutations that can provide for inhibition endogenous PNCLEPRG include, but are not limited, mutations modeled after dominant negative mutations in other Leucine Rich Repeat-Receptor Like Kinase (LRR-RLK) proteins.
In one embodiment, the dominant negative mutation can comprise a deletion or other loss-of-function mutation in the kinase domain. Such mutations have been disclosed for plant LRR-RLK proteins (Shpak et al., Plant Cell, Vol. 15, 1095-1110, 2003). Methods of identifying transgene insertions into specific genomic loci have also been disclosed. T-DNA of Agrobacterium is also an insertional mutagen that can be used as an agent to reduce expression of an endogenous PNCLEPRG. T-DNA mutagenesis has been described in Arabidopsis (Krysan et al., Plant Cell, 1999, 1: 2283-2290) and rice (Jeon et al., Plant J. June 2000; 22(6):561-70). Transposons such as those in the Ac/Ds (Activator-Disassociation) family and the Enhancer-inhibitor system can also be used to effect mutagenesis of an endogenous PNCLEPRG. Transposon mutagenesis schemes have been described (Speulman et al. Plant Cell, Vol. 11, 1853-1866, October 1999; Das, L., and Martienssen, R, 1995, Plant Cell 7:287-294).
Plants wherein expression of the endogenous PNCLEPRG is inhibited by a mutation and the use of such plants is also provided. Methods of identifying plants comprising mutations in PNCLEPRG include, but are not limited to, “TILLING” (Targeting Induced Local Lesions in Genomes). The TILLING technique comprises the induction of mutations across the genome followed by the identification and isolation of plants with mutations in desired genes (McCallum, Plant Physiology, 2000, Vol. 123, pp. 439-44).
PNCLEPRG target genes useful in the methods and plants of this invention include, but are not limited to, the ACR4, CLV1, CLV2, CRN, BAM1, BAM2, ER, and ERL2 genes of Arabidopsis and the orthologous ACR4, CLV1, CLV2, CRN, BAM1, BAM2, ER, and ERL2 genes of crop and ornamental plants subject to nematode infestation. Such orthologous genes are referred to herein as “ACR4-like, CLV1-like, CLV2-like, CRN-like, BAM1-like, BAM2-like, ER-like, and ERL2-like” genes. As used herein, the terms “orthologous” and “-like” (when appended to a gene) thus refer to genes that at least have a similar role in plant nematode CLE peptide signal transduction in their respective plant species of origin. In certain embodiments, the PNCLEPRG target genes are obtained from a plant that is a monocot or dicot plant, or that is a crop plant such as a tobacco, cereal, sugar beet, cotton, fruit, fiber, oilseed, potato, rice, corn, soybean, vegetable, and wheat plant. Exemplary vegetable plants include, but are not limited to, carrot, pepper, cucurbit, and tomato plants.
In certain embodiments, the PNCLEPRG target genes are derived from the plant that will be used (i.e. protected from nematode infection). However, a PNCLEPRG of a given plant specie can be used in a distinct plant species when it has sufficient homology to the orthologous PNCLEPRG of a distinct plant species. In this context, “sufficient homology” is that amount of homology necessary to provide for transgene-mediated inhibition of the orthologous gene. For certain transgene-mediated gene inhibition methods, a PNCLEPRG sequence of about is 23 nucleotides or longer with least 80%, 85%, 90%, 95%, 98%, 99% or 100% identity to the target orthologous sequence can be used. In certain embodiments, a hairpin RNA may comprise a 5′ sequence of roughly 19-24 nucleotides of sense strand target gene sequence with 100% identity followed by a spacer nucleotide of about 8-10 nucleotides followed by a sequence of roughly 19-24 nucleotides of antisense sequence that is capable of base pairing with the preceding sense strand sequence. In certain embodiments, a 19-24 base region of a PNCLEPRG that exhibits 100% identity over 19-24 nucleotides to an orthologous PNCLEPRG can also be used to inhibit that orthologous gene.
In certain embodiments, an Arabidopsis PNCLEPRG can be used to obtain nematode resistant plants, where the plants are Arabidopsis or other plants that comprise orthologous PNCLEPRGs that can be inhibited by the Arabidopsis PNCLEPRG. Arabidopsis PNCLEPRG include, but are not limited to, the ACR4, CLV1, CLV2, CRN, BAM1, BAM2, ER, and ERL2 can in certain embodiments be used to control plant parasitic nematode infections of cruciferous plants that include, but are not limited to, arugula, cauliflower, cabbage, cress, bok choy, broccoli, radish, canola, turnip, watercress, and the like.
In certain embodiments, a potato PNCLEPRG can be used to obtain nematode resistant plants, where the plants are potato plants or other plants that comprise orthologous PNCLEPRGs that can be inhibited by the potato PNCLEPRG. Potato PNCLEPRG provided herein include, but are not limited to, stCRN (SEQ ID NO:6), stBAM1 (SEQ ID NO:7), stBAM2 (SEQ ID NO:8), stER (SEQ ID NO:9), stCLV1 (SEQ ID NO:10), stCLV2 (SEQ ID NO:11), stACR4 (SEQ ID NO:12), and stERL2 (SEQ ID NO:13). Also provided herewith are related sequences with at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity to stCRN (SEQ ID NO:6), stBAM1 (SEQ ID NO:7), stBAM2 (SEQ ID NO:8), stER (SEQ ID NO:9), stCLV1 (SEQ ID NO:10), stCLV2 (SEQ ID NO:11), stACR4 (SEQ ID NO:12), and stERL2 (SEQ ID NO:13) as well as methods of using such sequences to control plant nematodes.
