NITROGEN-CONTAINING HETEROCYCLIC COMPOUND

Information

  • Patent Application
  • 20250197389
  • Publication Number
    20250197389
  • Date Filed
    March 16, 2023
    2 years ago
  • Date Published
    June 19, 2025
    8 months ago
Abstract
The present invention relates to a nitrogen-containing heterocyclic compound. Specifically, provided in the present invention is a compound of formula I or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof. The compound of the present invention has a good precise treatment effect on tumors with low expression, no expression, low activity or no activity of mitochondrial permeability transition pores and/or low expression, no expression, low activity or no activity of peptidylprolyl isomerase F.
Description
FIELD OF THE INVENTION

The present invention relates to the field of medicine. Specifically, the present invention relates to nitrogen-containing heterocyclic compound.


BACKGROUND TECHNOLOGY

Tumor is a common disease that seriously endangers human health, and the mortality rate of malignant tumors is rising. Due to the heterogeneity of tumor, simply using the same treatment method or medication based on source or pathological characteristic of tumors can easily lead to improper treatment, which can delay valuable treatment time and opportunities for patient.


Therefore, it is very necessary to take precision treatment according to the different features of tumor. With the development of biological technology, tumors are typed at the molecular level such as gene and protein level, etc, and more and more changes in tumor-related gene and the expression and activity of protein have been discovered, changes in tumor-related gene and the expression and activity of protein play an important role in the development of malignant tumors, the discovery and application of biomarkers can provide precise guidance for the application of related drug and make precision treatment of tumor possible, thereby achieving targeted administration of drug, significantly improving treatment effect, reducing the dose of drug and reducing toxic side effects.


Therefore, there is an urgent need in the art to develop a drug that can achieve precision treatment on tumor.


SUMMARY OF THE INVENTION

It is an object of the present invention to provide a compound, the compound has significantly excellent precision treatment effect on tumor with low expression, no expression, low activity or no activity of mitochondria permeability transition pore, and/or low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F.


In the first aspect of the present invention, it provides a compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof;




embedded image




    • wherein,

    • R1 and R2 are each independently hydrogen, deuterium, halogen, substituted or unsubstituted C1-C16 alkyl, substituted or unsubstituted C3-C16 cycloalkyl, substituted or unsubstituted 3-12 membered heterocycloalkyl, substituted or unsubstituted C1-C16 haloalkyl, substituted or unsubstituted C3-C16 halocycloalkyl, substituted or unsubstituted C6-C16 aryl, substituted or unsubstituted 5-12 membered heteroaryl;

    • R3, R4 and R5 are each independently hydrogen, halogen, R17—O—, R17—S—, (R18R19)N—; or R3 and R4, or R4 and R5 are connected to form a substituted or unsubstituted 3-12 membered heterocycloalkane ring;

    • R6, R8, R1, R12, R13, R14 and R15 are each independently hydrogen, substituted or unsubstituted C1-C8 alkyl, halogen;

    • R7 is hydrogen, substituted or unsubstituted C1-C12 alkyl, substituted or unsubstituted C1-C12 haloalkyl, substituted or unsubstituted C6-C16 aryl-substituted or unsubstituted C1-C12 alkyl-, substituted or unsubstituted 5-16 membered heteroaryl-substituted or unsubstituted C1-C12 alkyl-;

    • R9 and R10 are connected to form a substituted or unsubstituted 3-12 membered heterocycloalkane ring;

    • R17 is hydrogen, substituted or unsubstituted C1-C16 alkyl,







embedded image


substituted or unsubstituted C3-C16 cycloalkyl, substituted or unsubstituted 3-12 membered heterocycloalkyl, substituted or unsubstituted C3-C16 cycloalkyl-substituted or unsubstituted C2-C10 acyl-, substituted or unsubstituted C3-C16 cycloalkyl-C(O)—, substituted or unsubstituted C1-C16 haloalkyl, substituted or unsubstituted C3-C16 halocycloalkyl, substituted or unsubstituted 3-12 membered heterocycloalkyl-substituted or unsubstituted C1-C12 alkyl-, substituted or unsubstituted C6-C16 aryl-substituted or unsubstituted C1-C12 alkyl-, substituted or unsubstituted C6-C16 aryl-substituted or unsubstituted C6-C16 aryl-substituted or unsubstituted C1-C12 alkyl-, substituted or unsubstituted 5-16 membered heteroaryl-substituted or unsubstituted C1-C12 alkyl-, substituted or unsubstituted C6-C16 aryl-O-substituted or unsubstituted C1-C12 alkyl-, substituted or unsubstituted C6-C16 aryl-S-substituted or unsubstituted C1-C12 alkyl-, substituted or unsubstituted 5-16 membered heteroaryl-O-substituted or unsubstituted C1-C12 alkyl-, substituted or unsubstituted 5-16 membered heteroaryl-S-substituted or unsubstituted C1-C12 alkyl-, substituted or unsubstituted C2-C8 alkenyl-substituted or unsubstituted C1-C8 alkyl-substituted or unsubstituted C2-C8 alkenyl-substituted or unsubstituted C1-C8 alkyl-, substituted or unsubstituted C2-C8 alkenyl-substituted or unsubstituted C1-C8 alkyl-, (R20R21)N-substituted or unsubstituted C1-C12 alkyl-;

    • R18 and R19 are each independently hydrogen, substituted or unsubstituted C1-C12 alkyl, substituted or unsubstituted C3-C12 cycloalkyl, substituted or unsubstituted C6-C16 aryl-substituted or unsubstituted C1-C12 alkyl-; or R18 and R19 are connected to form a substituted or unsubstituted 3-12 membered heterocycloalkane ring;
    • R20 and R21 are each independently hydrogen, substituted or unsubstituted C1-C12 alkyl, substituted or unsubstituted C3-C12 cycloalkyl, substituted or unsubstituted C2-C10 ester group; or R20 and R21 are connected to form a substituted or unsubstituted 3-12 membered heterocycloalkyl.


In another preferred embodiment, the heterocyclic ring of the heterocycloalkyl, heteroaryl and heterocycloalkane ring has 1-4 (preferably 1, 2, 3 or 4) heteroatoms independently selected from the group consisting of N, O and S.


In another preferred embodiment, the heterocyclic ring of the heterocycloalkyl has 1-4 (preferably 1, 2, 3 or 4) heteroatoms independently selected from the group consisting of N, O and S.


In another preferred embodiment, the heterocyclic ring of the heteroaryl has 1-4 (preferably 1, 2, 3 or 4) heteroatoms independently selected from the group consisting of N, O and S.


In another preferred embodiment, the heterocyclic ring of the heterocycloalkane ring has 1-4 (preferably 1, 2, 3 or 4) heteroatoms independently selected from the group consisting of N, O and S.


In another preferred embodiment, the heterocycloalkyl has 0, 1, or 2 C═C ring double bonds.


In another preferred embodiment, the heterocycloalkane ring has 0, 1, or 2 C═C ring double bonds.


In another preferred embodiment, each “substituted” means that one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms on the ring or group are independently substituted by substituent selected from the group consisting of C1-C10 alkyl, C2-C6 alkenyl, C3-C12 cycloalkyl, C1-C10 haloalkyl, C3-C8 halocycloalkyl, C3-C8 cycloalkoxyl, C3-C8 cycloalkylthio, C3-C8 halocycloalkoxyl, C3-C8 halocycloalkylthio, halogen, nitro, —CN, carbonyl (═O), hydroxyl, sulfhydryl, amino, C1-C4 carboxyl, C2-C8 ester group, C2-C4 amide group, C2-C6 acyl, C1-C10 alkoxyl, C1-C10 alkylthio, C1-C10 haloalkoxyl, C1-C10 haloalkylthio, C6-C12 aryl, C6-C12 aryl-O—, 5-10 membered heteroaryl, 5-10 membered heteroaryl-O—, 5-10 membered heterocycloalkyl, (R20R21)N—.


In another preferred embodiment, each “substituted” means that one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms on the ring or group are independently substituted by substituent selected from the group consisting of C1-C8 alkyl, C2-C6 alkenyl, C3-C12 cycloalkyl, C1-C8 haloalkyl, C3-C8 halocycloalkyl, C3-C8 cycloalkoxyl, C3-C8 cycloalkylthio, C3-C8 halocycloalkoxyl, C3-C8 halocycloalkylthio, halogen, nitro, —CN, carbonyl (═O), hydroxyl, sulfhydryl, amino, C1-C4 carboxyl, C2-C8 ester group, C2-C4 amide group, C2-C4 acyl, C1-C8 alkoxyl, C1-C8 alkylthio, C1-C8 haloalkoxyl, C1-C8 haloalkylthio, C6-C12 aryl, C6-C12 aryl-O—, 5-10 membered heteroaryl, 5-10 membered heteroaryl-O—, 5-10 membered heterocycloalkyl, (R20R21)N—.


In another preferred embodiment, each “substituted” means that one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms on the ring or group are independently substituted by substituent selected from the group consisting of C1-C6 alkyl, C2-C4 alkenyl, C3-C10 cycloalkyl, C1-C6 haloalkyl, C3-C8 halocycloalkyl, C3-C8 cycloalkoxyl, C3-C8 cycloalkylthio, C3-C8 halocycloalkoxyl, C3-C8 halocycloalkylthio, halogen, nitro, —CN, carbonyl (═O), hydroxyl, sulfhydryl, amino, C1-C4 carboxyl, C2-C6 ester group, C2-C4 amide group, C2-C4 acyl, C1-C6 alkoxyl, C1-C6 alkylthio, C1-C6 haloalkoxyl, C1-C6 haloalkylthio, C6-C12 aryl, C6-C12 aryl-O—, 5-10 membered heteroaryl, 5-10 membered heteroaryl-O—, 5-10 membered heterocycloalkyl, (R20R21)N—.


In another preferred embodiment, each “substituted” means that one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms on the ring or group are independently substituted by substituent selected from the group consisting of C1-C4 alkyl, C2-C4 alkenyl, C3-C10 cycloalkyl, C1-C4 haloalkyl, C3-C8 halocycloalkyl, C3-C8 cycloalkoxyl, C3-C8 cycloalkylthio, C3-C8 halocycloalkoxyl, C3-C8 halocycloalkylthio, halogen, nitro, —CN, carbonyl (═O), hydroxyl, sulfhydryl, amino, C1-C4 carboxyl, C2-C4 ester group, C2-C4 amide group, C2-C4 acyl, C1-C4 alkoxyl, C1-C4 alkylthio, C1-C4 haloalkoxyl, C1-C4 haloalkylthio, C6-C12 aryl, C6-C12 aryl-O—, 5-10 membered heteroaryl, 5-10 membered heteroaryl-O—, 5-10 membered heterocycloalkyl, (R20R21)N—.


In another preferred embodiment, each “substituted” means that one or more (preferably 1, 2, 3, 4, 5, 6, 7 or 8) hydrogen atoms on the ring or group are each independently substituted by a substituent.


In another preferred embodiment, R1 and R2 are each independently hydrogen, deuterium, halogen, substituted or unsubstituted C1-C12 alkyl, substituted or unsubstituted C3-C12 cycloalkyl, substituted or unsubstituted 3-12 membered heterocycloalkyl, substituted or unsubstituted C1-C12 haloalkyl, substituted or unsubstituted C3-C12 halocycloalkyl, substituted or unsubstituted C6-C12 aryl, substituted or unsubstituted 5-12 membered heteroaryl.


In another preferred embodiment, R1 and R2 are each independently hydrogen, deuterium, halogen, substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C3-C10 cycloalkyl, substituted or unsubstituted 3-10 membered heterocycloalkyl, substituted or unsubstituted C1-C10 haloalkyl, substituted or unsubstituted C3-C10 halocycloalkyl, substituted or unsubstituted C6-C10 aryl, substituted or unsubstituted 5-10 membered heteroaryl.


In another preferred embodiment, R1 and R2 are each independently hydrogen, deuterium, halogen, substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C3-C8 cycloalkyl, substituted or unsubstituted 3-10 membered heterocycloalkyl, substituted or unsubstituted C1-C6 haloalkyl, substituted or unsubstituted C3-C10 halocycloalkyl, substituted or unsubstituted C6-C10 aryl, substituted or unsubstituted 5-8 membered heteroaryl.


In another preferred embodiment, R1 and R2 are each independently hydrogen, deuterium, halogen, substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C3-C8 cycloalkyl, substituted or unsubstituted 3-10 membered heterocycloalkyl, substituted or unsubstituted C1-C4 haloalkyl, substituted or unsubstituted C3-C10 halocycloalkyl, substituted or unsubstituted C6-C10 aryl, substituted or unsubstituted 5-8 membered heteroaryl.


In another preferred embodiment, R1 and R2 are each independently hydrogen, deuterium, halogen, substituted or unsubstituted C1-C8 alkyl, substituted or unsubstituted C3-C8 cycloalkyl, substituted or unsubstituted 3-8 membered heterocycloalkyl, substituted or unsubstituted C1-C8 haloalkyl, substituted or unsubstituted C3-C8 halocycloalkyl, substituted or unsubstituted C6-C8 aryl, substituted or unsubstituted 5-8 membered heteroaryl.


In another preferred embodiment, R1 and R2 are each independently hydrogen, deuterium, halogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C3-C8 cycloalkyl, substituted or unsubstituted 3-8 membered heterocycloalkyl, substituted or unsubstituted C1-C6 haloalkyl, substituted or unsubstituted C3-C8 halocycloalkyl, substituted or unsubstituted C6-C8 aryl, substituted or unsubstituted 5-8 membered heteroaryl.


In another preferred embodiment, R1 and R2 are each independently hydrogen, deuterium, halogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C3-C8 cycloalkyl, substituted or unsubstituted 3-8 membered heterocycloalkyl, substituted or unsubstituted C1-C4 haloalkyl, substituted or unsubstituted C3-C8 halocycloalkyl, substituted or unsubstituted C6-C8 aryl, substituted or unsubstituted 5-8 membered heteroaryl.


In another preferred embodiment, R1 and R2 are each independently hydrogen, deuterium, halogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C3-C8 cycloalkyl, substituted or unsubstituted 3-8 membered heterocycloalkyl, substituted or unsubstituted C1-C2 haloalkyl, substituted or unsubstituted C3-C8 halocycloalkyl, substituted or unsubstituted C6-C8 aryl, substituted or unsubstituted 5-8 membered heteroaryl.


In another preferred embodiment, R1 and R2 are each independently hydrogen, deuterium, halogen, substituted or unsubstituted methyl, substituted or unsubstituted ethyl, substituted or unsubstituted propyl, substituted or unsubstituted butyl, substituted or unsubstituted pentyl, substituted or unsubstituted hexyl, substituted or unsubstituted heptyl, substituted or unsubstituted octyl, substituted or unsubstituted cyclopropyl, substituted or unsubstituted cyclobutyl, substituted or unsubstituted cyclopentyl, substituted or unsubstituted cyclohexyl, substituted or unsubstituted cycloheptyl, substituted or unsubstituted cyclooctyl, substituted or unsubstituted halomethyl, substituted or unsubstituted haloethyl, substituted or unsubstituted halopropyl, substituted or unsubstituted halobutyl substituted or unsubstituted halopentyl, substituted or unsubstituted halohexyl, substituted or unsubstituted phenyl, acetyl-methyl-, substituted or unsubstituted pyridinyl, substituted or unsubstituted pyrrolyl, cyclohexanone group.


In another preferred embodiment, R1 and R2 are each independently hydrogen, deuterium, halogen, methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, halomethyl, haloethyl, halopropyl, halobutyl halopentyl, halohexyl, phenyl, acetyl-methyl-, pyridinyl, pyrrolyl, cyclohexanone group.


In another preferred embodiment, the pyridinyl is




embedded image


In another preferred embodiment, the acetyl-methyl- is




embedded image


In another preferred embodiment, the pyrrolyl is




embedded image


In another preferred embodiment, the cyclohexanone group is




embedded image


In another preferred embodiment, R1 and R2 are hydrogen or deuterium.


In another preferred embodiment, at least one of R1 and R2 is not hydrogen or deuterium.


In another preferred embodiment, R1 is hydrogen or deuterium, and R2 is not hydrogen or deuterium.


In another preferred embodiment, R1 is not hydrogen or deuterium, and R2 is hydrogen or deuterium.


In another preferred embodiment, both R1 and R2 are not hydrogen or deuterium.


In another preferred embodiment, R1 is not hydrogen or deuterium.


In another preferred embodiment, R2 is not hydrogen or deuterium.


In another preferred embodiment, R1 and R2 are the same or different functional groups.


In another preferred embodiment, the halogen is fluorine, chlorine, bromine or iodine.


In another preferred embodiment, the halo is mono-halo, di-halo, tri-halo or full-halo.


In another preferred embodiment, halo is fluoro, chloro, bromo, iodo.


In another preferred embodiment, the halomethyl is trichloromethyl.


In another preferred embodiment, the deuterated is mono-deuterated, di-deuterated, tri-deuterated or fully-deuterated.


In another preferred embodiment, R1 and R2 are each independently hydrogen, deuterium, trichloromethyl, methyl, cyclobutyl, cyclopentyl, butyl, hexyl, phenyl.


In another preferred embodiment, the propyl is n-propyl.


In another preferred embodiment, the propyl is




embedded image


In another preferred embodiment, the butyl is n-butyl.


In another preferred embodiment, the butyl is




embedded image


In another preferred embodiment, the pentyl is n-pentyl.


In another preferred embodiment, the pentyl is




embedded image


In another preferred embodiment, the hexyl is n-hexyl.


In another preferred embodiment, the hexyl is




embedded image


In another preferred embodiment, the cyclobutyl is




embedded image


In another preferred embodiment, the cyclohexyl is




embedded image


In another preferred embodiment, R3, R4 and R5 are each independently hydrogen, halogen, R17—O—, R17—S—, (R18R19)N—; or R3 and R4, or R4 and R5 are connected to form a substituted or unsubstituted 3-10 membered heterocycloalkane ring.


In another preferred embodiment, R3, R4 and R5 are each independently hydrogen, halogen, R17—O—, R17—S—, (R18R19)N—; or R3 and R4, or R4 and R5 are connected to form a substituted or unsubstituted 3-8 membered heterocycloalkane ring.


In another preferred embodiment, R3, R4 and R5 are each independently hydrogen, halogen, R17—O—, R17—S—, (R18R19)N—; or R3 and R4, or R4 and R5 are connected to form a substituted or unsubstituted 3 membered heterocycloalkane ring, substituted or unsubstituted 4 membered heterocycloalkane ring, substituted or unsubstituted 5 membered heterocycloalkane ring, substituted or unsubstituted 6 membered heterocycloalkane ring, substituted or unsubstituted 7 membered heterocycloalkane ring, substituted or unsubstituted 8 membered heterocycloalkane ring, substituted or unsubstituted 9 membered heterocycloalkane ring, substituted or unsubstituted 10 membered heterocycloalkane ring.


In another preferred embodiment, R3, R4 and R5 are each independently hydrogen, halogen (e.g, Cl, Br), R17—O—, R17—S—, (R18R19)N—; or R3 and R4, or R4 and R5 are connected to form a substituted or unsubstituted 5 membered heterocycloalkane ring.


In another preferred embodiment, R3, R4 and R5 are each independently hydrogen, halogen (e.g, Cl, Br), R17—O—, R17—S—, (R18R19)N—; or R3 and R4, or R4 and R5 are connected to form a substituted or unsubstituted dioxolene ring.


In another preferred embodiment, R3, R4 and R5 are each independently hydrogen, halogen (e.g, Cl, Br), R17—O—, R17—S—, (R18R19)N—; or R3 and R4, or R4 and R5 are connected to form




embedded image




    • W1 and W2 are each independently O or S;

    • R41 is hydrogen, substituted or unsubstituted C1-C8 alkyl.





In another preferred embodiment, W1 is O or S.


In another preferred embodiment, W2 is O or S.


In another preferred embodiment, R3 is hydrogen.


In another preferred embodiment, R5 is hydrogen.


In another preferred embodiment, R3 and R4 are connected to form W2




embedded image


In another preferred embodiment, R4 and R5 are connected to form




embedded image


In another preferred embodiment, R6, R8, R11, R12, R13, R14 and R15 are each independently hydrogen, substituted or unsubstituted C1-C8 alkyl, halogen (e.g, Br).


In another preferred embodiment, R6, R8, R11, R12, R13, R14 and R15 are each independently hydrogen, substituted or unsubstituted C1-C6 alkyl, halogen (e.g, Br).


In another preferred embodiment, R6, R8, R11, R12, R13, R14 and R15 are each independently hydrogen, substituted or unsubstituted C1-C4 alkyl, halogen (e.g, Br).


In another preferred embodiment, R6, R8, R11, R12, R13, R14 and R15 are each independently hydroge, halogen (e.g, Br).


In another preferred embodiment, R7 is hydrogen, substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C1-C10 haloalkyl, substituted or unsubstituted C6-C16 aryl-substituted or unsubstituted C1-C12 alkyl-, substituted or unsubstituted 5-16 membered heteroaryl-substituted or unsubstituted C1-C12 alkyl-.


In another preferred embodiment, R7 is hydrogen, substituted or unsubstituted C1-C8 alkyl, substituted or unsubstituted C1-C8 haloalkyl, substituted or unsubstituted C6-C16 aryl-substituted or unsubstituted C1-C12 alkyl-, substituted or unsubstituted 5-16 membered heteroaryl-substituted or unsubstituted C1-C12 alkyl-.


In another preferred embodiment, R7 is hydrogen, substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C1-C10 haloalkyl, substituted or unsubstituted C6-C12 aryl-substituted or unsubstituted C1-C10 alkyl-, substituted or unsubstituted 5-12 membered heteroaryl-substituted or unsubstituted C1-C10 alkyl-.


In another preferred embodiment, R7 is hydrogen, substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C1-C10 haloalkyl, substituted or unsubstituted C6-C10 aryl-substituted or unsubstituted C1-C8 alkyl-, substituted or unsubstituted 5-10 membered heteroaryl-substituted or unsubstituted C1-C10 alkyl-.


In another preferred embodiment, R7 is hydrogen, substituted or unsubstituted C1-C8 alkyl, substituted or unsubstituted C1-C8 haloalkyl, substituted or unsubstituted C6-C12 aryl-substituted or unsubstituted C1-C10 alkyl-, substituted or unsubstituted 5-12 membered heteroaryl-substituted or unsubstituted C1-C12 alkyl-.


In another preferred embodiment, R7 is hydrogen, substituted or unsubstituted C1-C8 alkyl, substituted or unsubstituted C1-C8 haloalkyl, substituted or unsubstituted C6-C12 aryl-substituted or unsubstituted C1-C10 alkyl-, substituted or unsubstituted 5-12 membered heteroaryl-substituted or unsubstituted C1-C10 alkyl-.


In another preferred embodiment, R7 is hydrogen, substituted or unsubstituted C1-C8 alkyl, substituted or unsubstituted C1-C8 haloalkyl, substituted or unsubstituted C6-C12 aryl-substituted or unsubstituted C1-C8 alkyl-, substituted or unsubstituted 5-12 membered heteroaryl-substituted or unsubstituted C1-C8 alkyl-.


In another preferred embodiment, R7 is hydrogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C1-C8 haloalkyl, substituted or unsubstituted C6-C12 aryl-substituted or unsubstituted C1-C6 alkyl-, substituted or unsubstituted 5-10 membered heteroaryl-substituted or unsubstituted C1-C6 alkyl-.


In another preferred embodiment, R7 is hydrogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C1-C8 haloalkyl, substituted or unsubstituted C6-C8 aryl-substituted or unsubstituted C1-C5 alkyl-, substituted or unsubstituted 5-8 membered heteroaryl-substituted or unsubstituted C1-C5 alkyl-.


In another preferred embodiment, R7 is hydrogen, substituted or unsubstituted C1-C8 alkyl, substituted or unsubstituted C1-C8 haloalkyl, substituted or unsubstituted 5-8 membered heteroaryl-substituted or unsubstituted C1-C4 alkyl-,




embedded image




    • Z1 and Z2 are each independently substituted or unsubstituted C1-C8 alkylidene;

    • R22, R23, R24, R25, R26, R27, R28, R29 and R30 are each independently hydrogen, C1-C8 alkyl, C3-C12 cycloalkyl, C1-C8 haloalkyl, C3-C8 halocycloalkyl, C3-C8 cycloalkoxyl, C3-C8 cycloalkylthio, C3-C8 halocycloalkoxyl, C3-C8 halocycloalkylthio, halogen, nitro, —CN, hydroxyl, sulfhydryl, amino, C1-C4 carboxyl, C2-C6 ester group, C2-C4 amide group, C1-C8 alkoxyl, C1-C8 alkylthio, C1-C8 haloalkoxyl, C1-C8 haloalkylthio, C6-C12 aryl, C6-C12 aryl-O—, 5-10 membered heteroaryl, 5-10 membered heteroaryl-O—, 5-10 membered heterocycloalkyl.





In another preferred embodiment, R7 is hydrogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C1-C8 haloalkyl, pyridinyl-methyl-,




embedded image


In another preferred embodiment, R7 is hydrogen, substituted or unsubstituted methyl, substituted or unsubstituted ethyl, substituted or unsubstituted propyl, substituted or unsubstituted butyl, substituted or unsubstituted pentyl, substituted or unsubstituted hexyl, substituted or unsubstituted heptyl, substituted or unsubstituted octyl, halohexyl, pyridinyl-methyl-,




embedded image


In another preferred embodiment, R7 is hydrogen, methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, halohexyl, pyridinyl-methyl-,




embedded image


In another preferred embodiment, the pentyl is n-pentyl.


In another preferred embodiment, the pentyl is




embedded image


In another preferred embodiment, the octyl is




embedded image


In another preferred embodiment, the halohexyl is monohalohexyl.


In another preferred embodiment, the halohexyl is C1 or




embedded image


In another preferred embodiment, R9 and R10 are connected to form a substituted or unsubstituted 3-10 membered heterocycloalkane ring.


In another preferred embodiment, R9 and R10 are connected to form a substituted or unsubstituted 3-8 membered heterocycloalkane ring.


In another preferred embodiment, R9 and R10 are connected to form a substituted or unsubstituted 5-8 membered heterocycloalkane ring.


In another preferred embodiment, R9 and R10 are connected to form a substituted or unsubstituted 5-7 membered heterocycloalkane ring.


In another preferred embodiment, R9 and R10 are connected to form a substituted or unsubstituted 3 membered heterocycloalkane ring, substituted or unsubstituted 4 membered heterocycloalkane ring, substituted or unsubstituted 5 membered heterocycloalkane ring, substituted or unsubstituted 6 membered heterocycloalkane ring, substituted or unsubstituted 7 membered heterocycloalkane ring, substituted or unsubstituted 8 membered heterocycloalkane ring, substituted or unsubstituted 9 membered heterocycloalkane ring, substituted or unsubstituted 10 membered heterocycloalkane ring, substituted or unsubstituted 11 membered heterocycloalkane ring, substituted or unsubstituted 12 membered heterocycloalkane ring.


In another preferred embodiment, R9 and R10 are connected to form a substituted or unsubstituted




embedded image


substituted or unsubstituted




embedded image




    • W3, W4, W5 and W6 are each independently O or S;

    • R31, R32, R33, R34 and R35 are each independently hydrogen, C1-C8 alkyl, C3-C12 cycloalkyl, C1-C8 haloalkyl, C3-C8 halocycloalkyl, C3-C8 cycloalkoxyl, C3-C8 cycloalkylthio, C3-C8 halocycloalkoxyl, C3-C8 halocycloalkylthio, halogen, nitro, —CN, hydroxyl, sulfhydryl, amino, C1-C4 carboxyl, C2-C4 ester group, C2-C4 amide group, C1-C8 alkoxyl, C1-C8 alkylthio, C1-C8 haloalkoxyl, C1-C8 haloalkylthio, C6-C12 aryl, C6-C12 aryl-O—, 5-10 membered heteroaryl, 5-10 membered heteroaryl-O—, 5-10 membered heterocycloalkyl.





In another preferred embodiment, R9 and R10 are connected to form




embedded image


In another preferred embodiment, W3 is O or S.


In another preferred embodiment, W4 is O or S.


In another preferred embodiment, W5 is O or S.


In another preferred embodiment, W6 is O or S.


In another preferred embodiment, the propyl-phenyl-methy- is




embedded image


In another preferred embodiment, R17 is hydrogen, substituted or unsubstituted C1-C12 alkyl,




embedded image


substituted or unsubstituted C3-C14 cycloalkyl, substituted or unsubstituted 3-10 membered heterocycloalkyl, substituted or unsubstituted C3-C14 cycloalkyl-substituted or unsubstituted C2-C8 acyl-, substituted or unsubstituted C3-C14 cycloalkyl-C(O)—, substituted or unsubstituted C1-C12 haloalkyl, substituted or unsubstituted C3-C12 halocycloalkyl, substituted or unsubstituted 3-10 membered heterocycloalkyl-substituted or unsubstituted C1-C10 alkyl-, substituted or unsubstituted C6-C12 aryl-substituted or unsubstituted C1-C10 alkyl-, substituted or unsubstituted C6-C12 aryl-substituted or unsubstituted C6-C12 aryl-substituted or unsubstituted C1-C10 alkyl-, substituted or unsubstituted 5-12 membered heteroaryl-substituted or unsubstituted C1-C10 alkyl-, substituted or unsubstituted C6-C12 aryl-O-substituted or unsubstituted C1-C10 alkyl-, substituted or unsubstituted C6-C12 aryl-S-substituted or unsubstituted C1-C10 alkyl-, substituted or unsubstituted 5-12 membered heteroaryl-O-substituted or unsubstituted C1-C10 alkyl-, substituted or unsubstituted 5-12 membered heteroaryl-S-substituted or unsubstituted C1-C10 alkyl-, substituted or unsubstituted C2-C6 alkenyl-substituted or unsubstituted C1-C6 alkyl-substituted or unsubstituted C2-C6 alkenyl-substituted or unsubstituted C1-C6 alkyl-, substituted or unsubstituted C2-C6 alkenyl-substituted or unsubstituted C1-C6 alkyl-, (R20R21)N-substituted or unsubstituted C1-C10 alkyl-.


In another preferred embodiment, R17 is hydrogen, substituted or unsubstituted C1-C10 alkyl,




embedded image


substituted or unsubstituted C3-C12 cycloalkyl, substituted or unsubstituted 3-10 membered heterocycloalkyl, substituted or unsubstituted C3-C12 cycloalkyl-substituted or unsubstituted C2-C6 acyl-, substituted or unsubstituted C3-C12 cycloalkyl-C(O)—, substituted or unsubstituted C1-C10 haloalkyl, substituted or unsubstituted C3-C10 halocycloalkyl, substituted or unsubstituted 3-10 membered heterocycloalkyl-substituted or unsubstituted C1-C8 alkyl-, substituted or unsubstituted C6-C12 aryl-substituted or unsubstituted C1-C8 alkyl-, substituted or unsubstituted C6-C12 aryl-substituted or unsubstituted C6-C12 aryl-substituted or unsubstituted C1-C8 alkyl-, substituted or unsubstituted 5-12 membered heteroaryl-substituted or unsubstituted C1-C8 alkyl-, substituted or unsubstituted C6-C12 aryl-O-substituted or unsubstituted C1-C8 alkyl-, substituted or unsubstituted C6-C12 aryl-S-substituted or unsubstituted C1-C8 alkyl-, substituted or unsubstituted 5-12 membered heteroaryl-O-substituted or unsubstituted C1-C8 alkyl-, substituted or unsubstituted 5-12 membered heteroaryl-S-substituted or unsubstituted C1-C8 alkyl-, substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C4 alkyl-substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C4 alkyl-, (R20R21)N-substituted or unsubstituted C1-C10 alkyl-.


In another preferred embodiment, R17 is hydrogen, substituted or unsubstituted C1-C8 alkyl,




embedded image


substituted or unsubstituted C3-C10 cycloalkyl, substituted or unsubstituted 3-10 membered heterocycloalkyl, substituted or unsubstituted C3-C12 cycloalkyl-substituted or unsubstituted C2-C4 acyl-, substituted or unsubstituted C3-C12 cycloalkyl-C(O)—, substituted or unsubstituted C1-C8 haloalkyl, substituted or unsubstituted C3-C8 halocycloalkyl, substituted or unsubstituted 3-10 membered heterocycloalkyl-substituted or unsubstituted C1-C6 alkyl-, substituted or unsubstituted C6-C12 aryl-substituted or unsubstituted C1-C6 alkyl-, substituted or unsubstituted C6-C12 aryl-substituted or unsubstituted C6-C12 aryl-substituted or unsubstituted C1-C6 alkyl-, substituted or unsubstituted 5-12 membered heteroaryl-substituted or unsubstituted C1-C6 alkyl-, substituted or unsubstituted C6-C12 aryl-O-substituted or unsubstituted C1-C6 alkyl-, substituted or unsubstituted C6-C12 aryl-S-substituted or unsubstituted C1-C6 alkyl-, substituted or unsubstituted 5-12 membered heteroaryl-O-substituted or unsubstituted C1-C6 alkyl-, substituted or unsubstituted 5-12 membered heteroaryl-S-substituted or unsubstituted C1-C6 alkyl-, substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C4 alkyl-substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C4 alkyl-, (R20R21)N-substituted or unsubstituted C1-C8 alkyl-.


In another preferred embodiment, R17 is hydrogen, substituted or unsubstituted C1-C8 alkyl,




embedded image


substituted or unsubstituted C3-C10 cycloalkyl, substituted or unsubstituted 3-10 membered heterocycloalkyl, substituted or unsubstituted C3-C12 cycloalkyl-substituted or unsubstituted C2-C4 acyl-, substituted or unsubstituted C3-C12 cycloalkyl-C(O)—, substituted or unsubstituted C1-C8 haloalkyl, substituted or unsubstituted C3-C8 halocycloalkyl, substituted or unsubstituted 3-10 membered heterocycloalkyl-substituted or unsubstituted C1-C6 alkyl-, substituted or unsubstituted C6-C10 aryl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C6-C10 aryl-substituted or unsubstituted C6-C10 aryl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted 5-10 membered heteroaryl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C6-C10 aryl-O-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C6-C12 aryl-S-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted 5-10 membered heteroaryl-O-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted 5-10 membered heteroaryl-S-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C4 alkyl-substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C4 alkyl-, (R20R21)N-substituted or unsubstituted C1-C8 alkyl-.


In another preferred embodiment, R17 is hydrogen, substituted or unsubstituted C1-C6 alkyl,




embedded image


substituted or unsubstituted C3-C10 cycloalkyl, substituted or unsubstituted 3-10 membered heterocycloalkyl, substituted or unsubstituted C5-C12 cycloalkyl-substituted or unsubstituted C2-C4 acyl-, substituted or unsubstituted C5-C12 cycloalkyl-C(O)—, substituted or unsubstituted C1-C8 haloalkyl, substituted or unsubstituted C3-C8 halocycloalkyl, substituted or unsubstituted 3-10 membered heterocycloalkyl-substituted or unsubstituted C1-C6 alkyl-, substituted or unsubstituted C6-C10 aryl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C6-C10 aryl-substituted or unsubstituted C6-C10 aryl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted 5-10 membered heteroaryl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C6-C10 aryl-O-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C6-C10 aryl-S-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted 5-10 membered heteroaryl-O-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted 5-10 membered heteroaryl-S-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C4 alkyl-substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C4 alkyl-, (R20R21)N-substituted or unsubstituted C1-C8 alkyl-.


In another preferred embodiment, R17 is hydrogen, substituted or unsubstituted C1-C6 alkyl,




embedded image


substituted or unsubstituted C3-C10 cycloalkyl, substituted or unsubstituted 3-10 membered heterocycloalkyl, substituted or unsubstituted C6-C12 cycloalkyl-substituted or unsubstituted C2 acyl-, substituted or unsubstituted C6-C12 cycloalkyl-C(O)—, substituted or unsubstituted C1-C6 haloalkyl, substituted or unsubstituted C3-C8 halocycloalkyl, substituted or unsubstituted 3-10 membered heterocycloalkyl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C6-C8 aryl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C6-C8 aryl-substituted or unsubstituted C6-C8 aryl-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted 5-8 membered heteroaryl-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C6-C8 aryl-O-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C6-C8 aryl-S-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted 5-8 membered heteroaryl-O-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted 5-8 membered heteroaryl-S-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C4 alkyl-substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C2 alkyl-, (R20R21)N-substituted or unsubstituted C1-C8 alkyl-.


In another preferred embodiment, R17 is hydrogen, substituted or unsubstituted C1-C6 alkyl,




embedded image


substituted or unsubstituted C6-C12 cycloalkyl-substituted or unsubstituted C2-C4 acyl-, substituted or unsubstituted C6-C12 cycloalkyl-C(O)—, substituted or unsubstituted 3-10 membered heterocycloalkyl, substituted or unsubstituted C1-C6 haloalkyl, substituted or unsubstituted 5-7 membered heterocycloalkyl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C6-C10 aryl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C6-C10 aryl-substituted or unsubstituted C6-C10 aryl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted 5-10 membered heteroaryl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C6-C10 aryl-O-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C6-C10 aryl-S-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted 5-10 membered heteroaryl-O-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted 5-10 membered heteroaryl-S-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C2 alkyl-substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C2 alkyl-, (R20R21)N-substituted or unsubstituted C1-C8 alkyl-.


In another preferred embodiment, R17 is hydrogen, substituted or unsubstituted C1-C6 alkyl,




embedded image


substituted or unsubstituted C8-C10 cycloalkyl-substituted or unsubstituted C2 acyl-, substituted or unsubstituted C8-C10 cycloalkyl-C(O)—, substituted or unsubstituted 5-7 membered heterocycloalkyl, substituted or unsubstituted C1-C6 haloalkyl, substituted or unsubstituted 5-7 membered heterocycloalkyl-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C6-C8 aryl-O-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C6-C8 aryl-S-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C6-C8 aryl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C6-C8 aryl-substituted or unsubstituted C6-C8 aryl-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted 5-8 membered heteroaryl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted 5-8 membered heteroaryl-O-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted 5-8 membered heteroaryl-S-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C2 alkyl-substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C2 alkyl-, (R20R21)N-substituted or unsubstituted C1-C8 alkyl-.


In another preferred embodiment, R17 is hydrogen, substituted or unsubstituted C1-C4 alkyl,




embedded image


substituted or unsubstituted C3-C10 cycloalkyl, substituted or unsubstituted 3-10 membered heterocycloalkyl, substituted or unsubstituted C6-C12 cycloalkyl-substituted or unsubstituted C2 acyl-, substituted or unsubstituted C6-C12 cycloalkyl-C(O)—, substituted or unsubstituted C1-C6 haloalkyl, substituted or unsubstituted C3-C8 halocycloalkyl, substituted or unsubstituted 3-10 membered heterocycloalkyl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C6-C8 aryl-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C6-C8 aryl-substituted or unsubstituted C6-C8 aryl-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted 5-8 membered heteroaryl-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C6-C8 aryl-O-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C6-C8 aryl-S-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted 5-8 membered heteroaryl-O-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted 5-8 membered heteroaryl-S-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C4 alkyl-substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C2 alkyl-, (R20R21)N-substituted or unsubstituted C1-C8 alkyl-.


In another preferred embodiment, R17 is hydrogen, substituted or unsubstituted C1-C4 alkyl,




embedded image


substituted or unsubstituted C6-C12 cycloalkyl-substituted or unsubstituted C2-C4 acyl-, substituted or unsubstituted C6-C12 cycloalkyl-C(O)—, substituted or unsubstituted 3-10 membered heterocycloalkyl, substituted or unsubstituted C1-C6 haloalkyl, substituted or unsubstituted 5-7 membered heterocycloalkyl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C6-C10 aryl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C6-C10 aryl-substituted or unsubstituted C6-C10 aryl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted 5-10 membered heteroaryl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C6-C10 aryl-O-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C6-C10 aryl-S-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted 5-10 membered heteroaryl-O-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted 5-10 membered heteroaryl-S-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C2 alkyl-substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C2 alkyl-, (R20R21)N-substituted or unsubstituted C1-C8 alkyl-.


In another preferred embodiment, R17 is hydrogen, substituted or unsubstituted C1-C2 alkyl,




embedded image


substituted or unsubstituted C8-C10 cycloalkyl-substituted or unsubstituted C2 acyl-, substituted or unsubstituted C8-C10 cycloalkyl-C(O)—, substituted or unsubstituted 5-7 membered heterocycloalkyl, substituted or unsubstituted C3-C6 haloalkyl, substituted or unsubstituted 5-7 membered heterocycloalkyl-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C6-C8 aryl-O-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C6-C8 aryl-S-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C6-C8 aryl-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C6-C8 aryl-substituted or unsubstituted C6-C8 aryl-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted 5-8 membered heteroaryl-substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted 5-8 membered heteroaryl-O-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted 5-8 membered heteroaryl-S-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C2 alkyl-substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C2 alkyl-, substituted or unsubstituted C2-C4 alkenyl-substituted or unsubstituted C1-C2 alkyl-, (R20R21)N-substituted or unsubstituted C1-C8 alkyl-.


In another preferred embodiment, R17 is hydrogen, substituted or unsubstituted methyl




embedded image


substituted or unsubstituted ethyl, substituted or unsubstituted propyl, substituted or unsubstituted pentyl, substituted or unsubstituted hexyl, substituted or unsubstituted phenyl-O-substituted or unsubstituted butyl-, haloethyl, halopropyl, halobutyl, halohexyl, substituted or unsubstituted phenyl-substituted or unsubstituted ethyl-, substituted or unsubstituted phenyl-substituted or unsubstituted propyl-, substituted or unsubstituted phenyl-substituted or unsubstituted butyl-, substituted or unsubstituted cyclodecyl-substituted or unsubstituted acetyl-, substituted or unsubstituted butenyl-substituted or unsubstituted ethyl-substituted or unsubstituted propenyl-substituted or unsubstituted methyl-, (R20R21)N-substituted or unsubstituted hexyl-, (R20R21)N-substituted or unsubstituted butyl-, (R20R21)N-substituted or unsubstituted ethyl-, substituted or unsubstituted piperidinyl-substituted or unsubstituted ethyl-, substituted or unsubstituted butyl-substituted or unsubstituted piperazine ring-, substituted or unsubstituted methyl-substituted or unsubstituted piperidinyl-, substituted or unsubstituted phenyl-substituted or unsubstituted phenyl-substituted or unsubstituted methyl-, substituted or unsubstituted ethylenyl-substituted or unsubstituted methyl-, substituted or unsubstituted piperidinyl-substituted or unsubstituted propyl-, substituted or unsubstituted piperidinyl-substituted or unsubstituted ethyl-, dimethylamino-ethyl-.


In another preferred embodiment, R17 is hydrogen, methyl,




embedded image


ethyl, propyl, pentyl, hexyl, phenyl-O-butyl-, haloethyl, halopropyl, halobutyl, halohexyl, phenyl-ethyl-, phenyl-propyl-, phenyl-butyl-, cyclodecyl-acetyl-, butenyl-ethyl-propenyl-methyl-, (R20R21)N-hexyl-, (R20R21)N-butyl-, (R20R21)N-ethyl-, piperidinyl-ethyl-, butyl-piperazinyl-, methyl-piperidinyl-, phenyl-phenyl-methyl-, ethylenyl-methyl-, piperidinyl-propyl-, piperidinyl-ethyl-, dimethylamino-ethyl-.


In another preferred embodiment, the butyl is n-butyl.


In another preferred embodiment, the butyl is




embedded image


In another preferred embodiment, the hexyl is




embedded image


In another preferred embodiment, the pentyl is n-pentyl.


In another preferred embodiment, the pentyl is




embedded image


In another preferred embodiment, the cyclopentyl is




embedded image


In another preferred embodiment, the phenyl-propyl- is




embedded image


In another preferred embodiment, the phenyl-butyl- is




embedded image


In another preferred embodiment, the phenyl-O-butyl- is




embedded image


In another preferred embodiment, haloethyl is monobromoethyl, monochloroethyl or monofluoroethyl.