In certain embodiments, the use of such potato PNCLEPRGs and related sequences to control plant nematode, and particularly, plant cyst nematode infections, in solanaceous plants including, but not limited to, eggplant, tobacco, potato, and tomato is provided. In certain embodiments, the use of such potato PNCLEPRGs and related sequences to control Globedera sp. infections of potato plants is provided. In any of the aforementioned embodiments, inhibition of the plant PNCLEPRG can be limited to inhibition in roots or limited to inhibition at the site of nematode infection by use of root-specific and/or nematode inducible promoters, respectively.
In certain embodiments, a soybean PNCLEPRG can be used to obtain nematode resistant plants, where the plants are soybean plants or other plants that comprise orthologous PNCLEPRGs that can be inhibited by the soybean PNCLEPRG. Soybean PNCLEPRG provided herein include, but are not limited to, soybean CRN (SEQ ID NO:44, 45, 47, and 48), BAM1 (SEQ ID NO:23, 24, 26, 27), BAM2 (SEQ ID NO:29, 30, 32, 33), CLV1 (SEQ ID NO:38, 39, 41, 42), and CLV2 (SEQ ID NO:35, 36, 50, 51) orthologs. Also provided herewith are related sequences with at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity to soybean CRN (SEQ ID NO:44, 45, 47, 48), BAM1 (SEQ ID NO:23, 24, 26, 27), BAM2 (SEQ ID NO:29, 30, 32, 33), CLV1 (SEQ ID NO:38, 39, 41, 42), and CLV2 (SEQ ID NO: 35, 36, 50, 51) orthologs as well as methods of using such sequences to control plant nematodes. In certain embodiments, the use of such soybean PNCLEPRGs and related sequences to control plant nematodes, and particularly, plant cyst nematode infections, in leguminous plants including, but not limited to, alfalfa, clover, peas, beans, lentils, lupins, mesquite, carob, soybean, and peanuts, is provided. In certain embodiments, the use of such soybean PNCLEPRGs and related sequences to control Heterodera glycine infections of soybean plants is provided. In any of the aforementioned embodiments, inhibition of the plant PNCLEPRG can be limited to inhibition in roots or limited to inhibition at the site of nematode infection by use of root-specific and/or nematode inducible promoters, respectively.
In certain embodiments of the invention, combinations of two or more a plant PNCLEPRG are inhibited in a plant to provide resistance to plant parasitic nematode infections. Plants wherein combinations of two or more PNCLEPRG selected from the group of CRN, BAM1, BAM2, ER, CLV1, CLV2, ACR4, and ERL2 genes or orthologs thereof are inhibited can be used to provide resistance to plant parasitic nematode infections. In certain embodiments, a plant CLV2-like and a plant BAM1-like gene are both inhibited in parallel to reduce nematode infections in the plant. In certain embodiments of the invention, a plant CRN-1-like and a plant BAM1-like gene are both inhibited in parallel to reduce nematode infections in the plant. In certain embodiments, combinations of two or more of a soybean CRN (SEQ ID NO:44, 45, 47, and 48), BAM1 (SEQ ID NO:23, 24, 26, 27), BAM2 (SEQ ID NO:29, 30, 32), CLV1 (SEQ ID NO:38, 39, 41, 42), and CLV2 (SEQ ID NO:35, 36, 50, 51) orthologs or a related sequence are inhibited in a soybean or other plant to provide resistance to plant parasitic nematode infections. In certain embodiments, combinations of two or more of a potato stCRN (SEQ ID NO:6), stBAM1 (SEQ ID NO:7), stBAM2 (SEQ ID NO:8), stER (SEQ ID NO:9), stCLV1 (SEQ ID NO:10), stCLV2 (SEQ ID NO:11), stACR4 (SEQ ID NO:12), and stERL2 (SEQ ID NO:13) are inhibited in a potato or other plant to provide resistance to plant parasitic nematode infections. In any of the aforementioned embodiments, inhibition of the plant PNCLEPRG can be limited to inhibition in roots or limited to inhibition at the site of nematode infection by use of root-specific and/or nematode inducible promoters, respectively.
In addition to nematode resistant plants, the instant invention also provides for parts of those plants and plant cells. Plant parts provided herein include, but are not limited to, seeds, tubers, roots, leaves, stalks, lint, and the like. Also provided herein are processed products of the nematode resistant plants. Such processed plant products include, but are not limited to, a ground meal, a feed, a cake, and the like. In certain embodiments, such processed product would comprise a detectable amount of a transgene used to inhibit the PNCLEPRG.
Promoters from Plant Nematode CLE Receptor Genes and Methods of Use
Promoters from PNCLEPRG and recombinant DNA constructs providing such promoters that are useful for expressing genes of interest in plant cells where the nematodes feed are provided. Such promoters are particularly useful for expressing nucleic acid and/or protein sequences that are inhibitory to plant parasitic nematodes. Particular advantages of the promoters include, but are not limited to, providing for expression of the operably linked nucleic acid sequences at nematode feeding sites within the plant while limiting expression of the gene in other parts of the plant where such expression is not required or desired. As used herein in the context of a promoter, the term “operably linked” means that a promoter is connected to a sequence of interest such that the transcription of that sequence of interest is controlled and regulated by that promoter. When the sequence of interest encodes a protein and when expression of that protein is desired, “operably linked” means that the promoter is linked to the sequence in such a way that the resulting transcript will be efficiently translated. If the linkage of the promoter to the coding sequence is a transcriptional fusion and expression of the encoded protein is desired, the linkage is made so that the first translational initiation codon in the resulting transcript is the initiation codon of the coding sequence. Alternatively, if the linkage of the promoter to the coding sequence is a translational fusion and expression of the encoded protein is desired, the linkage is made so that the first translational initiation codon contained in the 5′ untranslated sequence associated with the promoter and is linked such that the resulting translation product is in frame with the translational open reading frame that encodes the protein desired.
A variety of recombinant DNA molecules comprising promoters of the invention that are operably linked to heterologous genes or nucleic acids of interest are provided. Heterologous genes or nucleic acids that provide for inhibition of plant parasitic nematodes can be operably linked to the PNCLEPRG promoters. In certain embodiments, the heterologous genes or nucleic acids of interest provide for inhibition of a plant parasitic nematode gene or function. Such plant parasitic nematode genes or functions include, but are not limited to, nematode genes that are essential or required for nematode viability or nematode genes involved in any aspect of plant host parasitism. In certain embodiments, the promoters are used to drive expression of heterologous genes or nucleic acids that are inhibitory to nematode genes disclosed in US Patent Application publication US20090012029, which discloses inhibitory nucleic acid specific for one or more cyst nematode esophageal gland cell proteins and which is incorporated herein by reference in its entirety.
In certain embodiments, the promoters are used to drive expression of genes or nucleic acids that inhibit formation and/or maintenance of the plant cells of the nematode feeding site. In certain embodiments, the promoters are thus used to: i) drive expression of heterologous genes or nucleic acids that are inhibitory to endogenous plant genes involved in formation and/or maintenance of the plant cells of the nematode feeding site; and/or, ii) drive expression of heterologous genes that comprise endogenous plant genes that are downregulated during the formation and/or maintenance of the plant cells of the nematode feeding site. Endogenous plant genes involved in formation and/or maintenance of the plant cells of the nematode feeding site that include, but are not limited to, genes involved in the cell wall architectural modifications during feeding site formation/maintenance, genes involved in sugar or carbohydrate, metal ion, and amino acid transport, and genes involved in plant phytohormone signaling and biosynthesis. A variety of soybean plant genes suitable for use with the promoters of the invention are disclosed in Ithal et al., Molec. Plant. Microb. Interact. Vol. 20, No. 5, 2007, pp. 510-525, incorporated herein by reference in its entirety. PNCLEPRG promoters useful in the methods and plants of this invention include, but are not limited to, the ACR4, CLV1, CLV2, CRN, BAM1, BAM2, ER, and ERL2 promoters of Arabidopsis and the orthologous ACR4, CLV1, CLV2, CRN, BAM1, BAM2, ER, and ERL2 promoters of crop and ornamental plants subject to nematode infestation. Such orthologous promoters are referred to herein as “ACR4-like, CLV1-like, CLV2-like, CRN-like, BAM1-like, BAM2-like, ER-like, and ERL2-like” promoters. As used herein, the terms “orthologous” and “-like” (when appended to a promoter) thus refer to promoters that at least have a similar role or expression pattern in plant nematode CLE peptide signal transduction in their respective plant species of origin. In certain embodiments, the PNCLEPRG promoters are obtained from a plant that is a monocot or dicot plant, or that is a crop plant such as a tobacco, cereal, sugar beet, cotton, fruit, fiber, oilseed, potato, rice, corn, soybean, vegetable, and wheat plant. Exemplary vegetable plants include, but are not limited to, carrot, pepper, cucurbit, and tomato plants.
In certain embodiments, a recombinant DNA construct comprising a PNCLEPRG promoter that is operably linked to a heterologous gene, or a plant, plant cell, plant part, or processed plant product comprising the same, is provided. In certain embodiments, the PNCLEPRG promoter comprises any one of: i) a potato ACR4 promoter (SEQ ID NO:15), an Arabidopsis (SEQ ID NO:14), potato (SEQ ID NO:16), or soybean (SEQ ID NO: 38 or 41) CLV1 promoter; ii) an Arabidopsis (SEQ ID NO:4), potato (SEQ ID NO:17), or soybean (SEQ ID NO:35 or 50) CLV2 promoter; iii) an Arabidopsis (SEQ ID NO:5), potato (SEQ ID NO:18), or soybean (SEQ ID NO: 44 or 47) CRN promoter; iv) an Arabidopsis (SEQ ID NO:3), potato (SEQ ID NO:19), or soybean (SEQ ID NO: 23 or 26) BAM1 promoter; v) a potato (SEQ ID 20), or soybean (SEQ ID NO: 29 or 32) BAM2 promoter; vi) a potato ER promoter (SEQ ID NO:21); vii) or a potato ERL2 promoter (SEQ ID NO:22). Also provided are recombinant DNA constructs comprising a variant PNCLEPRG promoter that has at least 70%, 85%, 90%, 95%, or 99% sequence identity to any one of: i) a potato ACR4 promoter (SEQ ID NO:15), an Arabidopsis (SEQ ID NO:14), potato (SEQ ID NO:16), or soybean (SEQ ID NO: 38 or 41) CLV1 promoter; ii) an Arabidopsis (SEQ ID NO:4), potato (SEQ ID NO:17), or soybean (SEQ ID NO:35 or 50) CLV2 promoter; iii) an Arabidopsis (SEQ ID NO:5), potato (SEQ ID NO:18), or soybean (SEQ ID NO: 44 or 47) CRN promoter; iv) an Arabidopsis (SEQ ID NO:3), potato (SEQ ID NO:19), or soybean (SEQ ID NO: 23 or 26) BAM1 promoter; v) a potato (SEQ ID 20), or soybean (SEQ ID NO: 29 or 32) BAM2 promoter; vi) a potato ER promoter (SEQ ID NO:21); vii) or a potato ERL2 promoter (SEQ ID NO:22).