In another preferred embodiment, the haloethyl is or




embedded image


In another preferred embodiment, the propyl is n-propyl.


In another preferred embodiment, the propyl is




embedded image


In another preferred embodiment, the halopropyl is n-halopropyl.


In another preferred embodiment, the halopropyl is monobromopropyl, monochloropropyl or monofluoropropyl.


In another preferred embodiment, the halopropyl is




embedded image


In another preferred embodiment, the butyl is n-butyl.


In another preferred embodiment, the halobutyl is n-halobutyl.


In another preferred embodiment, the halobutyl is monobromobutyl, monochlorobutyl or monofluorobutyl.


In another preferred embodiment, the halobutyl is




embedded image


In another preferred embodiment, the hexyl is n-hexyl.


In another preferred embodiment, the halohexyl is n-halohexyl.


In another preferred embodiment, the halohexyl is monochlorohexyl or monobromohexyl.


In another preferred embodiment, the halohexyl is




embedded image


In another preferred embodiment, the cyclodecyl-acetyl- is




embedded image


In another preferred embodiment, the butenyl-ethyl-propenyl-methyl- is




embedded image


In another preferred embodiment, the piperidinyl-ethyl- is




embedded image


In another preferred embodiment, the phenyl-phenyl-methyl- is




embedded image


In another preferred embodiment, the ethylenyl-methyl- is




embedded image


In another preferred embodiment, the piperidinyl-propyl- is




embedded image


In another preferred embodiment, the piperidinyl-ethyl- is




embedded image


In another preferred embodiment, the dimethylamino-ethyl- is




embedded image


In another preferred embodiment, R18 and R19 are each independently hydrogen, substituted or unsubstituted C1-C8 alkyl, substituted or unsubstituted C3-C10 cycloalkyl, substituted or unsubstituted C6-C12 aryl-substituted or unsubstituted C1-C10 alkyl-; or R18 and R19 are connected to form a substituted or unsubstituted 3-12 membered heterocycloalkane ring.


In another preferred embodiment, R18 and R19 are each independently hydrogen, substituted or unsubstituted C1-C8 alkyl, substituted or unsubstituted C3-C10 cycloalkyl, substituted or unsubstituted C6-C12 aryl-substituted or unsubstituted C1-C8 alkyl-; or R18 and R19 are connected to form a substituted or unsubstituted 3-12 membered heterocycloalkane ring.


In another preferred embodiment, R18 and R19 are each independently hydrogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C3-C10 cycloalkyl, substituted or unsubstituted C6-C12 aryl-substituted or unsubstituted C1-C6 alkyl-; or R18 and R19 are connected to form a substituted or unsubstituted 3-10 membered heterocycloalkane ring.


In another preferred embodiment, R18 and R19 are each independently hydrogen, substituted or unsubstituted C1-C4 alkyl, substituted or unsubstituted C3-C10 cycloalkyl, substituted or unsubstituted C6-C12 aryl-substituted or unsubstituted C1-C4 alkyl-; or R18 and R19 are connected to form a substituted or unsubstituted 3-8 membered heterocycloalkane ring.


In another preferred embodiment, R18 and R19 are each independently hydrogen, substituted or unsubstituted C1-C4 alkyl, substituted or unsubstituted C3-C10 cycloalkyl, substituted or unsubstituted C6-C10 aryl-substituted or unsubstituted C1-C4 alkyl-; or R18 and R19 are connected to form a substituted or unsubstituted 3-8 membered heterocycloalkane ring.


In another preferred embodiment, R18 and R19 are each independently hydrogen, substituted or unsubstituted C1-C4 alkyl, substituted or unsubstituted C3-C10 cycloalkyl, substituted or unsubstituted C6-C8 aryl-substituted or unsubstituted C1-C4 alkyl-; or R18 and R19 are connected to form a substituted or unsubstituted 5-8 membered heterocycloalkane ring.


In another preferred embodiment, R18 and R19 are each independently hydrogen, substituted or unsubstituted C1-C4 alkyl, substituted or unsubstituted C3-C10 cycloalkyl, substituted or unsubstituted C6-C8 aryl-substituted or unsubstituted C1-C4 alkyl-; or R18 and R19 are connected to form a substituted or unsubstituted 5 membered heterocycloalkane ring, substituted or unsubstituted 6 membered heterocycloalkane ring, substituted or unsubstituted 7 membered heterocycloalkane ring, substituted or unsubstituted 8 membered heterocycloalkane ring.


In another preferred embodiment, R18 and R19 are each independently hydrogen, substituted or unsubstituted phenyl-substituted or unsubstituted ethyl-; or R18 and R19 are connected to form a substituted or unsubstituted piperazine ring, substituted or unsubstituted piperidine ring, or substituted or unsubstituted azacycloheptane ring.


In another preferred embodiment, R18 and R19 are each independently hydrogen, substituted or unsubstituted C1-C4 alkyl, substituted or unsubstituted C3-C10 cycloalkyl, substituted or unsubstituted C6-C8 aryl-substituted or unsubstituted C1-C4 alkyl-; or R18 and R19 are connected to form a substituted or unsubstituted piperazine ring, substituted or unsubstituted piperidine ring, or substituted or unsubstituted azacycloheptane ring.


In another preferred embodiment, R18 and R19 are each independently hydrogen, substituted or unsubstituted phenyl-substituted or unsubstituted ethyl-; or R18 and R19 are connected to form a substituted or unsubstituted methyl-substituted or unsubstituted piperazine ring, substituted or unsubstituted butyl-substituted or unsubstituted piperazine ring, substituted or unsubstituted methyl-substituted or unsubstituted piperidine ring, trifluoromethyl-piperidine ring, halopiperidine ring, or substituted or unsubstituted azacycloheptane ring.


In another preferred embodiment, R18 and R19 are each independently hydrogen, phenyl-ethyl-; or R18 and R19 are connected to form a methyl-piperazine ring, butyl-piperazine ring, trifluoromethyl-piperazine ring, trifluoromethoxyl-piperazine ring, halopiperazine ring, methyl-piperidine ring, trifluoromethyl-piperidine ring, trifluoromethoxyl-piperidine ring, halopiperidine ring, azacycloheptane ring, (R20R21)N-piperidine ring.


In another preferred embodiment, R3 is hydrogen, hydroxyl, sulfhydryl, amino, methyl-O—,




embedded image


ethyl-O—, propyl-O—, pentyl-O—, hexyl-O—, phenyl-O-butyl-O—O—, haloethyl-O—, halopropyl-O—, halobutyl-O—, halohexyl-O—, phenyl-ethyl-O—, phenyl-propyl-O—, phenyl-butyl-O—, cyclodecyl-acetyl-O—, butenyl-ethyl-propenyl-methyl-O—, (R20R21)N-hexyl-O—, (R20R21)N-butyl-O—, (R20R21)N-ethyl-O—, piperidinyl-ethyl-O—, butyl-piperazinyl-O—, methyl-piperidinyl-O—, phenyl-phenyl-methyl-O—, ethylenyl-methyl-O—, piperidinyl-propyl-O—, piperidinyl-ethyl-O—, dimethylamino-ethyl-O—, phenyl-ethyl-NH—, butyl-piperazinyl-, methyl-piperazinyl-, trifluoromethyl-piperazinyl-, trifluoromethoxyl-piperazinyl-, halopiperazinyl, methyl-piperidinyl-, trifluoromethyl-piperidinyl-, trifluoromethoxyl-piperidinyl-, halopiperidinyl, azacycloheptane group, (R20R21)N-piperazinyl-.


In another preferred embodiment, the phenyl-ethyl- is




embedded image


In another preferred embodiment, the methyl-piperazine ring is




embedded image


In another preferred embodiment, the methyl-piperazinyl- is




embedded image


In another preferred embodiment, the butyl-piperazine ring is




embedded image


In another preferred embodiment, the butyl-piperazinyl- is




embedded image


In another preferred embodiment, the trifluoromethyl-piperidine ring is




embedded image


In another preferred embodiment, the trifluoromethyl-piperazinyl- is




embedded image


In another preferred embodiment, the trifluoromethoxyl-piperazine ring is




embedded image


In another preferred embodiment, the trifluoromethoxyl-piperazinyl- is




embedded image


In another preferred embodiment, the halopiperazine ring is chloropiperazine ring.


In another preferred embodiment, the halopiperazine ring is




embedded image


In another preferred embodiment, the halopiperazinyl is chloropiperazinyl.


In another preferred embodiment, the halopiperazinyl is




embedded image


In another preferred embodiment, the methyl-piperidiny-1 is




embedded image


In another preferred embodiment, the methyl-piperidine ring is




embedded image


In another preferred embodiment, the trifluoromethyl-piperidiny- is




embedded image


In another preferred embodiment, the trifluoromethoxyl-piperidine ring is




embedded image


In another preferred embodiment, the trifluoromethoxyl-piperidinyl- is




embedded image


In another preferred embodiment, the trifluoromethyl-piperidine ring is




embedded image


In another preferred embodiment, the halopiperidine ring is chloropiperidine ring.


In another preferred embodiment, the halopiperidine ring is




embedded image


In another preferred embodiment, the halopiperidinyl is chloropiperidinyl.


In another preferred embodiment, the halopiperidinyl is




embedded image


In another preferred embodiment, the azacycloheptane ring is




embedded image


In another preferred embodiment, the azacycloheptane group is




embedded image


In another preferred embodiment, the (R20R21)N— piperazinyl- is




embedded image


In another preferred embodiment, the (R20R21)N-piperidine ring is




embedded image


In another preferred embodiment, R18 and R19 are each independently hydrogen, substituted or unsubstituted C1-C4 alkyl, substituted or unsubstituted C3-C10 cycloalkyl, substituted or unsubstituted C6-C8 aryl-substituted or unsubstituted C1-C4 alkyl-; or R18 and R19 are connected to form




embedded image




    • wherein, R42, R43, R44, R45, R46, R47, R48, R49, R50 and R51 are each independently hydrogen, C1-C10 alkyl, C1-C10 haloalkyl, C1-C10 haloalkoxyl, C1-C10 haloalkylthio, halogen;

    • R52, R53, R54, R55, R56, R57, R58, R59 and R60 are each independently hydrogen, C1-C10 alkyl, C1-C10 haloalkyl, C1-C10 haloalkoxyl, C1-C10 haloalkylthio, halogen.





In another preferred embodiment, (R20R21)N— is




embedded image




    • R42, R43, R44, R45, R46, R47, R48, R49, R50 and R51 are each independently hydrogen, C1-C10 alkyl, C1-C10 haloalkyl, C1-C10 haloalkoxyl, C1-C10 haloalkylthio, halogen;

    • R52, R53, R54, R55, R56, R57, R58, R59 and R60 are each independently hydrogen, C1-C10 alkyl, C1-C10 haloalkyl, C1-C10 haloalkoxyl, C1-C10 haloalkylthio, halogen.





In another preferred embodiment, R20 and R21 are each independently hydrogen, substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C3-C10 cycloalkyl, substituted or unsubstituted C2-C8 ester group; or R20 and R21 are connected to form a substituted or unsubstituted 3-10 membered heterocycloalkyl.


In another preferred embodiment, R20 and R21 are each independently hydrogen, substituted or unsubstituted C1-C8 alkyl, substituted or unsubstituted C3-C8 cycloalkyl, substituted or unsubstituted C2-C8 ester group; or R20 and R21 are connected to form a substituted or unsubstituted 3-8 membered heterocycloalkyl.


In another preferred embodiment, R20 and R21 are each independently hydrogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C3-C8 cycloalkyl, substituted or unsubstituted C3-C7 ester group; or R20 and R21 are connected to form a substituted or unsubstituted 5-8 membered heterocycloalkyl.


In another preferred embodiment, R20 and R21 are each independently hydrogen, substituted or unsubstituted amyl ester group; or R20 and R21 are connected to form a substituted or unsubstituted piperidine ring.


In another preferred embodiment, R20 and R21 are each independently hydrogen, amyl ester group; or R20 and R21 are connected to form piperidine ring.


In another preferred embodiment, amyl ester group is




embedded image


In another preferred embodiment, (R20R21)N-hexyl- is




embedded image


In another preferred embodiment, (R20R21)N-butyl- is




embedded image


In another preferred embodiment, (R20R21)N-ethyl- is




embedded image


In another preferred embodiment, R22, R23, R24, R25, R26, R27, R28, R29 and R30 are each independently hydrogen, C1-C6 alkyl, C3-C8 cycloalkyl, C1-C6 haloalkyl, C3-C8 halocycloalkyl, C3-C8 cycloalkoxyl, C3-C8 cycloalkylthio, C3-C8 halocycloalkoxyl, C3-C8 halocycloalkylthio, halogen, nitro, —CN, hydroxyl, sulfhydryl, amino, C1-C4 carboxyl, C2-C6 ester group, C2-C4 amide group, C1-C6 alkoxyl, C1-C6 alkylthio, C1-C6 haloalkoxyl, C1-C6 haloalkylthio, C6-C12 aryl, C6-C12 aryl-O—, 5-10 membered heteroaryl, 5-10 membered heteroaryl-O—, 5-10 membered heterocycloalkyl.


In another preferred embodiment, R22, R23, R24, R25, R26, R27, R28, R29 and R30 are each independently hydrogen, C1-C6 alkyl, C1-C6 alkoxyl, C1-C6 alkylthio.


In another preferred embodiment, R22, R23, R24, R25, R26, R27, R28, R29 and R30 are each independently hydrogen, C1-C4 alkyl, C1-C4 alkoxyl, C1-C4 alkylthio.


In another preferred embodiment, R22, R23, R24, R25, R26, R27, R28, R29 and R30 are each independently hydrogen, C1-C3 alkyl, C1-C2 alkoxyl, C1-C2 alkylthio.


In another preferred embodiment, R22, R23, R24, R25, R26, R27, R28, R29 and R30 are each independently hydrogen, trifluoromethoxyl, propyl.


In another preferred embodiment, propyl is isopropyl.


In another preferred embodiment, Z1 and Z2 are each independently substituted or unsubstituted C1-C6 alkylidene.


In another preferred embodiment, Z1 and Z2 are each independently substituted or unsubstituted C1-C4 alkylidene.


In another preferred embodiment, Z1 and Z2 are each independently substituted or unsubstituted methylidene, substituted or unsubstituted ethylidene, substituted or unsubstituted propylidene, substituted or unsubstituted butylidene, substituted or unsubstituted pentylidene, substituted or unsubstituted hexylidene.


In another preferred embodiment, Z1 and Z2 are each independently methylidene, ethylidene, propylidene, butylidene, pentylidene, hexylidene.


In another preferred embodiment, ethylidene is P




embedded image


In another preferred embodiment, propyl is




embedded image


In another preferred embodiment, propylidene is n-propylidene.


In another preferred embodiment, propylidene is




embedded image


In another preferred embodiment, butylidene is




embedded image


In another preferred embodiment, R31, R32, R33, R34 and R35 are each independently hydrogen, C1-C6 alkyl.


In another preferred embodiment, R31, R32, R33, R34 and R35 are each independently hydrogen, C1-C4 alkyl.


In another preferred embodiment, R41 is hydrogen, substituted or unsubstituted C1-C6 alkyl.


In another preferred embodiment, R41 is hydrogen, substituted or unsubstituted C1-C4 alkyl.


In another preferred embodiment, R42, R43, R44, R45, R46, R47, R48, R49, R50 and R51 are each independently hydrogen, C1-C8 alkyl, C1-C8 haloalkyl, C1-C8 haloalkoxyl, C1-C8 haloalkylthio, halogen


In another preferred embodiment, R42, R43, R44, R45, R46, R47, R48, R49, R50 and R51 are each independently hydrogen, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 haloalkoxyl, C1-C6 haloalkylthio, halogen.


In another preferred embodiment, R42, R43, R44, R45, R46, R47, R48, R49, R50 and R51 are each independently hydrogen, C1-C4 alkyl, C1-C4 haloalkyl, C1-C4 haloalkoxyl, C1-C4 haloalkylthio, halogen.


In another preferred embodiment, R42, R43, R44, R45, R46, R47, R48, R49, R50 and R51 are each independently hydrogen, methyl, butyl, trifluoromethyl, trifluoromethoxyl, halogen (e.g., chlorine).


In another preferred embodiment, R52, R53, R54, R55, R56, R57, R58, R59 and R60 are each independently hydrogen, C1-C8 alkyl, C1-C8 haloalkyl, C1-C8 haloalkoxyl, C1-C8 haloalkylthio, halogen


In another preferred embodiment, R52, R53, R54, R55, R56, R57, R58, R59 and R60 are each independently hydrogen, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 haloalkoxyl, C1-C6 haloalkylthio, halogen.


In another preferred embodiment, R52, R53, R54, R55, R56, R57, R58, R59 and R60 are each independently hydrogen, C1-C4 alkyl, C1-C4 haloalkyl, C1-C4 haloalkoxyl, C1-C4 haloalkylthio, halogen.


In another preferred embodiment, R52, R53, R54, R55, R56, R57, R58, R59 and R60 are each independently hydrogen, methyl, butyl, trifluoromethyl, trifluoromethoxyl, halogen (e.g., chlorine).


In another preferred embodiment, halogen is F. Cl, Br or I.


In another preferred embodiment, halo is fluoro, chloro, bromo and/or iodo.


In another preferred embodiment, the halon is mono-halo, di-halo or tri-halo.


In another preferred embodiment, the aryl is phenyl.


In another preferred embodiment, the compound of formula I has no optical activity or has optical activity.


In another preferred embodiment, the compound of formula I has no chiral carbon atom or has chiral carbon atom.


In another preferred embodiment, the compound of formula I has one chiral carbon atom.


In another preferred embodiment, the configuration of the compound of formula I is racemate, R configuration (rectus), or S configuration (sinister).


In another preferred embodiment, the compound of formula I has the following structure of formula I-1:




embedded image




    • wherein,

    • R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14 and R15 are each independently defined as described above.





In another preferred embodiment, “*” represents the configuration of the compound.


In another preferred embodiment, “*” means that the configuration of the compound is racemate, R configuration (rectus), or S configuration (sinister).


In another preferred embodiment, “*” represents a chiral carbon atom.


In another preferred embodiment, the configuration of chiral carbon atom is R configuration (rectus), S configuration (sinister) or racemate.


In another preferred embodiment, the configuration of chiral carbon atom is R configuration (rectus) and/or S configuration.


In another preferred embodiment, the R configuration (rectus) and S configuration of chiral carbon atom refers to racemate.


In another preferred embodiment, the compound of formula I has the following structure of formula I-2:




embedded image




    • wherein,

    • R1, R2, R3, R4, R5, R6, R7, R8, R11, R12, R13, R14, R15, R31, W3 and W4 are each independently defined as described above.





In another preferred embodiment, the compound of formula I has the following structure of formula I-3:




embedded image




    • wherein,

    • R1, R2, R3, R4, R5, R6, R7, R8, R11, R12, R13, R14, R15, R31, W3, W4 and * are each independently defined as described above.





In another preferred embodiment, the compound of formula I has the following structure of formula I-4:




embedded image




    • wherein,

    • R1, R2, R3, R4, R5, R6, R7, R8, R11, R12, R13, R14, R15, R32, R33, R34, R35, W5 and W6 are each independently defined as described above.





In another preferred embodiment, the compound of formula I has the following structure of formula I-5:




embedded image




    • wherein,

    • R1, R2, R3, R4, R5, R6, R7, R8, R11, R12, R13, R14, R15, R32, R33, R34, R35, W5, W6 and * are each independently defined as described above.





In another preferred embodiment, the compound of formula I has the following structure of formula I-6:




embedded image




    • wherein,

    • R1, R2, R5, R6, R7, R8, R11, R12, R13, R14, R15, R31, R41, W1, W2, W3 and W4 are each independently defined as described above.





In another preferred embodiment, the compound of formula I has the following structure of formula I-7:




embedded image




    • wherein,

    • R1, R2, R5, R6, R7, R8, R11, R12, R13, R14, R15, R31, R41, W1, W2, W3, W4 and * are each independently defined as described above.





In another preferred embodiment, the compound of formula I has the following structure of formula I-8:




embedded image




    • wherein,

    • R1, R2, R3, R6, R7, R8, R11, R12, R13, R14, R15, R31, R41, W1, W2, W3 and W4 are each independently defined as described above.





In another preferred embodiment, the compound of formula I has the following structure of formula I-9:




embedded image




    • wherein,

    • R1, R2, R3, R6, R7, R8, R11, R12, R13, R14, R15, R31, R41, W1, W2, W3, W4 and * are each independently defined as described above.





In another preferred embodiment, the compound of formula I has the following structure of formula I-11:




embedded image




    • wherein,

    • R1, R2, R4, R5, R6, R7, R8, R11, R12, R13, R14, R15, R31, R42, R43, R44, R45, R46, R47, R48, R49, R50, R51, W3 and W4 are each independently defined as described above.





In another preferred embodiment, the compound of formula I has the following structure of formula I-12:




embedded image




    • wherein,

    • R1, R2, R4, R5, R6, R7, R8, R11, R12, R13, R14, R15, R31, R42, R43, R44, R45, R46, R47, R48, R49, R50, R51, W3, W4 and * are each independently defined as described above.





In another preferred embodiment, the compound of formula I has the following structure of formula I-13:




embedded image




    • wherein,

    • R1, R2, R4, R5, R6, R7, R8, R11, R12, R13, R14, R15, R31, R52, R53, R54, R55, R56, R57, R58, R59, R60, W3 and W4 are each independently defined as described above.





In another preferred embodiment, the compound of formula I has the following structure of formula I-14:




embedded image




    • wherein,

    • R1, R2, R4, R5, R6, R7, R8, R11, R12, R13, R14, R15, R31, R52, R53, R54, R55, R56, R57, R58, R59, R60, W3, W4 and * are each independently defined as described above.





In another preferred embodiment, the compound of formula I has the following structure of formula I-15:




embedded image




    • wherein,

    • R1, R2, R4, R5, R6, R7, R8, R11, R12, R13, R14, R15, R32, R33, R34, R35, R42, R43, R44, R45, R46, R47, R48, R49, R50, R51, W5 and W6 are each independently defined as described above.





In another preferred embodiment, the compound of formula I has the following structure of formula I-16:




embedded image




    • wherein,

    • R1, R2, R4, R5, R6, R7, R8, R11, R12, R13, R14, R15, R32, R33, R349 R35, R42, R43, R44, R45, R46, R47, R48, R49, R50, R51, W5, W6 and * are each independently defined as described above.





In another preferred embodiment, the compound of formula I has the following structure of formula I-17:




embedded image




    • wherein,

    • R1, R2, R4, R5, R6, R7, R8, R11, R12, R13, R14, R15, R32, R33, R34, R35, R52, R53, R54, R55, R56, R57, R58, R59, R60, W5 and W6 are each independently defined as described above.





In another preferred embodiment, the compound of formula I has the following structure of formula I-18:




embedded image




    • wherein,

    • R1, R2, R4, R5, R6, R7, R8, R11, R12, R13, R14, R15, R32, R33, R34, R35, R52, R53, R54, R55, R56, R57, R58, R59, R60, W5, W6 and * are each independently defined as described above.





In another preferred embodiment, the compound of formula I has the following structure of formula I-19:




embedded image




    • wherein,

    • R1, R2, R5, R6, R7, R8, R1, R12, R13, R14, R15, R32, R33, R34, R35, R41, W1, W2, W5custom-character W6 are each independently defined as described above.





In another preferred embodiment, the compound of formula I has the following structure of formula I-20:




embedded image




    • wherein,

    • R1, R2, R5, R6, R7, R8, R11, R12, R13, R14, R15, R32, R33, R34, R35, R41, W1, W2, W5, W6 and * are each independently defined as described above.





In another preferred embodiment, the compound of formula I has the following structure of




embedded image




    • wherein,

    • R1, R2, R3, R6, R7, R8, Rn, R12, R13, R14, R15, R32, R33, R34, R35, R41, W1, W2, W5 and W6 are each independently defined as described above.





In another preferred embodiment, the compound of formula I has the following structure of formula I-22:




embedded image




    • wherein,

    • R1, R2, R3, R6, R7, R8, R1, R12, R13, R14, R15, R32, R33, R34, R35, R41, W1, W2, W5, WV and * are each independently defined as described above.





In another preferred embodiment, the pharmaceutically acceptable salt of the compound of formula I comprises the salt formed by the compound of formula I and an acid.


In another preferred embodiment, the acid comprises one or more of hydrochloric acid, mucic acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid and glutamic acid.


In another preferred embodiment, the pharmaceutically acceptable salt of the compound of formula I comprises the salt formed by the compound of formula I and one or more of hydrochloric acid, mucic acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid and glutamic acid.


In another preferred embodiment, the pharmaceutically acceptable salt of the compound of formula I comprises the salt formed by the compound of formula I and hydrochloric acid, mucic acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid or glutamic acid.


In another preferred embodiment, the salt root of the pharmaceutically acceptable salt of the compound of formula I comprises the salt root formed by the loss of a H+ in the acid.


In another preferred embodiment, the salt root of the pharmaceutically acceptable salt of the compound of formula I comprises the salt root formed by the loss of a H+ in hydrochloric acid, mucic acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid or glutamic acid.


In another preferred embodiment, the salt root of the pharmaceutically acceptable salt of the compound of formula I comprises F, Cl, Br, I, HCOO, CH3COO, SO42− or NO3.


In another preferred embodiment, the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof is selected from the following group:




embedded image


embedded image


embedded image


embedded image


embedded image


embedded image




embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image




embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image




embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image




embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


In the second aspect of the present invention, it provides a composition, the composition comprises (a) the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention; and (b) a pharmaceutically acceptable carrier.


In another preferred embodiment, the content of the (a) the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention is 0.001-99.9 wt %, based on the weight of the composition.


In another preferred embodiment, the composition is pharmaceutical composition.


In another preferred embodiment, the composition further comprises a pharmaceutically acceptable carrier.


In another preferred embodiment, the dosage form of the composition is a solid preparation, liquid preparation or semi-solid preparation.


In another preferred embodiment, the dosage form of the composition is oral preparation, external preparation or injection preparation.


In another preferred embodiment, the dosage form of the composition is tablet, injection, infusion, paste, gel, solution, microsphere or film.


In the third aspect of the present invention, it provides a use of the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention in the preparation of a composition or a preparation for preventing and/or treating tumor.


In another preferred embodiment, the tumor is human-derived tumor.


In another preferred embodiment, the tumor is human tumor.


In another preferred embodiment, the tumor comprises tumor with low expression, no expression, low activity or no activity of mitochondria permeability transition pore.


In another preferred embodiment, the tumor comprises tumor with low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F.


In another preferred embodiment, the protein identification number of peptidyl-prolyl cis-trans isomerase F is UniProtKB/Swiss Prot: P30405, and the gene identification number of peptidyl-prolyl cis-trans isomerase F is NCBI Entrez Gene: 10105.


In another preferred embodiment, the tumor with low expression or low activity of mitochondria permeability transition pore means the expression level or activity level of mitochondria permeability transition pore in tumor cell is lower than the expression level or activity level of mitochondria permeability transition pore in the same type of cell or a normal cell (e.g., para-tumor tissue cell).


In another preferred embodiment, the low expression or low activity of mitochondria permeability transition pore means the ratio (H1/H0) of the expression level or activity level H1 of mitochondria permeability transition pore in a cell (e.g., tumor cell) to the expression level or activity level H0 of mitochondria permeability transition pore in the same type of cell or a normal cell (e.g., para-tumor tissue cell) is <1.0, preferably ≤0.8, more preferably ≤0.7, more preferably ≤0.6, more preferably ≤0.5, more preferably ≤0.4, more preferably ≤0.3, more preferably ≤0.2, more preferably ≤0.1, more preferably ≤0.05, more preferably ≤0.01, more preferably ≤0.005, more preferably ≤0.001, more preferably ≤0.0001, more preferably ≤0.00001, more preferably ≤0.000001, more preferably ≤0.0000001.


In another preferred embodiment, the cell comprises tumor cell.


In another preferred embodiment, the same type of cell comprises the same type of tumor cell.


In another preferred embodiment, the same type of cell comprises the cell (e.g., the same type of tumor cell) with normal expression, high expression, normal activity or high activity of mitochondria permeability transition pore.


In another preferred embodiment, the same type of cell comprises the same type of cell (e.g., the same type of tumor cell) with normal expression, high expression, normal activity or high activity of mitochondria permeability transition pore


In another preferred embodiment, the normal cell comprises normal tissue cell (e.g., tumor origin cell, tumor-adjacent cell or para-tumor tissue cell) with normal expression or normal activity of mitochondria permeability transition pore.


In another preferred embodiment, H0 refers to the expression level or activity level H0 of mitochondria permeability transition pore in the cell with normal expression, high expression, normal activity or high activity of mitochondria permeability transition pore.


In another preferred embodiment, the cell with normal expression, high expression, normal activity or high activity of mitochondria permeability transition pore comprises the cell that is not sensitive to the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.


In another preferred embodiment, the tumor with low expression or low activity of peptidyl-prolyl cis-trans isomerase F means the expression level or activity level of peptidyl-prolyl cis-trans isomerase F in tumor cell is lower than the expression level or activity level of peptidyl-prolyl cis-trans isomerase F in the same type of cell or a normal cell (e.g., para-tumor tissue cell).


In another preferred embodiment, the low expression or low activity of peptidyl-prolyl cis-trans isomerase F means the ratio (C1/C0) of the expression level or activity level C1 of peptidyl-prolyl cis-trans isomerase F in a cell (e.g., tumor cell) to the expression level or activity level C0 of peptidyl-prolyl cis-trans isomerase F in the same type of cell or a normal cell (e.g., para-tumor tissue cell) is <1.0, preferably ≤0.8, more preferably ≤0.7, more preferably ≤0.6, more preferably ≤0.5, more preferably ≤0.4, more preferably ≤0.3, more preferably ≤0.2, more preferably ≤0.1, more preferably ≤0.05, more preferably ≤0.01, more preferably ≤0.005, more preferably ≤0.001, more preferably ≤0.0001, more preferably ≤0.00001, more preferably ≤0.000001, more preferably ≤0.0000001.


In another preferred embodiment, the cell comprises tumor cell.


In another preferred embodiment, the same type of cell comprises the same type of tumor cell.


In another preferred embodiment, the same type of cell comprises the cell (e.g., the same type of tumor cell) with normal expression, high expression, normal activity or high activity of peptidyl-prolyl cis-trans isomerase F.


In another preferred embodiment, the same type of cell comprises the same type of cell (e.g., the same type of tumor cell) with normal expression, high expression, normal activity or high activity of peptidyl-prolyl cis-trans isomerase F In another preferred embodiment, the normal cell comprises normal tissue cell (e.g., tumor origin cell, tumor-adjacent cell or para-tumor tissue cell) with normal expression or normal activity of peptidyl-prolyl cis-trans isomerase F.


In another preferred embodiment, C0 refers to the expression level or activity level H0 of peptidyl-prolyl cis-trans isomerase F in the cell with normal expression, high expression, normal activity or high activity of peptidyl-prolyl cis-trans isomerase F.


In another preferred embodiment, the cell with normal expression, high expression, normal activity or high activity of peptidyl-prolyl cis-trans isomerase F comprises the cell that is not sensitive to the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.


In another preferred embodiment, the mitochondria permeability transition pore inhibitor is administered to achieve low expression, no expression, low activity or no activity of mitochondria permeability transition pore in tumor.


In another preferred embodiment, the peptidyl-prolyl cis-trans isomerase F inhibitor is administered to achieve low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F.


In another preferred embodiment, the inhibitor comprises specific inhibitor.


In another preferred embodiment, the mitochondria permeability transition pore inhibitor comprises inhibitor that can achieve low expression, no expression, low activity or no activity of mitochondria permeability transition pore in tumor.


In another preferred embodiment, the peptidyl-prolyl cis-trans isomerase F inhibitor comprises inhibitor that can achieve low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F.


In another preferred embodiment, the mitochondria permeability transition pore inhibitor is selected from the group consisting of Cyclosporin A, CyP-D protein inhibitor, peroxide scavenger, and combinations thereof.


In another preferred embodiment, the peptidyl-prolyl cis-trans isomerase F inhibitor comprises shRNA.


In another preferred embodiment, the nucleotide sequence of shRNA is GTTCTTCATCTGCACCATAAA.


In another preferred embodiment, the tumor comprises brain tumor.


In another preferred embodiment, the brain tumor comprises glioma.


In another preferred embodiment, the brain tumor comprises a malignant glioma in cranial fossa.


In another preferred embodiment, the brain tumor comprises medulloblastoma.


In another preferred embodiment, the brain tumor cell comprises Daoy cell.


In another preferred embodiment, the level comprises protein level and/or mRNA level.


In another preferred embodiment, the expression comprises protein expression and/or mRNA expression.


In another preferred embodiment, the composition or preparation is a pharmaceutical composition or pharmaceutical preparation.


In another preferred embodiment, the composition or preparation further comprises a pharmaceutically acceptable carrier.


In another preferred embodiment, the dosage form of the composition or preparation is a solid preparation, liquid preparation or semi-solid preparation.


In another preferred embodiment, the dosage form of the composition or preparation is oral preparation, external preparation or injection preparation.


In another preferred embodiment, the injection preparation is intravenous injection preparation.


In another preferred embodiment, the dosage form of the composition or preparation is tablet, injection, infusion, paste, gel, solution, microsphere or film.


In the fourth aspect of the present invention, it provides a marker for determining whether the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention is suitable for use in the prevention and/or treatment of patient tumor, the marker comprises mitochondria permeability transition pore and/or peptidyl-prolyl cis-trans isomerase F.


In another preferred embodiment, the marker comprises the expression level or activity of mitochondria permeability transition pore and/or expression level or activity of peptidyl-prolyl cis-trans isomerase F.


In another preferred embodiment, the mitochondria permeability transition pore and/or peptidyl-prolyl cis-trans isomerase F comprises mitochondria permeability transition pore and/or peptidyl-prolyl cis-trans isomerase F in tumor cell.


In another preferred embodiment, the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention is suitable for use in the prevention and/or treatment of patient tumor with low expression, no expression, low activity or no activity of mitochondria permeability transition pore, and/or low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F.


In another preferred embodiment, the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention is not suitable for use in the prevention and/or treatment of patient tumor with high expression or high activity of mitochondria permeability transition pore, and/or high expression or high activity of peptidyl-prolyl cis-trans isomerase F.


In another preferred embodiment, “the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention is suitable for use in the prevention and/or treatment of patient tumor” comprises “the patient tumor is sensitive to the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention”.


In another preferred embodiment, “the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention is not suitable for use in the prevention and/or treatment of patient tumor” comprises “the patient tumor is not sensitive to the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention”.


In another preferred embodiment, the tumor with low expression, no expression, low activity or no activity of mitochondria permeability transition pore is as described in the third aspect of the invention.


In another preferred embodiment, the tumor with low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F is as described in the third aspect of the invention.


In another preferred embodiment, the high expression or high activity of mitochondria permeability transition pore means the ratio (H1/H0) of the expression level or activity level H1 of mitochondria permeability transition pore in a cell (e.g., tumor cell) to the expression level or activity level H0 of mitochondria permeability transition pore in the same type of cell or a normal cell (e.g., para-tumor tissue cell) is >1.0, preferably ≥1.2, more preferably ≥1.5, more preferably ≥2, more preferably ≥3, more preferably ≥5, more preferably ≥8, more preferably ≥10, more preferably ≥15, more preferably ≥20, more preferably ≥30, more preferably ≥50, such as 2-50.


In another preferred embodiment, the high expression or high activity of peptidyl-prolyl cis-trans isomerase F means the ratio (C1/C0) of the expression level or activity level C1 of peptidyl-prolyl cis-trans isomerase F in a cell (e.g., tumor cell) to the expression level or activity level C0 of peptidyl-prolyl cis-trans isomerase F in the same type of cell or a normal cell (e.g., para-tumor tissue cell) is >1.0, preferably ≥1.2, more preferably ≥1.5, more preferably ≥2, more preferably ≥3, more preferably ≥5, more preferably ≥8, more preferably ≥10, more preferably ≥15, more preferably ≥20, more preferably ≥30, more preferably ≥50, such as 2-50.


In the fifth aspect of the present invention, it provides a detection kit, which comprises: (i) a detection reagent for detecting the expression level or activity of mitochondria permeability transition pore, and/or expression level or activity of peptidyl-prolyl cis-trans isomerase F.


In another preferred embodiment, the test sample of the detection kit comprises tumor cell.


In another preferred embodiment, the level comprises protein level and/or mRNA level.


In another preferred embodiment, the expression comprises mRNA expression and/or protein expression.


In the sixth aspect of the present invention, it provides a use of the detection kit according to the fifth aspect of the present invention in the preparation of concomitant diagnose kit for determining whether the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention is suitable for use in the prevention and/or treatment of patient tumor.


In another preferred embodiment, the concomitant diagnose kit further comprises instruction or label.


In another preferred embodiment, the instruction or label records that the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention is suitable for use in the prevention and/or treatment of patient tumor with low expression, no expression, low activity or no activity of mitochondria permeability transition pore, and/or low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F.


In another preferred embodiment, the instruction or label records that the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention is not suitable for use in the prevention and/or treatment of patient tumor with high expression or high activity of mitochondria permeability transition pore, and/or high expression or high activity of peptidyl-prolyl cis-trans isomerase F.


In another preferred embodiment, “the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention is suitable for use in the prevention and/or treatment of patient tumor” is as described in the fourth aspect of the invention.


In another preferred embodiment, “the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention is not suitable for use in the prevention and/or treatment of patient tumor” is as described in the fourth aspect of the invention.


In the seventh aspect of the present invention, it provides a medicine kit, which comprises:

    • (i) a detection reagent for detecting the expression level or activity of mitochondria permeability transition pore, and/or expression level or activity of peptidyl-prolyl cis-trans isomerase F; and
    • (ii) the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention.


In another preferred embodiment, the expression level or activity of mitochondria permeability transition pore, and/or expression level or activity of peptidyl-prolyl cis-trans isomerase F comprises the expression level or activity of mitochondria permeability transition pore, and/or expression level or activity of peptidyl-prolyl cis-trans isomerase F in the tumor cell.


In another preferred embodiment, the detection sample comprises tumor.


In another preferred embodiment, the medicine kit further comprises instruction or label.


In another preferred embodiment, the instruction or label records that the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention is suitable for use in the prevention and/or treatment of patient tumor with low expression, no expression, low activity or no activity of mitochondria permeability transition pore, and/or low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F.


In another preferred embodiment, the instruction or label records that the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention is not suitable for use in the prevention and/or treatment of patient tumor with high expression or high activity of mitochondria permeability transition pore, and/or high expression or high activity of peptidyl-prolyl cis-trans isomerase F.


In the eighth aspect of the present invention, it provides a method for preventing and/or treating tumor, which comprises administering the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention to a subject in need, thereby preventing and/or treating tumor.


In another preferred embodiment, the tumor is as described in the third aspect of the invention.


In another preferred embodiment, the subject is human and non-human mammals (rodent, rabbit, monkey, livestock, dog, cat, etc.).


In another preferred embodiment, the method comprises:

    • firstly achieving low expression, no expression, low activity or no activity of mitochondria permeability transition pore, and/or low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F in the subject tumor, then administering the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof to prevent and/or treat tumor.


In another preferred embodiment, the method comprises:

    • firstly administering mitochondria permeability transition pore inhibitor, and/or peptidyl-prolyl cis-trans isomerase F inhibitor to achieve low expression, no expression, low activity or no activity of mitochondria permeability transition pore, and/or low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F in the subject tumor, then administering the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof to prevent and/or treat tumor.


In another preferred embodiment, the mitochondria permeability transition pore inhibitor, and/or peptidyl-prolyl cis-trans isomerase F inhibitor is as described in the third aspect of the invention.


In the ninth aspect of the present invention, it provides a device or system, the device or system comprises:

    • (i) a detection module, the detection module is used to detect the expression level or activity of mitochondria permeability transition pore, and/or expression level or activity of peptidyl-prolyl cis-trans isomerase F;
    • (ii) an output module, the output module comprises the information as follows:
    • the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention is suitable for use in the prevention and/or treatment of patient tumor with low expression, no expression, low activity or no activity of mitochondria permeability transition pore, and/or low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F; and/or
    • the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention is not suitable for use in the prevention and/or treatment of patient tumor with high expression or high activity of mitochondria permeability transition pore, and/or high expression or high activity of peptidyl-prolyl cis-trans isomerase F.


In another preferred embodiment, the detection sample comprises tumor.


In another preferred embodiment, the device comprises a gene detector or protein detector.


In another preferred embodiment, the device or system further comprises sample injection module.


In another preferred embodiment, the injection module is used to inject tumor cell extract.


In another preferred embodiment, the device or system further comprises data processing module.


In another preferred embodiment, the expression level or activity of mitochondria permeability transition pore, and/or expression level or activity of peptidyl-prolyl cis-trans isomerase F can be obtained by the procession of the data processing module.


In the tenth aspect of the present invention, it provides a use of mitochondria permeability transition pore inhibitor, and/or peptidyl-prolyl cis-trans isomerase F inhibitor in the preparation of a composition or a preparation for enhancing the anti-tumor effect of anti-tumor drug.


In another preferred embodiment, the mitochondria permeability transition pore inhibitor comprises inhibitor that can achieve low expression, no expression, low activity or no activity of mitochondria permeability transition pore in tumor.


In another preferred embodiment, the peptidyl-prolyl cis-trans isomerase F inhibitor comprises inhibitor that can achieve low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F.


In another preferred embodiment, the inhibitor comprises specific inhibitor.


In another preferred embodiment, the anti-tumor drug comprises the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention.


In another preferred embodiment, the tumor is as described in the third aspect of the invention.


In another preferred embodiment, the mitochondria permeability transition pore inhibitor is selected from the group consisting of Cyclosporin A, CyP-D protein inhibitor, peroxide scavenger, and combinations thereof.


In another preferred embodiment, the peptidyl-prolyl cis-trans isomerase F inhibitor comprises shRNA.


In another preferred embodiment, the nucleotide sequence of shRNA is GTTCTTCATCTGCACCATAAA.


In another preferred embodiment, the composition or preparation is a pharmaceutical composition or pharmaceutical preparation.


In another preferred embodiment, the composition or preparation further comprises a pharmaceutically acceptable carrier.


In another preferred embodiment, the dosage form of the composition or preparation is a solid preparation, liquid preparation or semi-solid preparation.


In another preferred embodiment, the dosage form of the composition or preparation is oral preparation, external preparation or injection preparation.


In another preferred embodiment, the injection preparation is intravenous injection preparation.


In another preferred embodiment, the dosage form of the composition or preparation is tablet, injection, infusion, paste, gel, solution, microsphere or film.


In the eleventh aspect of the present invention, it provides an active ingredient combination, the active ingredient combination comprises:

    • (1) a first active ingredient, the first active ingredient comprises anti-tumor drug; and
    • (2) a second active ingredient, the second active ingredient comprises mitochondria permeability transition pore inhibitor, and/or peptidyl-prolyl cis-trans isomerase F inhibitor.


In another preferred embodiment, the anti-tumor drug comprises the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention.


In another preferred embodiment, the mitochondria permeability transition pore inhibitor, and/or peptidyl-prolyl cis-trans isomerase F inhibitor is as described in the tenth aspect of the invention.


In another preferred embodiment, the molar ratio of the first active ingredient to the second active ingredient is 0.01-600:1, preferably 0.05-500:1, more preferably 0.1-400:1, more preferably 0.2-200:1, more preferably 0.5-100:1, more preferably 0.5-80:1, most preferably 1-50:1.


In another preferred embodiment, at least one active ingredient is independent in the active ingredient combination.


In another preferred embodiment, the first active ingredient and the second active ingredient are independent of each other in the active ingredient combination.


In the twelfth aspect of the present invention, it provides a composition, the composition comprises:

    • (1) a first active ingredient, the first active ingredient comprises anti-tumor drug; and
    • (2) a second active ingredient, the second active ingredient comprises mitochondria permeability transition pore inhibitor, and/or peptidyl-prolyl cis-trans isomerase F inhibitor.