In certain embodiments, recombinant DNA constructs comprising a PNCLEPRG promoter comprising a deletion of about up to about 10, 50, 100, 200, 500, 700, 1000, or 1500 nucleotides of the 5′ nucleotides of any one of: i) a potato ACR4 promoter (SEQ ID NO:15), an Arabidopsis (SEQ ID NO:14), potato (SEQ ID NO:16), or soybean (SEQ ID NO: 38 or 41) CLV1 promoter; ii) an Arabidopsis (SEQ ID NO:4), potato (SEQ ID NO:17), or soybean (SEQ ID NO:35 or 50) CLV2 promoter; iii) an Arabidopsis (SEQ ID NO:5), potato (SEQ ID NO:18), or soybean (SEQ ID NO: 44 or 47) CRN promoter; iv) an Arabidopsis (SEQ ID NO:3), potato (SEQ ID NO:19), or soybean (SEQ ID NO: 23 or 26) BAM1 promoter; v) a potato (SEQ ID 20), or soybean (SEQ ID NO: 29 or 32) BAM2 promoter; vi) a potato ER promoter (SEQ ID NO:21); vii) or a potato ERL2 promoter (SEQ ID NO:22) is provided. Those skilled in the art will appreciate that promoter and 5′UT regions of PNCLEPRG provided herewith as genomic sequences in association with the coding regions can be dissociated from those coding regions and operably linked to heterologous nucleic acids or genes by transcriptional or translational fusions. In certain embodiments, the soybean PNCLEPRG promoters and 5′UT of Table 5 (SEQ ID NO: 23, 26, 29, 32, 35, 38, 41, 44, 47, and 50) thus comprise the nucleic acid sequences located 5′ to the start codon of those genomic sequences.
In certain embodiments, variants of any of the aforementioned PNCLEPRG promoters comprising at least about 300, 500, 800, 900, 1,000, 1,500, 2,500, or 3,000 nucleotides of the nucleic acid sequence located 5′ to the start codon or located 5′ to mRNA 5′ cap site of the endogenous gene associated with said promoter are provided. Also provided are recombinant DNA constructs wherein any of the aforementioned promoters is operably linked to a gene encoding a gene product that is inhibitory to a plant parasitic nematode.
In addition to nematode resistant plants comprising the recombinant DNA constructs of the aforementioned PNCLEPRG promoters, the instant invention also provides for parts of those plants and plant cells. Plant parts provided herein include, but are not limited to, seeds, tubers, roots, leaves, stalks, lint, and the like. Also provided herein are processed products of the nematode resistant plants. Such processed products include, but are not limited to, a ground meal, a feed, a cake, and the like.
In certain embodiments, such processed product would comprise a detectable amount of a recombinant DNA comprising a PNCLEPRG promoter that is operably linked to a heterologous gene.
The disclosed embodiments are merely representative of the invention, which may be embodied in various forms. Thus, specific structural and functional details disclosed herein are not to be interpreted as limiting.
Arabidopsis seeds were sterilized using the chlorine gas method (Wang et al., 2010b). Sterilized seeds were germinated on vertical plates in a growth chamber at 22° C. under long-day conditions (16 h light/8 h dark) containing synthetic peptides (Sigma-Genosys) as previously described (Wang et al., 2010b). The clv2-1 mutant in the Ler background (Koornneef et al., 1983) was obtained from the Arabidopsis Biological Resource Center. The crn-1 mutant in the Ler background (Muller, 2008) and the sol2-1 mutant in the Utr background (Miwa et al., 2008) have been described previously. The HgCLEp, HsCLE1p, and HsCLE2p peptides used in this study were as described (Wang et al., 2010b). Two days after germination, root length was marked each day for nine days. Plates were scanned using an Epson Perfection V200 PHOTO scanner and total root length was determined using Scion Image. Primary root tips of Arabidopsis were mounted on glass slides and visualized with an Olympus Vanox AHBT3 microscope equipped with Nomarski optics.
The CLE gene sequences from the soybean cyst nematode (HgCLE2ΔSP) and the beet cyst nematode (HsCLE1 and HsCLE2) used to generate the overexpression constructs were previously described (Wang et al., 2010a; Wang et al., 2010b). Constructs were transformed into the mutant backgrounds using the Arabidopsis floral dip method (Clough and Bent, 1998). Seeds from primary Arabidopsis transformants (T1) were selected on 0.5×MS media [MS basal nutrients salts (Caisson Laboratories), 2% sucrose, 0.8% Type A agar (Sigma), pH 5.7] containing 50 μg/mL timentin (GlaxoSmithKline) to control Agrobacterium contamination, and 50 μg/mL kanamycin and grown under the same conditions as above. Seedlings resistant to kanamycin were transplanted to soil seven days after germination. Two weeks after transplanting to soil the shoot phenotypes were observed.
CRN:GUS has been previously described and characterized (Muller et al., 2008). To generate CLV2:H2B-mCherry, vector pMDC99 (Curtis and Grossniklaus, 2003) was modified by introducing the CDS of chimeric construct mCherry-H2B at the 3′ site of the gateway cassette using the unique Pad restriction site to give pAB149. To analyze the expression of CLV2 1252 bp of the 5′ region and 9 bp of the CDS was amplified using the primers AB_CLV2_Pro_F (5′ CACCAGACACAAAGCCCTTTCCATTGTC 3′; SEQ ID NO:1) and AB_CLV2_Pro_R (5′ CTTTATCATAGCTCAGAGGA 3′; SEQ ID NO:2) to give a CACC-TOPO containing amplicon, which was cloned into pENTR/D-TOPO (Invitrogen™). This entry clone was used in a LR reaction with pAB149 to give pAB183 (CLV2:H2B-mCherry). Expression of CLV2 under the control of the endogenous promoter, using 1252 bp of the CLV2 5′ region was sufficient to rescue the clv2-1 mutant in all isolated lines (N=20).
The beet cyst nematode (BCN) Heterodera schachtii was propagated on greenhouse-grown sugar beets (Beta vulgaris cv Monohi). BCN eggs were isolated and hatched as previously described (Mitchum et al., 2004). After 2 days, second stage juveniles (J2) were collected and surfaced sterilized according to Wang et al. (2007) except 0.004% mercuric chloride, 0.004% sodium azide, and 0.002% Triton X-100 were used. Sterilized seeds were grown on modified Knop's medium (Brunschwig Chemie) (Sijmons et al., 1991). Ten days after germination seedlings were inoculated with 20 sterilized J2/root.
At the indicated timepoints, freshly excised CRN:GUS tissues were infiltrated with GUS substrate buffer (0.5 mM 5-bromo-4chloro-3-indolyl glucuronide, 100 mM Tris, pH 7.0, 50 mM NaCl, 0.06% Triton X-100, 3 mM potassium ferricyanide) and incubated overnight at 37° C. (Jefferson et al., 1987). Stained roots were placed in glass Petri dishes and visualized with a Nikon Eclipse TS 100 inverted microscope.
CLV2:H2B-mCherry seed was sterilized, grown, and inoculated with nematodes as described above. At the indicated timepoints, infected roots were mounted on glass slides and visualized with a 510 META confocal scanning microscope (Carl Zeiss, Thornwood, N.Y., USA) excited at 543 nm.
Infection Assay with Receptor Mutants
Sterilized receptor mutants were plated in 12-well Falcon tissue culture plates (BD Biosciences) containing modified Knop's medium with 0.8% Daishin agar in a randomized block design. Plants were grown at 24° C. with a 12 hour photoperiod. Fourteen days after germination, seedlings were inoculated with 200 surface-sterilized BCN J2. J4 females were counted at 14 days post-inoculation (dpi) and adult females were counted at 30 dpi. The average values were calculated and significant differences were determined by using Student's t test (P<0.05). To measure syncytia size, receptor mutants were germinated on modified Knop's medium in vertical square plates and inoculated at 10 days after germination with 10 surface-sterilized BCN J2. At 14 dpi, syncytia that were transparent and only fed upon by only one nematode were visualized with a Nikon Eclipse TS 100 inverted microscope. Area of syncytia was measured using Adobe Photoshop CS5 and significant differences were determined by using Student's t test (P<0.05).
We have previously shown that exogenously applied 12-aa peptides corresponding to the CLE motifs of the SCN (HgCLEs) and the BCN (HsCLEs) CLEs can function as plant CLE peptide mimics causing termination of the primary root meristem in a concentration dependent manner (Wang et al., 2010b). In Arabidopsis, it has been shown that the short root phenotype caused by overexpression or exogenous application of some plant CLE peptides is dependent on CLV2 signaling (Fiers et al., 2005; Miwa et al., 2008; Muller, 2008; Meng et al., 2010). More recent evidence indicates that CLV2 forms a complex with CRN and can transmit the signal from CLV3 binding in a CLV1-independent manner (Miwa et al., 2008; Muller, 2008; Bleckmann et al., 2010; Zhu et al., 2010). To determine whether or not CLV2 and CRN might play a role in cyst nematode CLE perception we screened the Arabidopsis clv2-1 null mutant and the crn-1 amorphic allele for resistance to the HgCLE, HsCLE1, and HsCLE2 12-aa peptides. Seeds were grown on vertical plates in the absence of exogenous peptide or in the presence of 1 μM HgCLE or 10 μM of the HsCLEs and roots were measured 9 days after germination. Wild-type seedlings (Landsberg erecta [Ler]) had significantly shorter roots when grown on plates with any of the CLE peptides in comparison to the no peptide control (
Nematode CLEs function in planta through a CLV2- and CRN-dependent pathway Overexpression of HgCLE2, HsCLE1, and HsCLE2 in wild-type Arabidopsis has been shown to cause wus-like phenotypes similar to other plant CLEs (Strabala et al., 2006; Meng et al., 2010; Wang et al., 2005; Wang et al., 2010a; Wang et al., 2010b). If CLV2 and/or CRN are involved in nematode CLE perception then we would expect the phenotypes to be diminished or abolished when overexpressed in clv2-1 and/or crn-1. Each of the nematode CLE genes was cloned into an overexpression vector and transformed into the mutant backgrounds. Transgenic seedlings in the T1 generation were screened and characterized in soil. In contrast to the overexpression phenotypes seen in wild-type Arabidopsis where a high percentage of wus-like phenotypes were observed (Wang et al., 2010a; Wang et al., 2010b), no wus-like phenotypes were observed when HgCLE2, HsCLE 1, and HsCLE2 were overexpressed in clv2-1 or crn-1 (Table 1). These results demonstrate that mutations in CRN and CLV2 suppress nematode CLE overexpression phenotypes.
Spatial and temporal relationship between CLV2, CRN, and nematode feeding sites Cyst nematodes enter the root near the zone of elongation, migrate through root cortical cells using their stylet to puncture through cell walls, and begin feeding from a single cell near the vascular cylinder. Once cyst nematodes initiate a feeding site the dorsal esophageal gland cell becomes active and the secreted CLE peptides are delivered to the host root cells (Wang et al., 2010a). In order for CLV2 and CRN to be able to perceive the nematode CLE as a ligand mimic they must be expressed in the correct spatial and temporal context.