In another preferred embodiment, the anti-tumor drug comprises the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention.


In another preferred embodiment, the mitochondria permeability transition pore inhibitor, and/or peptidyl-prolyl cis-trans isomerase F inhibitor is as described in the tenth aspect of the invention.


In another preferred embodiment, the composition is a pharmaceutical composition.


In another preferred embodiment, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.


In another preferred embodiment, the dosage form of the composition or preparation is a solid preparation, liquid preparation or semi-solid preparation.


In another preferred embodiment, the dosage form of the composition or preparation is oral preparation, external preparation or injection preparation.


In another preferred embodiment, the dosage form of the composition or preparation is tablet, injection, infusion, paste, gel, solution, microsphere or film.


In another preferred embodiment, the content of the first active ingredient is 0.01-99.99 wt %, preferably 0.1-99.9 wt %, more preferably 1-99 wt %, more preferably 10-99 wt %, most preferably 20-99 wt %, based on the total weight of the active ingredient in the composition.


In another preferred embodiment, the content of the second active ingredient is 0.01-99.99 wt %, preferably 0.1-99.9 wt %, more preferably 1-99 wt %, more preferably 10-99 wt %, most preferably 20-99 wt %, based on the total weight of the active ingredient in the composition.


In the thirteenth h aspect of the present invention, it provides a medicine kit, the medicine kit comprises:

    • (A) a first preparation comprising a first active ingredient, the first active ingredient comprises anti-tumor drug; and
    • (B) a second preparation comprising a second active ingredient, the second active ingredient comprises mitochondria permeability transition pore inhibitor, and/or peptidyl-prolyl cis-trans isomerase F inhibitor.


In another preferred embodiment, the anti-tumor drug comprises the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention.


In another preferred embodiment, the mitochondria permeability transition pore inhibitor, and/or peptidyl-prolyl cis-trans isomerase F inhibitor is as described in the tenth aspect of the invention.


In another preferred embodiment, the medicine kit further comprises a user manual.


In another preferred embodiment, the first preparation and the second preparation are independent preparation of each other.


In another preferred embodiment, the first preparation and the second preparation are combined preparation.


In another preferred embodiment, the user manual records that the first preparation and the second preparation are used together to enhance anti-tumor activity of anti-tumor drug.


In another preferred embodiment, the method for using together means the second preparation comprising the second active ingredient is administered firstly, then the first preparation comprising the first active ingredient is administered.


In the fourteenth aspect of the present invention, it provides a method for inhibiting tumor cell, which comprises contacting the tumor cell with the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention, thereby inhibiting tumor cell.


In another preferred embodiment, the method is vitro method.


In another preferred embodiment, the method is non-therapeutic and non-diagnostic method.


In another preferred embodiment, the contact is performed in vitro culture.


In another preferred embodiment, the tumor is as described in the third aspect of the invention.


In another preferred embodiment, the method comprises:

    • firstly achieving low expression, no expression, low activity or no activity of mitochondria permeability transition pore, and/or low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F in the tumor cell, then contacting the tumor cell with the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention, thereby inhibiting tumor cell.


In another preferred embodiment, the method comprises:

    • firstly administering mitochondria permeability transition pore inhibitor, and/or peptidyl-prolyl cis-trans isomerase F inhibitor to achieve low expression, no expression, low activity or no activity of mitochondria permeability transition pore, and/or low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F in the tumor cell, then contacting the tumor cell with the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention, thereby inhibiting tumor cell.


In another preferred embodiment, the mitochondria permeability transition pore inhibitor, and/or peptidyl-prolyl cis-trans isomerase F inhibitor is as described in the tenth aspect of the invention.


In the fifteenth aspect of the present invention, it provides a use of medicine kit according to the seventh aspect of the present invention in the preparation of medicine box for preventing and/or treating tumor.


In another preferred embodiment, the medicine box further comprises instruction or label.


In another preferred embodiment, the instruction or label records that the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention is suitable for use in the prevention and/or treatment of patient tumor with low expression, no expression, low activity or no activity of mitochondria permeability transition pore, and/or low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F.


In another preferred embodiment, the instruction or label records that the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention is not suitable for use in the prevention and/or treatment of patient tumor with high expression or high activity of mitochondria permeability transition pore, and/or high expression or high activity of peptidyl-prolyl cis-trans isomerase F.


It should be understood that, in the present invention, each of the technical features specifically described above and below can be combined with each other, thereby constituting new or preferred technical solutions which need not be redundantly described one-by-one.





DESCRIPTION OF THE DRAWINGS


FIG. 1 shows the expression content of PPIF protein using Western Blot test, wherein, Con shRNA refers to the expression content of PPIF protein in Daoy cell transfected with empty virus vector without carrying shRNA that can specificly induce the degradation of PPIF mRNA; PPIF shRNA refers to the expression content of PPIF protein in Daoy cell transfected with virus vector carrying shRNA that can specificly induce the degradation of PPIF mRNA.



FIG. 2 shows the relative cell viability of Daoy cell having inactive mPTP and Daoy cell having active mPTP, wherein, Con shRNA refers to the relative viability of Daoy cell transfected with empty virus vector without carrying shRNA that can specificly induce the degradation of PPIF mRNA; PPIF shRNA refers to the relative viability of Daoy cell transfected with virus vector carrying shRNA that can specificly induce the degradation of PPIF mRNA.





EMBODIMENTS FOR CARRYING OUT THE INVENTION

Based on an extensive and intensive research, the inventors have unexpectedly developed a compound, the compound has significantly excellent precision treatment effect on tumor with low expression, no expression, low activity or no activity of mitochondria permeability transition pore, and/or low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F. The expression level or activity of mitochondria permeability transition pore, and/or expression level or activity of peptidyl-prolyl cis-trans isomerase F can be used as a marker for determining whether the compound of present invention is suitable for use in the prevention and/or treatment of patient tumor. On this basis, the inventors has completed the present invention.


Terms

Unless otherwise defined, the meanings of all technical and scientific terms used in the invention are the same as those generally understood by the skilled in the art.


As used herein, the term “comprise”, “comprising”, and “containing” are used interchangeably, which not only comprise open definitions, but also semi-closed and closed definitions. In other words, the term comprises “consisting of” and “essentially consisting of”.


As used herein, the term “anti-tumor cancer” and “anti-tumor drug” are used interchangeably.


As used herein, the term “cancer” and “tumor” are used interchangeably.


As used herein, the term “a cell” refers to a cell (e.g., single tumor cell) or a group of cells containing multiple similar cells ((e.g., a tumor tissue).


As used herein, “the compound of present invention is suitable for use in the prevention and/or treatment of patient tumor” comprises “patient tumor is sensitive to compound of present invention”.


As used herein, “the compound of present invention is not suitable for use in the prevention and/or treatment of patient tumor” comprises “patient tumor is not sensitive to compound of present invention”.


As used herein, the term “IC50” and “IC50” are used interchangeably, which refers to 50% inhibiting concentration, ie, the concentration of the inhibitor when 50% inhibitory effect is achieved.


As used herein, the term “P/S” refers to adding penicillin and streptomycin into the culture medium.


As used herein, “the expression level or activity of mitochondria permeability transition pore, and/or expression level or activity of peptidyl-prolyl cis-trans isomerase F” refers to one or more of the expression level or activity of mitochondria permeability transition pore and the expression level or activity of peptidyl-prolyl cis-trans isomerase F.


As used herein, “the low expression, no expression, low activity or no activity of mitochondria permeability transition pore, and/or low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F” refers to one or more of the low expression, no expression, low activity or no activity of mitochondria permeability transition pore and the low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F.


As used herein, “the high expression or high activity of mitochondria permeability transition pore, and/or high expression or high activity of peptidyl-prolyl cis-trans isomerase F” refers to one or more of the high expression or high activity of mitochondria permeability transition pore and the high expression or high activity of peptidyl-prolyl cis-trans isomerase F.


As used herein, mitochondria permeability transition pore is abbreviated as mPTP.


As used herein, peptidyl-prolyl cis-trans isomerase F is abbreviated as PPIF.


As used herein, the term “MS-ESI” refers to Electro Spray Ionization-Mass Spectroscopy.


As used herein, the term “1H NMR” refers to H Nuclear Magnetic Resonance Spectra.


It should be understood that the skilled in the art can choose the substituents and substituted forms on the compound of the present invention to obtain chemically stable compounds, the compound can be synthesized by the techniques known in the art and the methods described below.


If the compound is substituted by more than one substituents, it should be understood that the substituents can be on the same carbon or different carbons, as long as a stable structure is obtained.


As used herein, the term “substitute” or “substituted” means the hydrogen atom on the group is substituted by non-hydrogen atom group, but it needs to meet its valence requirements and the substituted compound is chemically stable, that is, the substituted compound does not spontaneously undergo transformations such as cyclization and elimination, etc.


As used herein, the term “deuterated” refers to one or more hydrogen atoms in a compound or group are substituted by deuterium. The deuterated can be mono-substituted, di-substituted, multi-substituted or fully-substituted.


As used herein, the term “solvate” refers to a complex formed by the coordination of a compound with a solvent molecule in a specific ratio.


As used herein, “R1”, “R1” and “R1” have the same meaning and can be used interchangeably, the other similar definitions have the same meaning.


As used herein, “custom-character” denotes the linking site of the group.


As used herein, the term “alkyl” refers to a saturated hydrocarbon group with linear chain (ie, unbranched chain) or branched chain, or a combination of linear and branched chains, the alkyl only have carbon and hydrogen atoms. When the number of carbon atoms is limited in front of the alkyl (e.g., C1-C6 alkyl), it refers to the number of carbon atoms (e.g., 1-6) in the alkyl, for example, C1-C4 alkyl refers to an alkyl having 1-4 carbon atoms. Representative examples comprise but are not limited to methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, or the like.


As used herein, the term “alkylidene” refers to a group formed by removing one hydrogen on the alkyl, the alkyl is as defined above. When the number of carbon atoms is limited in front of the alkylidene (e.g., C1-C6 alkylidene), it refers to the number of carbon atoms (e.g., 1-6) in the alkylidene, for example, C1-C4 alkylidene refers to an alkylidene having 1-4 carbon atoms. Representative examples comprise but are not limited to methylidene, ethylidene, propylidene, isopropylidene, butylidene, isobutylidene, sec-butylidene, tert-butylidene, or the like.


As used herein, the term “alkenyl” refers to a hydrocarbon group formed by the loss of one hydrogen atom connected to the double bond in linear or branched alkene with one or more double bonds. When the number of carbon atoms is limited in front of the alkenyl (e.g., C2-C6 alkenyl), it refers to the number of carbon atoms (e.g., 1-6) in the alkenyl, for example, C2-C4 alkenyl refers to an alkenyl having 2-4 carbon atoms in the alkenyl. Representative examples comprise but are not limited to ethylenyl (e.g., CH2═CH—), butenyl (e.g., C (CH3)2═CH—), or the like.


As used herein, the term “halogen” refers to F, Cl, Br or I.


As used herein, the term “halo” means the group is substituted by halogen.


As used herein, the term “haloalkyl” means that one or more (preferably 1, 2, 3 or 4) hydrogens on the alkyl are substituted by halogen, the alkyl and halogen are as defined above. When the number of carbon atoms is limited in front of the haloalkyl (e.g., C1-C8 haloalkyl), it refers to the number of carbon atoms (e.g., 1-8) in the haloalkyl, for example, C1-C6 haloalkyl refers to an haloalkyl having 1-6 carbon atoms. Representative examples comprise but are not limited to —CF3, —CHF2, monofluoroisopropyl, difluorobutyl, or the like.


As used herein, the term “cycloalkyl” refers to a cyclic group having a saturated or partially saturated monocyclic ring, bicyclic ring or polycyclic ring (fused ring, bridged ring or spiro ring). When the number of carbon atoms is limited in front of the cycloalkyl (e.g., C3-C12 cycloalkyl), it refers to the number of ring carbon atoms (e.g., 3-12) in the cycloalkyl. For example, C3-C8 cycloalkyl refers to a saturated or partially saturated monocycloalkyl or dicycloalkyl having 3-8 ring carbon atoms, comprising cyclopropyl, cyclobutyl, cyclopentyl, cycloheptyl, or the like. The term “spirocycloalkyl” refers to a bicyclic or polycyclic group that shares a carbon atom (referred to spiro-atom) between single rings, the spirocycloalkyl can contain one or more double bonds, but no ring has a fully conjugated 1 L electron system. Fused cycloalkyl refers to all carbon bicyclic or polycyclic group in which each rings in the system shares an adjacent pair of carbon atoms with other rings, one or more rings can have one or more double bonds, but no ring has a fully conjugated 1 L electron system. Bridged cycloalkyl refers to all carbon polycyclic group in which any two rings share two non-directly connected carbon atoms, the bridged cycloalkyl can have one or more double bonds, but no ring has a fully conjugated 1 L electron system. The representative examples of cycloalkyl comprise but are not limited to




embedded image


As used herein, the term “halocycloalkyl” means that one or more (preferably 1, 2, 3 or 4) hydrogens on cycloalkyl are substituted by halogen, the cycloalkyl and halogen are as defined above, When the number of carbon atoms is limited in front of the halocycloalkyl (e.g, C3-C8 halocycloalkyl), it refers to the number of ring carbon atoms (e.g., 3-8) in the halocycloalkyl, for example, C3-C8 halocycloalkyl refers to an halocycloalkyl having 3-8 ring carbon atoms. Representative examples comprises but are not limited to monofluorocyclopropyl, monochlorocyclobutyl, monofluorocyclopentyl, difluorocycloheptyl, or the like.


As used herein, the term “alkoxyl” refers to R—O— group, wherein R is alkyl, the alkyl is as defined above. When the number of carbon atoms is limited in front of the alkoxyl, for example, C1-C8 alkoxyl means that the alkyl in the alkoxyl has 1-8 carbon atoms. Representative examples of alkoxyl comprise but are not limited to methoxyl, ethoxyl, n-propoxyl, isopropoxyl, tert-butoxyl, or the like.


As used herein, the term “alkylthio” refers to R—S— group, wherein R is alkyl, the alkyl is as defined above. When the number of carbon atoms is limited in front of the alkylthio, for example, C1-C8 alkylthio means that the alkyl in the alkylthio has 1-8 carbon atoms. Representative examples of alkylthio comprise but are not limited to methylthio, ethylthio, n-propylthio, isopropylthio, tert-butylthio, or the like.


As used herein, the term “haloalkoxyl” refers to haloalkyl-O—, wherein the haloalkyl is as defined above, for example, C1-C6 haloalkoxyl refers to a haloalkoxyl having 1-6 carbon atoms.


Representative examples comprise but are not limited to monofluoromethoxyl, monofluoroethoxyl, bisfluorobutoxyl, or the like.


As used herein, the term “haloalkylthio” refers to haloalkyl-S—, wherein the haloalkyl is as defined above, for example, C1-C6 haloalkylthio refers to a haloalkylthio having 1-6 carbon atoms.


Representative examples of haloalkylthio comprise but are not limited to monofluoromethylthio, monofluoroethylthio, difluorobutylthio, or the like.


As used herein, the term “cycloalkoxyl” refers to R—O—, wherein R is cycloalkyl, the cycloalkyl is as defined above. When the number of carbon atoms is limited in front of the cycloalkoxyl, for example, C3-C8 cycloalkoxyl means that the cycloalkyl in the cycloalkoxyl has 3-8 ring carbon atoms. Representative examples of cycloalkoxyl comprise but are not limited to cyclopropyloxyl, cyclobutoxyl, or the like.


As used herein, the term “cycloalkylthio” refers to R—S— group, wherein R is cycloalkyl, the cycloalkyl is as defined above. When the number of carbon atoms is limited in front of the cycloalkylthio, for example, C3-C8 cycloalkylthio means that the cycloalkyl in the cycloalkylthio has 3-8 ring carbon atoms. Representative examples of cycloalkylthio comprise but are not limited to cyclopropylthio, cyclobutythio, or the like.


As used herein, the term “halocycloalkoxyl” means that one or more (preferably 1, 2, 3 or 4) hydrogens on the cycloalkoxyll are substituted by halogen, the cycloalkoxyl and halogen are as defined above. When the number of carbon atoms is limited in front of the halocycloalkoxyl (e.g., C3-C8 halocycloalkoxyl), it refers to the number of ring carbon atoms (e.g., 3-8) in the halocycloalkoxyl, for example, C3-C8 halocycloalkoxyl refers to an halocycloalkoxyl having 3-8 ring carbon atoms. Representative examples comprises but are not limited to monofluorocyclopropyl-O—, monochlorocyclobutyl-O—, monofluorocyclopentyl-O—, difluorocycloheptyl-O—, or similar functional groups, or the like.


As used herein, the term “halocycloalkylthio” means that one or more (preferably 1, 2, 3 or 4) hydrogens on the cycloalkoxyll are substituted by halogen, the cycloalkoxyl and halogen are as defined above. When the number of carbon atoms is limited in front of the halocycloalkylthio (e.g., C3-C8 halocycloalkylthio), it refers to the number of ring carbon atoms (e.g., 3-8) in the halocycloalkylthio, for example, C3-C8 halocycloalkylthio refers to an halocycloalkylthio having 3-8 ring carbon atoms. Representative examples comprises but are not limited to monofluorocyclopropyl-S—, monochlorocyclobutyl-S—, monofluorocyclopentyl-S—, difluorocycloheptyl-S—, or similar functional groups, or the like.


As used herein, the term “heterocycloalkane ring” refers to fully saturated or partially unsaturated ring (comprising but not limited to such as 3-7 membered monocyclic ring, 7-11 membered bicyclic ring, or 8-16 membered tricyclic ring), at least one heteroatom is present in a ring with at least one carbon atom. When the number of members is limited in front of the heterocycloalkane ring, it refers to the number of ring atoms in the heterocycloalkane ring, for example, 3-16 membered heterocycloalkane ring refers to a heterocycloalkane ring having 3-16 ring atoms. Each heterocyclic ring having heteroatoms can have one or more (e.g., 1, 2, 3 or 4) heteroatoms, each of heteroatoms is independently selected from the group consisting of nitrogen atom, oxygen atom or sulfur atom, wherein the nitrogen atom or sulfur atom can be oxidized, and the nitrogen atom can also be quaternized. Representative examples of monocyclic heterocycloalkane ring comprise but are not limited to azetidine ring, oxetane ring, tetrahydrofuran ring, piperidine ring, piperazine ring. Polycyclic heterocycloalkane ring comprises spiro, fused and bridged ring, the spiro, fused and bridged heterocycloalkane ring is optionally linked with other rings by single bond, or further linked with other cycloalkane ring and heterocycloalkane ring by any two or more atoms on the ring.


As used herein, the term “heterocycloalkyl” refers to fully saturated or partially unsaturated cyclic (comprising but not limited to such as 3-7 membered monocyclic ring, 7-11 membered bicyclic ring, or 8-16 membered tricyclic ring) group, at least one heteroatom is present in a ring with at least one carbon atom. When the number of members is limited in front of the heterocycloalkyl, it refers to the number of ring atoms in the heterocycloalkyl, for example, 3-16 membered heterocycloalkyl refers to a heterocycloalkyl having 3-16 ring atoms. Each heterocyclic ring having heteroatoms can have one or more (e.g., 1, 2, 3 or 4) heteroatoms, each of heteroatoms is independently selected from the group consisting of nitrogen atom, oxygen atom or sulfur atom, wherein the nitrogen atom or sulfur atom can be oxidized, and the nitrogen atom can also be quaternized. Representative examples of monocyclic heterocycloalkyl comprise but are not limited to azetidinyl, oxetanyl, tetrahydrofuranyl, piperidinyl, piperazinyl. Polycyclic heterocycloalkyl comprises spiro, fused and bridged heterocyclyl, the spiro, fused and bridged heterocycloalkyl is optionally linked with other groups by single bond, or further linked with other cycloalkane rings and heterocycloalkane ring by any two or more atoms on the ring.


As used herein, the term “aryl” refers to an full carbon monocyclic ring or fused polycyclic ring (i.e., a ring that shares adjacent carbon atom pairs) group with a conjugated 1 L electron system, which is aromatic cyclic hydrocarbon compound group. When the number of carbon atoms is limited in front of the aryl, for example, C6-C12 aryl means that the aryl has 6-12 ring carbon atoms, such as phenyl and naphthyl.


As used herein, the term “heteroaryl” refers to aromatic heterocyclic ring group having one to more (preferably 1, 2, 3 or 4) heteroatoms, the heteroaryl can be monocyclic ring, or polycyclic ring (bicyclic, tricyclic or polycyclic ring) fused together or covalently connected. Each of heterocyclic ring having heteroatom can have one or more (e.g., 1, 2, 3, 4) heteroatoms independently selected from the group consisting of oxygen, sulfur and nitrogen. When the number of members is limited in front of the heteroaryl, it refers to the number of ring atoms of the heteroaryl, for example, 5-12 membered heteroaryl refers to a heteroaryl having 5-12 ring atoms. Representative examples comprise but are not limited to pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, furanyl, pyridyl, pyrimidinyl, etc.


As used herein, the term “carboxyl” refers to —COOH or -alkyl-COOH, the alkyl is as defined above. For example, “C2-C4 carboxyl” refers to —C1-C3 alkyl-COOH. Representative examples of carboxyl comprise but are not limited to —COOH, —CH2COOH, or the like.


As used herein, the term “ester group” refers to R—C(O)—O— or —C(O)—O—R, wherein, R is alkyl, the alkyl is defined as above. For example, “C2-C4 ester group” refers to C1-C3 alkyl-C(O)—O— or —C(O)—O—C1-C3 alkyl. Representative examples of ester group comprise but are not limited to CH3C(O)O—, C2HSC(O)O—, (CH3)2CHC(O)O—, —C(O)OCH3, —C(O)OC2H5, or the like.


As used herein, the term “amide group” refers to R—C(O)—N— or —C(O)—N—R, wherein, R is alkyl, the alkyl is defined as above. For example, “C2-C4 amide group” refers to C1-C3 alkyl-C(O)—N— or —C(O)—N—C1-C3 alkyl. Representative examples of amide group comprise but are not limited to CH3C(O)—N—, C2HSC(O)—N—, (CH3)2CHC(O)—N—, —C(O)—N—CH3, —C(O)—N—C2H5, or the like.




embedded image


As used herein, the term “acyl” refers to, wherein R is alkyl, the alkyl is as defined above. When the number of carbon atoms is limited in front of the acyl (e.g, C2-C6 acyl), it refers to the number of carbon atoms (e.g., 2-6) in the acyl, for example, C2-C6 acyl refers to acyl having 2-6 carbon atoms. For example, the C2-C4 acyl refers to C1-C3 alkyl —C(O)—, representative examples comprises but are not limited to CH3C(O)—, C2H5C(O)—, or the like.


As used herein, the term “—C(O)—” and




embedded image


are used interchangeably.


As used alone or as part of other substituent, the term “amino” refers to —NH2.


As used alone or as part of other substituent, the term ‘nitro’ refers to —NO2.


As used alone or as part of other substituent, the term “cyano” refers to —CN.


As used alone or as part of other substituent, the term “hydroxyl” refers to —OH.


As used alone or as part of other substituent, the term “sulfhydryl” refers to —SH.


As used herein, the term “(R20R21)N—” and




embedded image


are used interchangeably.


As used herein, “R3 and R4, or R4 and R5 are connected to form a substituted or unsubstituted 3-12 membered heterocycloalkane ring” means that R3 and R4 are connected to form a substituted or unsubstituted 3-12 membered heterocycloalkane ring, or R4 and R5 are connected to form a substituted or unsubstituted 3-12 membered heterocycloalkane ring, and the like.


In present invention, it should be understood that all substituents are unsubstituted, unless explicitly described herein as “substituted”. The “substituted” means that one or more hydrogen atoms on group are substituted by a substituent. The substituent is the substituent as described above or the substituent in each Example. Preferably, each “substituted” means that one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms on the ring or group are independently substituted by substituent selected from the group consisting of C1-C10 alkyl, C2-C6 alkenyl, C1-C10 haloalkyl, C3-C8 halocycloalkyl, C3-C8 cycloalkoxyl, C3-C8 cycloalkylthio, C3-C8 halocycloalkoxyl, C3-C8 halocycloalkylthio, halogen, nitro, —CN, carbonyl (═O), hydroxyl, sulfhydryl, amino, C1-C4 carboxyl, C2-C8 ester group, C2-C4 amide group, C2-C6 acyl, C1-C10 alkoxyl, C1-C10 alkylthio, C1-C10 haloalkoxyl, C1-C10 haloalkylthio, C6-C12 aryl, C6-C12 aryl-O—, 5-10 membered heteroaryl, 5-10 membered heteroaryl-O—, 5-10 membered heterocycloalkyl, (R20R21)N—.


In the present invention, the term “prevention” refers to a method of preventing the occurrence of disease and/or its accompanying symptoms, or protecting a subject from getting disease. The term ‘prevention’ also comprises delaying the occurrence of disease and/or its accompanying symptoms and reducing the risk of getting disease for subject.


In the present invention, the term “treatment” comprises delaying and terminating the progression of the disease, or eliminating the disease, and it does not require 100% inhibition, elimination and reversal. In some embodiments, compared to the level observed in the absence of the compound of present invention, the compound of present invention alleviates, inhibits and/or reverses related disease (e.g., tumor) and its accompanying symptoms, for example, by at least about 10%, at least about 30%, at least about 50%, at least about 80%, at least about 90%, or 100%.


Compound

As used herein, the terms “compound of the present invention”, “compound of formula I of the present invention” and “compound of formula I” are used interchangeably, and refer to a compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof. It should be understood that the term also comprises a mixture of the above components.




embedded image


Specifically, the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof is as described above in the first aspect of the present invention.


In the present invention, the configuration of the compound of formula I can be racemate, R configuration (rectus) or S configuration (sinister). The structure and determination method of the racemate, R configuration (rectus) or S configuration (sinister) of the compound of the present invention are well known to the skilled in the art. For example, the structure of the racemate, R configuration (rectus) or S configuration (sinister) of a compound is as follows:













racemate
R configuration (rectus) or S configuration (sinister)



















embedded image




embedded image




embedded image











The racemate, R configuration (rectus) or S configuration (sinister) of other compounds is the like.


Typically, the compound of formula I of the present invention is the compound (comprising salt thereof or free form without salt root) prepared in the Examples of the present invention.


The compound of formula I of the present invention can be prepared using the known organic synthesis method in the art.


The term “pharmaceutically acceptable salt” refers to a salt formed by the compound of the present invention and an acid or a base, the salt is suitable for use as a drug. Pharmaceutically acceptable salt comprises inorganic salt and organic salt. A preferred type of salt is the salt formed by the compound of the present invention and an acid. Acids suitable for salt formation comprise but are not limited to inorganic acid such as hydrochloric acid, hydrobromic acid, hydrofluoric acid, sulfuric acid, nitric acid, phosphoric acid and the like; organic acid such as formic acid, acetic acid, trifluoroacetic acid, trifluoroformic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid and the like; and acidic amino acid such as aspartic acid and glutamic acid. A preferred type of salt is a metal salt formed by the compound of the present invention and a base. Bases suitable for salt formation comprise but are not limited to inorganic base such as sodium hydroxide, potassium hydroxide, sodium carbonate, sodium bicarbonate, sodium phosphate and the like; and organic base such as ammonia, triethylamine, diethylamine and the like.


The compound of formula I in present invention can be converted into its pharmaceutically acceptable salt using conventional methods. For example, a solution of corresponding acid can be added into the solution of above compounds, and the solvent is removed after the salt is formed, thereby forming the corresponding salt of the compound of the present invention.


The compounds of the present invention is preferably prepared as described in the Examples of the present invention.


Mitochondria Permeability Transition Pore

In present invention, the mitochondria permeability transition pore is abbreviated as mPTP.


The compound of present invention has significantly excellent treatment effect on tumor with low expression, no expression, low activity or no activity of mitochondria permeability transition pore, the tumor with low expression, no expression, low activity or no activity of mitochondria permeability transition pore is sensitive to the compound of present invention.


Preferably, the tumor with low expression, no expression, low activity or no activity of mitochondria permeability transition pore is as described above in the third aspect of the invention.


In the present invention, the expression level or activity of mitochondria permeability transition pore can be determined using conventional methods, such as measuring the activity of mPTP, or measuring the expression level of mPTP at the protein or mRNA level.


Peptidyl-Prolyl Cis-Trans Isomerase F

In present invention, the peptidyl-prolyl cis-trans isomerase F is abbreviated as PPIF.


The compound of present invention has significantly excellent treatment effect on tumor with low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F, the tumor with low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F is sensitive to the compound of present invention.


Preferably, the tumor with low expression, no expression, low activity or no activity of mitochondria permeability transition pore is as described above in the third aspect of the invention.


In the present invention, the expression level or activity of mitochondria permeability transition can be determined using conventional methods, such as measuring the activity of mPTP, or measuring the expression level of mPTP at the protein or mRNA level.


Tumor

The compound of present invention can be used for preventing and/or treating tumor.


As used herein, the term “tumor” and “cancer” are used interchangeably.


In a preferred embodiment of the present invention, the tumor comprises tumor with low expression, no expression, low activity or no activity of mitochondria permeability transition pore. Typically, the tumor with low expression, no expression, low activity or no activity of mitochondria permeability transition pore is as described above in the third aspect of the present invention.


In a preferred embodiment of the present invention, the tumor comprises tumor with low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F. Typically, the tumor with low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F is as described above in the third aspect of the present invention.


Typically, the tumor of present invention is as described above in the third aspect of the present invention.


In present invention, the type of tumors corresponding to tumor cell lines are shown in Table 1












TABLE 1







Tumor cell line
The corresponding type of tumor









Daoy cell
Human medulloblastoma cell










Anti-Tumor Drug

The anti-tumor drug can be the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof of the present invention.


Use

A use of the compound of formula I of the present invention for preventing and/or treating tumor is provided.


Specifically, the compound of present invention has remarkable and excellent prevention and treatment effect on tumor with low expression, no expression, low activity or no activity of mitochondria permeability transition pore, and/or low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F. That is, the tumor with low expression, no expression, low activity or no activity of mitochondria permeability transition pore, and/or low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F is highly sensitive to the compound of the present invention. The expression level or activity of mitochondria permeability transition pore, and/or expression level or activity of peptidyl-prolyl cis-trans isomerase F can be used as a marker for determining whether the compound of the present invention is suitable for use in the precision treatment on tumor, the biomarker can be used to effectively identify patient tumor sensitive to the compound of the present invention, improve treatment effects and avoid administrating the compound of the present invention to patient tumor insensitive to the compound of the present invention, thereby achieving precision treatment on tumor.


The present invention further provides a method for preventing and/or treating tumor, which comprises administering the compound of the present invention to a subject in need.


The compound of present invention has more remarkable and excellent prevention and treatment effect on tumor with low expression, no expression, low activity or no activity of mitochondria permeability transition pore, and/or low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F, therefore, during the prevention and/or treatment of tumor, firstly administering mitochondria permeability transition pore inhibitor, and/or peptidyl-prolyl cis-trans isomerase F inhibitor to achieve low expression, no expression, low activity or no activity of mitochondria permeability transition pore, and/or low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F in the subject tumor, then administering the compound of the present invention to prevent and/or treat tumor, thereby enhancing the treatment effect of the compound of the present invention on tumor. Therefore, the present invention develops a compound that can significantly enhance anti-tumor effects when combined with mitochondria permeability transition pore inhibitor, and/or peptidyl-prolyl cis-trans isomerase F inhibitor. The compound of the present invention can be combined with mitochondria permeability transition pore inhibitor, and/or peptidyl-prolyl cis-trans isomerase F inhibitor to significantly enhance the treatment effect of the compound of the present invention on tumor.


In another preferred embodiment, the subject is human and non-human mammals (rodent, rabbit, monkey, livestock, dog, cat, etc.).


In the present invention, there are no special limitations to the method for achieving low expression, no expression, low activity or no activity of mitochondria permeability transition pore, and/or low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F in the tumor. For example, the expression and activity of mitochondria permeability transition pore and/or peptidyl-prolyl cis-trans isomerase F can be specifically inhibited using methods such as gene knockout, or gene silencing (e.g, shRNA transfection), etc.


In another preferred embodiment, the peptidyl-prolyl cis-trans isomerase F inhibitor comprises shRNA.


Preferably, the nucleotide sequence of shRNA is GTTCTTCATCTGCACCATAAA.


Marker

The present invention provides a marker for determining whether the compound of present invention is suitable for use in the prevention and/or treatment of patient tumor, the marker comprises the expression level or activity of mitochondria permeability transition pore, and/or expression level or activity of peptidyl-prolyl cis-trans isomerase F.


In a preferred embodiment, the expression level or activity of mitochondria permeability transition pore, and/or expression level or activity of peptidyl-prolyl cis-trans isomerase F are used as a marker for determining whether the compound of present invention is suitable for use in the prevention and/or treatment of patient tumor, the method comprises as follows:

    • the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention is suitable for use in the prevention and/or treatment of patient tumor with low expression, no expression, low activity or no activity of mitochondria permeability transition pore, and/or low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F; and/or
    • the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention is not suitable for use in the prevention and/or treatment of patient tumor with high expression or high activity of mitochondria permeability transition pore, and/or high expression or high activity of peptidyl-prolyl cis-trans isomerase F.


Preferably, “the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention is suitable for use in the prevention and/or treatment of patient tumor” comprises “the patient tumor is sensitive to the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention”.


Preferably, “the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention is not suitable for use in the prevention and/or treatment of patient tumor” comprises “the patient tumor is not sensitive to the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present invention”.


Specifically, the tumor with low expression, no expression, low activity or no activity of mitochondria permeability transition pore, and/or low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F is as described above in the third aspect of the present invention.


Specifically, the tumor with high expression or high activity of mitochondria permeability transition pore, and/or high expression or high activity of peptidyl-prolyl cis-trans isomerase F is as described above in the fourth aspect of the present invention.


The present invention further provides a use of the marker (or the expression level of marker) or its detection reagent in the preparation of reagent kit for determining whether the compound of the present invention is suitable for use in the prevention and/or treatment of patient tumor.


Composition or Preparation, Active Ingredient Combination, Medical Kit and Administration Method

Preferably, the composition or preparation of the present invention is pharmaceutical composition or pharmaceutical preparation. The compositions of the present invention can comprise a pharmaceutically acceptable carrier.


The term “pharmaceutically acceptable carrier” refers to one or more compatible solid, semi-solid, liquid or gel fillers, which are suitable for use in human or animal and must have sufficient purity and sufficiently low toxicity. The “compatible” means each component and active ingredient in the composition or preparation can be blended with each other without significantly reducing the efficacy.


It should be understood that the pharmaceutically acceptable carrier is not particularly limited in the present invention, the carrier can be selected from materials commonly used in the art, or can be obtained by a conventional method, or is commercially available. Some examples of pharmaceutically acceptable carriers are cellulose and its derivatives (e.g., methylcellulose, ethylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, etc.), gelatin, talc, solid lubricants (e.g., stearic acid, magnesium stearate), calcium sulfate, plant oil (e.g., soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (e.g., propylene glycol, glycerin, mannitol, sorbitol, etc.), emulsifier (e.g., Tween), wetting agent (e.g., sodium lauryl sulfate), buffer agent, chelating agent, thickener, pH regulator, transdermal enhancer, colorant, flavoring agent, stabilizer, antioxidant, preservative, bacteriostatic agent, pyrogen-free water, etc.


In a preferred embodiment of the present invention, the dosage form of the composition or preparation is a solid preparation, liquid preparation or semi-solid preparation.


In a preferred embodiment of the present invention, the dosage form of the composition or preparation is oral preparation, external preparation or injection preparation Typically, the dosage form of the composition or preparation is tablet, injection, infusion, paste, gel, solution, microsphere or film.


The pharmaceutical preparation should be matched with the mode of administration. The pharmaceutical preparation of the present invention can also be given together with other synergistic therapeutic drugs before, during or after the administration. When the pharmaceutical composition or preparation is administrated, a safe and effective amount of the drug is administered to a subject in need (e.g. human or non-human mammal). The safe and effective amount is usually at least about 10 μg/kg·bw, and does not exceed about 8 μg/kg·bw in most case, preferably, the dose is about 10 μg/kg·bw to 1 mg/kg·bw. Of course, the specific dose should also take into account the route of administration, the patient's health and other factors, which are within the skill range of skilled doctors.


The main advantages of the present invention comprise:


The present has developed a compound, the compound has excellent precision treatment effect on tumor with low expression, no expression, low activity or no activity of mitochondria permeability transition pore, and/or low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F. The tumor with low expression, no expression, low activity or no activity of mitochondria permeability transition pore, and/or low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F is highly sensitive to the compound of present invention, ie, the compound of present invention has more remarkable and excellent treatment effect on tumor with low expression, no expression, low activity or no activity of mitochondria permeability transition pore, and/or low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F. Therefore, the compound of present invention can realize precise treatment on tumor with low expression, no expression, low activity or no activity of mitochondria permeability transition pore, and/or low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F, thus improving the treatment effect of the compound of present invention on tumor and avoiding administrating the compound of present invention to patient tumor insensitive to such anti-tumor drug. Therefore, the precision treatment of the compound of the present invention on tumor with low expression, no expression, low activity or no activity of mitochondria permeability transition pore, and/or low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F has advantages such a more excellent prevention and treatment effect on tumors, low drug dose, and minimal side effects, which improve the precision prevention and treatment effect on tumor, reduce the side effects and improve patient compliance. Moreover, the method for detecting the expression and activity of mitochondria permeability transition pore and peptidyl-prolyl cis-trans isomerase F is stable and reliable, which is suitable for the development of biomarker.


The present invention will be further illustrated below with reference to the specific examples. It should be understood that the following specific Examples are based on the technical solution and provide detailed implementation methods and specific operation processes, but the scope of protection of the present invention is not limited to the Example.


EXAMPLE

Mitochondria permeability transition pore was abbreviated as mPTP.


Peptidyl-prolyl cis-trans isomerase F was abbreviated as PPIF.


Example 1 Synthesis of Compound AB31866

The structure of compound AB31866 was as follows:




embedded image


The synthesis method of compound AB31866 was as follows:




embedded image


Compound 1 (100 mg, 0.29 mmol, 1 eq) and compound 2 (122 mg, 0.58 mmol, 2.0 eq) were dissolved in acetonitrile (4 mL), and sodium iodide (87 mg, 0.58 mmol, 2.0 eq) was added. The mixture was reacted at 80° C. for 30 min under microwave condition, and the reaction was detected to be performed completely using LCMS. The reaction mixture was diluted with water and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.01% formic acid) to afford compound AB31866.


Compound AB31866:

MS-ESI: calculated [M+H]+:512.16, Found: 512.10.



1H NMR (400 MHz, CDCl3) δ 7.24 (s, 1H), 7.09 (d, J=8.0 Hz, 2H), 7.01-6.93 (m, 4H), 6.77 (s, 1H), 6.08 (d, J=12.0 Hz, 2H), 5.66 (d, J=20.0 Hz, 1H), 5.06 (d, J=20.0 Hz, 1H), 4.90-4.86 (m, 1H), 4.48-4.44 (m, 1H), 4.07-3.98 (m, 1H), 3.94 (s, 3H), 3.89 (m, 3H), 3.49-3.43 (m, 1H), 3.28-3.23 (m, 1H), 309-3.02 (m, 1H).


Example 2 Synthesis of Compound AB31870

The structure of compound AB31870 was as follows:




embedded image


The synthesis method of compound AB31870 was as follows:




embedded image


Compound 1 (100 mg, 0.29 mmol, 1 eq) and compound 2 (97 mg, 0.58 mmol, 2.0 eq) were dissolved in acetonitrile (4 mL), and sodium iodide (87 mg, 0.58 mmol, 2.0 eq) was added. The mixture was reacted at 80° C. for 30 min under microwave condition, and the reaction was detected to be performed completely using LCMS. The reaction mixture was diluted with water and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.01% formic acid) to afford compound AB31870.


Compound AB31870:

MS-ESI: Calculated [M+H]+: 470.23, Found: 470.20.



1H NMR (400 MHz, CDCl3) δ 7.52 (s, 1H), 7.08 (d, J=8.0 Hz, 1H), 6.98 (d, J=8.0 Hz, 3H), 6.86 (s, 1H), 6.55 (d, J=8.0 Hz, 2H), 6.13 (s, 2H), 5.04-4.92 (m, 2H), 4.17-4.13 (m, 2H), 3.89 (s, 3H), 3.85 (m, 3H), 3.36-3.17 (m, 4H), 2.86-2.79 (m, 1H), 1.17 (d, J=8.0 Hz, 6H).


Example 3 Synthesis of Compound AB31873

The structure of compound AB31873 was as follows:




embedded image


The synthesis method of compound AB31873 was as follows:


Step (1):



embedded image


Compound 1 (1.0 g, 2.69 mmol, 1 eq) was dissolved in acetic acid (10 mL), and bromine (2.1 g, 13.45 mmol, 5 eq) was added slowly. The mixture was reacted at 120° C. for 4 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was diluted with water and then extracted with dichloromethane twice, the organic phase was washed with brine once, dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by fast chromatography (100-200 mesh silica gel, DCM/MeOH=30/1) to afford compound 2.


MS-ESI: Calculated [M]+415.04, Found: 413.95.


Step (2):



embedded image


Compound 2 (200 mg, 0.40 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and butylmagnesium bromide (0.4 mL, 1.2 mmol, 5 eq, 3M) was added slowly at 0° C. under N2. The mixture was reacted for 0.5 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by thin layer chromatography (DCM:MeOH=30:1) to afford compound AB31873.


Compound AB31873:

MS-ESI: Calculated [M+H]+: 472.11, Found: 472.10.



1H NMR (400 MHz, CDCl3) δ 7.23 (s, 1H), 6.97 (s, 1H), 6.60 (s, 1H), 6.02 (s, 1H), 5.95 (d, J=4.0 Hz, 2H), 4.70-4.67 (m, 1H), 3.86 (s, 3H), 3.83 (s, 3H), 3.48-3.45 (m, 1H), 3.33-3.30 (m, 1H), 2.88-2.80 (m, 2H), 1.71-1.64 (m, 2H), 1.25-1.17 (m, 4H), 0.82-078 (m, 3H).


Example 4 Synthesis of Compound AB31880

The structure of compound AB31880 was as follows:




embedded image


The synthesis method of compound AB31880 was as follows:


Step (1):



embedded image


Compound 2 (300 mg, 0.70 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and hexylmagnesium bromide (3.5 mL, 3.50 mmol, 5 eq, 1M/L) was added slowly at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by thin layer chromatography (dichloromethane:methanol=50:1) to afford compound AB31880.


Compound AB31880:

MS-ESI: Calculated [M+H]+: 436.24, Found: 436.20.



1H NMR (400 MHz, CDCl3) δ 7.19 (s, 1H), 6.75-6.68 (m, 2H), 6.62 (s, 1H), 5.81 (s, 1H), 4.70-4.67 (m, 1H), 4.26 (s, 4H), 3.87 (s, 3H), 3.84 (s, 3H), 3.46-3.45 (m, 1H), 3.31-3.29 (m, 1H), 2.87-2.78 (m, 2H), 1.75-1.50 (m, 4H), 1.38-1.26 (m, 6H), 0.82-0.79 (m, 3H).


Example 5 Synthesis of Compound AB31881

The structure of compound AB31881 was as follows:




embedded image


The synthesis method of compound AB31881 was as follows:


Step (1):



embedded image


The compound 0 (10.0 g, 26.89 mmol, 1 eq) was added in a 500 mL eggplant-shaped flask, and heated at 190° C. for 8 h under vacuum, the reaction was detected to be performed completely using LCMS to afford compound 1.


MS-ESI: Calculated [M]+: 322.11, Found: 322.30.


Step (2):



embedded image


Compound 1 (500 mg, 1.40 mmol, 1 eq) and compound 1 (642 mg, 2.80 mmol, 2.0 eq) were dissolved in acetonitrile (10 mL). The mixture was reacted at 80° C. for overnight under N2, and the reaction was detected to be performed completely using LCMS. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by fast chromatography (100-200 mesh silica gel, DCM/MeOH=50/1) to afford compound 3.


MS-ESI: Calculated [M]+: 470.20, Found: 470.10.


Step (3):



embedded image


Compound 3 (200 mg, 0.36 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and methylmagnesium bromide (0.6 mL, 1.8 mmol, 5 eq, 3M) was added slowly at 0° C. under N2. The mixture was reacted for 0.5 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by thin layer chromatography (DCM:MeOH=30:1) to afford compound AB31881.


Compound AB31881:

MS-ESI: Calculated [M+H]+: 486.22, Found: 486.20.



1H NMR (400 MHz, CDCl3) δ 7.31-7.27 (m, 2H), 7.16 (s, 1H), 6.96-6.92 (m, 3H), 6.73 (s, 2H), 6.59 (s, 1H), 5.94 (s, 2H), 5.86 (s, 1H), 4.87-4.82 (m, 1H), 4.20-4.14 (m, 1H), 4.10-4.07 (m, 3H), 3.82 (s, 3H), 3.42-3.36 (m, 1H), 3.21-3.18 (m, 1H), 2.95-2.88 (m, 1H), 2.78-2.74 (m, 1H), 2.06-1.98 (m, 4H), 1.18 (d, J=8.0 Hz, 3H).


Example 6 Synthesis of Compound AB31887

The structure of compound AB31887 was as follows:




embedded image


The synthesis method of compound AB31887 was as follows:


Step (1):



embedded image


The compound 0 (10.0 g, 26.89 mmol, 1 eq) was added in a 500 mL eggplant-shaped flask, and heated at 190° C. for 8 h under vacuum, the reaction was detected to be performed completely using LCMS to afford compound 1.


MS-ESI: Calculated [M]+: 322.11, Found: 322.30.


Step (2):



embedded image


Compound 1 (500 mg, 1.40 mmol, 1 eq) and compound 2 (565 mg, 2.80 mmol, 2.0 eq) were dissolved in acetonitrile (10 mL). The mixture was reacted at 80° C. for overnight under N2, and the reaction was detected to be performed completely using LCMS. The reaction mixture was diluted with water and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by fast chromatography (100-200 mesh silica gel, DCM/MeOH=50/1) to afford compound 3.


MS-ESI: Calculated [M]+: 444.06, Found: 444.00.


Step (3):



embedded image


Compound 3 (160 mg, 0.30 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and methylmagnesium bromide (0.5 mL, 1.5 mmol, 5 eq, 3M) was added slowly at 0° C. under N2. The mixture was reacted for 0.5 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by thin layer chromatography (DCM:MeOH=30:1) to afford compound AB31887.


Compound AB31887:

MS-ESI: Calculated [M+H]+: 458.09, Found: 458.05.



1H NMR (400 MHz, CDCl3) δ 7.15 (s, 1H), 6.74 (s, 2H), 6.59 (s, 1H), 5.94 (s, 2H), 5.85 (s, 1H), 4.90-4.85 (m, 1H), 4.20-4.11 (m, 2H), 3.83 (s, 3H), 3.71-3.69 (m, 2H), 3.42-3.25 (m, 2H), 2.98-2.77 (m, 2H), 2.43-2.23 (m, 2H), 1.18 (d, J=4.0 Hz, 3H).


Example 7 Synthesis of Compound AB31888

The structure of compound AB31888 was as follows:




embedded image


The synthesis method of compound AB31888 was as follows:


Step (1):



embedded image


Compound 1 (300 mg, 0.84 mmol, 1 eq) and compound 2 (592 mg, 4.20 mmol, 5.0 eq) were dissolved in N, N-dimethylformamide (10 mL). The mixture was reacted at 80° C. for overnight under N2, and the reaction was detected to be performed completely using LCMS. The reaction mixture was diluted with water and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by fast chromatography (100-200 mesh silica gel, DCM:MeOH=50:1) to afford compound 3.


MS-ESI: Calculated [M]+: 443.18, Found: 443.05.


Step (2):



embedded image


Compound 3 (100 mg, 0.21 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and methylmagnesium bromide (0.4 mL, 1.5 mmol, 5 eq, 3M) was added slowly at 0° C. under N2. The mixture was reacted for 0.5 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by thin layer chromatography (DCM:MeOH=30:1) to afford compound AB31888.


Compound AB31888:

MS-ESI: Calculated [M+H]+: 456.19, Found: 456.15.



1H NMR (400 MHz, DMSO-d6) δ 7.25 (s, 1H), 6.81 (d, J=4.0 Hz, 2H), 6.77 (s, 1H), 6.66 (d, J=4.0 Hz, 1H), 6.00 (d, J=4.0 Hz, 2H), 5.93 (s, 1H), 4.77-4.73 (m, 1H), 3.97-3.94 (m, 2H), 3.75 (s, 3H), 3.68-3.64 (m, 2H), 3.27-3.21 (m, 2H), 2.84-2.74 (m, 2H), 1.78-1.70 (m, 4H), 1.49-1.45 (m, 4H), 1.05 (d, J=8.0 Hz, 3H).


Example 8 Synthesis of Compound AB31895

The structure of compound AB31895 was as follows:




embedded image


The synthesis method of compound AB31895 was as follows:


Step (1):



embedded image


Compound 1 (1.0 g, 2.69 mmol, 1 eq) was dissolved in ethanol (20 mL) in a 50 mL sealed tube, and phenylethylamine (326 mg, 26.9 mmol, 10 eq) was added. The mixture was reacted at 100° C. for 48 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was diluted with water and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by fast chromatography (dichloromethane:methanol=30:1) to afford compound 3.


MS-ESI: Calculated [M]+: 425.19, Found: 425.15.


Step (2):



embedded image


Compound 3 (190 mg, 0.41 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and methylmagnesium bromide (0.7 mL, 2.05 mmol, 5 eq, 3M) was added slowly at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by thin layer chromatography (dichloromethane:methanol=50:1) to afford compound AB31895.


Compound AB31895:

MS-ESI: Calculated [M+H]+: 441.21, Found: 441.20.



1H NMR (400 MHz, DMSO-d6) δ 7.28-7.18 (m, 6H), 6.72 (s, 1H), 6.68 (d, J=8.0 Hz, 1H), 6.48 (d, J=8.0 Hz, 1H), 5.96 (d, J=4.0 Hz, 2H), 5.87 (s, 1H), 4.54-4.50 (m, 1H), 3.68 (s, 3H), 3.18-3.04 (m, 5H), 2.76-2.73 (m, 4H), 0.91 (d, J=4.0 Hz, 3H).


Example 9 Synthesis of Compound AB31896

The structure of compound AB31896 was as follows:




embedded image


The synthesis method of compound AB31896 was as follows:


Step (1):



embedded image


Compound 1 (500 mg, 2.57 mmol, 1 eq) was dissolved in dichloromethane (10 mL) and cooled to 0° C., oxalyl chloride (1.6 g, 12.85 mmol, 5 eq) and two drops of N, N-dimethylformamide were added. The mixture was reacted at room temperature for 2 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was distilled under reduced pressure to afford compound 2.


MS-ESI: Calculated [M+H]+: 213.10, Found: not measured.


Step (2):



embedded image


Compound 3 (100 mg, 0.29 mmol, 1 eq) was dissolved in dichloromethane (10 mL), triethylamine (88 mg, 0.87 mmol, 3 eq) was added, the mixture was cooled to 0° C., and compound 2 (420 mg, 1.97 mmol, 6.8 eq) was added. The mixture was reacted at 0° C. for 0.5 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was diluted with water and then extracted with ethyl acetate, the organic phase was dried over sodium sulfate, filtered and rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.01% formic acid) to afford compound AB 31896.


MS-ESI: Calculated [M+H]+: 514.25, Found: 514.25.



1H NMR (400 MHz, DMSO-d6) δ 7.27 (s, 1H), 6.91-6.83 (m, 2H), 6.77 (s, 1H), 6.01 (s, 1H), 5.99 (s, 2H), 4.61-4.55 (m, 1H), 3.71 (s, 3H), 3.28-3.14 (m, 2H), 2.79-2.74 (m, 2H), 2.34 (s, 2H), 1.72-1.63 (m, 15H), 1.02 (d, J=8.0 Hz, 3H).


Example 10 Synthesis of Compound AB31897

The structure of compound AB31897 was as follows:




embedded image


The synthesis method of compound AB31897 was as follows:


Step (1):



embedded image


The compound 0 (10.0 g, 26.89 mmol, 1 eq) was added in a 500 mL eggplant-shaped flask, and heated at 190° C. for 8 h under vacuum, and the reaction was detected to be performed completely using LCMS to afford compound 1.


Step (2):



embedded image


Compound 1 (2 g, 5.59 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and methylmagnesium bromide (11.2 mL, 33.54 mmol, 6 eq, 3M) was added slowly at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by thin layer chromatography (dichloromethane:methanol=100:1 to 50:1) to afford compound 2.


Step (3):



embedded image


Compound 2 (300 mg, 0.89 mmol, 1 eq) was dissolved in acetonitrile (10 mL), and potassium carbonate (491 mg, 3.56 mmol, 4 eq) and compound 3 (868 mg, 3.56 mmol, 4 eq) were added. The mixture was reacted at 80° C. for overnight, and the reaction was detected to be performed completely using LCMS. The reaction mixture was diluted with water and then extracted with dichloromethane twice, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by fast chromatography (dichloromethane:methanol=50:1) to afford compound AB31897.


Compound AB31897:

MS-ESI: Calculated [M+H]+: 501.13, Found: 501.10.



1H NMR (400 MHz, DMSO-d6) δ 7.22 (s, 1H), 6.79-6.74 (m, 2H), 6.64 (d, J=12.0 Hz, 1H), 5.97 (d, J=4.0 Hz, 2H), 5.89 (s, 1H), 4.74-4.69 (m, 1H), 3.94-3.91 (m, 2H), 3.72 (s, 3H), 3.55-3.51 (m, 2H), 3.25-3.15 (m, 2H), 2.79-2.68 (m, 2H), 1.85-1.79 (m, 2H), 1.72-1.65 (m, 2H), 1.44 (s, 4H), 1.03 (d, J=4.0 Hz, 3H).


Example 11 Synthesis of Compound AB31898

The structure of compound AB31898 was as follows:




embedded image


The synthesis method of compound AB31898 was as follows:




embedded image


Compound 1 (200 mg, 0.52 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and methylmagnesium bromide (2.7 mL, 2.7 mmol, 5 eq, 3M) was added slowly at 0° C. under N2. The mixture was reacted for 0.5 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by thin layer chromatography (DCM:MeOH=30:1) to afford compound AB31898.


Compound AB31898:

MS-ESI: Calculated [M+H]+: 366.17, Found: 366.10.



1H NMR (400 MHz, DMSO-d6) δ 7.11 (s, 1H), 6.81 (d, J=8.0 Hz, 1H), 6.68 (s, 1H), 6.67 (s, 1H), 5.87 (s, 1H), 4.77-4.73 (m, 1H), 4.23 (s, 4H), 3.77 (d, J=8.0 Hz, 6H), 3.28-3.20 (m, 2H), 2.79-2.66 (m, 2H), 1.05 (d, J=8.0 Hz, 3H).


Example 12 Synthesis of Compound AB35402

The structure of compound AB35402 was as follows:




embedded image




    • compound AB35402





The synthesis method of compound AB35402 was as follows:


Step (1):



embedded image


The compound 0 (10.0 g, 26.89 mmol, 1 eq) was added in a 500 mL eggplant-shaped flask, and heated at 190° C. for 8 h under vacuum, and the reaction was detected to be performed completely using LCMS to afford compound 1.


MS-ESI: Calculated [M+H]+: 322.11, Found: 322.30.


Step (2):



embedded image


Compound 1 (500 mg, 1.40 mmol, 1 eq) was dissolved in acetonitrile (10 mL), and potassium carbonate (773 mg, 5.6 mmol, 4 eq) and compound 2 (912 mg, 4.20 mmol, 3 eq) were added. The mixture was reacted at room temperature for overnight, and the reaction was detected to be performed completely using LCMS. The reaction mixture was diluted with water and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by fast chromatography (dichloromethane:methanol=30:1) to afford compound 3.


MS-ESI: Calculated [M]+: 458.23, Found: 458.30.


Step (3):



embedded image


Compound 3 (200 mg, 0.37 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and methylmagnesium bromide (0.6 mL, 1.85 mmol, 5 eq, 3M) was added slowly at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by thin layer chromatography (dichloromethane:methanol=50:1) to afford compound AB35402.


Compound AB35402:

MS-ESI: Calculated [M+H]+: 474.26, Found: 474.35.



1H NMR (400 MHz, DMSO-d6) δ 7.24 (s, 1H), 6.821 (d, J=8.0 Hz, 1H), 6.77 (s, 1H), 6.67 (d, J=12.0 Hz, 1H), 6.03 (s, 2H), 5.92 (s, 1H), 5.51-5.48 (m, 1H), 5.10-5.05 (m, 1H), 4.76-4.73 (m, 1H), 4.54-4.46 (m, 2H), 3.76 (s, 3H), 3.29-3.15 (m, 2H), 2.78-2.66 (m, 2H), 2.09-1.99 (m, 4H), 1.63 (s, 6H), 1.55 (s, 3H), 1.03 (d, J=4.0 Hz, 3H).


Example 13 Synthesis of Compound AB35405

The structure of compound AB35405 was as follows:




embedded image


The synthesis method of compound AB35405 was as follows:


Step (1):



embedded image


Compound 1 (200 mg, 0.37 mmol, 1 eq) was dissolved in chloroform (5 mL), and aqueous ammonia (2 mL) was added. The mixture was reacted at room temperature for overnight, and the reaction was detected to be performed completely using LCMS. The reaction mixture was diluted and extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by fast chromatography (PE:EA=200:1) to afford compound AB35405.


Compound AB35405:

MS-ESI: Calculated [M+H]+: 576.14, Found: 576.15.



1H NMR (400 MHz, CDCl3) δ 7.17 (s, 1H), 6.98-6.86 (m, 2H), 6.62 (s, 1H), 6.10 (s, 1H), 5.95 (d, J=4.0 Hz, 2H), 5.67 (s, 1H), 5.57-5.53 (m, 1H), 5.10-5.06 (m, 1H), 4.72-4.56 (m, 2H), 3.89-3.83 (m, 4H), 3.69-3.64 (m, 1H), 3.37-3.32 (m, 1H), 2.74-2.70 (m, 1H), 2.11-2.03 (m, 4H), 1.66 (d, J=8.0 Hz, 6H), 1.58 (s, 3H).


Example 14 Synthesis of Compound AB35407

The structure of compound AB35407 was as follows:




embedded image


The synthesis method of compound AB35407 was as follows:


Step (1):



embedded image


The compound 0 (10.0 g, 26.89 mmol, 1 eq) was added in a 500 mL eggplant-shaped flask, and heated at 190° C. for 8 h under vacuum, and the reaction was detected to be performed completely using LCMS to afford compound 1.


MS-ESI: Calculated [M]+: 322.11, Found: 322.30.


Step (2):



embedded image


Compound 1 (600 mg, 1.67 mmol, 1 eq) was dissolved in N, N-dimethylformamide (10 mL), and potassium carbonate (926 mg, 6.71 mmol, 4 eq) and compound 2 (1.9 g, 6.71 mmol, 4 eq) were added. The mixture was reacted at 60° C. for overnight under N2, and the reaction was detected to be performed completely using LCMS. The reaction mixture was diluted with water and then extracted with ethyl acetate twice, the phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by fast chromatography (dichloromethane:methanol=50:1) to afford compound 3.


MS-ESI: Calculated [M]+: 521.26, Found: 521.30.


Step (3):



embedded image


Compound 3 (200 mg, 0.33 mmol, 1 eq) was dissolved in a mixture of chloroform (5 mL) and aqueous ammonia (2 mL). The mixture was reacted at 40° C. for 48 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by fast chromatography (PE:EA=200:1) to afford compound AB35407.


MS-ESI: Calculated [M+H]+: 639.18, Found: 639.15.



1H NMR (400 MHz, CDCl3) δ 7.16 (s, 1H), 6.97-6.85 (m, 2H), 6.62 (s, 1H), 6.08 (s, 1H), 5.95 (d, J=4.0 Hz, 2H), 5.62 (s, 1H), 4.52 (s, 1H), 4.28-4.23 (m, 1H), 3.89-3.82 (m, 5H), 3.69-3.67 (m, 1H), 3.36-3.31 (m, 1H), 3.16-3.09 (m, 2H), 2.76-2.72 (m, 1H), 1.83-1.69 (m, 4H), 1.58-1.51 (m, 4H), 1.44 (s, 9H).


Example 15 Synthesis of Compound AB35411

The structure of compound AB35411 was as follows:




embedded image


The synthesis method of compound AB35411 was as follows:


Step (1):



embedded image


Compound 1 (2.0 g, 5.93 mmol, 1 eq) was dissolved in ethanol/acetic acid (10 mL/8 mL), and benzaldehyde (7.9 g, 59.3 mmol, 10 eq) was added. The mixture was reacted at 80° C. for 4 h, an appropriate amount of hydrochloric acid was added, and the mixture was concentrated. To crude product was added a small amount of dichloromethane and an appropriate amount of ethyl acetate, the mixture was stewed for 0.5 h and then filtered to remove solid. The filtrate was stewed for overnight to precipitate a solid, the solid was filtered and collected to afford compound 3 (1.4 g).


Step (2):



embedded image


Compound 3 (200 mg, 0.41 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and methylmagnesium bromide (0.7 mL, 2.05 mmol, 5 eq, 3M) was added at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was washed with brine, dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by thin layer chromatography (DCM/MeOH=20/1) to afford compound AB35411.


Compound AB35411:

MS-ESI: Calculated [M+H]+: 470.23; Found [M+H]+: 470.30.



1H NMR (400 MHz, CDCl3) δ 7.34-7.28 (m, 2H), 7.24-7.16 (m, 3H), 6.97 (s, 1H), 6.90-6.76 (m, 2H), 6.65 (s, 1H), 5.97-5.96 (m, 2H), 4.77-4.73 (m, 1H), 3.89 (s, 3H), 3.86 (s, 3H), 3.24-3.22 (m, 2H), 2.84-2.65 (m, 6H), 2.14-2.08 (m, 1H), 1.90-1.81 (m, 1H), 1.07 (d, J=4.0 Hz, 3H).


Example 16 Synthesis of Compound AB35413

The structure of compound AB35413 was as follows:




embedded image


The synthesis method of compound AB35413 was as follows:




embedded image


Compound 1 (100 mg, 0.28 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and methylmagnesium bromide (0.5 mL, 1.4 mmol, 5 eq, 3M) was added at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was washed with brine, dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by thin layer chromatography (DCM/MeOH=30/1) to afford compound AB35413.


Compound AB35413:

MS-ESI: Calculated [M+H]+: 336.12; Found[M+H]+: 336.10.



1H NMR (400 MHz, DMSO-d6) δ 7.25 (s, 1H), 6.78 (s, 1H), 6.79 (d, J=8.0 Hz, 1H), 6.46 (d, J=8.0 Hz, 1H), 6.04 (s, 1H), 6.00 (d, J=4.0 Hz, 2H), 5.94 (s, 1H), 5.89 (s, 1H), 4.71-4.66 (m, 1H), 3.28-3.20 (m, 2H), 2.83-2.70 (m, 2H), 1.11 (d, J=8.0 Hz, 3H).


Example 17 Synthesis of Compound AB35415

The structure of compound AB35415 was as follows:




embedded image


The synthesis method of compound AB35415 was as follows:




embedded image


Compound 1 (200 mg, 0.59 mmol, 1 eq) was dissolved in N, N-dimethylformamide (10 mL), and potassium carbonate (326 mg, 2.36 mmol, 4 eq) and compound 2 (661 mg, 2.36 mmol, 4 eq) were added. The mixture was reacted at 60° C. for overnight, the reaction mixture was diluted with water and then extracted with ethyl acetate twice, the organic phase was washed with brine, dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.01% formic acid) to afford compound AB35415.


Compound AB35415:

MS-ESI: Calculated [M+H]+: 537.29; Found [M+H]+: 537.35.



1H NMR (400 MHz, CDCl3) δ 7.15 (s, 1H), 6.72 (s, 2H), 6.59 (s, 1H), 5.94 (s, 2H), 5.85 (s, 1H), 4.85-4.80 (m, 1H), 4.53 (s, 1H), 4.05-4.09 (m, 2H), 3.82 (s, 3H), 3.44-3.39 (m, 1H), 3.24-3.14 (m, 3H), 2.98-2.77 (m, 2H), 1.82-1.79 (m, 2H), 1.55-1.50 (m, 4H), 1.44 (s, 11H), 1.17 (d, J=8.0 Hz, 3H).


Example 18 Synthesis of Compound AB35416

The structure of compound AB35416 was as follows:




embedded image


The synthesis method of compound AB35416 was as follows:




embedded image


Compound 1 (200 mg, 0.33 mmol, 1 eq) was dissolved in chloroform (5 mL), and aqueous ammonia (2 mL) was added. The mixture was reacted at 40° C. for 48 h. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was washed with brine, dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by thin layer chromatography (PE/EA=10/1) to afford compound AB35416.


Compound AB35416

MS-ESI: Calculated [M+H]+: 583.11; Found [M+H]+: 583.10.



1H NMR (400 MHz, CDCl3) δ 7.16 (s, 1H), 6.97-6.89 (m, 2H), 6.62 (s, 1H), 6.09 (s, 1H), 5.96 (s, 2H), 5.64 (s, 1H), 4.34 (s, 1H), 4.24 (s, 1H), 3.96-3.87 (m, 5H), 3.71 (s, 1H), 3.56-3.49 (m, 2H), 3.35-3.30 (m, 1H), 2.76-2.73 (m, 1H), 1.47 (s, 9H)


Example 19 Synthesis of Compound AB35417

The structure of compound AB35417 was as follows:




embedded image


The synthesis method of compound AB35417 was as follows:




embedded image


Compound 1 (200 mg, 0.41 mmol, 1 eq) was dissolved in chloroform (5 mL), and aqueous ammonia (2 mL) was added. The mixture was reacted at room temperature for 24 h. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was washed with brine, dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by thin layer chromatography (PE/EA=10/1) to afford compound AB35417.


Compound AB35417

MS-ESI: Calculated [M+H]+: 572.11; Found [M+H]+: 572.1.



1H NMR (400 MHz, CDCl3) δ 7.32-7.30 (m, 2H), 7.24-7.20 (m, 3H), 6.99-6.90 (m, 2H), 6.85 (s, 1H), 6.68 (s, 1H), 5.99 (s, 2H), 5.58 (s, 1H), 4.09-4.03 (m, 1H), 3.93 (s, 3H), 3.90 (s, 3H), 3.46-3.44 (m, 1H), 2.75-2.56 (m, 6H), 2.12-2.04 (m, 1H), 1.88-1.77 (m, 1H).


Example 20 Synthesis of Compound AB35418

The structure of compound AB35418 was as follows:




embedded image


The synthesis method of compound AB35418 was as follows:




embedded image


Compound 1 (200 mg, 0.45 mmol, 1 eq) was dissolved in chloroform (5 mL), and aqueous ammonia (2 mL) was added. The mixture was reacted at room temperature for overnight. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was washed with brine, dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by thin layer chromatography (PE/EA=10/1) to afford compound AB35418.


Compound AB35418

MS-ESI: Calculated [M+H]+: 524.11; Found [M+H]+: 524.15.



1H NMR (400 MHz, DMSO-d6) δ 7.13-7.04 (m, 2H), 6.91 (s, 1H), 6.68 (s, 1H), 5.99 (s, 2H), 5.60 (s, 1H), 4.11-4.05 (m, 1H), 3.94 (s, 3H), 3.91 (s, 3H), 3.47-3.45 (m, 1H), 2.73-2.53 (m, 4H), 1.82-1.74 (m, 1H), 1.46-1.38 (m, 5H), 0.95-0.92 (m, 3H).


Example 21 Synthesis of Compound AB35420

The structure of compound AB35420 was as follows:




embedded image


The synthesis method of compound AB35420 was as follows:


Step (1):



embedded image


Compound 1 (5.0 g, 13.97 mmol, 1 eq) and compound 2 (21.0 g, 111.76 mmol, 8 eq) were dissolved in N, N-dimethylformamide (50 mL). The mixture was reacted at 60° C. for overnight. The reaction mixture was diluted with water and then extracted with dichloromethane twice, the organic phase was washed with brine, dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=50/1 to 20/1) to afford compound 3.


Step (2):



embedded image


Compound 3 (250 mg, 0.49 mmol, 1 eq) and compound 4 (167 mg, 1.96 mmol, 4 eq) were dissolved in N, N-dimethylformamide (10 mL), and potassium carbonate (270 mg, 1.96 mmol, 4 eq) was added. The mixture was reacted at 60° C. for overnight, the reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was washed with brine, dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=10/1) to afford compound 5.


Step (3):



embedded image


Compound 5 (100 mg, 0.19 mmol, 1 eq) was dissolved in chloroform (5 mL), and aqueous ammonia (2 mL) was added. The mixture was reacted at room temperature for 48 h. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was washed with brine, dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by thin layer chromatography (PE/EA=10/1) to afford compound AB35420.


Compound AB35420

MS-ESI: Calculated [M+H]+: 551.12; Found [M+H]+: 551.10.



1H NMR (400 MHz, CDCl3) δ 7.14 (s, 1H), 6.95-6.84 (m, 2H), 6.60 (s, 1H), 6.06 (s, 1H), 5.93 (s, 2H), 5.84 (s, 1H), 4.41-4.36 (m, 1H), 3.93-3.88 (m, 1H), 3.84 (s, 3H), 3.75-3.27 (m, 1H), 3.33-3.27 (m, 1H), 2.86-2.56 (m, 6H), 1.66-1.47 (m, 10).


Example 22 Synthesis of Compound AB35421

The structure of compound AB35421 was as follows:




embedded image


The synthesis method of compound AB35421 was as follows:




embedded image


Compound 1 (100 mg, 0.28 mmol, 1 eq) was dissolved in chloroform (5 mL), and aqueous ammonia (2 mL) was added. The mixture was reacted at room temperature for 48 h. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was washed with brine, dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by thin layer chromatography (PE/EA=10/1) to afford compound AB35421.


Compound AB35421:

MS-ESI: Calculated [M+H]+: 438.00; Found[M+H]+: 437.95.



1H NMR (400 MHz, CDCl3) δ 7.16 (s, 1H), 6.86 (d, J=8.0 Hz, 1H), 6.87 (d, J=8.0 Hz, 1H), 6.61 (s, 1H), 6.14 (s, 1H), 6.03 (s, 1H), 5.96-5.94 (m, 2H), 5.91 (s, 1H), 5.41 (s, 1H), 3.86-3.80 (m, 1H), 3.72-3.68 (m, 1H), 3.39-3.32 (m, 1H), 2.75-2.68 (m, 1H).


Example 23 Synthesis of Compound AB35422

The structure of compound AB35422 was as follows:




embedded image


The synthesis method of compound AB35422 was as follows:




embedded image


Compound 1 (110 mg, 0.25 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and methylmagnesium bromide (0.4 mL, 1.25 mmol, 5 eq, 3M) was added slowly at 0° C. under N2. The mixture was reacted for 0.5 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by thin layer chromatography (DCM:MeOH=20:1) to afford compound AB35422.


Compound AB35422:

MS-ESI: Calculated [M+H]+: 422.23, Found[M+H]+: 422.20.



1H NMR (400 MHz, DMSO-d6) δ 6.88-6.83 (m, 4H), 6.00 (d, J=8.0 Hz, 2H), 4.65-4.61 (m, 1H), 3.76 (d, J=8.0 Hz, 6H), 3.16-3.08 (m, 3H), 2.74-2.70 (m, 3H), 1.71-1.63 (m, 1H), 1.42-1.32 (m, 5H), 0.94 (d, J=4.0 Hz, 3H), 0.89-0.86 (m, 3H).


Example 24 Synthesis of Compound AB35423

The structure of compound AB35423 was as follows:




embedded image


The synthesis method of compound AB35423 was as follows:


Step (1):



embedded image


Compound 1 (300 mg, 0.84 mmol, 1 eq) was dissolved in N, N-dimethylformamide (10 mL), and potassium carbonate (464 mg, 3.36 mmol, 4 eq) and compound 2 (847 mg, 3.36 mmol, 4 eq) were added. The mixture was reacted at 60° C. for overnight. The reaction mixture was diluted with water and then extracted with dichloromethane twice, the phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=50/1 to 20/1) to afford compound 3.


Step (2):



embedded image


Compound 3 (200 mg, 0.35 mmol, 1 eq) was dissolved in chloroform (5 mL), and aqueous ammonia (2 mL) was added. The mixture was reacted at 40° C. for 48 h. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was washed with brine, dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by thin layer chromatography (PE:EA=200:1) to afford compound AB35423.


Compound AB35423:

MS-ESI: Calculated [M+H]+: 611.14; Found [M+H]+: 611.05.



1H NMR (400 MHz, CDCl3) δ 7.16 (s, 1H), 6.97-6.86 (m, 2H), 6.62 (s, 1H), 6.09 (s, 1H), 5.95-5.94 (m, 2H), 5.60 (s, 1H), 4.64 (s, 1H), 4.27-4.23 (m, 1H), 3.90-3.86 (m, 5H), 3.73-3.67 (m, 1H), 3.35-3.22 (m, 3H), 2.77-2.71 (m, 1H), 1.84-1.72 (m, 4H), 1.44 (s, 9H).


Example 25 Synthesis of Compound AB35424

The structure of compound AB35424 was as follows:




embedded image


The synthesis method of compound AB35424 was as follows:


Step (1):



embedded image


Compound 1 (300 mg, 0.84 mmol, 1 eq) was dissolved in N, N-dimethylformamide (10 mL), and potassium carbonate (464 mg, 3.36 mmol, 4 eq) and compound 2 (753 mg, 3.36 mmol, 4 eq) were added. The mixture was reacted at 60° C. for overnight. The reaction mixture was diluted with water and then extracted with dichloromethane twice, the phase was washed with brine, dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=50/1 to 20/1) to afford compound 3.


Step (2):



embedded image


Compound 3 (50 mg, 0.09 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and methylmagnesium bromide (0.15 mL, 0.45 mmol, 5 eq, 3M) was added slowly at 0° C. under N2. The mixture was reacted for 0.5 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.01% formic acid) to afford compound AB35424.


Compound AB35424:

MS-ESI: Calculated [M+H]+: 481.23; Found [M+H]+: 481.20.



1H NMR (400 MHz, DMSO-d6) δ 7.25 (s, 1H), 7.04-7.02 (m, 1H), 6.82-6.66 (m, 3H), 6.00 (d, J=4.0 Hz, 2H), 5.92 (s, 1H), 4.86-4.81 (m, 1H), 3.96-3.91 (m, 2H), 3.75 (s, 3H), 3.28-3.26 (m, 4H), 2.84-2.74 (m, 2H), 1.39 (s, 9H), 1.03 (d, J=8.0 Hz, 3H).


Example 26 Synthesis of Compound AB35426

The structure of compound AB35426 was as follows:




embedded image


The synthesis method of compound AB35426 was as follows:


Step (1):



embedded image


Compound 3 (200 mg, 0.56 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and hexylmagnesium bromide (3.4 mL, 3.36 mmol, 6 eq, 1 M) was added slowly at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was washed with brine, dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by thin layer chromatography (dichloromethane:methanol=30:1) to afford compound AB35426.


Compound AB35426:

MS-ESI: Calculated [M+H]+: 405.19; Found: 406.25.



1H NMR (400 MHz, CDCl3) δ 7.13 (s, 1H), 6.66 (d, J=4.0 Hz, 1H), 6.59 (s, 1H), 6.51 (d, J=8.0 Hz, 1H), 5.95-5.94 (m, 3H), 5.83 (d, J=8.0 Hz, 2H), 4.58-4.56 (m, 1H), 3.46-3.41 (m, 1H), 3.26-3.23 (m, 1H), 2.89-2.77 (m, 2H), 1.85-1.76 (m, 1H), 1.64-1.57 (m, 1H), 1.28-1.19 (m, 8H), 0.84-0.81 (m, 3H).


Example 27 Synthesis of Compound AB35427

The structure of compound AB35427 was as follows:




embedded image


The synthesis method of compound AB35427 was as follows:


Step (1):



embedded image


Compound 1 (500 mg, 1.41 mmol, 1 eq) was dissolved in methanol (10 mL), and potassium carbonate (583 mg, 4.22 mmol, 3.0 eq) was added, then a mixture of sodium borohydride (53 mg, 1.41 mmol, 1.0 eq) in 5% sodium hydroxide solution was slowly added dropwise at 0° C. The mixture was reacted for 2 h. The reaction mixture was filtered, the solid was washed with ethanol 2-3 times and collected to afford compound 2 (800 mg, yield: 99.9%) as a yellow solid.


Step (2):



embedded image


Compound 2 (400 mg, 1.26 mmol, 1 eq) was dissolved in ethanol/acetic acid (12 mL/2 mL), and phenylpropionaldehyde (1.69 g, 12.58 mmol, 10 eq) was added. The mixture was reacted at 90° C. for 4 h, an appropriate amount of hydrochloric acid was added, and the mixture was concentrated. To crude product was added a small amount of dichloromethane and an appropriate amount of ethyl acetate, the mixture was stewed for 0.5 h and then filtered to remove solid. The filtrate was stewed for overnight to precipitate a solid, the solid was filtered and collected to afford compound 4 (160 mg, yield: 29.0%) as a yellow solid.


Step (3):



embedded image


Compound 4 (90 mg, 0.21 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and methylmagnesium bromide (1 mL, 1.03 mmol, 5 eq, 3M) was added slowly at 0° C. under N2.


The mixture was reacted at room temperature for 0.5 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was washed with brine, dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.01% formic acid) to afford solid compound AB35427.


Compound AB35427:

MS-ESI: Calculated [M+H]+: 453.20; Found: 454.20.



1H NMR (400 MHz, DMSO-d6) δ 7.23-7.21 (m, 2H), 7.17-7.15 (m, 3H), 6.81 (s, 2H), 6.69 (d, J=8.0 Hz, 1H), 6.53 (d, J=8.0 Hz, 1H), 6.00-5.99 (m, 3H), 5.90 (s, 1H), 4.55-4.51 (m, 1H), 3.16-3.04 (m, 2H), 2.73-2.46 (m, 6H), 1.95-1.69 (m, 2H), 20.99 (d, J=4.0 Hz, 3H).


Example 28 Synthesis of Compound AB35428

The structure of compound AB35428 was as follows:




embedded image


The synthesis method of compound AB35428 was as follows:




embedded image


Compound 1 (100 mg, 0.21 mmol, 1 eq) was dissolved in chloroform (4 mL), and aqueous ammonia (2 mL) was added. The mixture was reacted at room temperature for 48 h. The reaction mixture was washed with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by thin layer chromatography (dichloromethane:methanol=30:1) to afford compound AB35428.


Compound AB35428:

MS-ESI: Calculated [M+H]+: 556.08; Found[M+H]+: 556.00.



1H NMR (400 MHz, DMSO-d6) δ 7.28-7.24 (m, 2H), 7.21-7.14 (m, 3H), 6.96 (d, J=12.0 Hz, 1H), 6.85 (s, 1H), 6.73-6.71 (m, 2H), 6.07 (s, 1H), 6.02 (d, J=4.0 Hz, 2H), 5.97 (s, 1H), 5.44 (s, 1H), 3.80-3.75 (m, 1H), 3.63-3.61 (m, 1H), 2.70-2.53 (m, 6H), 1.88-1.74 (m, 2H).


Example 29 Synthesis of Compound AB35429

The structure of compound AB35429 was as follows:




embedded image


The synthesis method of compound AB35429 was as follows:


Step (1):



embedded image


Compound 1 (400 mg, 0.81 mmol, 1.0 eq) was dissolved in methanol (30 mL), and aqueous ammonia (7 mL) and ammonium chloride (44 mg, 0.81 mmol, 1.0 eq) were added in sequence. The mixture was stirred at 70° C. for 16 h, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was diluted with water and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried, the crude product was purified by fast chromatography (DCM/MeOH=100/1 to 50/1) to afford compound 2 (190 mg, yield: 42.2%) as a yellow solid.


Step (2):



embedded image


Compound 2 (80 mg, 0.19 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (5 mL), and methylmagnesium bromide (0.4 mL, 1.14 mmol, 6.0 eq, 3M) was added slowly at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.01% formic acid) to afford solid compound AB35429 (10 mg, yield: 12.5%) as a yellow solid Compound AB35429:


MS-ESI: Calculated [M+H]+: 409.21, Found [M+H+H2O]+: 428.10.


1H NMR (400 MHz, DMSO-d6) δ 7.23 (s, 1H), 6.80-6.64 (m, 3H), 5.98 (d, J=4.0 Hz, 2H), 5.90 (s, 1H), 4.75-4.70 (m, 1H), 3.96-3.87 (m, 2H), 3.74-3.71 (m, 5H), 3.26-3.20 (m, 2H), 2.81-2.72 (m, 2H), 1.95-1.79 (m, 4H), 1.03 (d, J=8.0 Hz, 3H).


Example 30 Synthesis of Compound AB35430

The structure of compound AB35430 was as follows:




embedded image


The synthesis method of compound AB35430 was as follows:




embedded image


Compound 1 (150 mg, 0.28 mmol, 1.0 eq) was dissolved in tetrahydrofuran (10 mL), and cyclopentylmagnesium bromide (1.4 mL, 1.4 mmol, 5 eq, 1M) was added at 0° C. The mixture was reacted at room temperature for 0.5 h, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by thin layer chromatography (dichloromethane/methanol=30/1) to afford compound AB35430.


Compound AB35430:

MS-ESI: Calculated [M+H]+: 512.14, Found: 512.10.


1H NMR (400 MHz, CDCl3) δ 7.13 (s, 1H), 6.74 (s, 2H), 6.58 (s, 1H), 5.93 (s, 2H), 5.83 (s, 1H), 4.65 (d, J=4.0 Hz, 1H), 4.26-4.21 (m, 1H), 4.03-3.97 (m, 1H), 3.82 (s, 3H), 3.80-3.67 (m, 2H), 3.60-3.44 (m, 2H), 2.89-2.76 (m, 2H), 2.46-2.16 (m, 3H), 1.76-1.70 (m, 1H), 1.48-1.30 (m, 7H).


Example 31 Synthesis of Compound AB35434

The structure of compound AB35434 was as follows:




embedded image


The synthesis method of compound AB35434 was as follows:


Step (1):



embedded image


Compound 1 (500 mg, 1.4 mmol, 1.0 eq) was dissolved in DMF (10 mL), and compound 2 (949 mg, 8.4 mmol, 6 eq) was added. The mixture was reacted at 75° C. for 16 h, and the reaction was detected to be performed completely using TLC and LCMS. The organic phase was rotary dried, the crude product was purified by fast chromatography (100-200 mesh silica gel, DCM/MeOH=20/1) to afford compound 3 (300 mg, yield: 49.3%) as a yellow solid.


Step (2):



embedded image


Compound 3 (200 mg, 0.46 mmol, 1.0 eq) was dissolved in tetrahydrofuran (10 mL), and cyclopentylmagnesium bromide (2.8 mL, 2.76 mmol, 6.0 eq, 1M) was added at 0° C. under N2. The mixture was reacted at 0° C. for 0.5 h, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.01% formic acid) to afford compound AB35434.


Compound AB35434:

MS-ESI: Calculated [M+H]+: 468.19, Found: 468.45.



1H NMR (400 MHz, CDCl3) δ 7.13 (s, 1H), 6.74 (s, 2H), 6.57 (s, 1H), 5.92 (s, 2H), 5.82 (s, 1H), 4.61 (d, J=8.0 Hz, 1H), 4.23-4.21 (m, 1H), 4.00-3.84 (m, 2H), 3.79 (s, 4H), 3.58-3.43 (m, 2H), 2.88-2.81 (m, 2H), 2.36-2.28 (m, 2H), 2.16-2.06 (m, 1H), 1.74-1.37 (m, 8H).


Example 32 Synthesis of Compound AB35436

The structure of compound AB35436 was as follows:




embedded image


The synthesis method of compound AB35436 was as follows:


Step (1):



embedded image


Compound 1 (2.0 g, 5.93 mmol, 1 eq) was dissolved in ethanol/acetic acid (10 mL/8 mL), and phenylpropionaldehyde (7.9 g, 59.3 mmol, 10 eq) was added. The mixture was reacted at 80° C. for 4 h, an appropriate amount of hydrochloric acid was added, and the mixture was concentrated. To crude product was added a small amount of dichloromethane and an appropriate amount of ethyl acetate, the mixture was stewed for 0.5 h and then filtered to remove solid. The filtrate was stewed for overnight to precipitate a solid, the solid was filtered and collected to afford compound 3 (1.4 g, yield: 48.2%) as a yellow solid.


Step (2):



embedded image


Compound 3 (200 mg, 0.41 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and cyclopentylmagnesium bromide (0.7 mL, 2.05 mmol, 5 eq, 3M) was added at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was washed with brine, dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.01% formic acid) to afford compound AB35436.


Compound AB35436:

MS-ESI: Calculated [M+H]+:524.28; Found: 524.30.



1H NMR (400 MHz, CDCl3) δ 7.26-7.16 (m, 5H), 6.83-6.74 (m, 4H), 6.01 (d, J=4.0 Hz, 2H), 4.40 (d, J=8.0 Hz, 1H), 3.76 (s, 3H), 3.72 (s, 3H), 2.69-2.65 (m, 2H), 2.12-2.05 (m, 1H), 1.98-1.85 (m, 2H), 1.76-1.68 (m, 1H), 1.47-1.43 (m, 4H), 1.34-1.16 (m, 9H).


Example 33 Synthesis of Compound AB35438

The structure of compound AB35438 was as follows:




embedded image


The synthesis method of compound AB35438 was as follows:


Step (1):



embedded image


Compound 1 (2 g, 5.59 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (20 mL), and cyclopentylmagnesium bromide (28 mL, 27.95 mmol, 5 eq, 1M) was added at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried.


The crude product was purified by fast chromatography (DCM/MeOH=100/1 to 50/1) to afford compound 3 (1.2 g, yield: 54.5%) as a yellow solid.


Step (2):



embedded image


Compound 3 (200 mg, 0.51 mmol, 1 eq) was dissolved in dimethylformamide (10 mL), and compound 4 (222 mg, 1.02 mmol, 2 eq) and potassium carbonate (211 mg, 1.53 mmol, 3 eq) were added. The mixture was reacted at room temperature for 12 h. The reaction mixture was diluted with water and then extracted with ethyl acetate twice, the organic phase was washed with brine, dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.01% formic acid) to afford compound AB35438.


Compound AB35438:

MS-ESI: Calculated [M+H]+: 528.31; Found: 528.45.



1H NMR (400 MHz, DMSO-d6) δ 6.81 (s, 2H), 6.77 (d, J=8.0 Hz, 1H), 6.55 (d, J=8.0 Hz, 1H), 5.98 (d, J=12.0 Hz, 2H), 5.09-5.00 (m, 2H), 4.58 (d, J=8.0 Hz, 1H), 3.75 (s, 3H), 3.30-3.10 (s, 5H), 2.70-2.51 (m, 2H), 2.10-1.98 (m, 5H), 1.66 (s, 3H), 1.53 (s, 3H), 1.50 (s, 3H), 1.41-1.37 (m, 4H), 1.30-1.21 (m, 4H).


Example 34 Synthesis of Compound AB35440

The structure of compound AB35440 was as follows:




embedded image


The synthesis method of compound AB35440 was as follows:


Step (1):



embedded image


Compound 1 (500 mg, 1.40 mmol, 1 eq) was dissolved in N, N-dimethylformamide (5 mL), and compound 2 (862 mg, 5.6 mmol, 4 eq) was added. The mixture was reacted at 60° C. for 16 h, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was diluted with water and then extracted with dichloromethane twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=50/1 to 20/1) to afford compound 3 (100 mg, yield: 15%) as a yellow solid.