Using a CRN:GUS transgene in Arabidopsis, CRN expression was previously shown to be expressed throughout the root including the vasculature where the nematode initiates feeding (
Similar to CRN, CLV2 is expressed in many different vegetative tissues (Jeong et al., 1999). However little is known about the expression pattern of CLV2 in roots. To visualize CLV2 expression in roots and nematode feeding sites, mCherry was fused to the C-terminus of the Arabidopsis Histone 2B (H2B) gene and placed under the transcriptional control of the CLV2 promoter. The H2B protein has been shown to be a valid marker for chromatin organization in plant nuclei and has been used to describe development of the syncytial endosperm in Arabidopsis (Boisnard-Lorig et al., 2001). In uninfected roots, CLV2:H2B-mCherry fluorescence was detected throughout the root vasculature with the strongest expression detected in lateral root primordia and the zone of elongation extending down to the root apical meristem (A. Bleckmann and R. Simon, unpublished). Upon nematode infection, increased expression of CLV2:H2B-mCherry fluorescence was detected in the nuclei of syncytia fed upon by parasitic J2s (
Mutant alleles of CLV2 and CRN cause a reduction in nematode infection and defects in syncytial size.
By using an RNAi approach targeting nematode CLE genes, previous reports have shown that nematode CLE peptides are important for successful infection of host plants roots (Bakhetia et al., 2007; Patel et al., 2008). To determine if nematode CLE perception by CLV2 or CRN is required, root infection assays with nematodes were performed on the clv2-1 and crn-1 single mutants, and the crn-1 clv2-1 double mutant. According to Muller et al. (2008), crn-1 clv2-1 is morphologically indistinguishable from either of the single mutants, indicating that they act in the same pathway. The mutant alleles and the wild-type Ler were randomized in 12-well plates and grown on modified Knop's medium.
Two weeks after germination seedlings were inoculated with infective J2s. J4 females were counted at 14 days post-inoculation (dpi) and adult females were counted at 30 dpi. Both the single and double mutants showed a statistically significant reduction in nematode infection with the exception of crn-1 at 14 dpi (
The mutant alleles and the wild-type Ler were grown on vertical square plates and inoculated with infective J2s. At 14 dpi, syncytia that were transparent and fed upon by only one nematode were measured. The average area of wild-type (Ler) syncytia was 1402±147 μm2 (
Nematode CLE genes have been found to be upregulated in the dorsal esophageal gland cell at the onset of parasitism and remain on through the adult female life stage. CLE genes are turned off in adult males that are no longer feeding (Wang et al., 2005; Patel et al., 2008; Lu et al., 2009; Wang et al., 2010a). In SCN and BCN, immunolocalization studies have localized nematode CLEs along the dorsal gland extension and in the ampulla at the base of the nematode stylet indicating they are secreted into host plant roots via the stylet (Wang et al., 2005; Patel et al., 2008; Wang et al., 2010a). Consistent with these results an immunofluorescence study found that SCN CLEs are secreted directly into host plant root cytoplasm (Wang et al., 2010a). The variable domain of SCN CLEs is then able to redirect the proteins into the apoplast where they can act as plant CLE ligand mimics by interacting with extracellular membrane bound plant CLE receptors. However, thus far, host plant receptors that perceive nematode CLE signals have not been identified.
Many studies have used synthetic CLE peptides to help determine the roles that plant CLE peptides play in plant growth and development. Previous studies have shown that nematode CLE peptides cause root growth phenotypes similar to other plant CLEs (Lu et al., 2009; Wang et al., 2010a; Wang et al., 2010b). Other studies have also shown that these peptide screens can identify receptors that may be involved in certain CLE signaling pathways by utilizing receptor mutants (Fiers et al., 2005; Stahl et al., 2009; Meng et al., 2010).
To identify potential nematode CLE receptors we tested plant CLE receptors implicated in CLE signaling in the RAM for a role in nematode CLE perception. In the root, exogenous peptide assays and overexpression studies have shown that CLV2 is required for proper proximal meristem function (Stahl et al., 2009; Meng et al., 2010).
It has also been shown that a new member of the receptor kinase family, CRN, forms a heterodimer with CLV2 and is required for proper localization of the CLV2/CRN complex to the plasma membrane (Bleckmann et al., 2010; Zhu et al., 2010). In Arabidopsis, CRN has been found to be widely expressed in both shoot and root tissues suggesting dual roles in shoot and root development (Muller et al., 2008). CLV2 has been found to be expressed in shoot tissues (Jeong et al., 1999), but less is known about its expression in the root. In this paper we screened a null mutant allele of CLV2 and an amorphic mutant allele of CRN for resistance to the nematode CLE peptides. Both clv2-1 and crn-1 were resistant to HgCLEp, HsCLE1p, and HsCLE2p (
In order to serve as a receptor complex for nematode CLE peptides, CLV2 and CRN would most likely need to be expressed in feeding cell initials as well as the developing feeding sites. With the use of promoter-reporter lines we confirmed that both CLV2 and CRN were expressed in nematode-induced feeding sites (
Previous reports have demonstrated that SCN and BCN CLEs are important for nematode parasitism by showing a reduction in nematode infection after knocking down CLE expression in the worm using RNAi approaches (Bakhetia et al., 2007; Patel et al., 2008). To directly test for a role of CLV2/CRN in nematode CLE perception we performed infection assays on the receptor mutants.