Step (2):



embedded image


Compound 3 (100 g mg, 0.21 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (5 mL), and cyclopentylmagnesium bromide (0.4 mL, 1.05 mmol, 5 eq, 3M) was added at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.01% formic acid) to afford compound AB35440.


Compound AB35440:

MS-ESI: Calculated [M+H]+510.24; Found: 510.25.



1H NMR (400 MHz, DMSO-d6) δ 7.21 (s, 1H), 6.79 (d, J=8.0 Hz, 1H), 6.74 (s, 1H), 6.64 (d, J=8.0 Hz, 1H), 5.97 (s, 2H), 5.89 (s, 1H), 4.50 (d, J=8.0 Hz, 1H), 4.03-4.00 (m, 1H), 3.77-3.72 (m, 4H), 3.65-3.61 (m, 2H), 3.42-3.36 (m, 2H), 2.90-2.84 (m, 1H), 2.66-2.64 (m, 1H), 2.20-2.13 (m, 1H), 1.73-1.57 (m, 6H), 1.47-1.41 (m, 6H), 1.28-1.15 (m, 4H).


Example 35 Synthesis of Compound AB35441

The structure of compound AB35441 was as follows:




embedded image


The synthesis method of compound AB35441 was as follows:




embedded image


Compound 1 (100 mg, 0.23 mmol, 1 eq) was dissolved in a mixture of aqueous ammonia (3 ml) and chloroform (6 ml). The mixture was reacted at room temperature for 48 h. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by thin layer chromatography (dichloromethane/methanol=50/1) to afford compound AB35441.


Compound AB35441:

MS-ESI: Calculated [M+H]+: 516.02; Found: 516.25.



1H NMR (400 MHz, DMSO-d6) δ 7.31 (s, 1H), 7.09 (d, J=12.0 Hz, 1H), 6.89 (d, J=4.0 Hz, 1H), 6.77 (s, 1H), 6.32 (s, 1H), 5.99 (d, J=4.0 Hz, 2H), 5.63 (s, 1H), 4.23-4.19 (m, 1H), 3.90-3.88 (m, 3H), 3.79-3.74 (m, 4H), 3.65-3.60 (m, 1H), 3.27-3.21 (m, 1H), 2.73-2.67 (m, 1H), 2.21-2.20 (m, 1H), 2.09-2.02 (m, 1H).


Example 36 Synthesis of Compound AB35444

The structure of compound AB35444 was as follows:




embedded image


The synthesis method of compound AB35444 was as follows:


Step (1):



embedded image


Compound 1 (3.0 g, 8.89 mmol, 1 eq) was dissolved in ethanol/acetic acid (30 mL/5 mL), and phenylacetaldehyde (10.7 g, 88.9 mmol, 10 eq) was added. The mixture was reacted at 90° C. for 4 h, an appropriate amount of hydrochloric acid was added, and the mixture was concentrated. To crude product was added a small amount of dichloromethane and an appropriate amount of ethyl acetate, the mixture was stewed for 0.5 h and then filtered to remove solid. The filtrate was stewed for overnight to precipitate a solid, the solid was filtered and collected to afford compound 3 (1.8 g, yield: 42.8%) as a yellow solid.


Step (2):



embedded image


Compound 1 (300 mg, 0.63 mmol, 1 eq) was dissolved in aqueous ammonia (4 ml), and chloroform (8 ml) was added. The mixture was reacted at room temperature for 48 h under N2. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=100/1 to 50/1) to afford compound AB 35444.


Compound AB35444:

MS-ESI: Calculated [M+H]+: 558.10; Found: 558.05.



1H NMR (400 MHz, DMSO-d6) δ 7.30 (d, J=4.0 Hz, 4H), 7.21-7.18 (m, 3H), 6.97 (s, 1H), 6.87 (s, 1H), 6.03 (s, 1H), 6.00 (s, 1H), 5.58 (s, 1H), 3.85-3.79 (m, 7H), 3.62-3.59 (m, 1H), 2.90-2.70 (m, 5H), 2.58-2.51 (m, 1H).


Example 37 Synthesis of Compound AB35445

The structure of compound AB35445 was as follows:




embedded image


The synthesis method of compound AB35445 was as follows:


Step (1):



embedded image


Compound 1 (5.0 g, 13.97 mmol, 1.0 eq) was dissolved in dichloromethane (300 mL), and trifluoromethanesulfonic anhydride (4.3 g, 15.37 mmol, 1.1 eq) was slowly added dropwise at 0° C. The mixture was reacted at room temperature for 1 h, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was quenched with water and then extracted with dichloromethane twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane/methanol=100/1 to 50/1) to afford compound 2 (3.4 g, yield: 40.5%) as a yellow solid.


Step (2):



embedded image


Compound 2 (300 mg, 0.49 mmol, 1.0 eq) was dissolved in dioxane (10 mL), and compound 3 (330 mg, 2.32 mmol, 4.6 eq), triethylamine (201 mg, 1.99 mmol, 4.0 eq), palladium acetate (22 mg, 0.099 mmol, 0.2 eq), and 1,1′-binaphthalene-2,2′-biphenylphosphine (62 mg, 0.099 mmol, 0.2 eq) were added. The mixture was reacted at 100° C. for 16 h under N2, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was diluted with water and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane/methanol=50/1) to afford compound 4 (150 mg, yield: 51.4%) as a yellow solid.


Step (3):



embedded image


Compound 4 (150 mg, 0.25 mmol, 1 eq) was dissolved in a mixture of chloroform (8 ml) and aqueous ammonia (4 ml). The mixture was reacted at 40° C. for overnight, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was diluted with water and then extracted with dichloromethane twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane/methanol=100/1 to 50/1) to afford compound AB35445.


Compound AB35445:

MS-ESI: Calculated [M+H]+: 564.15, Found: 564.40.



1H NMR (400 MHz, DMSO-d6) δ 7.27 (s, 1H), 7.03-6.98 (m, 2H), 6.77 (s, 1H), 6.25 (s, 1H), 5.98 (d, J=8.0 Hz, 2H), 5.93 (s, 1H), 3.76 (s, 3H), 3.72-3.59 (m, 3H), 3.17-3.03 (m, 2H), 2.81-2.68 (m, 4H), 2.59-2.48 (m, 1H), 2.29-2.25 (m, 2H), 2.18-2.03 (m, 2H), 1.42-1.39 (m, 2H), 1.29-1.26 (m, 2H), 0.89-0.85 (m, 3H).


Example 38 Synthesis of Compound AB35448

The structure of compound AB35448 was as follows:




embedded image


The synthesis method of compound AB35448 was as follows:




embedded image


Compound 1 (300 mg, 0.63 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and cyclopentylmagnesium bromide (3.2 mL, 3.15 mmol, 5.0 eq, 1M) was added at 0° C. under N2. The mixture was reacted at room temperature for 0.5. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.01% formic acid) to afford compound AB35448.


MS-ESI: Calculated [M+H]+: 510.26; Found: 510.20.



1H NMR (400 MHz, DMSO-d6) δ 7.30-7.25 (m, 4H), 7.20-7.16 (m, 1H), 7.05-6.93 (m, 2H), 6.81 (d, J=4.0 Hz, 2H), 6.00 (s, 2H), 4.43 (d, J=8.0 Hz, 1H), 3.79 (s, 3H), 3.75 (s, 3H), 3.35-3.32 (m, 2H), 2.91-2.65 (m, 5H), 2.51-2.48 (m, 1H), 2.21-2.13 (m, 1H), 1.50-1.24 (m, 9H).


Example 39 Synthesis of Compound AB35453

The structure of compound AB35453 was as follows:




embedded image


The synthesis method of compound AB35453 was as follows:




embedded image


Compound 1 (700 mg, 1.16 mmol, 1.0 eq) was dissolved in dioxane (20 mL), and compound 2 (460 mg, 4.64 mmol, 4.0 eq), triethylamine (469 mg, 4.64 mmol, 4.0 eq), palladium acetate (52 mg, 0.232 mmol, 0.2 eq) and 1,1′-binaphthalene-2,2′-biphenylphosphine (144 mg, 0.232 mmol, 0.2 eq) were added. The mixture was reacted at 100° C. for 16 h under N2, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was diluted with water and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane/methanol=50/1) to afford compound 3 (280 mg).


Step (2):



embedded image


Compound 3 (150 mg, 0.27 mmol, 1 eq) was dissolved in a mixture of chloroform (8 ml) and aqueous ammonia (4 ml). The mixture was reacted at 40° C. for overnight, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was diluted with water and then extracted with dichloromethane twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane/methanol=100/1 to 50/1) to afford compound AB35453.


Compound AB35453:

MS-ESI: Calculated [M+H]+: 521.11, Found: 521.15.



1H NMR (400 MHz, CDCl3) δ 7.15 (s, 1H), 6.98-6.90 (m, 2H), 6.61 (s, 1H), 6.07 (s, 1H), 6.03 (s, 1H), 5.95 (d, J=4.0 Hz, 2H), 3.91-3.86 (m, 1H), 3.81 (s, 3H), 3.68-3.64 (m, 1H), 3.55-3.49 (m, 1H), 3.31-3.26 (m, 1H), 3.06-2.99 (m, 2H), 2.78-2.72 (m, 2H), 1.68-1.61 (m, 1H), 1.49-1.45 (m, 1H), 1.36-1.26 (m, 3H), 0.99 (d, J=4.0 Hz, 3H).


Example 40 Synthesis of Compound AB35454

The structure of compound AB35454 was as follows:




embedded image


The synthesis method of compound AB35454 was as follows:




embedded image


Compound 1 (200 mg, 0.36 mmol, 1 eq) was dissolved in tetrahydrofuran (10 mL), and cyclopentylmagnesium bromide (2.2 mL, 2.16 mmol, 6.0 eq, 1M) was added at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.01% formic acid) to afford compound AB35454.


MS-ESI: Calculated [M+H]+: 540.27, Found: 540.40.



1H NMR (400 MHz, DMSO-d6): δ 7.27-7.23 (m, 2H), 7.20 (s, 1H), 6.92-6.89 (m, 3H), 6.79 (d, J=8.0 Hz, 1H), 6.72 (s, 1H), 6.65 (d, J=8.0 Hz, 1H), 5.96 (s, 2H), 5.88 (s, 1H), 4.51 (d, J=8.0 Hz, 1H), 4.11-4.02 (m, 3H), 3.81-3.79 (m, 1H), 3.71 (s, 3H), 3.35-3.28 (m, 2H), 2.89-2.79 (m, 1H), 2.61-2.56 (m, 1H), 2.18-2.12 (m, 1H), 1.91-1.82 (m, 4H), 1.54-1.15 (m, 8H).


Example 41 Synthesis of Compound AB35455

The structure of compound AB35455 was as follows:




embedded image


The synthesis method of compound AB35455 was as follows:


Step (1):



embedded image


Compound 1 (500 mg, 1.40 mmol, 1.0 eq) was dissolved in DMF (30 mL), and compound 2 (784 mg, 2.8 mmol, 2 eq) and potassium carbonate (386 mg, 2.8 mmol, 2 eq) were added. The mixture was reacted at 60° C. for 16 h under N2, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was diluted with water and then extracted with ethyl acetate twice, the phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane/methanol=50/1) to afford compound 3 (580 mg, yield: 68.9%) as a yellow solid.


Step (2):



embedded image


Compound 3 (580 mg, 0.96 mmol, 1 eq) was dissolved in tetrahydrofuran (20 mL), and cyclopentylmagnesium bromide (6 mL, 5.8 mmol, 6.0 eq, 1M) was slowly added dropwise at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.1% formic acid) to afford compound AB35455.


Compound AB35455:

MS-ESI: Calculated [M+H]+: 591.34, Found: 591.45.



1H NMR (400 MHz, DMSO-d6) δ 7.20 (s, 1H), 6.79-6.63 (m, 4H), 5.97 (s, 2H), 5.88 (s, 1H), 4.50 (d, J=8.0 Hz, 1H), 4.04-4.00 (m, 1H), 3.71 (s, 4H), 3.35-3.33 (m, 2H), 2.90-2.85 (m, 3H), 2.66-2.61 (m, 1H), 2.19-2.12 (m, 1H), 1.65-1.57 (m, 3H), 1.38-1.15 (m, 22H).


Example 42 Synthesis of Compound AB35456

The structure of compound AB35456 was as follows:




embedded image


The synthesis method of compound AB35456 was as follows:




embedded image


Compound 1 (100 mg, 0.23 mmol, 1 eq) was dissolved in tetrahydrofuran (10 mL), and methylmagnesium bromide (0.4 mL, 1.15 mmol, 5.0 eq, 3M) was added at 0° C. The mixture was reacted at room temperature for 0.5 h, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with dichloromethane twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.1% formic acid) to afford compound AB35456.


MS-ESI: Calculated [M+H]+: 413.14, Found: 413.90.



1H NMR (400 MHz, DMSO-d6) δ 7.23 (s, 1H), 6.80 (d, J=8.0 Hz, 1H), 6.75 (s, 1H), 6.65 (d, J=8.0 Hz, 1H), 5.98 (d, J=4.0 Hz, 2H), 5.91 (s, 1H), 4.78-4.73 (m, 1H), 4.06-4.03 (m, 2H), 3.86-3.83 (m, 2H), 3.73 (s, 3H), 3.32-3.18 (m, 2H), 2.81-2.72 (m, 2H), 2.17-2.11 (m, 2H), 1.04 (d, J=4.0 Hz, 3H).


Example 43 Synthesis of Compound AB35457

The structure of compound AB35457 was as follows:




embedded image


The synthesis method of compound AB35457 was as follows:




embedded image


Compound 1 (500 mg, 1.34 mmol, 1.0 eq) was dissolved in ethanol (5 mL) in a sealed tube, and compound 2 (815 mg, 6.72 mmol, 5 eq) was added. The mixture was reacted at 110° C. for 16 h under N2, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was rotary dried. The crude product was purified by fast chromatography (dichloromethane:methanol=20:1) to afford compound 3 (150 mg, yield: 24.3%).


Step (2):



embedded image


Compound 3 (150 mg, 0.32 mmol, 1.0 eq) was dissolved in tetrahydrofuran (10 mL), and cyclopentylmagnesium bromide (3 mL) was added at 0° C. The mixture was reacted at room temperature for 0.5 h, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with dichloromethane twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.1% formic acid) to afford compound AB35457.


Compound AB35457:

MS-ESI: Calculated [M+H]+: 495.26, Found: 495.40.



1H NMR (400 MHz, DMSO-d6) δ 7.29-7.19 (m, 6H), 6.72-6.67 (m, 2H), 6.49 (d, J=8.0 Hz, 1H), 5.96 (s, 2H), 5.84 (s, 1H), 4.23 (d, J=8.0 Hz, 1H), 3.71-3.68 (m, 4H), 3.34-3.24 (m, 4H), 2.87-2.77 (m, 3H), 2.62-2.59 (m, 1H), 2.12-2.06 (m, 1H), 1.44-1.33 (m, 4H), 1.15-0.96 (m, 4H).


Example 44 Synthesis of Compound AB35458

The structure of compound AB35458 was as follows:




embedded image


The synthesis method of compound AB35458 was as follows:


Step (1):



embedded image


Compound 1 (500 mg, 1.4 mmol, 1.0 eq) was dissolved in DMF (10 mL), and compound 2 (1.7 g, 7 mmol, 5 eq) was added. The mixture was reacted at 75° C. for 16 h under N2, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was rotary dried. The crude product was purified by fast chromatography (dichloromethane/methanol=30/1) to afford compound 3 (500 mg, yield: 63.2%).


Step (2):



embedded image


Compound 3 (150 mg, 0.26 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and cyclopentylmagnesium bromide (1.3 mL, 1.3 mmol, 5.0 eq, 1M) was added at 0° C. The mixture was reacted at room temperature for 0.5 h, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with dichloromethane twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.1% formic acid) to afford compound AB35458.


Compound AB35458:

MS-ESI: Calculated [M+H]+: 554.19, Found: 554.15.



1H NMR (400 MHz, DMSO-d6) δ 7.23 (s, 1H), 6.81 (d, J=8.0 Hz, 1H), 6.76 (s, 1H), 6.66 (d, J=8.0 Hz, 1H), 5.99 (s, 2H), 5.91 (s, 1H), 4.52 (d, J=8.0 Hz, 1H), 4.08-4.02 (m, 1H), 3.78-3.74 (m, 4H), 23.55-3.53 (m, 2H), 3.42-3.35 (m, 2H), 2.92-2.86 (m, 1H), 2.69-2.63 (m, 1H), 2.22-2.15 (m, 1H), 1.85-1.82 (m, 2H), 1.70-1.66 (m, 2H), 1.60-1.48 (m, 8H), 1.31-1.17 (m, 4H).


Example 45 Synthesis of Compound AB35459

The structure of compound AB35459 was as follows:




embedded image


The synthesis method of compound AB35459 was as follows:


Step (1):



embedded image


Compound 1 (1 g, 5.15 mmol, 1 eq) was dissolved in dichloromethane (10 mL), and compound 2 (2.0 g, 15.45 mmol, 3 eq) and a small amount of dimethylformamide (2 drops) were added at 0° C. The mixture was reacted at room temperature for 2 h, and the reaction was detected to be performed completely using TLC and LCMS. The organic phase was rotary dried to afford compound 3 (1.0 g, yield: 90.9%).


Step (2):



embedded image


Compound 4 (434 mg, 1.11 mmol, 1 eq) was dissolved in dichloromethane, trimethylamine (560 mg, 5.55 mmol, 5 eq) was added, then compound 3 (708 mg, 3.33 mmol, 3 eq) was added at 0° C. The mixture was reacted at room temperature for 16 h, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was diluted with water and then extracted with dichloromethane twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.1% formic acid) to afford compound AB35459.


Compound AB35459:

MS-ESI: Calculated [M+H]+: 568.30, Found: 568.30.



1H NMR (400 MHz, DMSO-d6) δ 7.22 (s, 1H), 6.89-6.80 (m, 2H), 6.74 (s, 1H), 5.97 (s, 2H), 5.94 (s, 1H), 4.33 (d, J=4.0 Hz, 1H), 3.68 (s, 3H), 3.30-3.26 (m, 2H), 2.88-2.80 (m, 1H), 2.68-2.60 (m, 1H), 2.30 (s, 2H), 2.19-2.11 (m, 1H), 1.70-1.60 (m, 16H), 1.45-1.35 (m, 3H), 1.27-1.20 (m, 4H).


Example 46 Synthesis of Compound AB35465

The structure of compound AB35465 was as follows:




embedded image


The synthesis method of compound AB35465 was as follows:


Step (1):



embedded image


Compound 1 (1.0 g, 1.66 mmol, 1.0 eq) was dissolved in dioxane (30 mL), and compound 2 (1.3 g, 6.64 mmol, 4.0 eq), triethylamine (671 mg, 6.64 mmol, 4.0 eq), palladium acetate (74 mg, 0.332 mmol, 0.2 eq), and 1,1′-binaphthalene-2,2′-biphenylphosphine (207 mg, 0.332 mmol, 0.2 eq) were added. The mixture was reacted at 100° C. for 16 h under N2, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was diluted with water and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane/methanol=50/1) to afford compound 3 (1.0 g, yield: 92.6%) as a yellow solid.


Step (2):



embedded image


Compound 3 (300 mg, 0.46 mmol, 1 eq) was dissolved in a mixture of chloroform (8 ml) and aqueous ammonia (4 ml). The mixture was reacted at 30° C. for overnight, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was diluted with water and then extracted with dichloromethane twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane/methanol=100/1 to 50/1) to afford compound AB35465.


Compound AB35465:

MS-ESI: Calculated [M+H]+: 622.16, Found: 622.30.



1H NMR (400 MHz, CDCl3) δ 7.12 (s, 1H), 6.97-6.87 (m, 2H), 6.60 (s, 1H), 6.04 (s, 1H), 5.96-5.93 (m, 3H), 4.48 (s, 1H), 3.88-3.84 (s, 1H), 3.79 (s, 3H), 3.62-3.53 (m, 3H), 3.24-3.20 (m, 1H), 3.14-3.02 (m, 2H), 2.76-2.71 (m, 2H), 2.02-1.82 (m, 2H), 1.52-1.44 (m, 11H).


Example 47 Synthesis of Compound AB35466

The structure of compound AB35466 was as follows:




embedded image


The synthesis method of compound AB35466 was as follows:


Step (1):



embedded image


Compound 1 (500 mg, 1.40 mmol, 1 eq) was dissolved in N, N-dimethylformamide (10 mL), and compound 2 (1.1 g, 5.6 mmol, 4 eq) was added. The mixture was reacted at 60° C. for 16 h, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was diluted with water and then extracted with dichloromethane twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=50/1 to 20/1) to afford compound 3 (420 mg, yield: 57.4%) as a yellow solid.


Step (2):



embedded image


Compound 3 (200 mg, 0.38 mmol, 1.0 eq) was dissolved in a mixture of chloroform (8 ml) and aqueous ammonia (4 ml). The mixture was reacted at 30° C. for overnight, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was diluted with water and then extracted with dichloromethane twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane/methanol=100/1 to 50/1) to afford compound AB35466.


Compound AB35466:

MS-ESI: Calculated [M+H]+: 559.95, Found: 559.95.



1H NMR (400 MHz, DMSO-d6) δ 7.31 (s, 1H), 7.08 (d, J=8.0 Hz, 1H), 6.89 (d, J=8.0 Hz, 1H), 6.77 (s, 1H), 6.32 (s, 1H), 5.99 (d, J=4.0 Hz, 2H), 5.65 (s, 1H), 4.22-4.20 (m, 1H), 3.88-3.85 (m, 1H), 3.79-3.74 (m, 6H), 3.67-3.60 (m, 1H), 3.28-3.20 (m, 1H), 2.73-2.66 (m, 1H), 2.33-2.26 (m, 1H), 2.15-2.08 (m, 1H).


Example 48 Synthesis of Compound AB35433

The structure of compound AB35433 was as follows:




embedded image


The synthesis method of compound AB35433 was as follows:


Step (1):



embedded image


Compound 1 (6.2 g, 28.29 mmol, 1.2 eq) and compound 2 (5.4 g, 23.58 mmol, 1.0 eq) were dissolved in tetrahydrofuran (100 mL), and copper iodide (135 mg, 0.71 mmol, 0.03 eq), bis (triphenylphosphine) palladium dichloride (492 mg, 0.70 mmol, 0.03 eq) and triethylamine (7.2 g, 70.74 mmol, 3 eq) were added. The mixture was reacted at 60° C. for 16 h under N2, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was diluted with water and then extracted with dichloromethane twice, the organic phase was washed with brine once, dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (100-200 mesh silica gel, PE/EA=3/1) to afford compound 3 (6.5 g, yield: 75.6%) as a yellow solid.


Step (2):



embedded image


Compound 3 (2.0 g, 5.46 mmol, 1.0 eq) was dissolved in tert-butanol (50 mL), and ammonium acetate (2.1 g, 27.32 mmol, 5.0 eq) and silver nitrate (1.85 g, 10.93 mmol, 0.2 eq) were added. The mixture was reacted at room temperature for 16 h, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was diluted with water and then extracted with dichloromethane twice, the organic phase was washed with brine once, dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (100-200 mesh silica gel, PE/EA=3/1) to afford compound 4 (1.5 g, yield: 75.3%) as a yellow solid.


Step (3):



embedded image


Compound 4 (1.5 g, 4.11 mmol, 1.0 eq) was dissolved in tetrahydrofuran (20 mL), and lithium triethylborohydride (16.4 mL, 16.44 mmol, 4 eq) was slowly added dropwise at −78° C. The mixture was reacted at room temperature for 3 h, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was diluted with saturated sodium chloride aqueous solution and then extracted with ethyl acetate twice, the organic phase was washed with brine once, dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried to afford compound 5 (630 mg, yield: 47.1%) as a yellow solid.


Step (4):



embedded image


Compound 5 (100 mg, 0.29 mmol, 1.0 eq) was dissolved in THE (5 mL), and methanesulfonyl chloride (68 mg, 0.58 mmol, 2.0 eq) and triethylamine (117 mg, 1.16 mmol, 4.0 eq) were added at 0° C. The mixture was reacted at room temperature for 2 h, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was filtered, the solid was purified by reversed phase preparation chromatography (acetonitrile/water+0.01% formic acid) to afford solid compound AB35433.


Compound AB35433:

MS-ESI: Calculated [M]+: 320.09, Found: 320.06.



1H NMR (400 MHz, DMSO-d6) δ 9.48 (s, 1H), 8.72 (s, 1H), 7.73 (s, 1H), 7.69 (s, 1H), 7.50 (s, 1H), 7.08 (s, 1H), 6.40 (s, 2H), 6.15 (s, 2H), 4.74-4.41 (m, 2H), 3.18-3.14 (m, 2H).


Example 49 Synthesis of Compound AB35467

The structure of compound AB35467 was as follows:




embedded image


The synthesis method of compound AB35467 was as follows:




embedded image


Compound 1 (200 mg, 0.56 mmol, 1.0 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and cyclopentylmagnesium bromide (3.4 mL, 3.36 mmol, 6.0 eq, 1M) was added at 0° C. The mixture was reacted at room temperature for 0.5 h, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with dichloromethane twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.1% formic acid) to afford compound AB35467.


Compound AB35467:

MS-ESI: Calculated [M+H]+: 390.17, Found: 390.15.



1H NMR (400 MHz, DMSO-d6) δ 7.17 (s, 1H), 6.75 (s, 1H), 6.58 (s, 1H), 6.52 (s, 1H), 5.97 (s, 2H), 5.88 (s, 2H), 5.79 (s, 1H), 4.15 (d, J=8.0 Hz, 1H), 3.42-3.37 (m, 1H), 2.87-2.82 (m, 1H), 2.65-2.60 (m, 1H), 2.21-2.15 (m, 1H), 1.60-1.56 (m, 1H), 1.45-1.10 (m, 8H).


Example 50 Synthesis of Compound AB35468

The structure of compound AB35468 was as follows:




embedded image


The synthesis method of compound AB35468 was as follows:




embedded image


Compound 1 (200 mg, 0.39 mmol, 1.0 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and methylmagnesium bromide (0.6 mL, 1.95 mmol, 5.0 eq, 3M) was added at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.1% formic acid, 30%-40% acetonitrile, reverse phase column Green ODS, 21.2*250 mm, 10 μm, 120 Å) to afford compound AB35468.


MS-ESI: Calculated [M+H]+: 484.24; Found [M+H]+: 484.25.



1H NMR (400 MHz, DMSO-d6): δ 7.27-7.23 (m, 2H), 7.18-7.12 (m, 3H), 6.85-6.82 (m, 4H), 6.01 (d, J=4.0 Hz, 2H), 4.65-4.60 (m, 1H), 3.76 (s, 3H), 3.74 (s, 3H), 3.18-3.08 (m, 2H), 2.74-2.59 (m, 6H), 1.72-1.63 (m, 3H), 1.45-1.40 (m, 1H), 0.93 (d, J=4.0 Hz, 3H).


Example 51 Synthesis of Compound AB35469

The structure of compound AB35469 was as follows:




embedded image


The synthesis method of compound AB35469 was as follows:


Step (1):



embedded image


Compound 1 (10 g, 66.57 mmol, 1 eq) was dissolved in dichloromethane (200 mL), and Dess-Martin Periodinane (3.4 g, 79.88 mmol, 1.2 eq) was added in batches at 0° C. The mixture was reacted at room temperature for 2 h, and the reaction was detected to be performed completely using TLC. The reaction mixture was filtered, the filtrate was concentrated. The crude product was purified by fast chromatography (PE/EA=100/1) to afford compound 2 (7.8 g, yield: 79.6%) as a yellow liquid.


Step (2):



embedded image


Compound 3 (2 g, 5.9 mmol, 1 eq) was dissolved in ethanol/acetic acid (30 mL/5 mL), and compound 2 (7.8 g, 52.6 mmol, 9 eq) was added. The mixture was reacted at 90° C. for 4 h, an appropriate amount of hydrochloric acid was added, and the mixture was concentrated. To crude product was added a small amount of dichloromethane and an appropriate amount of ethyl acetate, the mixture was stewed for 0.5 h and then filtered to remove solid. The filtrate was stewed for overnight to precipitate a solid, the solid was filtered and collected to afford compound 4 (1.2 g, yield: 40.4%) as a yellow solid.


Step (3):



embedded image


Compound 4 (200 mg, 0.39 mmol, 1 eq) was dissolved in chloroform (8 mL), and aqueous ammonia (4 mL) was added. The mixture was reacted at 30° C. for 48 h under N2. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=100/1 to 50/1) to afford compound AB35469.


Compound AB35469:

MS-ESI: Calculated [M+H]+: 586.13; Found [M+H]+: 586.10.



1H NMR (400 MHz, CDCl3) δ 7.30-7.26 (m, 2H), 7.21-7.17 (m, 3H), 7.07-7.00 (m, 2H), 6.86 (s, 1H), 6.67 (s, 1H), 5.97 (s, 2H), 5.58 (s, 1H), 4.09-4.02 (m, 1H), 3.93 (s, 3H), 3.89 (s, 3H), 3.46-3.42 (m, 1H), 2.80-2.53 (m, 6H), 1.83-1.75 (m, 3H), 1.54-1.47 (m, 1H).


Example 52 Synthesis of Compound AB35475

The structure of compound AB35475 was as follows:




embedded image


The synthesis method of compound AB35475 was as follows:


Step (1):



embedded image


Compound 1 (1.0 g, 2.79 mmol, 1 eq) was dissolved in N, N-dimethylformamide (20 mL), and compound 2 (1.7 g, 11.16 mmol, 4 eq) was added. The mixture was reacted at 75° C. for 16 h, and the reaction was detected to be performed completely using TLC and LCMS. The solvent was rotary dried, and water was added, the mixture was extracted with dichloromethane twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried.


The crude product was purified by fast chromatography (DCM/MeOH=50/1 to 20/1) to afford compound 3 (400 mg, yield: 25.6%).


Step (2):



embedded image


Compound 3 (200 mg, 0.42 mmol, 1 eq) was dissolved in a mixture of chloroform (8 ml) and aqueous ammonia (4 ml). The mixture was reacted at room temperature for overnight, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was diluted with water and then extracted with dichloromethane twice, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified fast chromatography (dichloromethane/methanol=100/1 to 50/1) to afford compound AB35475.


Compound AB35475:

MS-ESI: Calculated [M+H]+: 558.07, Found: 558.05.



1H NMR (400 MHz, DMSO-d6) δ 7.29 (s, 1H), 7.05 (d, J=8.0 Hz, 1H), 6.85 (d, J=8.0 Hz, 1H), 6.77 (s, 1H), 6.29 (s, 1H), 5.98 (d, J=4.0 Hz, 2H), 5.55 (s, 1H), 4.12-4.08 (m, 1H), 3.81-3.78 (m, 1H), 3.77 (s, 3H), 3.74-3.71 (m, 1H), 3.63-3.60 (m, 3H), 3.25-3.19 (m, 1H), 2.72-2.66 (m, 1H), 1.73-1.64 (m, 4H), 1.47-1.41 (m, 4H).


Example 53 Synthesis of Compound AB35476

The structure of compound AB35476 was as follows:




embedded image


The synthesis method of compound AB35476 was as follows:


Step (1):



embedded image


Compound 1 (2.0 g, 5.59 mmol, 1 eq) was dissolved in acetonitrile (40 mL), and compound 2 (5.1 g, 22.36 mmol, 4 eq) was added. The mixture was reacted at 80° C. for 16 h, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was diluted with water and then extracted with dichloromethane twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=50/1 to 20/1) to afford compound 3 (1.48 g, yield: 48.2%) as a yellow solid.


Step (2):



embedded image


Compound 3 (1.3 g, 2.36 mmol, 1.0 eq) was dissolved in a mixture of chloroform (40 ml) and aqueous ammonia (20 ml). The mixture was reacted at 30° C. for overnight, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was diluted with water and then extracted with dichloromethane twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified fast chromatography (dichloromethane/methanol=100/1 to 50/1) to afford compound AB35476.


Compound AB35476:

MS-ESI: Calculated [M+H]+: 588.11, Found: 588.10.



1H NMR (400 MHz, DMSO-d6) δ 7.30 (s, 1H), 7.27-7.23 (m, 2H), 7.07 (d, J=12.0 Hz, 1H), 6.91-6.85 (m, 4H), 6.76 (s, 1H), 6.29 (s, 1H), 5.98 (d, J=8.0 Hz, 2H), 5.58 (s, 1H), 4.21-4.16 (m, 1H), 4.04-4.01 (m, 2H), 3.91-3.86 (m, 1H), 3.77 (s, 3H), 3.69-3.65 (m, 1H), 3.59-3.53 (m, 1H), 3.22-3.14 (m, 1H), 2.66-2.62 (m, 1H), 1.90-1.82 (m, 2H), 1.21-1.10 (m, 1H), 0.83-0.71 (m, 1H).


Example 54 Synthesis of Compound AB35478

The structure of compound AB35478 was as follows:




embedded image


The synthesis method of compound AB35478 was as follows:


Step (1):



embedded image


Compound 1 (1.5 g, 4.19 mmol, 1 eq) was dissolved in N, N-dimethylformamide (30 mL), and compound 2 (3.1 g, 16.76 mmol, 4 eq) was added. The mixture was reacted at 70° C. for 16 h, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was diluted with water and then extracted with dichloromethane twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (DCM:MeOH=50:1) to afford compound 3 (560 mg, yield: 26.2%) as a yellow solid.


Step (2):



embedded image


Compound 3 (160 mg, 0.31 mmol, 1.0 eq) was dissolved in a mixture of chloroform (8 ml) and aqueous ammonia (4 ml). The mixture was reacted at 30° C. for overnight, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was diluted with water and then extracted with dichloromethane twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified fast chromatography (dichloromethane/methanol=100/1 to 50/1) to afford compound AB35478.


MS-ESI and 1H NMR of compound AB35478 were as follows:


MS-ESI: Calculated [M+H]+: 500.05, Found: 500.25.



1H NMR (400 MHz, CDCl3) δ 7.15 (s, 1H), 6.97-6.87 (m, 2H), 6.60 (s, 1H), 6.09 (s, 1H), 5.94 (d, J=4.0 Hz, 2H), 5.61 (s, 1H), 4.98-4.80 (m, 1H), 4.78-4.62 (m, 1H), 4.37-4.33 (m, 1H), 3.96-3.82 (m, 5H), 3.71-3.64 (m, 1H), 3.35-3.28 (m, 1H), 2.74-2.68 (m, 1H), 2.24-2.10 (m, 2H).


Example 55

Compound SJ0002 was prepared by conventional method, the structure of compound SJ0002 was as follows:




embedded image


Example 56

Compound SJ0003 was prepared by conventional method, the structure of compound SJ0003 was as follows:




embedded image


Example 57

Compound SJ0005 was prepared by conventional method, the structure of compound SJ0005 was as follows:




embedded image


Example 58

Compound SJ0006 was prepared by conventional method, the structure of compound SJ0006 was as follows:




embedded image


Example 59

Compound SJ0007 was prepared by conventional method, the structure of compound SJ0007 was as follows:




embedded image


Example 60

Compound SJ0008 was prepared by conventional method, the structure of compound SJ0008 was as follows:




embedded image


Example 61

Compound SJ0010 was prepared by conventional method, the structure of compound SJ0010 was as follows:




embedded image


Example 62

Compound SJ0011 was prepared by conventional method, the structure of compound SJ0011 was as follows:




embedded image


Example 63

Compound SJ0013 was prepared by conventional method, the structure of compound SJ0013 was as follows:




embedded image


Example 64

Compound SJ0014 was prepared by conventional method, the structure of compound SJ0014 was as follows:




embedded image


Example 65

Compound SJ0015 was prepared by conventional method, the structure of compound SJ0015 was as follows:




embedded image


Example 66

Compound SJ0017 was prepared by conventional method, the structure of compound SJ0017 was as follows:




embedded image


Example 67

Compound SJ0018 was prepared by conventional method, the structure of compound SJ0018 was as follows:




embedded image


Example 68

Compound SJ0019 was prepared by conventional method, the structure of compound SJ0019 was as follows:




embedded image


Example 69

Compound SJ0020 was prepared by conventional method, the structure of compound SJ0020 was as follows:




embedded image


Example 70

Compound SJ0021 was prepared by conventional method, the structure of compound SJ0021 was as follows:




embedded image


Example 71

Compound SJ0022 was prepared by conventional method, the structure of compound SJ0022 was as follows:




embedded image


Example 72

Compound SJ0023 was prepared by conventional method, the structure of compound SJ0023 was as follows:




embedded image


Example 73

Compound SJ0025 was prepared by conventional method, the structure of compound SJ0025 was as follows:




embedded image


Example 74

Compound SJ0026 was prepared by conventional method, the structure of compound SJ0026 was as follows:




embedded image


Example 75

Compound SJ0027 was prepared by conventional method, the structure of compound SJ0027 was as follows:




embedded image


Example 76

Compound SJ0029 was prepared by conventional method, the structure of compound SJ0029 was as follows:




embedded image


Example 77

Compound SJ0030 was prepared by conventional method, the structure of compound SJ0030 was as follows:




embedded image


Example 78

Compound SJ0031 was prepared by conventional method, the structure of compound SJ0031 was as follows:




embedded image


Example 79

Compound SJ0032 was prepared by conventional method, the structure of compound SJ0032 was as follows:




embedded image


Example 80

Compound SJ0033 was prepared by conventional method, the structure of compound SJ0033 was as follows:




embedded image


Example 81

Compound SJ0034 was prepared by conventional method, the structure of compound SJ0034 was as follows:




embedded image


Example 82

Compound SJ0035 was prepared by conventional method, the structure of compound SJ0035 was as follows:




embedded image


Example 83 Synthesis of Compound AB35484

The structure of compound AB35484 was as follows:




embedded image


The synthesis method of compound AB35484 was as follows:


Step (1):



embedded image


Compound 1 (7.1 g, 16.5 mmol, 1 eq) was dissolved in methanol (50 mL), and potassium carbonate (6.8 g, 49.5 mmol, 3.0 eq) and sodium borohydride (499 mg, 13.2 mmol, 0.8 eq) were added at 0° C. The mixture was reacted at 0° C. for 1 h. and the reaction was detected to be performed completely using LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and filtered, the solid was filtered and washed with a small amount of water and methanol to obtain compound 2.


Step (2):



embedded image


Compound 2 (1.0 g, 2.84 mmol, 1 eq) was dissolved in ethanol/acetic acid (10 mL/8 mL), and phenylpropionaldehyde (3.8 g, 28.4 mmol, 10 eq) was added. The mixture was reacted at 90° C. for 4 h, an appropriate amount of hydrochloric acid was added, the mixture was concentrated and rotary dried, a small amount of dichloromethane and an appropriate amount of ethyl acetate were added, the mixture was stewed for 0.5 h and then filtered to remove impurity solid. The filtrate was stewed for overnight and filtered to afford compound 4.


Step (3):



embedded image


Compound 4 (200 mg, 0.39 mmol, 1 eq) was dissolved in a mixture of aqueous ammonia (5 mL) and chloroform (10 mL). The mixture was reacted at room temperature for overnight, and the reaction was detected to be performed completely using LCMS. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate, filtered, and rotary dried. The crude product was purified by fast chromatography (dichloromethane/methanol=100/1 to 50/1) to afford compound AB35484.


The MS-ESI and 1H NMR spectra of compound AB35484 were as follows:


MS-ESI: Calculated [M+H]+: 586.13, Found: 586.10.



1H NMR (400 MHz, DMSO-d6) δ 7.29-7.25 (m, 2H), 7.21-7.17 (m, 3H), 7.06 (d, J=8.0 Hz, 1H), 6.88 (d, J=8.0 Hz, 1H), 6.75 (s, 2H), 5.53 (s, 1H), 4.28-4.21 (m, 4H), 3.84-3.79 (m, 7H), 3.56-3.54 (m, 1H), 2.68-2.51 (m, 6H), 1.90-1.70 (m, 2H).


Example 84 Synthesis of Compound AB35485

The structure of compound AB35485 was as follows:




embedded image


The synthesis method of compound AB35485 was as follows:




embedded image


Compound 1 (200 mg, 0.39 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and methylmagnesium bromide (0.7 mL, 1.95 mmol, 5 eq, 3M) was added at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.1% formic acid) to afford compound AB35485.


The MS-ESI and 1H NMR spectra of compound AB35485 were as follows:


MS-ESI: Calculated [M+H]+: 398.17; Found[M+H]+: 398.15.



1H NMR (400 MHz, DMSO-d6) δ 7.21 (s, 1H), 6.79 (d, J=8.0 Hz, 1H), 6.74 (s, 1H), 6.65 (d, J=8.0 Hz, 1H), 5.97 (d, J=4.0 Hz, 2H), 5.90 (s, 1H), 4.73-4.68 (m, 2H), 4.59-4.56 (m, 1H), 4.03-4.00 (m, 2H), 3.72 (s, 3H), 3.24-3.16 (m, 2H), 2.76-2.71 (m, 2H), 2.11-2.01 (m, 2H), 1.02 (d, J=8.0 Hz, 3H).


Example 85 Synthesis of Compound AB35486

The structure of compound AB35486 was as follows:




embedded image


The synthesis method was as follows:


Step (1):



embedded image


Compound 1 (3.0 g, 5.38 mmol, 1 eq) was dissolved in ethanol (50 mL), and phenylethylamine (652 mg, 53.8 mmol, 10 eq) was added. The mixture was reacted at 110° C. for 48 h under N2, the reaction was completed. The reaction mixture was concentrated, the crude product was purified by fast chromatography (DCM/MeOH=100/1 to 50/1) to afford compound 3.


Step (2):



embedded image


Compound 3 (1.5 g, 3.25 mmol, 1 eq) was dissolved in chloroform (20 ml), and aqueous ammonia (10 ml) was added. The mixture was reacted at room temperature for overnight under N2, and the reaction was detected to be performed completely using LCMS. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=100/1 to 50/1) to afford compound AB35486.


The MS-ESI and 1H NMR spectra of compound AB35486 were as follows:


MS-ESI: Calculated [M+H]+: 543.09, Found: 543.10.



1H NMR (400 MHz, DMSO-d6) δ 7.30-7.25 (m, 3H), 7.21-7.17 (m, 3H), 6.92 (d, J=8.0 Hz, 1H), 6.74 (s, 1H), 6.67 (d, J=12.0 Hz, 1H), 6.24 (s, 1H), 5.97 (d, J=8.0 Hz, 2H), 5.68 (s, 1H), 4.38-4.35 (m, 1H), 3.74 (s, 3H), 3.70-3.44 (m, 2H), 3.28-3.24 (m, 2H), 2.77-2.65 (m, 4H).


Example 86 Synthesis of Compound AB35487

The structure of compound AB35487 was as follows:




embedded image


The synthesis method of compound AB35487 was as follows:


Step (1):



embedded image


Compound 1 (2.0 g, 5.59 mmol, 1 eq) was dissolved in N, N-dimethylformamide (30 mL), and compound 2 (4.6 g, 27.95 mmol, 5 eq) was added. The mixture was reacted at 60° C. for overnight. The reaction mixture was diluted with water and then extracted with dichloromethane twice, the organic phase was washed with brine, dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=500/1 to 30/1) to afford compound 3.


Step (2):



embedded image


Compound 3 (200 mg, 0.41 mmol, 1 eq) was dissolved in chloroform (10 mL), and aqueous ammonia (5 mL) was added. The mixture was reacted at room temperature for overnight. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was washed with brine, dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=100/1) to afford compound AB35487.


The MS-ESI and 1H NMR spectra of compound AB35487 were as follows:


MS-ESI: Calculated [M+H]+: 524.10; Found [M+H]+: 524.10.



1H NMR (400 MHz, DMSO-d6) δ 7.33 (s, 1H), 7.09 (d, J=8.0 Hz, 1H), 6.89 (d, J=8.0 Hz, 1H), 6.80 (s, 1H), 6.32 (s, 1H), 6.01 (d, J=8.0 Hz, 2H), 5.59 (s, 1H), 4.18-4.13 (m, 1H), 3.80 (s, 3H), 3.73-3.62 (m, 2H), 3.26-3.24 (m, 1H), 2.76-2.70 (m, 1H), 2.01-1.97 (m, 1H), 1.75-1.70 (m, 2H), 1.50-1.48 (m, 2H), 1.35-1.32 (m, 4H), 0.91-0.87 (m, 3H).


Example 87 Synthesis of Compound AB35488

The structure of compound AB35488 was as follows:




embedded image


The synthesis method of compound AB35488 was as follows:


Step (1):



embedded image


Compound 1 (2.0 g, 5.93 mmol, 1 eq) was dissolved in ethanol/acetic acid (10 mL/8 mL), and acetaldehyde (12 mL, 59.3 mmol, 10 eq, 5M in THF) was added. The mixture was reacted at 90° C. for 4 h under N2, the reaction was completed, an appropriate amount of hydrochloric acid was added, and the mixture was concentrated and rotary dried, a small amount of dichloromethane and an appropriate amount of ethyl acetate were added, the mixture was stewed for 0.5 h and then filtered to remove impurity solid. The filtrate was stewed for overnight and filtered to afford compound 3.


Step (2):



embedded image


Compound 3 (200 mg, 0.50 mmol, 1 eq) was dissolved in a mixture of chloroform (10 mL) and aqueous ammonia (5 mL). The mixture was reacted at room temperature for overnight under N2, and the reaction was detected to be performed completely using LCMS. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=100/1) to afford compound AB35488.


The MS-ESI and 1H NMR spectra of compound AB35488 were as follows:


MS-ESI: Calculated [M+H]+: 482.06, Found: 482.05.



1H NMR (400 MHz, DMSO-d6) δ 7.15-7.08 (m, 2H), 6.88 (s, 1H), 6.82 (s, 1H), 6.02 (s, 2H), 5.55 (s, 1H), 3.87-3.80 (s, 7H), 3.58-3.56 (m, 1H), 2.70-2.58 (m, 4H), 1.15-1.11 (m, 3H).


Example 88 Synthesis of Compound AB35489

The structure of compound AB35489 was as follows:




embedded image


The synthesis method of compound AB35489 was as follows:


Step (1):



embedded image


Compound 1 (2.0 g, 5.93 mmol, 1 eq) was dissolved in ethanol/acetic acid (20 mL/10 mL), and hexanal (5.9 g, 59.3 mmol, 10 eq) was added was added. The mixture was reacted at 90° C. for 4 h under N2, the reaction was completed, an appropriate amount of hydrochloric acid was added, and the mixture was concentrated and rotary dried, a small amount of dichloromethane and an appropriate amount of ethyl acetate were added, the mixture was stewed for 0.5 h and then filtered to remove impurity solid. The filtrate was stewed for overnight, the solid was filtered and dried to afford compound 3.


Step (2):



embedded image


Compound 3 (200 mg, 0.44 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and cyclopentylmagnesium bromide (2.2 mL, 0.50 mmol, 5 eq, 1M) was added at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=100/1) to afford compound AB35489.


The MS-ESI and 1H NMR spectra of compound AB35489 were as follows:


MS-ESI: Calculated [M+H]+: 490.29, Found: 490.30.



1H NMR (400 MHz, DMSO-d6) δ 6.88 (s, 2H), 6.84 (d, J=4.0 Hz, 2H), 6.01 (d, J=4.0 Hz, 2H), 4.41 (d, J=8.0 Hz, 1H), 3.76 (s, 3H), 3.73 (s, 3H), 2.66-2.60 (m, 2H), 2.12-2.05 (m, 1H), 1.63-1.61 (m, 1H), 1.38-1.21 (m, 19H), 0.87-0.83 (m, 3H).


Example 89 Synthesis of Compound AB35490

The structure of compound AB35490 was as follows:




embedded image


The synthesis method of compound AB35490 was as follows:




embedded image


Compound 1 (150 mg, 0.34 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and cyclobutylmagnesium bromide (0.6 mL, 1.7 mmol, 5 eq, 3M) was added at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.1% formic acid) to afford compound AB35490.


The MS-ESI and 1H NMR spectra of compound AB35490 were as follows:


MS-ESI: Calculated [M+H]+: 454.17; Found[M+H]+: 454.25.



1H NMR (400 MHz, DMSO-d6) δ 7.21 (s, 1H), 6.80-6.65 (m, 3H), 5.97 (s, 2H), 5.88 (s, 1H), 4.53 (d, J=8.0 Hz, 1H), 4.13-4.11 (m, 1H), 3.89-3.86 (m, 3H), 3.73 (s, 3H), 3.32-3.31 (m, 2H), 2.80-2.75 (m, 2H), 2.65-2.62 (m, 1H), 2.20-2.07 (m, 2H), 1.83-1.75 (m, 3H), 1.57-1.55 (m, 2H), 1.38-1.32 (m, 1H).


Example 90 Synthesis of Compound AB35491

The structure of compound AB35491 was as follows:




embedded image


The synthesis method of compound AB35491 was as follows:




embedded image


Compound 1 (150 mg, 0.34 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and cyclohexylmagnesium bromide (1.7 mL, 1.7 mmol, 5 eq, 1M) was added at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.1% formic acid) to afford compound AB35491.


The MS-ESI and #H NMR spectra of compound AB35491 were as follows:


MS-ESI: Calculated [M+H]+: 482.21; Found[M+H]+: 482.20.



1H NMR (400 MHz, DMSO-d6) δ 7.20 (s, 1H), 6.81-6.63 (m, 3H), 5.96 (s, 2H), 5.83 (s, 1H), 4.45 (d, J=4.0 Hz, 1H), 4.09-4.07 (m, 1H), 3.90-3.86 (m, 3H), 3.72 (s, 3H), 3.38-3.35 (m, 2H), 2.89-2.87 (m, 1H), 2.63-2.61 (m, 1H), 2.14-2.02 (m, 2H), 1.64-1.46 (m, 6H), 1.04-0.95 (m, 5H).


Example 91 Synthesis of Compound AB35492

The structure of compound AB35492 was as follows:




embedded image


The synthesis method of compound AB35492 was as follows:


Step (1):



embedded image


Compound 1 (2.0 g, 5.93 mmol, 1 eq) was dissolved in ethanol/acetic acid (20 mL/10 mL), and propionaldehyde (3.4 g, 59.3 mmol, 10 eq) was added. The mixture was reacted at 90° C. for 4 h under N2, the reaction was completed, an appropriate amount of hydrochloric acid was added, the mixture was concentrated and rotary dried, a small amount of dichloromethane and an appropriate amount of ethyl acetate were added, the mixture was stewed for 0.5 h and then filtered to remove impurity solid. The filtrate was stewed for overnight and filtered to afford compound 3.


Step (2):



embedded image


Compound 3 (200 mg, 0.48 mmol, 1 eq) was dissolved in chloroform (10 mL), and aqueous ammonia (5 mL) was added. The mixture was reacted at room temperature for overnight under N2. The reaction mixture was diluted with water and extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=100/1) to afford compound AB35492.


The MS-ESI and 1H NMR spectra of compound AB35492 were as follows:


MS-ESI: Calculated [M+H]+: 496.07, Found: 496.50.



1H NMR (400 MHz, DMSO-d6) δ 7.14-7.06 (m, 2H), 6.87 (s, 1H), 6.77 (s, 1H), 6.02 (d, J=8.0 Hz, 2H), 5.54 (s, 1H), 3.86-3.79 (m, 7H), 3.59-3.56 (m, 1H), 2.73-2.70 (m, 1H), 2.56-2.49 (m, 3H), 1.66-1.59 (m, 1H), 1.42-1.38 (m, 1H), 0.97-0.94 (m, 3H).


Example 92 Synthesis of Compound AB35494

The structure of compound AB35494 was as follows:




embedded image


The synthesis method of compound AB35494 was as follows:


Step (1):



embedded image


Compound 1 (500 mg, 1.40 mmol, 1 eq) was dissolved in N, N-dimethylformamide (10 mL), and bromobutane (959 mg, 7.0 mmol, 5 eq) was added. The mixture was reacted at 75° C. for 16 h under N2, the reaction was completed. The reaction mixture was concentrated, the crude product was purified by fast chromatography (DCM/MeOH=50/1) to afford compound 3.


Step (2):



embedded image


Compound 3 (200 mg, 0.44 mmol, 1 eq) was dissolved in chloroform (10 mL), and aqueous ammonia (5 mL) was added. The mixture was reacted at room temperature for overnight under N2, the reaction was completed. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate, filtered, and rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=100/1) to afford compound AB35494.


The MS-ESI and 1H NMR spectra of compound AB35494 were as follows:


MS-ESI: Calculated [M+H]+: 496.07, Found: 496.30.



1H NMR (400 MHz, DMSO-d6) δ 7.30 (s, 1H), 7.06 (d, J=8.0 Hz, 1H), 6.86 (d, J=8.0 Hz, 1H), 6.77 (s, 1H), 6.30 (s, 1H), 5.99 (d, J=4.0 Hz, 2H), 5.56 (s, 1H), 4.15-4.10 (m, 1H), 3.77-3.73 (m, 4H), 3.61-3.59 (m, 2H), 3.26-3.19 (m, 1H), 2.72-2.66 (m, 1H), 1.64-1.55 (m, 2H), 1.50-1.45 (m, 2H), 0.94-0.91 (m, 3H).


Example 93 Synthesis of Compound AB35496

The structure of compound AB35496 was as follows:




embedded image


The synthesis method of compound AB35496 was as follows:


Step (1):



embedded image


Compound 1 (1.0 g, 2.79 mmol, 1 eq) was dissolved in N, N-dimethylformamide (20 mL), and compound 2 (1.8 g, 13.95 mmol, 5 eq) was added. The mixture was reacted at 60° C. for 16 h under N2, the reaction was completed. The reaction mixture was concentrated, the crude product was purified by fast chromatography (DCM/MeOH=50/1) to afford compound 3.


Step (2):



embedded image


Compound 3 (200 mg, 0.45 mmol, 1 eq) was dissolved in chloroform (10 mL), and aqueous ammonia (5 mL) was added. The mixture was reacted at room temperature for overnight under N2, the reaction was completed. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate, filtered, and rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=100/1) to afford compound AB35496.


The MS-ESI and 1H NMR spectra of compound AB35496 were as follows:


MS-ESI: Calculated [M+H]+: 530.03, Found: 530.25.



1H NMR (400 MHz, DMSO-d6) δ 7.30 (s, 1H), 7.07 (d, J=8.0 Hz, 1H), 6.87 (d, J=8.0 Hz, 1H), 6.77 (s, 1H), 6.29 (s, 1H), 5.99 (d, J=4.0 Hz, 2H), 5.56 (s, 1H), 4.16-4.11 (m, 1H), 3.80-3.78 (m, 1H), 3.72 (s, 3H), 3.61-3.59 (m, 3H), 3.56-3.54 (m, 1H), 3.26-3.19 (m, 1H), 2.72-2.67 (m, 1H), 1.95-1.90 (m, 2H), 1.82-1.78 (m, 2H).


Example 94 Synthesis of Compound AB35497

The structure of compound AB35497 was as follows:




embedded image


The synthesis method of compound AB35497 was as follows:


Step (1):



embedded image


Compound 1 (2.0 g, 5.93 mmol, 1 eq) was dissolved in ethanol/acetic acid (20 mL/10 mL), and octanal (7.6 g, 59.3 mmol, 10 eq) was added. The mixture was reacted at 90° C. for 4 h under N2, the reaction was completed, an appropriate amount of hydrochloric acid was added, the mixture was concentrated and rotary dried, a small amount of dichloromethane and an appropriate amount of ethyl acetate were added, the mixture was stewed for 0.5 h and then filtered to remove impurity solid. The filtrate was stewed for overnight and filtered to afford compound 3.


Step (2):



embedded image


Compound 3 (200 mg, 0.41 mmol, 1 eq) was dissolved in chloroform (10 mL), and aqueous ammonia (5 mL) was added. The mixture was reacted at room temperature for overnight under N2, the reaction was completed. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate, filtered, and rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=100/1) to afford compound AB35497.


The MS-ESI and 1H NMR spectra of compound AB35497 were as follows:


MS-ESI: Calculated [M+H]+: 566.16, Found: 566.15.



1H NMR (400 MHz, DMSO-d6) δ 7.15-7.04 (m, 2H), 6.88 (s, 1H), 6.79 (s, 1H), 6.02 (d, J=4.0 Hz, 2H), 5.55 (s, 1H), 3.87-3.80 (m, 7H), 3.57-3.54 (m, 1H), 2.70-2.65 (m, 1H), 2.57-2.51 (m, 3H), 1.66-1.58 (m, 1H), 1.37-1.24 (m, 11H), 0.85-0.82 (m, 3H).


Example 95 Synthesis of Compound AB35498

The structure of compound AB35498 was as follows:




embedded image


The synthesis method of compound AB35498 was as follows:




embedded image


Compound 1 (240 mg, 0.50 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and methylmagnesium bromide (0.8 mL, 2.5 mmol, 5 eq, 3M) was added at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by thin layer chromatography (DCM/MeOH=30/1) to afford compound AB35498.


The MS-ESI and 1H NMR spectra of compound AB35498 were as follows:


MS-ESI: Calculated [M+H]+: 456.21; Found[M+H]+: 456.40.



1H NMR (400 MHz, DMSO-d6) δ 7.29-7.24 (m, 4H), 7.19-7.16 (m, 1H), 7.05-6.94 (m, 2H), 6.89 (s, 1H), 6.81 (s, 1H), 5.99 (s, 2H), 4.69-4.65 (m, 1H), 3.78 (d, J=8.0 Hz, 6H), 3.25-3.10 (m, 2H), 2.90-2.60 (m, 6H), 0.98 (d, J=4.0 Hz, 3H).


Example 96 Synthesis of Compound AB35499

The structure of compound AB35499 was as follows:




embedded image


The synthesis method of compound AB35499 was as follows:


Step (1):



embedded image


Compound 1 (2.0 g, 5.59 mmol, 1 eq) was dissolved in N, N-dimethylformamide (50 mL), and bromoethane (53.0 g, 27.95 mmol, 10 eq) was added. The mixture was reacted at 60° C. for 16 h under N2, the reaction was completed. The reaction mixture was concentrated, the crude product was purified by fast chromatography (DCM/MeOH=50/1) to afford compound 3.


Step (2):



embedded image


Compound 3 (200 mg, 0.46 mmol, 1 eq) was dissolved in chloroform (10 mL), and aqueous ammonia (5 mL) was added. The mixture was reacted at room temperature for overnight under N2, the reaction was completed. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=100/1) to afford compound AB35499.


The MS-ESI and 1H NMR spectra of compound AB35499 were as follows:


MS-ESI: Calculated [M+H]+: 468.04; Found[M+H]+: 468.05.



1H NMR (400 MHz, DMSO-d6) δ 7.30 (s, 1H), 7.06 (d, J=8.0 Hz, 1H), 6.86 (d, J=8.0 Hz, 1H), 6.77 (s, 1H), 6.29 (s, 1H), 5.98 (d, J=8.0 Hz, 2H), 5.60 (s, 1H), 4.09-3.96 (m, 2H), 3.78-3.75 (m, 4H), 3.60-3.58 (m, 1H), 3.22-3.19 (m, 1H), 2.67-2.65 (m, 1H), 1.28-1.24 (m, 3H).


Example 97 Synthesis of Compound AB35500

The structure of compound AB35500 was as follows:




embedded image


The synthesis method of compound AB35500 was as follows:


Step (1):



embedded image


Compound 1 (30 g, 219.59 mmol, 1 eq) was dissolved in dichloromethane (300 mL), and Dess-Martin Periodinane (111.7 g, 263.51 mmol, 1.2 eq) was added in batches at 0° C. The mixture was reacted at room temperature for 2 h, the reaction was completed. The solid was filtered, the filtrate was concentrated. The crude product was purified by fast chromatography (PE/EA=100/1) to afford compound 2.




embedded image


Compound 3 (2 g, 5.93 mmol, 1 eq) was dissolved in ethanol/acetic acid (30 mL/5 mL), and compound 2 (8.0 g, 59.3 mmol, 10 eq) was added. The mixture was reacted at 90° C. for 4 h, the reaction was completed, an appropriate amount of hydrochloric acid was added, and the mixture was concentrated and rotary dried, a small amount of dichloromethane and an appropriate amount of ethyl acetate were added, the mixture was stewed for 0.5 h and then filtered to remove solid. The filtrate was stewed for overnight, the solid was filtered and dried to afford compound 4.


Step (3):



embedded image


Compound 4 (300 mg, 0.61 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and cyclopentylmagnesium bromide (3 mL, 3.05 mmol, 5 eq, 1M) was added at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h, the reaction was completed. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=100/1 to 50/1) to afford compound AB35500.


The MS-ESI and 1H NMR spectra of compound AB35500 were as follows:


MS-ESI: Calculated [M+H]+: 524.25; Found [M+H]+: 524.25.



1H NMR (400 MHz, DMSO-d6) δ 6.88 (s, 2H), 6.84 (d, J=4.0 Hz, 2H), 6.01 (s, 2H), 4.41 (d, J=8.0 Hz, 1H), 3.76 (s, 3H), 3.73 (s, 3H), 3.62-3.59 (m, 2H), 3.34 (s, 1H), 2.66-2.53 (m, 4H), 2.12-2.05 (m, 1H), 1.71-1.58 (m, 3H), 1.40-1.19 (m, 14H).


Example 98 Synthesis of Compound AB35501

The structure of compound AB35501 was as follows:




embedded image


The synthesis method of compound AB35501 was as follows:


Step (1):



embedded image


Compound 1 (25 g, 138.07 mmol, 1 eq) was dissolved in dichloromethane (300 mL), and Dess-Martin Periodinane (70.2 g, 165.68 mmol, 1.2 eq) was added in batches at 0° C. The mixture was reacted at room temperature for 2 h, and the reaction was completed. The solid was filtered, the filtrate was concentrated. The crude product was purified by fast chromatography (PE/EA=100/1) to afford compound 2.


Step (2):



embedded image


Compound 3 (2 g, 5.93 mmol, 1 eq) was dissolved in ethanol/acetic acid (30 mL/5 mL), and compound 2 (10.6 g, 59.3 mmol, 10 eq) was added. The mixture was reacted at 90° C. for 4 h, the reaction was completed, an appropriate amount of hydrochloric acid was added, and the mixture was concentrated and rotary dried, a small amount of dichloromethane and an appropriate amount of ethyl acetate were added, the mixture was stewed for 0.5 h and then filtered to remove solid.


The filtrate was stewed for overnight, the solid was filtered and dried to afford compound 4.


Step (3):



embedded image


Compound 4 (200 mg, 0.39 mmol, 1 eq) was dissolved in chloroform (10 mL), and aqueous ammonia (4 mL) was added. The mixture was reacted at room temperature for overnight, the reaction was completed. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=100/1) to afford compound AB35501.


The MS-ESI and 1H NMR spectra of compound AB35501 were as follows:


MS-ESI: Calculated [M+H]+: 616.03; Found [M+H]+: 616.00.



1H NMR (400 MHz, DMSO-d6) δ 7.15-7.05 (m, 2H), 6.88 (s, 1H), 6.79 (s, 1H), 6.03 (d, J=4.0 Hz, 2H), 5.73 (s, 1H), 5.55 (s, 1H), 3.87-3.80 (m, 7H), 3.54-3.52 (m, 1H), 3.51-3.49 (m, 2H), 2.70-2.68 (m, 1H), 2.58-2.53 (m, 2H), 1.81-1.78 (m, 2H), 1.63-1.58 (m, 1H), 1.45-1.37 (m, 5H).


Example 99 Synthesis of Compound AB35502

The structure of compound AB35502 was as follows:




embedded image


Step (1):



embedded image


Compound 1 (2 g, 5.93 mmol, 1 eq) was dissolved in ethanol/acetic acid (30 mL/5 mL), and butyraldehyde (4.3 g, 59.3 mmol, 10 eq) was added. The mixture was reacted at 90° C. for 4 h, the reaction was completed, an appropriate amount of hydrochloric acid was added, the mixture was concentrated and rotary dried, a small amount of dichloromethane and an appropriate amount of ethyl acetate were added, the mixture was stewed for 0.5 h and then filtered to remove solid. The filtrate was stewed for overnight, the solid was filtered and dried to afford compound 2.


Step (2):



embedded image


Compound 2 (200 mg, 0.47 mmol, 1 eq) was dissolved in chloroform (10 mL), and aqueous ammonia (4 mL) was added. The mixture was reacted at room temperature for overnight, the reaction was completed. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=100/1) to afford compound AB35502.


The MS-ESI and 1H NMR spectra of compound AB35502 were as follows:


MS-ESI: Calculated [M+H]+: 510.09; Found [M+H]+: 510.05.



1H NMR (400 MHz, DMSO-d6) δ 7.16-7.06 (m, 2H), 6.88 (s, 1H), 6.80 (s, 1H), 6.02 (d, J=8.0 Hz, 2H), 5.55 (s, 1H), 3.87-3.80 (m, 7H), 3.57-3.54 (m, 1H), 2.70-2.64 (m, 1H), 2.60-2.53 (m, 3H), 1.65-1.59 (m, 1H), 1.40-1.36 (m, 3H), 0.94-0.91 (m, 3H).


Example 100 Synthesis of Compound AB35504

The structure of compound AB35504 was as follows:




embedded image


The synthesis method of compound AB35504 was as follows:




embedded image


Compound 1 (200 mg, 0.48 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and cyclopentylmagnesium bromide (2.4 mL, 2.4 mmol, 5 eq, 1M) was slowly added dropwise at 0° C. under N2. The mixture was reacted for 0.5 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by thin layer chromatography (dichloromethane:methanol=50:1) to afford compound AB35504.


The MS-ESI and 1H NMR spectra of compound AB35504 were as follows:


MS-ESI: Calculated [M+H]+: 448.24, Found: 448.45.



1H NMR (400 MHz, DMSO-d6) δ 6.88-6.83 (m, 4H), 6.01 (s, 2H), 4.41 (d, J=8.0 Hz, 1H), 3.74 (d, J=12.0 Hz, 6H), 3.32 (s, 1H), 2.70-2.66 (m, 1H), 2.56-2.49 (m, 3H), 2.15-2.10 (m, 1H), 1.73-1.62 (m, 1H), 1.42-1.20 (m, 10H), 0.97-0.95 (m, 3H).


Example 101 Synthesis of Compound AB35505

The structure of compound AB35505 was as follows:




embedded image


The synthesis method of compound AB35505 was as follows:


Step (1):



embedded image


Compound 1 (500 mg, 1.40 mmol, 1 eq) was dissolved in N, N-dimethylformamide (20 mL), and bromopentane (1.0 g, 7.0 mmol, 5 eq) was added. The mixture was reacted at 75° C. for overnight, the reaction was completed. The reaction mixture was concentrated, the crude product was purified by fast chromatography (DCM/MeOH=50/1 to 30/1) to afford compound 3.


Step (2):



embedded image


Compound 3 (200 mg, 0.42 mmol, 1 eq) was dissolved in chloroform (10 mL), and aqueous ammonia (5 mL) was added. The mixture was reacted at room temperature for overnight, the reaction was completed. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by fast chromatography (PE/EA=50/1) to afford compound AB35505.


The MS-ESI and 1H NMR spectra of compound AB35505 were as follows:


MS-ESI: Calculated [M+H]+: 510.09; Found [M+H]+: 510.30.



1H NMR (400 MHz, DMSO-d6) δ 7.30 (s, 1H), 7.06 (d, J=8.0 Hz, 1H), 6.86 (d, J=8.0 Hz, 1H), 6.77 (s, 1H), 6.30 (s, 1H), 5.99 (d, J=4.0 Hz, 2H), 5.56 (s, 1H), 4.15-4.09 (m, 1H), 3.83-3.79 (m, 4H), 3.70-3.59 (m, 2H), 3.27-3.20 (m, 1H), 2.72-2.67 (m, 1H), 1.69-1.62 (m, 2H), 1.49-1.36 (m, 4H), 0.90-0.86 (m, 3H).


Example 102 Synthesis of Compound AB35506

The structure of compound AB35506 was as follows:




embedded image


The synthesis method of compound AB35506 was as follows:


Step (1):



embedded image


Compound 1 (1 g, 2.79 mmol, 1 eq) was dissolved in N, N-dimethylformamide (20 mL), and compound 2 (1.7 g, 13.95 mmol, 5 eq) was added. The mixture was reacted at 70° C. for overnight.


The reaction mixture was diluted with water and then extracted with dichloromethane twice, the organic phase was washed with brine, dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried, the crude product was purified by fast chromatography (DCM/MeOH=50/1 to 30/1) to afford compound 3.


Step (2):



embedded image


Compound 3 (350 mg, 0.79 mmol, 1 eq) was dissolved in chloroform (10 mL), and ammonia water (5 mL) was added. The mixture was reacted at room temperature for overnight. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was washed with brine, dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (petroleum ether/ethyl acetate=50/1) to afford compound AB35506.


The MS-ESI and 1H NMR spectra of compound AB35506 were as follows:


MS-ESI: Calculated [M+H]+: 482.06; Found [M+H]+: 482.25.



1H NMR (400 MHz, CDCl3) δ 7.30 (s, 1H), 7.06 (d, J=8.0 Hz, 1H), 6.86 (d, J=8.0 Hz, 1H), 6.77 (s, 1H), 6.30 (s, 1H), 5.99 (d, J=4.0 Hz, 2H), 5.57 (s, 1H), 4.12-4.07 (m, 1H), 3.74-3.70 (m, 5H), 3.61-3.59 (m, 1H), 3.25-3.20 (m, 1H), 2.72-2.66 (m, 1H), 1.69-1.65 (m, 2H), 1.02-0.98 (m, 3H).


Example 103 Synthesis of Compound AB35508

The structure of compound AB35508 was as follows:




embedded image


The synthesis method of compound AB35508 was as follows:


Step (1):



embedded image


Compound 1 (2 g, 5.93 mmol, 1 eq) was dissolved in ethanol/acetic acid (30 mL/5 mL), and hexanal (5.9 g, 59.3 mmol, 10 eq) was added. The mixture was stirred at 90° C. for 4 h, the reaction was completed, an appropriate amount of hydrochloric acid was added, the mixture was concentrated and rotary dried, a small amount of dichloromethane and an appropriate amount of ethyl acetate were added, the mixture was stewed for 0.5 h and then filtered to remove solid. The filtrate was stewed for overnight, the solid was filtered and dried to afford compound 3.


Step (2):



embedded image


Compound 3 (400 mg, 0.88 mmol, 1 eq) was dissolved in chloroform (20 mL), and aqueous ammonia (10 mL) was added. The mixture was reacted at room temperature for overnight, the reaction was completed. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=100/1) to afford compound AB35508.


The MS-ESI and 1H NMR spectra of compound AB35508 were as follows:


MS-ESI: Calculated [M+H]+: 5,38.12; Found [M+H]+: 538.40.



1H NMR (400 MHz, DMSO-d6) δ 7.16-7.05 (m, 2H), 6.88 (s, 1H), 6.79 (s, 1H), 6.02 (d, J=8.0 Hz, 2H), 5.55 (s, 1H), 4.07 (s, 1H), 3.81 (d, J=8.0 Hz, 6H), 3.60-3.57 (m, 1H), 2.74-2.54 (m, 2H), 1.38-1.21 (m, 10H), 0.87-0.84 (m, 3H).


Example 104 Synthesis of Compound AB35510

The structure of compound AB35510 was as follows:




embedded image


The synthesis method of compound AB35510 was as follows:




embedded image


Compound 1 (300 mg, 0.54 mmol, 1.0 eq) was dissolved in tetrahydrofuran (10 mL), and compound 2 (2.7 mL, 2.7 mmol, 5.0 eq, 1M in THF) was added at 0° C. The mixture was reacted at 0° C. for 0.5 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane:methanol=100:1 to 50/1) to afford compound AB35510.


The MS-ESI and 1H NMR spectra of compound AB35510 were as follows:


MS-ESI: Calculated [M+H]+: 473.28, Found: 473.50.



1H NMR (400 MHz, DMSO-d6) δ 7.22 (s, 1H), 6.75 (s, 3H), 5.99 (s, 2H), 5.91 (s, 1H), 4.70 (d, J=8.0 Hz, 1H), 3.72 (s, 3H), 3.46-3.44 (m, 2H), 2.98-2.72 (m, 2H), 2.65-2.50 (m, 3H), 2.16-2.07 (m, 1H), 1.61-1.11 (m, 14H), 0.96 (d, J=4.0 Hz, 3H).


Example 105 Synthesis of Compound AB35512

The structure of compound AB35512 was as follows:




embedded image


The synthesis method of compound AB35512 was as follows:




embedded image


Compound 1 (300 mg, 0.67 mmol, 1.0 eq) was dissolved in tetrahydrofuran (10 mL), and compound 2 (3.4 mL, 3.35 mmol, 5.0 eq, 1M in THF) was added at 0° C. The mixture was reacted at 0° C. for 0.5 h under N2, and the reaction was detected to be performed completely using LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane:methanol=100:1 to 50/1) to afford compound AB35512.


The MS-ESI and 1H NMR spectra of compound AB35512 were as follows:


MS-ESI: Calculated [M+H]+: 434.23, Found: 434.45.



1H NMR (400 MHz, DMSO-d6) δ 7.19 (s, 1H), 6.79-6.62 (m, 3H), 5.96 (s, 2H), 5.88 (s, 1H), 4.51 (d, J=8.0 Hz, 1H), 4.00-3.96 (m, 1H), 3.71-3.65 (m, 4H), 3.40-3.35 (m, 2H), 2.87-2.83 (m, 1H), 2.46-2.43 (m, 1H), 2.16-2.14 (m, 1H), 1.67-1.15 (m, 10H), 1.00-0.97 (m, 3H).


Example 106 Synthesis of Compound AB35514

The structure of compound AB35514 was as follows:




embedded image


The synthesis method of compound AB35514 was as follows:


Step (1):



embedded image


Compound 1 (480 mg, 0.79 mmol, 1.0 eq) and compound 2 (484 mg, 3.16 mmol, 4.0 eq) were dissolved in dioxane (10 mL), and triethylamine (319 mg, 3.16 mmol, 4.0 eq), palladium acetate (35 mg, 0.16 mmol, 0.2 eq) and 1,1′-binaphthalene-2,2′-biphenylphosphine (100 mg, 0.16 mmol, 0.2 eq) were added. The mixture was reacted at 100° C. for 16 h under N2, and the reaction was detected to be performed completely using LCMS. The reaction mixture was rotary dried, the crude product was purified by fast chromatography (dichloromethane/methanol=100:1 to 50/1) to afford compound AB35513.


Step (2):



embedded image


Compound AB35513 (220 mg, 0.36 mmol, 1.0 eq) was dissolved in a mixture of chloroform (10 ml) and aqueous ammonia (2 ml). The mixture was reacted at 30° C. for 16 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was washed with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane/methanol=100/1 to 50/1) to afford compound AB35514.


The MS-ESI and 1H NMR spectra of compound AB35514 were as follows:


MS-ESI: Calculated [M]+: 403.20, Found: 403.20.



1H NMR (400 MHz, DMSO-d6) δ 7.26 (s, 1H), 6.98-6.95 (m, 2H), 6.77 (s, 1H), 6.23 (s, 1H), 5.98-5.97 (m, 2H), 5.86 (s, 1H), 3.77-3.73 (m, 4H), 3.71-3.47 (m, 2H), 3.20-3.16 (m, 1H), 3.05-2.93 (m, 2H), 2.71-2.47 (m, 2H), 2.38-2.30 (m, 1H), 1.76-1.51 (m, 4H).


Example 107 Synthesis of Compound AB35518

The structure of compound AB35518 was as follows:




embedded image


The synthesis method of compound AB35518 was as follows:


Step (1):



embedded image


Compound 1 (800 mg, 1.32 mmol, 1.0 eq) and compound 2 (529 mg, 5.28 mmol, 4.0 eq) were dissolved in dioxane (10 mL), and triethylamine (533 mg, 5.28 mmol, 4.0 eq), palladium acetate (64 mg, 0.26 mmol, 0.2 eq), and 1,1′-binaphthalene-2,2′-biphenylphosphine (162 mg, 0.26 mmol, 0.2 eq) were added. The mixture was reacted at 100° C. for 16 h under N2, and the reaction was detected to be performed completely using LCMS. The reaction mixture was rotary dried, the crude product was purified by fast chromatography (dichloromethane/methanol=100:1 to 50/1) to afford compound AB35517.


Step (2):



embedded image


Compound AB35517 (355 mg, 0.64 mmol, 1.0 eq) was dissolved in a mixture of chloroform (10 ml) and aqueous ammonia (2 ml). The mixture was reacted at 30° C. for 16 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was washed with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane/methanol=100/1 to 50/1) to afford compound AB35518.


The MS-ESI and 1H NMR spectra of compound AB35518 were as follows:


MS-ESI: Calculated [M]+: 522.10, Found: 522.10.



1H NMR (400 MHz, DMSO-d6) δ 7.30 (s, 1H), 7.01-6.98 (m, 2H), 6.80 (s, 1H), 6.28 (s, 1H), 6.01 (d, J=8.0 Hz, 2H), 5.96 (s, 1H), 3.79 (s, 3H), 3.76-3.64 (m, 3H), 3.33-3.09 (m, 2H), 2.70-2.50 (m, 5H), 2.22-2.09 (m, 5H).


Example 108 Synthesis of Compound AB35519

The structure of compound AB35519 was as follows:




embedded image


The synthesis method of compound AB35519 was as follows:




embedded image


Compound 1 (475 mg, 0.86 mmol, 1.0 eq) was dissolved in tetrahydrofuran (10 mL), and compound 2 (4.3 mL, 4.3 mmol, 5.0 eq, 1M in THF) was added at 0° C. The mixture was reacted at 0° C. for 0.5 h under N2, and the reaction was detected to be performed completely using LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane:methanol=100:1 to 50/1) to afford compound AB35519.


The MS-ESI and 1H NMR spectra of compound AB35519 were as follows:


MS-ESI: Calculated [M+H]+: 474.27, Found: 474.25.



1H NMR (400 MHz, CDCl3) δ 7.13 (s, 1H), 6.82-6.67 (m, 2H), 6.56 (s, 1H), 5.92 (s, 2H), 5.82 (s, 1H), 4.82 (d, J=8.0 Hz, 1H), 3.76-3.74 (m, 1H), 3.55 (s, 3H), 3.54-3.51 (m, 1H), 3.41-3.33 (m, 2H), 2.79-2.73 (m, 6H), 2.35 (s, 3H), 2.18-2.16 (m, 3H), 1.58-1.49 (m, 2H), 1.39-1.24 (m, 6H).


Example 109 Synthesis of Compound AB35521

The structure of compound AB35521 was as follows:




embedded image


The synthesis method of compound AB35521 was as follows:


Step (1):



embedded image


Compound 1 (1 g, 2.79 mmol, 1 eq) was dissolved in N, N-dimethylformamide (20 mL), and compound 2 (460 mg, 13.95 mmol, 5 eq) was added. The mixture was reacted at 70° C. for overnight. The reaction mixture was washed with water and then extracted with dichloromethane twice, the organic phase was washed with brine, dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=50/1 to 30/1) to afford compound AB35520.


Step (2):



embedded image


Compound AB35520 (300 mg, 0.62 mmol, 1.0 eq) was dissolved in a mixture of chloroform (10 ml) and aqueous ammonia (2 ml). The mixture was reacted at 30° C. for 16 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was washed with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane/methanol=100/1 to 50/1) to afford compound AB35521.


The MS-ESI and 1H NMR spectra of compound AB35521 were as follows:


MS-ESI: Calculated [M]+: 524.10, Found: 524.10.



1H NMR (400 MHz, DMSO-d6) δ 7.30 (s, 1H), 7.04-6.86 (m, 2H), 6.76 (s, 1H), 6.30 (s, 1H), 5.98-5.96 (m, 2H), 5.52 (s, 1H), 4.17-4.14 (m, 1H), 3.66 (s, 3H), 3.65-3.56 (m, 3H), 3.24-3.19 (m, 1H), 2.48-2.46 (m, 1H), 1.51-1.39 (m, 5H), 0.93-0.90 (m, 6H).


Example 110 Synthesis of Compound AB35522

The structure of compound AB35522 was as follows:




embedded image


The synthesis method of compound AB35522 was as follows:


Step (1):



embedded image


Compound 1 (1.0 g, 2.96 mmol, 1 eq) was dissolved in ethanol/acetic acid (20 mL/10 mL), and pentanal (2.5 g, 29.6 mmol, 10 eq) was added. The mixture was stirred at 90° C. for 4 h under N2, the reaction was completed, an appropriate amount of hydrochloric acid was added, the mixture was concentrated and rotary dried, a small amount of dichloromethane and an appropriate amount of ethyl acetate were added, the mixture was stewed for 0.5 h and then filtered to remove impurity solid. The filtrate was stewed for overnight and then filtered to afford compound 3.


Step (2):



embedded image


Compound 3 (300 mg, 0.68 mmol, 1 eq) was dissolved in tetrahydrofuran (10 mL), and cyclopentylmagnesium bromide (3.4 mL, 3.4 mmol, 5 eq, 1M) was added at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=100/1) to afford compound AB35522.


The MS-ESI and 1H NMR spectra of compound AB35522 were as follows:


MS-ESI: Calculated [M+H]+: 476.28, Found: 476.25.



1H NMR (400 MHz, DMSO-d6) δ 6.91 (s, 2H), 6.87 (d, J=8.0 Hz, 2H), 6.04 (d, J=8.0 Hz, 2H), 6.45 (d, J=4.0 Hz, 1H), 3.80 (s, 3H), 3.76 (s, 3H), 3.37-3.33 (m, 2H), 2.69-2.51 (m, 4H), 2.15-2.09 (m, 1H), 1.69-1.62 (m, 1H), 1.38-1.22 (m, 13H), 0.92-0.89 (m, 3H).


Example 111 Synthesis of Compound AB35523

The structure of compound AB35523 was as follows:




embedded image


The synthesis method of compound AB35523 was as follows:




embedded image


Compound 1 (300 mg, 0.56 mmol, 1.0 eq) was dissolved in tetrahydrofuran (10 mL), and compound 2 (2.8 mL, 2.8 mmol, 5.0 eq, 1M in THF) was added at 0° C. The mixture was reacted at 0° C. for 0.5 h under N2, and the reaction was detected to be performed completely using LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane/methanol=100/1 to 50/1) to afford compound AB35523.


The MS-ESI and 1H NMR spectra of compound AB35523 were as follows:


MS-ESI: Calculated [M+H]+: 568.20, Found: 568.20.



1H NMR (400 MHz, DMSO-d6) δ 6.88 (s, 2H), 6.84 (d, J=4.0 Hz, 2H), 6.01 (s, 2H), 4.01 (d, J=8.0 Hz, 1H), 3.77 (s, 3H), 3.73 (s, 3H), 3.50-3.48 (m, 2H), 3.31 (s, 1H), 2.66-2.48 (m, 4H), 2.09-2.06 (m, 1H), 1.78-1.76 (m, 2H), 1.45-1.42 (m, 1H), 1.29-1.19 (m, 14H).


Example 112 Synthesis of Compound AB35524

The structure of compound AB35524 was as follows:




embedded image


The synthesis method of compound AB35524 was as follows:




embedded image


Compound 1 (300 mg, 0.61 mmol, 1.0 eq) was dissolved in a mixture of chloroform (10 ml) and aqueous ammonia (2 ml). The mixture was reacted at 30° C. for 16 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was washed with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane/methanol=100/1 to 50/1) to afford compound AB35524.


The MS-ESI and 1H NMR spectra of compound AB35524 were as follows:


MS-ESI: Calculated [M+H]+: 572.08, Found: 572.10.



1H NMR (400 MHz, DMSO-d6) δ 7.14-7.04 (m, 2H), 6.87 (s, 1H), 6.78 (s, 1H), 6.01 (d, J=8.0 Hz, 2H), 5.54 (m, 1H), 3.85-3.79 (m, 7H), 3.60-3.56 (m, 3H), 2.73-2.53 (m, 4H), 1.72-1.59 (m, 3H), 1.45-1.35 (m, 5H).


Example 113 Synthesis of Compound AB35525

The structure of compound AB35525 was as follows:




embedded image


The synthesis method of compound AB35525 was as follows:




embedded image


Compound 1 (300 mg, 0.58 mmol, 1.0 eq) was dissolved in a mixture of chloroform (10 ml) and aqueous ammonia (2 ml). The mixture was reacted at room temperature for 16 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was washed with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane/methanol=100/1 to 50/1) to afford compound AB35525.


The MS-ESI and 1H NMR spectra of compound AB35525 were as follows:


MS-ESI: Calculated [M+H]+: 558.10, Found: 558.10.



1H NMR (400 MHz, DMSO-d6) δ 7.30-7.15 (m, 6H), 7.06 (d, J=8.0 Hz, 1H), 6.87 (d, J=8.0 Hz, 1H), 6.77 (s, 1H), 6.30 (s, 1H), 5.98 (d, J=8.0 Hz, 2H), 5.55 (m, 1H), 4.15-4.09 (m, 1H), 3.78-3.67 (m, 4H), 3.57-3.50 (m, 2H), 3.20-3.17 (m, 1H), 3.11-2.62 (m, 3H), 2.02-1.95 (m, 2H).


Example 114 Synthesis of Compound AB35531

The structure of compound AB35531 was as follows:




embedded image


The synthesis method of compound AB35531 was as follows:


Step (1):



embedded image


Compound 1 (500 mg, 1.4 mmol, 1 eq) was dissolved in N, N-dimethylformamide (20 mL), and compound 2 (1.7 g, 7 mmol, 5 eq) was added. The mixture was reacted at 80° C. for overnight.


The reaction mixture was diluted with water and then extracted with dichloromethane twice, the organic phase was washed with brine, dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=50/1 to 30/1) to afford compound 3.


Step (2):



embedded image


Compound 3 (300 mg, 0.53 mmol, 1.0 eq) was dissolved in a mixture of chloroform (10 ml) and aqueous ammonia (2 ml). The mixture was reacted at 30° C. for 16 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane/methanol=100/1 to 50/1) to afford compound AB35531.


The MS-ESI and 1H NMR spectra of compound AB35531 were as follows:


MS-ESI: Calculated [M+H]+: 606.10, Found: 606.10.



1H NMR (400 MHz, DMSO-d6) δ 7.43-7.36 (m, 9H), 7.29 (s, 1H), 7.04-6.77 (m, 2H), 6.77 (s, 1H), 6.26 (s, 1H), 6.01 (d, J=4.0 Hz, 2H), 5.10 (s, 1H), 5.02 (d, J=8.0 Hz, 1H), 4.85 (d, J=8.0 Hz, 1H), 3.73 (s, 3H), 3.22-3.25 (m, 1H), 3.11-3.04 (m, 2H), 2.59-2.55 (m, 1H).


Example 115 Synthesis of Compound AB35534

The structure of compound AB35534 was as follows:




embedded image


The synthesis method of compound AB35534 was as follows:


Step (1):



embedded image


Compound 1 (1 g, 2.79 mmol, 1 eq) was dissolved in N, N-dimethylformamide (20 mL), and compound 2 (1.7 g, 13.95 mmol, 5 eq) was added. The mixture was reacted at 80° C. for overnight.


The reaction mixture was washed with water and then extracted with dichloromethane twice, the organic phase was washed with brine, dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=50/1 to 30/1) to afford compound 3.


Step (2):



embedded image


Compound 3 (500 mg, 1.13 mmol, 1.0 eq) was dissolved in a mixture of chloroform (10 ml) and aqueous ammonia (2 ml). The mixture was reacted at 30° C. for 16 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was washed with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane/methanol=100/1 to 50/1) to afford compound AB35534.


The MS-ESI and 1H NMR spectra of compound AB35534 were as follows:


MS-ESI: Calculated [M+H]+: 480.05, Found: 480.05.