We showed that a reduction in nematode infection occurs on the receptor mutants (
The involvement of CRN in nematode CLE signaling also opens up the interesting possibility that nematode CLE signaling may be directly or indirectly suppressing host plant defense responses. It has been reported that in root tips of sol2-1, another mutant allele of CRN, plant disease resistance-related and stress responsive genes were upregulated (Miwa et al., 2008). Therefore, when nematode CLEs are secreted they could activate the CLV2/CRN signaling pathway leading to a suppression of plant disease resistance-related and plant stress responsive genes. One might speculate that the main target for nematode CLEs is a signaling pathway which allows developmental programming of root cells for syncytium formation to occur and that suppression of plant defense responses is just an added benefit to the nematode. Alternatively, the nematode may require suppression of plant defense responses through plant CLE signaling in order for the syncytium to form properly. Further studies will need to be performed to investigate this possibility.
Several possibilities exist for why we only see a partial reduction in nematode numbers and syncytia size in the clv2-1 and crn-1 mutant backgrounds. First, besides CLEs, nematodes secrete many different effectors that likely play an important role in feeding cell formation (Wang et al., 2001; Gao et al., 2003).
For example, when BCN CLEs were targeted with RNAi a similar partial reduction in nematode infection was observed (Patel et al., 2008), either as a consequence of limited reductions in transcript levels or an indication that the other effectors still active in the nematode allow infection to proceed. A second possibility for the partial reduction in the receptor mutants is that there could be multiple nematode CLE receptors. So far, the nematode CLEs reported belong to gene families (Lu et al., 2009; Wang et al., 2010a; Wang et al., 2010b). In addition, PCN CLEs have multiple CLE motifs that may be simultaneously processed to release different CLE peptides (Lu et al., 2009). This leaves the possibility that nematode CLE peptides may activate multiple plant CLE signaling pathways concurrently to function in an antagonistic or synergistic fashion as reported for plant CLEs (Whitford et al., 2008). The current plant CLV3 signaling pathway in the shoot indicates that there are parallel signaling pathways. Genetic evidence indicates that CLV1 acts in a separate pathway from the CLV2/CRN pathway (Muller et al., 2008). In support of the genetic data, recent reports using luciferase complementation assays and FRET analysis have shown that CLV1 forms a homodimer and that CLV2 and CRN form a heterodimer without CLV3 stimulation (Bleckmann et al., 2010; Zhu et al., 2010).
These reports also found evidence for CLV1 interacting with the CLV2/CRN complex leading to the possibility that different signaling pathways could be activated depending on which receptor in the complex interacts with the CLE ligand (Bleckmann et al., 2010; Zhu et al., 2010). Thus it is possible that in the crn-1 clv2-1 double mutants, nematodes are still able to signal through other receptors in the roots. Unlike CLV2, which has a broad expression pattern in plants, CLV1 expression is thought to be restricted to the center of the SAM and its function is thought to be confined to stem cell specification in the shoot (Clark et al., 1997; Fletcher et al., 1999). Therefore, in order to utilize CLV1 as a receptor, nematodes would have to activate CLV1 expression in the roots. Recently, CLV1-related Barely Any Meristem (BAM) 1 and BAM2 have been shown to act redundantly in the SAM and are widely expressed throughout the plant, including root tissues (DeYoung et al., 2006; Deyoung and Clark, 2008). We have found that bam1 is also resistant to exogenous application of synthetic nematode CLE peptides (A. Replogle, S. Chen, X. Wang and M. G. Mitchum, unpublished data). Moreover, there are over 200 LRR-RLKs in Arabidopsis and only a few receptor-CLE ligand pairs have been identified (Shiu and Bleecker, 2001). Thus, further studies using a combination of mutants will need to be performed to investigate the possible involvement of other host plant receptors in nematode CLE signaling.
It is shown here that nematode CLE signaling through the CLV2/CRN receptor complex is important for proper syncytium formation and ultimately successful nematode infection. These findings open the door for identifying the downstream signaling components regulated by CLV2/CRN to uncover the role nematode CLE signaling plays in syncytium formation.
Screening of plant CLE receptor mutants for resistance to nematode CLE peptides, overexpression of the nematode CLEs in the receptor mutant background, and infection assays of plant receptor mutants, has identified several receptors involved in nematode CLE peptide signaling. Plant receptor mutants exhibiting resistance to exogenous treatment of nematode CLE peptides include CLAVATA2 (CLV2; At1g65380), CORYNE (CRN; At5g13290), BARELY ANY MERISTEM (BAM1; At5g65700), and ERECTA-LIKE2 (ERL2; (At5g07180) (
indicates data missing or illegible when filed
Promoters associated with any of the potato genes provided below in Example 4 are also provided herewith. In particular, use of the promoter associated with the StCLV1 gene provided below in any of the methods of this invention is provided.