1H NMR (400 MHz, DMSO-d6) δ 7.30 (s, 1H), 7.07-6.87 (m, 2H), 6.77 (s, 1H), 6.30 (s, 1H), 6.07-5.97 (m, 3H), 5.58 (s, 1H), 3.32-5.18 (m, 2H), 4.65-4.61 (m, 1H), 4.40-4.38 (m, 1H), 3.79 (s, 3H), 3.70-3.57 (m, 2H), 3.22-3.20 (m, 1H), 2.70-2.65 (m, 1H).


Example 116 Synthesis of Compound AB35535

The structure of compound AB35535 was as follows:




embedded image


The synthesis method of compound AB35535 was as follows:


Step (1):



embedded image


Compound 1 (500 mg, 14 mmol, 1 eq) was dissolved in N, N-dimethylformamide (20 mL), and compound 2 (1.5 g, 7 mmol, 5 eq) was added. The mixture was reacted at 80° C. for overnight. The reaction mixture was diluted with water and then extracted with dichloromethane twice, the organic phase was washed with brine, dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=50/1 to 30/1) to afford compound 3.


Step (2):



embedded image


Compound 3 (300 mg, 0.56 mmol, 1.0 eq) was dissolved in a mixture of chloroform (10 ml) and aqueous ammonia (2 ml). The mixture was reacted at room temperature for 16 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane/methanol=100/1 to 50/1) to afford compound AB35535.


The MS-ESI and 1H NMR spectra of compound AB35535 were as follows:


MS-ESI: Calculated [M+H]+: 572.11, Found: 572.11.



1H NMR (400 MHz, DMSO-d6) δ 7.30 (s, 1H), 7.23-7.12 (m, 5H), 7.05 (d, J=8.0 Hz, 1H), 6.85 (d, J=8.0 Hz, 1H), 6.76 (s, 1H), 6.29 (s, 1H), 5.98 (d, J=8.0 Hz, 2H), 5.53 (s, 1H), 4.17-4.13 (m, 1H), 3.78-3.77 (m, 1H), 3.76 (s, 3H), 3.62-3.50 (m, 2H), 3.19-3.17 (m, 1H), 2.63-2.61 (m, 3H), 1.76-1.66 (m, 4H).


Example 117 Synthesis of Compound AB35536

The structure of compound AB35536 was as follows:




embedded image


The synthesis method of compound AB35536 was as follows:




embedded image


Compound 1 (500 mg, 1.12 mmol, 1.0 eq) was dissolved in methanol (10 mL), and aqueous potassium carbonate solution (464 mg, 3.36 mmol, 3.0 eq, 3 mL) and aqueous sodium borohydride solution (13 mg, 0.336 mmol, 0.3 eq, 0.3 mL) were added at 0° C. The mixture was reacted at 0° C. for 3 min, and the reaction was detected to be performed completely using LCMS, the solid was filtered and then washed with water, the crude product was purified by fast chromatography (dichloromethane/methanol=0-2%) to afford compound AB35536.


The MS-ESI and 1H NMR spectra of compound AB35536 were as follows:


MS-ESI: Calculated [M+H]+: 366.17, Found: 366.30.



1H NMR (400 MHz, DMSO-d6) δ 7.26 (s, 1H), 6.79-6.64 (m, 3H), 6.02 (s, 1H), 5.97 (s, 2H), 4.17 (s, 2H), 3.82-3.79 (m, 2H), 3.72 (s, 3H), 3.02-3.00 (m, 2H), 2.77-2.76 (m, 2H), 1.68-1.63 (m, 2H), 0.97-0.93 (m, 3H).


Example 118 Synthesis of Compound AB35543

The structure of compound AB35543 was as follows:




embedded image


The synthesis method of compound AB35543 was as follows:




embedded image


Compound 1 (830 mg, 1.91 mmol, 1.0 eq) was dissolved in methanol (10 mL), and aqueous potassium carbonate solution (791 mg, 5.73 mmol, 3.0 eq, 3 mL) and aqueous sodium borohydride solution (22 mg, 0.573 mmol, 0.3 eq, 0.3 mL) were added at 0° C. The mixture was reacted at 0° C. for 5 min, and the reaction was detected to be performed completely using LCMS, the solid was filtered and then washed with water, the crude product was purified by fast chromatography (dichloromethane/methanol=0-2%) to afford compound AB35543.


The MS-ESI and 1H NMR spectra of Compound AB35543 were as follows:


MS-ESI: Calculated [M+H]+: 400.13, Found: 400.15.



1H NMR (400 MHz, DMSO-d6) δ 7.29 (s, 1H), 6.84-6.69 (m, 3H), 6.05 (s, 1H), 6.00 (s, 2H), 4.21 (s, 2H), 4.01-3.98 (m, 2H), 3.87-3.84 (m, 2H), 3.76 (s, 3H), 3.07-3.04 (m, 2H), 2.81-2.78 (m, 2H), 2.15-2.09 (m, 2H).


Example 119 Synthesis of Compound AB35544

The structure of compound AB35544 was as follows:




embedded image


The synthesis method of compound AB35544 was as follows:




embedded image


Compound 1 (125 mg, 0.24 mmol, 1.0 eq) was dissolved in methanol (10 mL), and aqueous potassium carbonate solution (99 mg, 0.72 mmol, 3.0 eq, 3 mL) and aqueous sodium borohydride solution (3 mg, 0.072 mmol, 0.3 eq, 0.3 mL) were added at 0° C. The mixture was reacted at 0° C. for 5 min, and the reaction was detected to be performed completely using LCMS, the solid was filtered and then washed with water, the crude product was purified by fast chromatography (dichloromethane/methanol=0-2%) to afford compound AB35544.


The MS-ESI and 1H NMR spectra of compound AB35544 were as follows:


MS-ESI: Calculated [M+H]+: 444.08, Found: 444.05.



1H NMR (400 MHz, DMSO-d6) δ 7.29 (s, 1H), 6.84-6.69 (m, 3H), 6.05 (s, 1H), 6.00 (s, 2H), 4.22 (s, 2H), 4.00-3.97 (m, 2H), 3.76-3.71 (m, 5H), 3.07-3.04 (m, 2H), 2.81-2.78 (m, 2H), 2.23-2.18 (m, 2H).


Example 120 Synthesis of Compound AB35545

The structure of compound AB35545 was as follows:




embedded image


The synthesis method of compound AB35545 was as follows:




embedded image


Compound 1 (145 mg, 0.26 mmol, 1.0 eq) was dissolved in methanol (10 mL), and aqueous potassium carbonate solution (108 mg, 0.78 mmol, 3.0 eq, 3 mL) and aqueous sodium borohydride solution (3 mg, 0.078 mmol, 0.3 eq, 0.3 mL) were added at 0° C. The mixture was reacted at 0° C. for 5 min, and the reaction was detected to be performed completely using LCMS, the solid was filtered and then washed with water, the crude product was purified by fast chromatography (dichloromethane/methanol=0-5%) to afford compound AB35545.


The MS-ESI and 1H NMR spectra of compound AB35545 were as follows:


MS-ESI: Calculated [M+H]+: 405.21, Found: 405.25.



1H NMR (400 MHz, DMSO-d6) δ 7.28 (s, 1H), 6.75-6.74 (m, 3H), 6.03 (s, 1H), 6.00 (s, 2H), 4.25 (s, 2H), 3.73 (s, 3H), 3.21-3.16 (m, 2H), 3.05-3.02 (m, 2H), 2.81-2.78 (m, 2H), 2.72 (d, J=12.0 Hz, 2H), 1.62 (d, J=12.0 Hz, 2H), 1.39 (s, 1H), 1.30-1.23 (m, 2H), 0.96 (d, J=4.0 Hz, 3H).


Example 121 Synthesis of Compound AB35550

The structure of compound AB35550 was as follows:




embedded image


The synthesis method of compound AB35550 was as follows:




embedded image


Compound 1 (530 mg, 0.92 mmol, 1.0 eq) was dissolved in methanol (10 mL), and aqueous potassium carbonate solution (381 mg, 2.76 mmol, 3.0 eq, 3 mL) and aqueous sodium borohydride solution (10 mg, 0.078 mmol, 0.27 eq, 0.3 mL) were added at 0° C. The mixture was reacted at 0° C. for 5 min, and the reaction was detected to be performed completely using LCMS, the solid was filtered and then washed with water, the crude product was purified by fast chromatography (dichloromethane/methanol=0-5%) to afford compound AB35550.


The MS-ESI and 1H NMR spectra of compound AB35550 were as follows:


MS-ESI: Calculated [M+H]+: 425.16, Found: 425.15.



1H NMR (400 MHz, DMSO-d6) δ 7.29 (s, 1H), 6.75 (s, 3H), 6.03 (s, 1H), 6.00 (s, 2H), 4.28 (s, 2H), 4.14-4.08 (m, 1H), 3.76-3.73 (m, 3H), 3.60-3.53 (m, 1H), 3.29-3.23 (m, 2H), 3.08-3.02 (m, 2H), 2.80-2.76 (m, 3H), 2.62-2.57 (m, 1H), 2.13-2.10 (m, 2H), 1.91-1.85 (m, 2H).


Example 122 Synthesis of Compound AB35590

The structure of compound AB35590 was as follows:




embedded image


The synthesis method of compound AB35590 was as follows:




embedded image


Compound 1 (100 mg, 0.19 mmol, 1.0 eq) was dissolved in methanol (5 mL), and aqueous potassium carbonate solution (81 mg, 0.59 mmol, 3.0 eq, 2 mL) and aqueous sodium borohydride solution (2 mg, 0.057 mmol, 0.3 eq, 0.3 mL) were added at 0° C. The mixture was reacted at 0° C. for 5 min, and the reaction was detected to be performed completely using LCMS, the solid was filtered and then washed with water, the crude product was purified by fast chromatography (dichloromethane/methanol=0-5%) to afford compound AB35590.


The MS-ESI and 1H NMR spectra of compound AB35590 were as follows:


MS-ESI: Calculated [M+H]+: 384.16, Found: 384.20.



1H NMR (400 MHz, DMSO-d6) δ 7.30 (s, 1H), 6.84-6.69 (m, 3H), 6.06 (s, 1H), 6.00 (s, 2H), 4.73-4.70 (m, 1H), 4.61-4.58 (m, 1H), 4.20 (s, 2H), 3.99-3.96 (m, 2H), 3.76 (s, 3H), 3.07-3.04 (m, 2H), 2.81-2.78 (m, 2H), 2.11-2.01 (m, 2H).


Example 123 Synthesis of Compound AB35594

The structure of compound AB35594 was as follows:




embedded image


The synthesis method of compound AB35594 was as follows:




embedded image


Compound 1 (390 mg, 0.82 mmol, 1.0 eq) was dissolved in methanol (10 mL), and aqueous potassium carbonate solution (339 mg, 2.46 mmol, 3.0 eq, 2 mL) and aqueous sodium borohydride solution (9 mg, 0.057 mmol, 0.24 eq, 0.3 mL) were added at 0° C. The mixture was reacted at 0° C. for 5 min, and the reaction was detected to be performed completely using LCMS, the solid was filtered and then washed with water, the crude product was purified by fast chromatography (dichloromethane/methanol=0-5%) to afford compound AB35594.


The MS-ESI and 1H NMR spectra of compound AB35594 were as follows:


MS-ESI: Calculated [M+H]+: 352.15, Found: 352.20.



1H NMR (400 MHz, DMSO-d6) δ 7.29 (s, 1H), 6.82-6.67 (m, 3H), 6.05 (s, 1H), 6.00 (s, 2H), 4.20 (s, 2H), 3.97-3.92 (m, 2H), 3.75 (s, 3H), 3.07-3.04 (m, 2H), 2.81-2.50 (m, 2H), 1.29-1.25 (m, 3H).


Example 124 Synthesis of Compound AB35599

The structure of compound AB35599 was as follows:




embedded image


The synthesis method of compound AB35599 was as follows:




embedded image


Compound 1 (500 mg, 1.0 mmol, 1.0 eq) was dissolved in methanol (10 mL), and aqueous potassium carbonate solution (414 mg, 3.0 mmol, 3.0 eq, 2 mL) and aqueous sodium borohydride solution (11 mg, 0.3 mmol, 0.3 eq, 0.3 mL) were added at 0° C. The mixture was reacted at 0° C. for 5 min, and the reaction was detected to be performed completely using LCMS, the solid was filtered and then washed with water, the crude product was purified by fast chromatography (dichloromethane/methanol=0-5%) to afford compound AB35599.


The MS-ESI and 1H NMR spectra of compound AB35599 were as follows:


MS-ESI: Calculated [M+H]+: 370.14, Found: 370.00.



1H NMR (400 MHz, DMSO-d6) δ 7.30 (s, 1H), 6.85-6.70 (m, 3H), 6.06 (s, 1H), 6.00 (s, 2H), 4.72-4.71 (m, 1H), 4.60-4.59 (m, 1H), 4.22 (s, 3H), 4.14-4.12 (m, 1H), 3.76 (s, 3H), 3.05-3.02 (m, 2H), 2.81-2.78 (m, 2H).


Example 125 Synthesis of Compound AB36403

The structure of compound AB36403 was as follows:




embedded image


The synthesis method of compound AB36403 was as follows:




embedded image


Compound 1 (500 mg, 0.98 mmol, 1.0 eq) was dissolved in methanol (10 mL), and aqueous potassium carbonate solution (406 mg, 2.94 mmol, 3.0 eq, 2 mL) and aqueous sodium borohydride solution (11 mg, 0.057 mmol, 0.29 eq, 0.3 mL) were added at 0° C. The mixture was reacted at 0° C. for 5 min, and the reaction was detected to be performed completely using LCMS, the solid was filtered and then washed with water, the crude product was purified by fast chromatography (dichloromethane/methanol=0-5%) to afford compound AB36403.


The MS-ESI and 1H NMR spectra of compound AB36403 were as follows:


MS-ESI: Calculated [M+H]+: 430.06, Found: 430.25.



1H NMR (400 MHz, DMSO-d6) δ 7.30 (s, 1H), 6.84-6.70 (m, 3H), 6.06 (s, 1H), 6.00 (s, 2H), 4.29-4.24 (m, 4H), 3.80-3.74 (m, 5H), 3.07-3.04 (m, 2H), 2.81-2.78 (m, 2H).


Example 126 Synthesis of Compound AB36415

The structure of compound AB36415 was as follows:




embedded image


The synthesis method of compound AB36415 was as follows:




embedded image


Compound 1 (500 mg, 1.34 mmol, 1.0 eq) was dissolved in methanol (10 mL), and aqueous potassium carbonate solution (555 mg, 4.02 mmol, 3.0 eq, 2 mL) and aqueous deuterated sodium borohydride solution (15 mg, 0.057 mmol, 0.40 eq, 0.3 mL) were added at 0° C. The mixture was reacted at 0° C. for 5 min, and the reaction was detected to be performed completely using LCMS, the solid was filtered and then washed with water, the crude product was purified by fast chromatography (dichloromethane/methanol=0-5%) to afford compound AB36415.


The MS-ESI and 1H NMR spectra of Compound AB36415 were as follows:


MS-ESI: Calculated [M+H]+: 339.14, Found: 339.05.



1H NMR (400 MHz, DMSO-d6) δ 7.29 (s, 1H), 6.83-6.68 (m, 3H), 6.05 (s, 1H), 6.00 (s, 2H), 4.16 (s, 1H), 3.76 (s, 3H), 3.71 (s, 3H), 3.07-3.03 (m, 2H), 2.81-2.78 (m, 2H).


Example 127 Synthesis of Compound AB36416

The structure of compound AB36416 was as follows:




embedded image


The synthesis method of compound AB36416 was as follows:




embedded image


Compound 1 (300 mg, 0.84 mmol, 1.0 eq) was dissolved in tetrahydrofuran (20 mL), and compound 2 (4.2 mL, 4.2 mmol, 5.0 eq, 1 mol/L) was added at 0° C. The mixture was reacted at room temperature for 30 min. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane:methanol=0-5%) to afford compound AB36416.


The MS-ESI and 1H NMR spectra of compound AB36416 were as follows:


MS-ESI: Calculated [M+H]+: 364.15, Found: 364.15.



1H NMR (400 MHz, DMSO-d6) δ 7.19 (s, 1H), 6.74 (s, 1H), 6.66 (d, J=8.0 Hz, 1H), 6.43 (d, J=8.0 Hz, 1H), 5.99 (s, 1H), 5.97 (d, J=4.0 Hz, 2H), 5.86 (s, 1H), 5.82 (s, 1H), 4.53-4.50 (m, 1H), 3.25-3.19 (m, 2H), 2.82-2.64 (m, 2H), 169-1.45 (m, 2H), 1.20-1.08 (m, 2H), 0.77-0.74 (m, 3H).


Example 128 Synthesis of Compound AB36423

The structure of compound AB36423 was as follows:




embedded image


The synthesis method of compound AB36423 was as follows:




embedded image


Compound 1 (300 mg, 0.84 mmol, 1.0 eq) was dissolved in tetrahydrofuran (20 mL), and compound 2 (4.2 mL, 4.2 mmol, 5.0 eq, 1 mol/L) was added at 0° C. The mixture was reacted at room temperature for 30 min. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane:methanol=0-5%) to afford compound AB36423.


The MS-ESI and 1H NMR spectra of compound AB36423 were as follows:


MS-ESI: Calculated [M+H]+: 390.17, Found: 390.30.



1H NMR (400 MHz, DMSO-d6) δ 7.18 (s, 1H), 6.73 (s, 1H), 6.67 (d, J=4.0 Hz, 1H), 6.44 (d, J=4.0 Hz, 1H), 5.97 (s, 1H), 5.96 (s, 2H), 5.88 (s, 1H), 5.80 (s, 1H), 4.42 (d, J=8.0 Hz, 1H), 3.43-3.38 (m, 2H), 2.86-2.80 (m, 1H), 2.66-2.58 (m, 1H), 2.28-2.20 (m, 1H), 1.59-1.40 (m, 4H), 1.34-1.19 (m, 4H).


Example 129 Synthesis of Compound AB36427

The structure of compound AB36427 was as follows:




embedded image


The synthesis method of compound AB36427 was as follows:




embedded image


Compound 1 (200 mg, 5.5 mmol, 1.0 eq) was dissolved in a mixture of chloroform (10 ml) and aqueous ammonia (5 ml). The mixture was reacted at room temperature for overnight. The reaction mixture diluted with water and then extracted with dichloromethane, the organic phase was washed with brine, dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=50/1) to afford compound AB36427.


The MS-ESI and 1H NMR spectra of compound AB36427 were as follows:


MS-ESI: Calculated [M+H]+: 480.04; Found [M+H]+: 479.95.



1H NMR (400 MHz, CDCl3) δ 7.92 (s, 2H), 6.89 (m, 1H), 6.68 (s, 1H), 6.04-5.94 (m, 4H), 5.34 (s, 1H), 4.09-4.02 (m, 1H), 3.47-3.43 (m, 1H), 2.80-2.63 (m, 3H), 2.56-2.48 (s, 1H), 1.82-1.76 (m, 1H), 1.50-1.43 (m, 1H), 1.06-1.02 (m, 3H).


Example 130 Synthesis of Compound AB36428

The structure of compound AB36428 was as follows:




embedded image


The synthesis method of compound AB36428 was as follows:




embedded image


Compound 1 (300 mg, 0.84 mmol, 1.0 eq) was dissolved in methanol (10 mL), and aqueous potassium carbonate solution (348 mg, 2.52 mmol, 3.0 eq, 2 mL) and aqueous sodium borohydride solution (9 mg, 0.25 mmol, 0.3 eq, 0.3 mL) were added at 0° C. The mixture was reacted at 0° C. for 5 min, and the reaction was detected to be performed completely using LCMS, the solid was filtered and then washed with water, the crude product was purified by fast chromatography (dichloromethane/methanol=0-5%) to afford compound AB36428.


The MS-ESI and 1H NMR spectra of compound AB36428 were as follows:


MS-ESI: Calculated [M+H]+: 322.10, Found: 322.35.



1H NMR (400 MHz, DMSO-d6) δ 7.27 (s, 1H), 6.76 (s, 1H), 6.71 (s, 1H), 6.58 (s, 1H), 6.06 (s, 1H), 6.00 (s, 2H), 5.92 (s, 2H), 4.07 (s, 2H), 3.02-3.00 (m, 2H), 2.80-2.77 (m, 2H).


Example 131 Synthesis of Compound AB36432

The structure of compound AB36432 was as follows:




embedded image


The synthesis method of compound AB36432 was as follows:




embedded image


Compound 1 (300 mg, 0.75 mmol, 1 eq) was dissolved in tetrahydrofuran (10 mL), and cyclopentylmagnesium bromide (3.7 mL, 3.75 mmol, 5 eq, 1M) was added at 0° C. under N2. The mixture was reacted at room temperature for 1 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=50/1) to afford compound AB36432.


The MS-ESI and 1H NMR spectra of compound AB36432 were as follows:


MS-ESI: Calculated [M+H]+: 432.21; Found [M+H]*: 432.25.



1H NMR (400 MHz, DMSO-d6) δ 6.85 (s, 2H), 6.77-6.71 (m, 2H), 6.04 (s, 1H), 6.03 (s, 2H), 5.90 (s, 1H), 4.34-4.32 (d, J=8.0 Hz, 1H), 3.32-3.26 (m, 2H), 2.72-2.62 (m, 1H), 2.60-2.50 (m, 2H), 2.22-2.16 (m, 1H), 1.71-1.62 (m, 1H), 1.50-1.23 (m, 10H), 0.99-0.96 (m, 3H).


Example 132 Synthesis of Compound AB36433

The structure of compound AB36433 was as follows:




embedded image


The synthesis method of compound AB36432 was as follows:




embedded image


Compound 1 (300 mg, 0.84 mmol, 1 eq) was dissolved in tetrahydrofuran (10 mL), and pentylmagnesium bromide (4.2 mL, 4.21 mmol, 5 eq, 1M) was added at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=50/1) to afford compound AB36433.


The MS-ESI and 1H NMR spectra of compound AB36433 were as follows:


MS-ESI: Calculated [M+H]+: 392.18; Found [M+H]+: 392.25.



1H NMR (400 MHz, DMSO-d6) δ 7.22 (s, 1H), 6.76 (s, 1H), 6.69 (d, J=8.0 Hz, 1H), 6.46 (d, J=8.0 Hz, 1H), 6.00-5.86 (m, 5H), 4.55-4.52 (m, 1H), 3.32-3.23 (m, 2H), 2.83-2.67 (m, 2H), 1.70-1.51 (m, 2H), 1.22-1.11 (m, 6H), 0.78-0.75 (m, 3H).


Example 133 Synthesis of Compound AB36434

The structure of compound AB36434 was as follows:




embedded image


The synthesis method of compound AB36434 was as follows:


Step (1):



embedded image


Compound 1 (4.5 g, 22.93 mmol, 1 eq) was dissolved in tetrahydrofuran (40 mL), and deuterated lithium aluminum hydride (1.9 g, 45.86 mmol, 2 eq) was added at 0 at 0° C. under N2. The mixture was reacted for 0.5 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane:methanol=50:1) to afford compound 2.


Step (2):



embedded image


Compound 2 (2.8 g, 16.45 mmol, 1 eq) was dissolved in tetrahydrofuran (30 mL), and triphenylphosphine (4.3 g, 16.45 mmol, 1 eq) and carbon tetrabromide (5.4 g, 16.45 mmol, 1 eq) were added. The mixture was reacted at room temperature for 16 h under N2. The reaction mixture diluted with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (petroleum ether:ethyl acetate=50:1) to afford compound 3.


Step (3):



embedded image


Compound 3 (2.1 g, 9.01 mmol, 1 eq) was dissolved in N, N-dimethylformamide (30 mL), and potassium carbonate (2.5 g, 18.02 mmol, 2 eq) and compound 4 (1.5 g, 9.01 mmol, 1 eq) were added. The mixture was reacted at room temperature for 16 h. The reaction mixture was diluted with water and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane:methanol=20:1) to afford compound 5.


Step (4):



embedded image


Compound 5 (647 mg, 2.04 mmol, 1 eq) was dissolved in formic acid (5 mL), and copper sulfate pentahydrate (1.3 g, 6.53 mmol, 2.6 eq) and aqueous glyoxal solution (947 mg, 6.49 mmol, 3.2 eq, 40%) were added. The mixture was reacted at 100° C. for 16 h. The reaction mixture was cooled, the solid was filtered and then washed with methanol, the filtrate was rotary dried. The crude product was purified by fast chromatography ((dichloromethane:methanol=10:1) to afford compound 7 (100 mg, yield: 12.8%) and compound 8 (AB36443).


Step (5):



embedded image


Compound 7 (100 mg, 0.26 mmol, 1.0 eq) was dissolved in methanol (5 mL), and aqueous potassium carbonate solution (108 mg, 0.78 mmol, 3.0 eq, 1 mL) and aqueous deuterated sodium borohydride solution (3 mg, 0.078 mmol, 0.3 eq, 0.3 mL) were added at 0° C. The mixture was reacted at 0° C. for 5 min, and the reaction was detected to be performed completely using LCMS, the solid was filtered and then washed with water, the crude product was purified by fast chromatography (dichloromethane/methanol=0-5%) to afford compound AB36434.


The MS-ESI and 1H NMR spectra of compound AB36434 were as follows:


MS-ESI: Calculated [M+H]+: 340.15, Found: 340.05.



1H NMR (400 MHz, DMSO-d6) δ 7.29 (s, 1H), 6.83-6.68 (m, 3H), 6.04 (s, 1H), 6.00 (s, 2H), 3.76 (s, 3H), 3.71 (s, 3H), 3.07-3.04 (m, 2H), 2.81-2.78 (m, 2H).


Example 134 Synthesis of Compound AB36437

The structure of compound AB36437 was as follows:




embedded image


The synthesis method of compound AB36437 was as follows:




embedded image


Compound 1 (400 mg, 0.90 mmol, 1.0 eq) was dissolved in methanol (5 mL), and aqueous potassium carbonate solution (377 mg, 2.7 mmol, 3.0 eq, 1 mL) and aqueous deuterated sodium borohydride solution (11 mg, 0.288 mmol, 0.27 eq, 0.3 mL) were added at 0° C. The mixture was reacted at 0° C. for 5 min, and the reaction was detected to be performed completely using LCMS, the solid was filtered and then washed with water, the crude product was purified by fast chromatography (dichloromethane/methanol=0-5%) to afford compound AB36437.


The MS-ESI and 1H NMR spectra of compound AB36437 were as follows:


MS-ESI: Calculated [M+H]+: 367.17, Found: 367.20.



1H NMR (400 MHz, DMSO-d6) δ 7.29 (s, 1H), 6.82-6.67 (m, 3H), 6.05 (s, 1H), 6.00 (s, 2H), 4.15 (s, 1H), 3.86-3.82 (m, 2H), 3.75 (s, 3H), 3.08-3.03 (m, 2H), 2.81-2.78 (m, 2H), 1.71-1.66 (m, 2H), 1.00-0.96 (m, 3H).


Example 135 Synthesis of Compound AB36446

The structure of compound AB36446 was as follows:




embedded image


The synthesis method of compound AB36446 was as follows:




embedded image


Compound 1 (200 mg, 0.43 mmol, 1.0 eq) was dissolved in methanol (5 mL), and aqueous potassium carbonate solution (178 mg, 1.29 mmol, 3.0 eq, 1 mL) and aqueous deuterated sodium borohydride solution (5 mg, 0.129 mmol, 0.27 eq, 0.3 mL) were added at 0° C. The mixture was reacted at 0° C. for 5 min, and the reaction was detected to be performed completely using LCMS, the solid was filtered and then washed with water, the crude product was purified by fast chromatography (dichloromethane/methanol=0-5%) to afford compound AB36446.


The MS-ESI and 1H NMR spectra of compound AB36446 were as follows:


MS-ESI: Calculated [M+H]+: 342.16, Found: 342.05.



1H NMR (400 MHz, DMSO-d6) δ 7.29 (s, 1H), 6.83-6.68 (m, 3H), 6.05 (s, 1H), 6.00 (s, 2H), 4.16 (s, 1H), 3.76 (s, 3H), 3.07-3.03 (m, 2H), 2.81-2.78 (m, 2H).


Example 136 Synthesis of Compound AB36447

The structure of compound AB36447 was as follows:




embedded image


The synthesis method of compound AB36447 was as follows:




embedded image


Compound 1 (500 mg, 1.34 mmol, 1 eq) was dissolved in tetrahydrofuran (10 mL), and compound 2 (6.7 mL, 6.7 mmol, 5 eq, 1M) was added at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=50/1) to afford compound AB36447.


The MS-ESI and 1H NMR spectra of compound AB36447 were as follows:


MS-ESI: Calculated [M+H]+: 392.18; Found [M+H]+: 392.15.



1H NMR (400 MHz, CDCl3) δ 7.22 (s, 1H), 6.82-6.66 (m, 3H), 5.99 (d, J=4.0 Hz, 2H), 5.88 (s, 1H), 4.51 (d, J=8.0 Hz, 1H), 3.76 (d, J=4.0 Hz, 6H), 3.33-3.32 (m, 2H), 2.82-2.75 (m, 2H), 2.68-2.61 (m, 1H), 1.93-1.80 (m, 3H), 1.63-1.54 (m, 2H), 1.40-1.35 (m, 1H).


Example 137 Synthesis of Compound AB36450

The structure of compound AB36450 was as follows:




embedded image


The synthesis method of compound AB36450 was as follows:


Step (1):



embedded image


Compound 1 (3 g, 17.58 mmol, 1 eq) was dissolved in methanol (50 mL), and compound 2 (2.9 g, 17.58 mmol, 1 eq) was added. The mixture was reacted at 70° C. for 1 h, then cooled to 0° C., sodium borohydride (1.3 g, 35.16 mmol, 2 eq) was slowly added. The mixture was reacted at room temperature for 1 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane:methanol=20:1) to afford compound 3.


Step (2):



embedded image


Compound 3 (2 g, 6.25 mmol, 1 eq) was dissolved in formic acid (10 mL), and copper sulfate pentahydrate (4.0 g, 16.25 mmol, 2.6 eq) and aqueous glyoxal solution (2.9 g, 20 mmol, 3.2 eq, 40%) were added. The mixture was reacted at 100° C. for 16 h under N2. The reaction mixture was cooled, the solid was filtered and then washed with methanol, the filtrate was rotary dried. The crude product was purified by fast chromatography ((dichloromethane:methanol=10:1) to afford compound 5.


Step (3):



embedded image


Compound 5 (250 mg, 0.65 mmol, 1.0 eq) was dissolved in methanol (5 mL), and aqueous potassium carbonate solution (260 mg, 1.95 mmol, 3.0 eq, 1 mL) and aqueous sodium borohydride solution (7 mg, 0.195 mmol, 0.3 eq, 0.3 mL) was added at 0° C. The mixture was reacted at 0° C. for 5 min, and the reaction was detected to be performed completely using LCMS, the solid was filtered and then washed with water, the crude product was purified by fast chromatography (dichloromethane/methanol=0-5%) to afford compound AB36450.


The MS-ESI and 1H NMR spectra of compound AB36450 were as follows:


MS-ESI: Calculated [M+H]+: 342.09, Found: 342.00.



1H NMR (400 MHz, DMSO-d6) δ 7.30 (s, 1H), 6.95-6.90 (m, 2H), 6.77 (s, 1H), 6.07 (s, 1H), 6.01 (s, 2H), 4.31 (s, 2H), 3.81 (s, 3H), 3.09-3.06 (m, 2H), 2.82-2.79 (m, 2H).


Example 138 Synthesis of Compound AB36460

The structure of compound AB36460 was as follows:




embedded image


The synthesis method of compound AB36460 was as follows:


Step (1):



embedded image


Compound 1 (2.5 g, 12.44 mmol, 1 eq) was dissolved in N, N-dimethylformamide (50 mL), and sodium hydride (597 mg, 14.93 mmol, 1.2 eq, 60% in mineral oil) was added at 0° C. The mixture was reacted for 5 h, iodine methane (1.7 g, 12.44 mmol, 1 eq) was added, then the mixture was reacted at room temperature for 1 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane/methanol=100:1) to afford compound 2.


Step (2):



embedded image


Compound 2 (2.5 g, 11.63 mmol, 1 eq) was dissolved in methanol (50 mL), and compound 3 (1.9 g, 11.63 mmol, 1 eq) was added. The mixture was reacted at 70° C. for 1 h, then cooled to 0° C., sodium borohydride (879 mg, 23.26 mmol, 2 eq) was slowly added. The mixture was reacted at room temperature for 1 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane:methanol=20:1) to afford compound 4.


Step (3):



embedded image


Compound 4 (2.5 g, 6.86 mmol, 1 eq) was dissolved in formic acid (20 mL), and copper sulfate pentahydrate (4.4 g, 17.84 mmol, 2.6 eq) and aqueous glyoxal solution (3.2 g, 21.95 mmol, 3.2 eq, 40%) were added. The mixture was reacted at 100° C. for 16 h under N2. The reaction mixture was cooled, the solid was filtered and then washed with methanol, the filtrate was rotary dried. The crude product was purified by fast chromatography ((dichloromethane:methanol=10:1) to afford compound 6.


Step (4):



embedded image


Compound 6 (400 mg, 0.93 mmol, 1.0 eq) was dissolved in methanol (10 mL), and aqueous potassium carbonate solution (385 mg, 2.79 mmol, 3.0 eq, 2 mL) and aqueous sodium borohydride solution (10 mg, 0.279 mmol, 0.3 eq, 0.3 mL) were added at 0° C. The mixture was reacted at 0° C. for 5 min, and the reaction was detected to be performed completely using LCMS, the solid was filtered and then washed with water, the crude product was purified by fast chromatography (dichloromethane/methanol=0-5%) to afford compound AB36460.


The MS-ESI and 1H NMR spectra of compound AB36460 were as follows:


MS-ESI: Calculated [M+H]+: 386.03, Found: 386.00.



1H NMR (400 MHz, DMSO-d6) δ 7.31 (s, 1H), 6.94-6.89 (m, 2H), 6.67 (s, 1H), 6.07 (s, 1H), 6.01 (s, 2H), 4.30 (s, 2H), 3.80 (s, 3H), 3.07-3.05 (m, 2H), 2.82-2.79 (s, 2H).


Example 139 Synthesis of Compound AB36463

The structure of compound AB36463 was as follows:




embedded image


The synthesis method of compound AB36463 was as follows:




embedded image


Compound 1 (500 mg, 1.16 mmol, 1.0 eq) was dissolved in methanol (10 mL), and aqueous potassium carbonate solution (480 mg, 3.48 mmol, 3.0 eq, 2 mL) and aqueous sodium borohydride solution (13 mg, 0.348 mmol, 0.3 eq, 0.3 mL) were added at 0° C. The mixture was reacted at 0° C. for 5 min, and the reaction was detected to be performed completely using LCMS, the solid was filtered and then washed with water, the crude product was purified by fast chromatography (dichloromethane/methanol=0-5%) to afford compound AB36463.


The MS-ESI and 1H NMR spectra of compound AB36463 were as follows:


MS-ESI: Calculated [M+H]+: 352.15, Found: 352.15.



1H NMR (400 MHz, CDCl3) δ 7.22 (s, 1H), 6.72 (s, 2H), 6.61 (s, 1H), 5.96 (s, 1H), 4.32 (s, 2H), 4.26 (s, 4H), 3.84 (s, 6H), 3.14-3.11 (m, 2H), 2.87-2.84 (m, 2H).


Example 140 Synthesis of Compound AB36467

The structure of compound AB36467 was as follows:




embedded image


The synthesis method of compound AB36467 was as follows:




embedded image


Compound 1 (300 mg, 0.81 mmol, 1 eq) was dissolved in tetrahydrofuran (10 mL), and compound 2 (4 mL, 4.03 mmol, 5 eq, 1M) was added at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=50/1) to afford compound AB36467.


The MS-ESI and 1H NMR spectra of compound AB36467 were as follows:


MS-ESI: Calculated [M+H]+: 414.17; Found [M+H]+: 414.20.



1H NMR (400 MHz, CDCl3) δ 7.65 (d, J=8.0 Hz, 2H), 7.49-7.38 (m, 4H), 7.05-6.96 (m, 2H), 6.76 (s, 1H), 6.15 (s, 2H), 6.09 (s, 1H), 5.99 (s, 1H), 4.03 (s, 3H), 3.78 (s, 3H), 3.52-3.47 (m, 1H), 3.34-3.28 (m, 1H), 3.20-3.141 (m, 1H), 2.93-2.87 (m, 1H).


Example 141 Synthesis of Compound AB36474

The structure of compound AB36474 was as follows:




embedded image


The synthesis method of compound AB36474 was as follows:




embedded image


Compound 1 (300 mg, 0.69 mmol, 1.0 eq) was dissolved in tetrahydrofuran (10 mL), and compound 2 (3.5 mL, 3.45 mmol, 5 eq, 1M) was added at 0° C. The mixture was reacted for 30 min, the reaction was completed. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane/methanol=0-5%) to afford compound AB36474.


The MS-ESI and 1H NMR spectra of compound AB36474 were as follows:


MS-ESI: Calculated [M+H]+: 468.19, Found: 468.15.



1H NMR (400 MHz, DMSO-d6) δ 7.19 (s, 1H), 6.82-6.62 (m, 3H), 5.96 (s, 2H), 5.87 (s, 1H), 4.51 (d, J=8.0 Hz, 1H), 4.06-4.00 (m, 2H), 3.81-3.77 (m, 2H), 3.74 (s, 3H), 3.41-3.36 (m, 2H), 2.87-2.82 (m, 1H), 2.67-2.59 (m, 1H), 2.19-2.11 (m, 3H), 1.56-1.16 (m, 8H).


Example 142 Synthesis of Compound AB36476

The structure of compound AB36476 was as follows:




embedded image


The synthesis method of compound AB36476 was as follows:




embedded image


Compound 1 (200 mg, 0.53 mmol, 1.0 eq) was dissolved in methanol (5 mL), and aqueous potassium carbonate solution (219 mg, 1.59 mmol, 3.0 eq, 1 mL) and aqueous sodium borohydride solution (6 mg, 0.159 mmol, 0.3 eq, 0.3 mL) were added at 0° C. The mixture was reacted at 0° C. for 5 min, and the reaction was detected to be performed completely using LCMS, the solid was filtered and then washed with water, the crude product was purified by fast chromatography (dichloromethane/methanol=0-5%) to afford compound AB36476.


The MS-ESI and 1H NMR spectra of compound AB36476 were as follows:


MS-ESI: Calculated [M+H]+: 340.15, Found: 340.10.



1H NMR (400 MHz, DMSO-d6) δ 7.29 (s, 1H), 6.83-6.68 (m, 3H), 6.04 (s, 1H), 6.00 (s, 2H), 4.20 (s, 2H), 3.76 (s, 3H), 3.71 (s, 3H), 2.78 (s, 2H).


Example 143 Synthesis of Compound AB36477

The structure of compound AB36477 was as follows:




embedded image


The synthesis method of compound AB36477 was as follows:




embedded image


Compound 1 (200 mg, 0.53 mmol, 1.0 eq) was dissolved in methanol (5 mL), and aqueous potassium carbonate solution (219 mg, 1.59 mmol, 3.0 eq, 1 mL) and aqueous deuterated sodium borohydride solution (7 mg, 0.159 mmol, 0.3 eq, 0.3 mL) were added at 0° C. The mixture was reacted at 0° C. for 5 min, and the reaction was detected to be performed completely using LCMS, the solid was filtered and then washed with water, the crude product was purified by fast chromatography (dichloromethane/methanol=0-5%) to afford compound AB36477.


The MS-ESI and 1H NMR spectra of compound AB36477 were as follows:


MS-ESI: Calculated [M+H]+: 341.15, Found: 341.10.



1H NMR (400 MHz, DMSO-d6) δ 7.29 (s, 1H), 6.83-6.68 (m, 3H), 6.04 (s, 1H), 6.00 (s, 2H), 4.16 (s, 1H), 3.76 (s, 3H), 3.71 (s, 3H), 2.78 (s, 2H).


Example 144 Synthesis of Compound AB31893

The structure of compound AB31893 was as follows:




embedded image


The synthesis method of compound AB31893 was as follows:




embedded image


Compound 1 (200 mg, 0.54 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and cyclohexylmagnesium bromide (2.7 mL, 2.7 mmol, 5 eq, 1M) was slowly added dropwise at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate, filtered and pin dried. The crude product was purified by thin layer chromatography (DCM/MeOH=50/1) to afford compound AB 31893.


MS-ESI: Calculated [M+H]+: 420.21, Found: 420.20.



1H NMR (400 MHz, DMSO-d6) δ 7.23 (s, 1H), 6.82 (d, J=8.0 Hz, 1H), 6.76 (s, 1H), 6.66 (d, J=8.0 Hz, 1H), 5.99 (s, 2H), 5.85 (s, 1H), 4.46-4.45 (m, 1H), 3.75 (d, J=8.0 Hz, 6H), 3.41-3.38 (m, 2H), 2.96-2.89 (m, 1H), 2.68-2.64 (m, 1H), 1.65-1.50 (m, 7H), 1.11-1.03 (m, 4H).


Example 145 Synthesis of Compound AB31900

The structure of compound AB31900 was as follows:




embedded image


The synthesis method of compound AB31900 was as follows:




embedded image


Compound 1 (200 mg, 0.54 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and cyclopentylmagnesium bromide (2.7 mL, 2.7 mmol, 5 eq, 1M) was slowly added dropwise at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h, and the reaction was detected to be performed completely using LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by thin layer chromatography (DCM:MeOH=30:1) to afford compound AB31900.


MS-ESI: Calculated [M+H]+: 406.20, Found: 406.20.



1H NMR (400 MHz, DMSO-d6) δ 7.20 (s, 1H), 6.79 (d, J=8.0 Hz, 1H), 6.73 (s, 1H), 6.64 (d, J=8.0 Hz, 1H), 5.96 (s, 2H), 5.87 (s, 1H), 4.51 (d, J=8.0 Hz, 1H), 3.72 (s, 6H), 3.41-3.35 (m, 2H), 2.86-2.63 (m, 2H), 2.17-2.15 (m, 1H), 1.55-1.15 (m, 8H).


Example 146 Synthesis of Compound AB35460

The structure of compound AB35460 was as follows:




embedded image


The synthesis method of compound AB35460 was as follows:




embedded image


Compound 1 (200 mg, 0.4 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and cyclopentylmagnesium bromide (2.0 mL, 2.0 mmol, 5 eq, 1M) was added at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.1% formic acid) to afford compound AB35460.


MS-ESI: Calculated [M+H]+: 538.29, Found[M+H]+: 538.35.



1H NMR (400 MHz, DMSO-d6) δ 7.15 (s, 4H), 6.85 (s, 1H), 6.77-6.69 (m, 3H), 5.93 (s, 2H), 4.51 (d, J=8.0 Hz, 1H), 3.94 (s, 2H), 3.73 (d, J=12.0 Hz, 6H), 3.41-3.36 (m, 2H), 2.79-2.60 (m, 3H), 2.27-2.23 (m, 1H), 1.55-1.30 (m, 8H),), 1.15 (d, J=8.0 Hz, 6H).


Example 147 Synthesis of Compound AB35493

The structure of compound AB35493 was as follows:




embedded image


The synthesis method of compound AB35493 was as follows:




embedded image


Compound 1 (100 mg, 0.4 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and methylmagnesium bromide (0.7 mL, 2.0 mmol, 5 eq, 3M) was added at 0° C. under N2. The mixture was reacted at room temperature for 0.5 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate twice, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.1% formic acid) to afford compound AB35493.


MS-ESI: Calculated [M+H]+: 484.24; Found[M+H]+: 484.45.



1H NMR (400 MHz, DMSO-d6) δ 7.27-7.23 (m, 2H), 7.19-7.13 (m, 3H), 6.86-6.71 (m, 4H), 4.64-4.60 (m, 1H), 4.27-4.18 (m, 4H), 3.75 (d, J=8.0 Hz, 6H), 3.15-3.07 (m, 2H), 2.67-2.54 (m, 6H), 1.95-1.89 (m, 1H), 1.76-1.69 (m, 1H), 0.93 (d, J=8.0 Hz, 3H).