Sequences correspond to potato genes analyzed in
GAAAATAACATGAGTAGATTTCTTGGGATTGTGTAAAAAAATGTAGTGCCATTATAATATTATTATTGTAGGTAG
ATGGCAGAATCAGTTCTTGAACCTTGTACAACCTCTTATTCCTTCAAAGTTTCAATCTTTATCCTATTCTTCTTG
ATGTCTTCAATTGCTATTTCATATGGTGAATATGGTTCTGTTTTTTGTGGGTTGAAGTCAGATGGATCTCATTTG
ATGGAGGTGAGCGTGAAGATGAAATTCCCCTCACAAGCACTACTGTTGGCTCTATTGCTT
Mutant Arabidopsis plants i) homozygous for the recessive bam1-3 mutation; ii) homozygous for the recessive clv2-6 mutation; iii) homozygous for the recessive crn-1 mutation; iv) homozygous for both the recessive clv2-6 and bam1-3 mutations; and v) homozygous for both the recessive crn-1 and bam1-3 mutations were exposed to the cyst nematode Heterodera schachtii and assayed for a response as described in Example 1. More specifically, sterilized receptor mutants were plated in 12-well Falcon tissue culture plates (BD Biosciences) containing modified Knop's medium with 0.8% Daishin agar in a randomized block design. Plants were grown at 24° C. with a 12 hour photoperiod. Fourteen days after germination, seedlings were inoculated with 200 surface-sterilized BCN (Beet Cyst Nematodes; i.e. Heterodera schachtii) J2. J4 females were counted at 14 days post-inoculation (dpi) and adult females were counted at 30 dpi. The average values were calculated and significant differences were determined by using Student's t test (P<0.05). To measure syncytia size, receptor mutants were germinated on modified Knop's medium in vertical square plates and inoculated at 10 days after germination with 10 surface-sterilized BCN J2. At 14 dpi (days post infection) and 30 dpi, syncytia that were transparent and only fed upon by only one nematode were visualized with a Nikon Eclipse TS 100 inverted microscope. Area of syncytia was measured using Adobe Photoshop CS5 and significant differences were determined by using Student's t test (P<0.05). In these experiments, the bam1-3 mutant exhibited a 25% reduction in nematode infection that was similar to reductions obtained with clv2-6 mutants. The clv2-6, bam1-3 double mutant and the crn-1, bam1-3 double mutant showed a 35% and 50% reduction in nematode infection respectively (
The promoter for the Arabidopsis CLV1 gene was operably linked to a beta-glucuronidase gene (GUS) and introduced into transgenic Arabidopsis plants. The transgenic plants were then infected with BCN and expression of the GUS observed. It was determined that the pCLV1 promoter can provide for expression in the root vasculature uninfected plants as well as upregulation of expression at sites of BCN infection in plant roots (
Arabidopsis thaliana Clv1
The promoter for the Solanum tuberosum CRN and CLV2 genes was operably linked to a beta-glucuronidase gene (GUS) and introduced into transgenic Arabidopsis plants. The transgenic plants were then infected with BCN and expression of the GUS observed. It was determined that the StCRN and StCLV2 promoters can provide for expression in the root vasculature uninfected plants as well as upregulation of expression at sites of BCN infection in plant roots (
Solanum tuberosum
Solanum tuberosum
Solanum tuberosum
Transgenic potato plants that expressed an artificial miRNA (amiRNA) directed against the endogenous potato StCLV2 gene (SEQ ID NO:11) were generated and assayed for both expression of StCLV2 and for resistance to G. rostochiensis infection. Two independent transgenic potato lines tested exhibited both reductions in expression of the endogenous StCLV2 gene and reductions in the numbers of G. rostochiensis (
Sequences of various candidate soybean nematode CLE receptor genes are provided in Table 5. Inhibition of the expression of such genes is anticipated to be useful in the control of nematode infections in transgenic plants. It is further anticipated that promoter sequences associated with these soybean genes will be useful in providing nematode inducible expression of operably linked sequences. Start and stop codons are underlined in the genomic and cDNA sequences provided. The soybean PNCLEPRG promoters and 5′UT of Table 5 (SEQ ID NO: 23, 26, 29, 32, 35, 38, 41, 44, 47, and 50) thus comprise the nucleic acid sequences located 5′ to the start codon of those genomic sequences.
ATGGCGTTGAGTATGACTCAACAGATCGGGACCCTAGCTGGTGCGACGGTGCCGGATTCCTCGGC
ATGATGCCGTTGGACAGCGTAAAGACGGGAAACGCGGTGAACCGGAAGAAGGCGATGAACGCGGC
ATGCGTGTCCTCTTTCTTTTTCTGTTTTTCCAGTTTCTCCATTTTCATTTCCCCAAAACCCTTTC
ATGCCCAAAATGCGTGTCCTCTTTGTTTTTCTGTTTTTCCATTTTCATTTCCCTGAAACCCTTTC
ATGGTGATGGGACACACCACACCCCTCACACTCCTCTGTATGATTCTTCTTTTTGCAACCCCTTC
ATGAGAAGCTGTGTGTGCTACACGCTATTATTGTTTATTTTCTTCATATGGCTGCGCGTGGCAAC
ATGGCAACGTGCTCTTCGTTCAGTGACATGGATGCGTTACTAAAGCTGAAGGAGTCCATGAAAGG
ATGTTTAGGAAAAGGCACACCCTTTCTTCTCTTGCAAGGGAATTGTTGGCATTTCAGCCACTTTT
ATGTTTAGGAAAAGGCACATCCTTTCTTCTCTTGCAAGGGAATTGTTGGCACTCCAGCCACTTTT
ATGCCCACCCAGTTCCTCTTTTGCTTCAAACTCCTCTCCCCCTTCCTAAAAATTGCACCTTTACT
Having illustrated and described the principles of the present invention, it should be apparent to persons skilled in the art that the invention can be modified in arrangement and detail without departing from such principles. Although the materials and methods of this invention have been described in terms of various embodiments and illustrative examples, it will be apparent to those of skill in the art that variations can be applied to the materials and methods described herein without departing from the concept, spirit and scope of the invention. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
This application claims benefit under 35 USC §119(e) of U.S. provisional application Ser. No. 61/371,619, filed Aug. 6, 2010, and incorporated herein by reference in its entirety.
This invention was made with Government support under Grant Numbers 2007-35607-17790, 2008-34113-19420, 2009-35302-0534, all awarded by the USDA-NRI. The government has certain rights to this invention.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/US11/43882 | 7/13/2011 | WO | 00 | 8/22/2013 |
| Number | Date | Country | |
|---|---|---|---|
| 61371619 | Aug 2010 | US |