Example 148 Synthesis of Compound AB36493

The structure of compound AB36493 was as follows:




embedded image


The synthesis method of compound AB36493 was as follows:




embedded image


Compound 1 (500 mg, 0.83 mmol, 1.0 eq) and compound 2 (329 mg, 3.32 mmol, 4.0 eq) were dissolved in dioxane (10 mL), and triethylamine (335 mg, 3.32 mmol, 4.0 eq), palladium acetate (37 mg, 0.166 mmol, 0.2 eq), and 1,1′-binaphthalene-2,2′-biphenylphosphine (103 mg, 0.166 mmol, 0.2 eq) were added. The mixture was reacted at 100° C. for 16 h under N2, and the reaction was detected to be performed completely using LCMS. The reaction mixture was rotary dried, the crude product was purified by fast chromatography (dichloromethane/methanol=100:1 to 50/1) to afford compound 3.


Step (2):



embedded image


Compound 3 (91 mg, 0.16 mmol, 1.0 eq) was dissolved in methanol (5 mL), and aqueous potassium carbonate solution (66 mg, 0.48 mmol, 3.0 eq, 1 mL) and aqueous sodium borohydride solution (2 mg, 0.048 mmol, 0.3 eq, 0.3 mL) were added at 0° C. The mixture was reacted at room temperature for 5 min, the solid was filtered and purified by fast chromatography (dichloromethane/methanol=100/1 to 50/1) to afford compound AB36493.


The MS-ESI and 1H NMR spectra of Compound AB36493 were as follows:


MS-ESI: Calculated [M+H]+: 405.21, Found: 405.50.



1H NMR (400 MHz, DMSO-d6) δ 7.28 (s, 1H), 6.78-6.72 (m, 3H), 6.04 (s, 1H), 5.99 (s, 2H), 4.32 (s, 2H), 3.74 (s, 3H), 3.22-3.13 (m, 2H), 3.05-3.03 (m, 2H), 2.81-2.74 (m, 4H), 1.80-1.53 (m, 8H).


Example 149 Synthesis of Compound AB36501



embedded image


The synthesis method of compound AB36501 was as follows:


Step (1):



embedded image


Compound 1 (3 g, 8.38 mmol, 1.0 eq) was dissolved in N, N-dimethylformamide (50 mL) and deuterated iodomethane (6.1 g, 41.9 mmol, 5.0 eq) was added. The mixture was reacted at 70° C. for 16 h. The reaction mixture was diluted with water and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane/methanol=0-10%) to afford compound 2.


Step (2):



embedded image


Compound 2 (300 mg, 0.64 mmol, 1.0 eq) was dissolved in tetrahydrofuran (10 mL), and cyclopentylmagnesium bromide (3.2 mL, 3.2 mmol, 5.0 eq, 1M in THF) was added at 0° C. The mixture was reacted at room temperature for 1 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane/methanol=0-5%) to afford compound AB36501.


The MS-ESI and 1H NMR spectra of compound AB36501 were as follows:


MS-ESI: Calculated [M+H]+: 409.22; Found: 409.15.



1H NMR (400 MHz, DMSO-d6) δ 7.22 (s, 1H), 6.83-6.66 (m, 3H), 5.99 (s, 2H), 5.90 (s, 1H), 4.54 (d, J=8.0 Hz, 1H), 3.76 (s, 3H), 3.46-3.40 (m, 2H), 2.90-2.86 (m, 1H), 2.68-2.62 (m, 1H), 2.22-2.16 (m, 1H), 1.59-1.19 (m, 8H).


Example 150 Synthesis of Compound AB36509



embedded image


The synthesis method of compound AB36509 was as follows:




embedded image


Compound 1 (200 mg, 0.41 mmol, 1.0 eq) was dissolved in methanol (10 mL), and aqueous potassium carbonate solution (3 mL, 1.23 mmol, 3.0 eq) and aqueous deuterated sodium borohydride solution (0.3 mL, 2.46 mmol, 0.3 eq) were added at 0° C. The mixture was reacted at 0° C. for 5 min, and the reaction mixture was filtered, and filter cake was collected. The crude product was purified by fast chromatography (dichloromethane/methanol=0-5%) to afford compound AB36509.


The MS-ESI and 1H NMR spectra of compound AB36509 were as follows:


MS-ESI: Calculated [M+H]+: 410.22; Found: 410.15.



1H NMR (400 MHz, DMSO-d6) δ 7.23 (s, 1H), 6.82 (d, J=8.0 Hz, 1H), 6.76 (s, 1H), 6.67 (d, J=8.0 Hz, 1H), 5.99 (s, 2H), 5.90 (s, 1H), 3.76 (s, 3H), 3.44-3.37 (m, 2H), 2.91-2.85 (m, 1H), 2.70-2.63 (m, 1H), 2.23-2.15 (m, 1H), 1.60-1.17 (m, 8H).


Example 151 Synthesis of Compound AB35442

The structure of compound AB35442 was as follows:




embedded image


The synthesis method of compound AB35442 was as follows:


Step (1):



embedded image


Compound 1 (200 mg, 0.38 mmol, 1.0 eq) was dissolved in DMF (10 mL), and compound 2 (200 mg, 2.28 mmol, 6 eq) and potassium carbonate (156 mg, 1.14 mmol, 3.0 eq) were added. The mixture was reacted at 60° C. for 16 h under N2, and the reaction was detected to be performed completely using TLC and LCMS, the organic solvent was rotary dried. The crude product was purified by thin layer chromatography (DCM/MeOH=10/1) to afford compound 3.


Step (2):



embedded image


Compound 3 (150 mg, 0.28 mmol, 1.0 eq) was dissolved in tetrahydrofuran (10 mL), and methylmagnesium bromide (0.6 mL, 1.68 mmol, 6 eq, 3M) was added at 0° C. The mixture was reacted at room temperature for 0.5 h, and the reaction was detected to be performed completely using TLC and LCMS. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with dichloromethane twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.01% formic acid) to afford compound AB35442.


The MS-ESI and 1H NMR spectra of compound AB35442 were as follows:


MS-ESI: Calculated [M+H]+: 463.26, Found: 463.35.



1H NMR (400 MHz, DMSO-d6) δ 8.24 (s, 1H), 7.23 (s, 1H), 6.78 (d, J=8.0 Hz, 1H), 6.75 (s, 1H), 6.64 (d, J=8.0 Hz, 1H), 5.98 (d, J=4.0 Hz, 2H), 5.90 (s, 1H), 4.76-4.71 (m, 1H), 3.96-3.93 (m, 2H), 3.72 (s, 3H), 3.31-3.24 (m, 1H), 3.21-3.16 (m, 1H), 2.81-2.72 (m, 2H), 2.44-2.38 (m, 5H), 1.87-1.80 (m, 2H), 1.52-1.46 (m, 4H), 1.41-1.35 (m, 2H), 1.03 (d, J=8.0 Hz, 3H).


Example 152 Synthesis of Compound AB35443

The structure of compound AB35443 was as follows:




embedded image


The synthesis method of compound AB35443 was as follows:


Step (1):



embedded image


Compound 1 (5.0 g, 13.97 mmol, 1.0 eq) was dissolved in DMF (50 mL), and compound 2 (26.2 g, 139.7 mmol, 10 eq) was added. The mixture was reacted at 60° C. for 16 h under N2, and the reaction was detected to be performed completely using TLC and LCMS, the organic solvent was rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=100/1 to 50/1) to afford compound 3.


Step (2):



embedded image


Compound 3 (200 mg, 0.39 mmol, 1.0 eq) was dissolved in DMF (10 mL), and compound 4 (200 mg, 2.34 mmol, 6 eq) and potassium carbonate (162 mg, 1.17 mmol, 3.0 eq) were added. The mixture was reacted at 60° C. for 16 h under N2, and the reaction was detected to be performed completely using TLC and LCMS, the organic solvent was rotary dried. The crude product was purified by thin layer chromatography (DCM/MeOH=10/1) to afford compound 5.


Step (3):



embedded image


Compound 5 (150 mg, 0.29 mmol, 1.0 eq) was dissolved in tetrahydrofuran (10 mL), and methyllithium (0.9 mL, 0.87 mmol, 3 eq, 1M) was added at −78° C. The mixture was reacted for 0.5 h, and the reaction was detected to be performed completely using TLC and LCMS. The mixture was quenched with saturated ammonium chloride solution and then extracted with dichloromethane twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried, the crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.01% formic acid) to afford compound AB35443.


The MS-ESI and 1H NMR spectra of compound AB35543 were as follows:


MS-ESI: Calculated [M+H]+: 449.24, Found: 449.40.



1H NMR (400 MHz, DMSO-d6) δ 8.23 (s, 1H), 7.23 (s, 1H), 6.78 (d, J=8.0 Hz, 1H), 6.75 (s, 1H), 6.64 (d, J=8.0 Hz, 1H), 5.98 (d, J=4.0 Hz, 2H), 5.89 (s, 1H), 4.86-4.85 (m, 1H), 4.04-4.00 (m, 2H), 3.72 (s, 3H), 3.3-3.24 (m, 1H), 3.19-3.15 (m, 1H), 2.82-2.71 (m, 2H), 2.59-2.56 (m, 2H), 2.42-2.39 (m, 3H), 1.50-1.48 (m, 4H), 1.38-1.34 (m, 2H), 1.02 (d, J=8.0 Hz, 3H).


Example 153 Synthesis of Compound AB35446

The structure of compound AB35446 was as follows:




embedded image


The synthesis method of compound AB35446 was as follows:


Step (1):



embedded image


Compound 1 (500 mg, 0.98 mmol, 1.0 eq) was dissolved in tetrahydrofuran (5 mL) in a sealed tube, compound 2 (3 mL, 5.88 mmol, 6 eq, 2M) and potassium carbonate (402 mg, 2.94 mmol, 3.0 eq) were added. The mixture was reacted at 80° C. for 16 h under N2, and the reaction was detected to be performed completely using TLC and LCMS, the organic phase was rotary dried. The crude product was purified by thin layer chromatography (DCM:MeOH=10/1) to afford compound 3.


Step (2):



embedded image


Compound 3 (120 mg, 0.25 mmol, 1 eq) was dissolved in a mixture of aqueous ammonia (3 ml) and chloroform (6 ml). The mixture was reacted at room temperature for 48 h. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by thin layer chromatography (DCM/MeOH=20/1) to afford compound AB 5446.


The MS-ESI and 1H NMR spectra of compound AB35546 were as follows:


MS-ESI: Calculated [M+H]+: 511.09, Found: 511.05.



1H NMR (400 MHz, DMSO-d6) δ 7.31 (s, 1H), 7.05 (d, J=8.0 Hz, 1H), 6.85 (d, J=8.0 Hz, 1H), 6.77 (s, 1H), 6.28 (s, 1H), 6.22 (s, 1H), 5.99 (d, J=4.0 Hz, 2H), 4.26-4.22 (m, 1H), 3.87-3.83 (m, 1H), 3.78 (s, 3H), 3.72-3.69 (m, 1H), 3.62-3.58 (m, 1H), 3.28-3.21 (m, 2H), 2.72-2.67 (m, 1H), 2.61-2.55 (m, 1H), 2.24 (s, 6H).


Example 154 Synthesis of Compound AB35447

The structure of compound AB35447 was as follows:




embedded image


The synthesis method of compound AB35447 was as follows:




embedded image


Compound 1 (280 mg, 0.60 mmol, 1 eq) was dissolved in a mixture of chloroform (12 ml) and aqueous ammonia (6 ml). The mixture was reacted at 40° C. for 48 h under N2. The reaction mixture was extracted with dichloromethane twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by thin layer chromatography (PE/PA=2/1) to afford compound AB 35447.


The MS-ESI and 1H NMR spectra of compound AB35447 were as follows:


MS-ESI: Calculated [M+H]+: 545.07, Found: 545.10.



1H NMR (400 MHz, DMSO-d6) δ 8.48 (d, J=4.0 Hz, 1H), 7.67-7.63 (m, 1H), 7.31-7.28 (m, 2H), 7.18-7.15 (m, 1H), 7.06-6.98 (m, 2H), 6.90 (s, 1H), 5.97 (d, J=4.0 Hz, 2H), 5.68 (s, 1H), 4.15-4.03 (m, 2H), 3.92-3.85 (m, 1H), 3.80 (s, 3H), 3.77 (s, 3H), 3.70-3.65 (m, 1H), 2.80-2.60 (m, 2H).


Example 155 Synthesis of Compound AB36426

The structure of compound AB36426 was as follows:




embedded image


The synthesis method of compound AB36426 was as follows:


Step (1):



embedded image


Compound 1 (1 g, 3.1 mmol, 1 eq) was dissolved in ethanol/acetic acid (10 mL/8 mL), and compound 2 (1.4 g, 30.9 mmol, 10 eq) was added. The mixture was reacted at 90° C. for 4 h, an appropriate amount of hydrochloric acid was added, and the mixture was concentrated. To crude product was added a small amount of dichloromethane and an appropriate amount of ethyl acetate, the mixture was stewed for 0.5 h and then filtered to remove solid. The filtrate was stewed for overnight to precipitate a solid, the solid was filtered and collected to afford compound 3.


Step (2):



embedded image


Compound 3 (200 mg, 0.5 mmol, 1 eq) was dissolved in a mixture of chloroform (10 ml) and aqueous ammonia (5 ml). The mixture was reacted at room temperature for overnight. The reaction mixture was diluted with water and then extracted with dichloromethane twice, the organic phase was washed with brine, dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=50/1) to afford compound AB36426.


The MS-ESI and 1H NMR spectra of compound AB36426 were as follows:


MS-ESI: Calculated [M+H]+: 466.03; Found [M+H]+: 466.15.



1H NMR (400 MHz, DMSO-d6) δ 7.02-6.88 (m, 4H), 6.10 (s, 1H), 6.03 (s, 2H), 6.00 (s, 1H), 5.50 (s, 1H), 3.86-3.80 (m, 1H), 3.66-3.63 (m, 1H), 3.37-3.36 (m, 2H), 2.79-2.76 (m, 1H), 2.61-2.50 (m, 1H), 2.13 (s, 3H).


Example 156 Synthesis of Compound AB36442

The structure of compound AB36442 was as follows:




embedded image


The synthesis method of compound AB356442 was as follows:


Step (1):



embedded image


Compound 1 (1 g, 3.1 mmol, 1 eq) was dissolved in ethanol/acetic acid (10 mL/8 mL), and formaldehyde tetrahydrofuran solution (31 mL, 30.9 mmol, 10 eq, 1M) was added. The mixture was reacted at 90° C. for 4 h, an appropriate amount of hydrochloric acid was added, and the mixture was concentrated. To crude product was added a small amount of dichloromethane and an appropriate amount of ethyl acetate, the mixture was stewed for 0.5 h and then filtered to remove solid. The filtrate was stewed for overnight to precipitate a solid, the solid was filtered and collected to afford compound 2.


Step (2):



embedded image


Compound 2 (200 mg, 0.54 mmol, 1 eq) was dissolved in a mixture of chloroform (10 ml) and aqueous ammonia (5 ml). The mixture was reacted at room temperature for overnight. The reaction mixture was diluted with water and then extracted with dichloromethane twice, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (DCM/MeOH=50/1) to afford compound AB36442.


The MS-ESI and 1H NMR spectra of compound AB36442 were as follows:


MS-ESI: Calculated [M+H]+: 452.01; Found [M+H]+: 452.20.



1H NMR (400 MHz, CDCl3) δ 7.00-6.88 (m, 4H), 76.10 (s, 1H), 6.03 (s, 2H), 6.00 (s, 1H), 5.50 (s, 1H), 3.86-3.80 (m, 1H), 3.66-3.63 (m, 1H), 2.79-2.76 (m, 1H), 2.58-2.50 (m, 1H), 2.13 (s, 3H).


Example 157 Synthesis of Compound AB36472

The structure of compound AB35472 was as follows:




embedded image


The synthesis method of compound AB356472 was as follows:




embedded image


Compound 1 (372 mg, 1 mmol, 1 eq) was dissolved in acetone (5 mL) in a sealed tube, and 4N sodium hydroxide solution (2 mL) was added. The mixture was reacted at room temperature for 1 h. The solid was filtered and washed with water. The crude product was purified by fast chromatography (dichloromethane:methanol=50:1) to afford compound AB36472.


MS-ESI: Calculated [M+H]+: 394.16; Found: 394.10.



1H NMR (400 MHz, CDCl3) δ 7.25 (s, 1H), 6.87-6.70 (m, 3H), 6.00 (d, J=4.0 Hz, 3H), 6.22-6.19 (m, 1H), 3.76 (d, J=4.0 Hz, 6H), 3.27-3.18 (m, 2H), 2.96-2.90 (m, 1H), 2.80-2.69 (m, 2H), 2.32-2.27 (m, 1H), 2.03 (s, 3H).


Example 158 Synthesis of Compound AB36488

The structure of compound AB36488 was as follows:




embedded image


The synthesis method of compound AB36488 was as follows:




embedded image


Compound 2 (1.3 g, 8.23 mmol, 4.0 eq) was dissolved in tetrahydrofuran (10 mL) and isopropylmagnesium chloride solution (5 mL, 10.3 mmol, 5.0 eq, 2M in THF) was added at 0° C. The mixture was reacted for 30 min, compound 1 (766 mg, 2.06 mmol, 1.0 eq) was added, and then the mixture was reacted at room temperature for 1 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by normal phase preparation chromatography (dichloromethane/methanol=0%-2%) to afford compound AB36488.


MS-ESI: Calculated [M]+: 415.16; Found: 415.10.



1H NMR (400 MHz, DMSO-d6) δ 8.44-8.42 (m, 2H), 7.31-7.28 (m, 3H), 6.91-6.79 (m, 2H), 6.74 (s, 1H), 6.00 (s, 3H), 5.75 (s, 1H), 3.75 (s, 3H), 3.61 (s, 3H), 3.41-3.36 (m, 1H), 2.94-2.87 (m, 1H), 2.79-2.71 (m, 2H).


Example 159 Synthesis of Compound AB36496

The structure of compound AB36496 was as follows:




embedded image


The synthesis method of compound AB36496 was as follows:


Step (1):



embedded image


Compound 1 (5 g, 27.44 mmol, 1.0 eq) was dissolved in aqueous sodium hydroxide solution (60 mL, 60.37 mmol, 2.2 eq), and N-bromosuccinimide (5.9 g, 32.93 mmol, 1.2 eq) was added at 0° C. The mixture was reacted at room temperature for 16 h. The reaction mixture was quenched with 5% aqueous sodium bisulfite solution, adjusted to pH=1 with 12M hydrochloric acid, and extracted with ethyl acetate. The organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried to afford compound 2.


Step (2):



embedded image


Compound 2 (7.9 g, 30.26 mmol, 1.0 eq) was dissolved in N, N-dimethylformamide (100 mL), and potassium carbonate (8.3 g, 60.52 mmol, 2.0 eq) and iodomethane (5.1 g, 36.31 mmol, 1.2 eq) were added. The mixture was reacted at room temperature for 16 h. The reaction mixture was rotary dried, the crude product was purified by normal phase preparation chromatography (petroleum ether/ethyl acetate=0%-10%) to afford compound 3.


Step (3):



embedded image


Compound 4 (10 g, 60.18 mmol, 1.0 eq) was dissolved in toluene (100 mL), and compound 5 (4.7 g, 60.18 mmol, 1.0 eq) was added at 0° C. The mixture was reacted at room temperature for 16 h. The reaction mixture was rotary dried, the crude product was purified by normal phase preparation chromatography (dichloromethane/methanol=0%-10%) to afford compound 6.


Step (4):



embedded image


Compound 6 (11.5 g, 55.49 mmol, 1.0 eq) was dissolved in acetonitrile (50 mL), and phosphorus oxychloride (8.5 g, 55.49 mmol, 1.0 eq) was added. The reaction was reacted at 80° C. for 16 h, and then cooled to room temperature. The reaction mixture was quenched with water, adjusted to pH=7-8 with 2N aqueous sodium hydroxide solution, and extracted with dichloromethane. The organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried, the crude product was purified by normal phase preparation chromatography (dichloromethane/methanol=0%-10%) to afford compound 7.


Step (5):



embedded image


Compound 7 (250 mg, 1.32 mmol, 1.0 eq) was dissolved in 1,4-dioxane (5 mL), and compound 3 (436 mg, 1.58 mmol, 1.2 eq), potassium phosphate (839 mg, 3.96 mmol, 3 eq), palladium acetate (30 mg, 0.132 mmol, 0.1 eq), and 4,5-diphenylphosphine-9,9-dimethyloxanthracene (153 mg, 0.264 mmol, 0.2 eq) were added. The mixture was reacted at 120° C. for 16 h, the reaction mixture was rotary dried, the crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.1% formic acid) to afford compound AB36496.


The MS-ESI and 1H NMR spectra of compound AB36496 were as follows:


MS-ESI: Calculated [M+H]+: 352.11; Found: 352.05.



1H NMR (400 MHz, DMSO-d6) δ 7.54-7.40 (m, 3H), 7.10 (s, 1H), 6.93 (s, 1H), 6.07 (s, 2H), 4.13-4.10 (m, 2H), 3.87 (s, 3H), 3.77 (s, 3H), 2.89-2.87 (m, 2H).


Example 160 Synthesis of Compound AB36497

The structure of compound AB36497 was as follows:




embedded image


The synthesis method of compound AB356497 was as follows:


Step (1):



embedded image


Compound 1 (1 g, 2.69 mmol, 1.0 eq) was dissolved in tetrahydrofuran (20 mL), and cyclopentylmagnesium bromide (13.5 mL, 13.45 mmol, 5.0 eq, 1M in THF) at 0° C. The mixture was reacted at room temperature for 1 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (dichloromethane/methanol=0-5%) to afford compound 3.


Step (2):



embedded image


Compound 2 (500 mg, 1.23 mmol, 1.0 eq) was dissolved in methanol (50 mL), and sodium borohydride (93 mg, 2.46 mmol, 2.0 eq) was added at 0° C. The mixture was reacted at room temperature for 1 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by reversed phase preparation chromatography (acetonitrile/water+0.1% formic acid) to afford compound AB36497.


The MS-ESI and 1H NMR spectra of compound AB36497 were as follows:


MS-ESI: Calculated [M+H]+: 408.21; Found: 408.00.



1H NMR (400 MHz, DMSO-d6) δ 6.93 (s, 1H), 6.90-6.82 (m, 2H), 6.63 (s, 1H), 5.91 (s, 2H), 4.00 (d, J=4.0 Hz, 1H), 3.75 (s, 3H), 3.70 (s, 3H), 3.28-3.25 (m, 2H), 3.07-2.94 (m, 2H), 2.74-2.71 (m, 1H), 2.70-2.68 (m, 1H), 2.52-2.47 (m, 1H), 2.44-2.40 (m, 1H), 1.99-1.94 (m, 2H), 1.57-1.27 (m, 5H), 0.95 (s, 1H).


Example 161 Synthesis of Compound AB36512

The structure of compound AB36512 was as follows:




embedded image


The synthesis method of compound AB36512 was as follows:




embedded image


Compound 1 (1.5 g, 4.0 mmol, 1 eq) was dissolved in chloroform (20 mL), and aqueous ammonia (10 mL) was added. The mixture was reacted at room temperature for overnight. The reaction mixture was diluted with water and then extracted with dichloromethane, the organic phase was washed with brine, dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (petroleum ether/ethyl acetate=10/1) to afford compound 2.


Step (2):



embedded image


Compound 2 (500 mg, 1.1 mmol, 1.0 eq) was dissolved in a mixture of tertbutanol (5 mL) and dimethyl sulfoxide (5 mL), and potassium t-butoxide (617 mg, 5.5 mmol, 5.0 eq) was added. The mixture was reacted at 80° C. for 2 h. The reaction mixture was diluted with water and then extracted with ethyl acetate, the organic phase was washed with brine, dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by fast chromatography (petroleum ether/ethyl acetate=10/1) to afford compound AB36512.


The MS-ESI and 1H NMR spectra of compound AB36512 were as follows:


MS-ESI: Calculated [M+H]+: 418.06; Found: 418.00.



1H NMR (400 MHz, DMSO-d6) δ 7.43 (s, 1H), 7.10 (d, J=8.0 Hz, 1H), 6.92 (d, J=8.0 Hz, 1H), 6.82 (s, 1H), 6.57 (s, 1H), 6.03 (s, 2H), 3.79 (s, 3H), 3.72 (s, 4H), 3.46-3.41 (m, 1H), 3.28-3.24 (m, 1H), 2.79-2.70 (m, 1H).


Example 162 Synthesis of Compound AB31878

The structure of compound AB31878 was as follows:




embedded image


The synthesis method of compound AB3188 was as follows:




embedded image


Compound 1 (200 mg, 0.38 mmol, 1.0 eq) was dissolved in methanol (5 mL), and sodium borohydride (29 mg, 0.76 mmol, 2.0 eq) was added at 0° C. The mixture was reacted at room temperature for 1 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate and filtered, the filtrate was rotary dried. The crude product was purified by reversed preparation column chromatography (acetonitrile/water+0.1% formic acid) to afford compound AB31878.


MS-ESI: Calculated [M+H]+: 446.09; Found: 446.30.



1H NMR (400 MHz, DMSO-d6) δ 6.88 (s, 1H), 6.84 (d, J=8.0 Hz, 2H), 6.63 (s, 1H), 5.91 (s, 2H), 4.06 (d, J=16.0 Hz, 1H), 3.99-3.95 (m, 2H), 3.73 (s, 3H), 3.71-3.68 (m, 2H), 3.37-3.34 (m, 2H), 3.29-3.27 (m, 2H), 3.05-3.03 (m, 1H), 2.89-2.86 (m, 1H), 2.59-2.54 (m, 1H), 2.45-2.42 (m, 1H), 2.19-2.16 (m, 2H).


Example 163 Synthesis of Compound AB36520

The structure of compound AB36520 was as follows:




embedded image


The synthesis method of compound AB36520 was as follows:




embedded image


Compound 2 (180 mg, 2.68 mmol, 2.0 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and sodium hydride (107 mg, 2.68 mmol, 2.0 eq, 60% in mineral oil) was added at 0° C. The mixture was reacted for 5 h, compound 1 (500 mg, 1.34 mmol, 1.0 eq) was added, then the mixture was reacted at room temperature for 1 h. The reaction mixture was quenched with saturated aqueous ammonium chloride solution and then extracted with ethyl acetate, the organic phase was dried over anhydrous sodium sulfate, filtered and rotary dried. The crude product was purified by normal preparation chromatography (dichloromethane/methanol=0%-5%) to afford compound AB36520.


MS-ESI: Calculated [M+H]+: 403.16; Found: 403.05.



1H NMR (400 MHz, DMSO-d6) δ 7.31 (s, 1H), 7.06-6.98 (m, 2H), 6.75 (d, J=12.0 Hz, 2H), 6.65-6.63 (m, 2H), 6.29 (s, 1H), 5.99 (s, 2H), 5.87-5.84 (m, 2H), 3.78 (s, 3H), 3.56-3.54 (m, 1H), 3.38 (s, 3H), 2.81-2.65 (m, 3H).


Example 164 Synthesis of Compound AB36525

The structure of compound AB36525 was as follows:




embedded image


The synthesis method of compound AB36525 was as follows:




embedded image


Compound 1 (400 mg, 1.07 mmol, 2.0 eq) was dissolved in methanol (10 mL), and 1N sodium hydroxide solution (1 mL) was added. The mixture was reacted for 0.5 h, and filtered to remove the solid, cyclohexanone (1 mL) was added to the filtrate, then the mixture was reacted at room temperature for 1 h, the solid was filtered, washed with methanol and dried to afford compound AB36525.


MS-ESI: Calculated [M+H]+: 434.19; Found: 434.15.



1H NMR (400 MHz, DMSO-d6) δ 7.15 (s, 1H), 6.81 (d, J=8.0 Hz, 1H), 6.70 (s, 1H), 6.62 (d, J=8.0 Hz, 1H), 5.95 (s, 2H), 5.73 (s, 1H), 5.57 (s, 1H), 3.72 (s, 3H), 3.69 (s, 3H), 3.23-3.18 (m, 1H), 3.05-3.03 (m, 1H), 2.66-2.59 (m, 2H), 2.26-2.15 (m, 3H), 1.95-1.93 (m, 1H), 1.78-1.76 (m, 1H), 1.61-1.59 (m, 1H), 1.48-1.35 (m, 3H).


Example 165

The activity of mitochondria permeability transition pore in related cell was investigated.


Experimental Background:

The mitochondria permeability transition pore (mPTP) was a non-specific channel on the inner membrane of mitochondria, which could allow small molecules with molecular less than 1.5 KD to pass freely, and its activity was affected by peroxides (such as H2O2), pH and calcium ions in mitochondria. Some cells had active mitochondria permeability transition pore, while some cells had inactive mitochondria permeability transition pore. For cells with active mitochondria permeability transition pore, adding peroxide (such as H2O2) could increase the activity of mitochondria permeability transition pore, resulting in a decrease in mitochondria membrane potential. For cells with inactive mitochondria permeability transition pore, adding peroxide (such as H2O2) had no significant effect on the activity of the mitochondria permeability transition pore, and the mitochondria membrane potential had no significant change. Based on this principle, whether the mPTP was active or inactive in specific cell could be determined by measuring the change of potential difference of the mitochondria membrane under peroxide stimulation


Experimental Method and Result:

Daoy cell (human medulloblastoma cell, ATCC no. HTB-186) were cultured in 10% fetal bovine serum-containing DMEM (+p/s), and then 1.5 μM Cyclosporin A (CSA, CSA could effectively inhibit the activity of mitochondria permeability transition pore) was added to the medium, and the cell cultured in medium without the addition of CsA were used as blank control. The mitochondria membrane potential difference was detected by Tetramethylrhodamine (TMRM), the high fluorescence intensity of TMRM represented the high membrane potential difference, the result was shown in Table 2.









TABLE 2







Relative TMRM signal intensity (%) in


Daoy cell after different treatments











Cell
Daoy cell

















CsA


+
+



H2O2

+

+



mean value
100
82
125
121



Standard deviation
7
11
14
11



Repeat times
3
3
3
3



P value

<0.05
<0.01







Remarks: “+” represented existence, “−” represented none.






It could be seen from Table 2 that as for normal Daoy cell cultured in medium without the addition of CSA, the membrane potential was significantly down-regulated under the action of H2O2, indicating that the mitochondria permeability transition pore was active in Daoy cell. However, as for normal Daoy cell cultured in medium with the addition of CSA (CsA could inhibit the activity of mitochondria permeability transition pore), the membrane potential was not down-regulated, indicating that active mPTP of Daoy cell was inhibited by CsA and the mPTP of Daoy cell become inactive, H2O2 did not cause a decrease in membrane potential in this case.


Therefore, Table 2 showed that the mitochondria permeability transition pore (mPTP) was active in Daoy cell.


Example 166

The inhibitory effect of the compounds prepared in the Examples of the present invention on the Daoy cell having active mPTP, and the Daoy cell having inactive mPTP which was constructed by transfecting the Daoy cell with shRNA that could specificly induce the degradation of PPIF mRNA.


The peptidyl-prolyl cis-trans isomerase F was abbreviated as PPIF, the protein identification number was UniProtKB/Swiss Prot: P30405, and the gene identification number was NCBI Entrez Gene: 10105


1. Construction of Daoy Cell Having Inactive Mitochondria Permeability Transition Pore (mPTP)


1.1 Experimental Background:

The activity of mitochondria permeability transition pore (mPTP) was regulated by the PPIF protein. When PPIF protein was inhibited, mPTP activity was significantly decreased. PPIF protein activity was restricted by the expression level of PPIF protein in cell. The PPIF protein expression level in Daoy cell can be specifically decreased by transfecting the Daoy cell with shRNA that could specificly induce the degradation of PPIF mRNA, thereby constructing Daoy cell having inactive mitochondria permeability transition pore (mPTP) (abbreviated as mPTP-inactive Daoy cell).


1.2 Experiment Method and Result:

A viral vector carrying shRNA that could specifically induces the degradation of PPIF mRNA was obtained using cloning technology, the shRNA (the nucleotide sequence was GTTCTTCATCTGCACCATAAA (SEQ ID NO: 1)) carried by viral vector could specifically induce the degradation of PPIF mRNA, the Daoy cell was transfected with the viral vector carrying shRNA that could specifically induce the degradation of PPIF mRNA, and the Daoy cell transfected with empty virus vector without carrying shRNA that can specificly induce the degradation of PPIF mRNA was used as control. The expression level of PPIF protein in Daoy cell was detected using Western blot technique, and the result was shown in FIG. 1. The FIG. 1 showed the PPIF in the Daoy cell transfected with the shRNA that could specifically induce the degradation of PPIF (mPTP regulated protein) mRNA was not expressed (i.e. PPIF shRNA in FIG. 1), while the PPIF in the Daoy cell not transfected with the shRNA that could specifically induce the degradation of PPIF mRN was normally expressed (i.e. con shRNA in FIG. 1, as the control). The activity of mitochondria permeability transition pore in the Daoy cell transfected with empty virus vector without carrying shRNA that could specificly induce the degradation of PPIF mRNA and the Daoy cell transfected with virus vector carrying shRNA that could specificly induce the degradation of PPIF mRNA was determined according to the method described in Example 165 above, the mitochondria membrane potential difference was detected by Tetramethylrhodamine (TMRM), the high fluorescence intensity of TMRM represented the high membrane potential difference, the results were shown in Table 3 and Table 4.









TABLE 3







Relative TMRM signal intensity (%) in the Daoy cell transfected with


empty virus vector without carrying shRNA that could specificly


induce the degradation of PPIF mRNA after different treatments









The Daoy cell transfected with empty virus



vector without carrying shRNA that could specificly


Cell
induce the degradation of PPIF mRNA














CsA


+
+


H2O2

+

+


mean value
100
79
131
126


Standard deviation
6
7
10
8


Repeat times
3
3
3
3
















TABLE 4







Relative TMRM signal intensity (%) in the Daoy cell transfected


with virus vector carrying shRNA that could specificly induce


the degradation of PPIF mRNA after different treatments









The Daoy cell transfected with virus vector carrying



shRNA that could specificly induce the degradation


Cell
of PPIF mRNA














CsA


+
+


H2O2

+

+


mean value
100
95
105
101


Standard deviation
5
6
8
11


Repeat times
3
3
3
3









The Table 3 and Table 4 showed the mitochondria permeability transition pore (mPTP) is active in the Daoy cell transfected with empty virus vector without carrying shRNA that could specificly induce the degradation of PPIF mRNA, the mitochondria permeability transition pore (mPTP) is inactive in the Daoy cell transfected with virus vector carrying shRNA that could specificly induce the degradation of PPIF mRNA, therefore, the Daoy cell having inactive mitochondria permeability transition pore (mPTP) was successfully constructed by transfecting the Daoy cell with shRNA that could specificly induce the degradation of PPIF (mPTP regulated protein) mRNA.


The cell viability of the mPTP-inactive Daoy cell constructed by transfecting the Daoy cell with shRNA that could specificly induce the degradation of PPIF mRNA and the mPTP-active Daoy cell not transfected with shRNA that could specificly induce the degradation of PPIF mRNA was detected using the Promega CellTiter-Glo kit which reflected cell viability by measuring intracellular ATP content, the results was shown in FIG. 2, it could be seen from FIG. 2 that cell viability of mPTP-inactive Daoy cell constructed by transfecting the Daoy cell with shRNA that could specificly induce the degradation of PPIF mRNA and the mPTP-active Daoy cell not transfected with shRNA that could specificly induce the degradation of PPIF mRNA was almost the same, and the difference in cell viability was not statistically significant.


2. The Correlation Between the Inhibitory Effect of the Compounds Prepared in the Examples of the Present Invention on Tumor Cell and the Activity Level of mPTP was Investigated


2.1 Experimental Background:

The inhibitory effect (IC50 value) of the compounds prepared in the Examples of the present invention on the mPTP-active Daoy cell not transfected with shRNA that could specificly induce the degradation of PPIF mRNA and the mPTP-inactive Daoy cell constructed by transfecting the Daoy cell with shRNA that could specificly induce the degradation of PPIF mRNA was detected using Promega CellTiter-Glo kit which reflected cell viability by directly measured intracellular ATP content.


2.2 Experiment Method and Result:

The mPTP-active Daoy cell not transfected with shRNA that could specificly induce the degradation of PPIF mRNA and the mPTP-inactive Daoy cell constructed by transfecting the Daoy cell with shRNA that could specificly induce the degradation of PPIF mRNA were cultured in 10% fetal bovine serum-containing DMEM (+p/s), the 50% inhibiting concentration (IC50) of the compounds prepared in the Examples of present invention on the two types of cells was detected, and the experimental results were shown in Table 3:


Table 3 the inhibitory effect of the compounds prepared in the Examples of present invention on the mPTP-active Daoy cell and mPTP-inactive Daoy cell (IC50, μM)















mPTP-active Daoy cell
mPTP-inactive Daoy cell


Compound
(IC50, μM)
(IC50, μM)

















compound AB31866
6.78
3.38


compound AB31870
3.94
1.86


compound AB35417
3.62
1.61


compound AB35411
3.51
1.78


compound AB35436
4.80
2.28


compound AB35418
3.25
1.56


compound AB35422
5.27
2.59


compound AB35448
3.53
1.72


compound AB31881
4.34
2.12


compound AB35430
5.07
2.38


compound AB31887
6.47
3.17


compound AB35434
5.21
2.48


compound AB31888
5.46
2.68


compound AB31895
3.15
1.46


compound AB31896
5.02
2.42


compound AB31897
3.43
1.58


compound AB35402
1.72
0.81


compound AB35405
2.68
1.21


compound AB35407
2.83
1.34


compound AB35415
4.79
2.26


compound AB35423
4.82
2.36


compound AB35416
10.57
5.11


compound AB35424
13.83
6.18


compound AB35438
1.86
0.84


compound AB35429
5.28
2.23


compound AB35420
9.55
4.59


compound AB31873
6.44
3.13


compound AB35440
2.36
1.14


compound AB35441
2.88
1.27


compound AB35444
6.85
3.33


compound AB35445
12.07
6.37


compound AB31880
2.93
1.13


compound AB31898
9.54
4.43


compound AB35426
2.71
1.03


compound AB35427
3.27
1.49


compound AB35428
12.87
5.61


compound AB35413
13.34
6.87


compound AB35421
>50
24.87


compound AB35453
1.23
0.43


compound AB35454
2.96
1.28


compound AB35455
3.51
1.47


compound AB35456
5.77
2.76


compound AB35457
3.25
1.52


compound AB35458
3.85
1.84


compound AB35459
12.51
6.18


compound AB35465
5.43
2.68


compound AB35466
2.21
0.91


compound AB35467
16.09
8.21


compound AB35468
2.29
1.05


compound AB35469
2.41
1.11


compound AB35475
2.64
1.23


compound AB35476
2.35
1.08


compound AB35478
3.78
1.51


compound AB35484
3.06
0.97


compound AB35485
16.26
5.27


compound AB35486
0.71
0.23


compound AB35487
1.77
0.47


compound AB35488
5.27
2.02


compound AB35489
1.68
0.79


compound AB35490
10.60
3.76


compound AB35491
6.01
2.63


compound AB35492
3.78
1.34


compound AB35494
1.28
0.36


compound AB35496
12.35
5.28


compound AB35497
3.28
1.15


compound AB35498
6.35
3.10


compound AB35499
6.45
3.15


compound AB35500
3.46
1.71


compound AB35501
4.98
1.91


compound AB35502
6.14
2.97


compound AB35504
10.59
4.25


compound AB35505
1.24
0.42


compound AB35506
3.45
1.49


compound AB35508
2.25
0.99


compound AB35510
0.83
0.29


compound AB35512
4.27
1.57


compound AB35514
3.42
1.33


compound AB35518
8.25
3.08


compound AB35519
13.64
6.03


compound AB35521
2.40
1.03


compound AB35522
3.95
1.34


compound AB35523
3.22
1.39


compound AB35524
4.04
1.90


compound AB35525
2.48
0.70


compound AB35531
3.60
1.55


compound AB35534
3.92
1.28


compound AB35535
0.59
0.18


compound AB35536
1.30
0.40


compound AB35543
1.22
0.44


compound AB35544
0.72
0.20


compound AB35545
0.53
0.20


compound AB35550
6.36
2.05


compound AB35590
4.54
1.41


compound AB35594
2.66
1.10


compound AB35599
5.41
2.43


compound AB36403
1.66
0.54


compound AB36415
2.18
1.07


compound AB36416
3.78
1.44


compound AB36423
6.76
2.02


compound AB36427
11.93
4.30


compound AB36428
0.92
0.40


compound AB36432
4.32
1.88


compound AB36433
1.92
0.58


compound AB36434
2.42
1.13


compound AB36437
1.37
0.54


compound AB36447
6.73
2.65


compound AB36450
5.12
2.23


compound AB36460
2.71
1.27


compound AB36463
1.95
0.88


compound AB36467
12.10
4.63


compound AB36474
4.26
1.39


compound AB36476
2.40
1.10


compound AB36477
2.54
1.32


compound AB31893
5.14
2.5


compound AB31900
5.37
2.56


compound AB35460
1.96
0.78


compound AB35493
3.33
1.02


compound AB36493
1.34
0.35


compound AB36501
12.92
3.43


compound AB36509
2.12
0.45


compound AB35442
10.71
11.37


compound AB35443
30.03
31.02


compound AB35446
16.23
17.58


compound AB35447
22.91
25.74


compound AB36426
30.89
34.96


compound AB36442
29.92
29.22


compound AB36472
15.82
15.92


compound AB36488
27.02
26.89


compound AB36496
86.28
>100


compound AB36497
67.38
68.99


compound AB36512
6.42
7.09


compound AB31878
10.44
10.95


compound AB36520
16.07
15.98


compound AB36525
1.50
1.65





Noted:


IC50 refered to 50% inhibiting concentration, ie, the concentration of the inhibitory compound when 50% inhibitory effect was achieved. The mPTP-active Daoy cell refered to the Daoy cell transfected with empty virus vector without carrying shRNA that can specificly induce the degradation of PPIF mRNA; The mPTP-inactive Daoy cell refered to the Daoy cell transfected with virus vector carrying shRNA that can specificly induce the degradation of PPIF mRNA.






As was shown in Table 3, the compounds prepared in the Examples of the present invention had significant inhibitory effect on mPTP-inactive Daoy cell, while the compounds prepared in the Examples of the present invention had weaker inhibitory effect on mPTP-active Daoy cell. Decreasing the mPTP activity in Daoy cell could significantly improve the inhibitory effect of the compounds prepared in the Examples of the present invention on tumor, therefore, the compounds prepared in the Examples of the present invention had more significant inhibitory effect on mPTP-inactive Daoy cell, the mPTP-inactive Daoy cell was highly sensitive to the compounds prepared in the Examples of the present invention. Therefore, the compounds prepared in the Examples of the present invention had excellent precision treatment effect on mPTP-inactive Daoy cell. As mentioned above, when PPIF protein was inhibited, mPTP activity was significantly decreased, inhibiting the expression level of PPIF protein could decrease the mPTP activity in Daoy cell. Therefore, the compounds prepared in the Examples of the present invention had more significant inhibitory effect on Daoy cell with low expression of PPIF protein, while the compounds prepared in the Examples of the present invention had weaker inhibitory effect on Daoy cell with normal expression of PPIF protein, indicating that decreasing the expression level of PPIF protein could significantly improve the inhibitory effect of the compounds prepared in the Examples of the present invention on tumor. Therefore, the compounds prepared in the Examples of the present invention had more significant inhibitory effect on Daoy cell with low expression of PPIF protein, i.e, the Daoy cell with low expression of PPIF protein was more sensitive to the compounds prepared in the Examples of the present invention compared with the Daoy cell with normal expression of PPIF protein. The compounds prepared in the Example of the present invention had excellent precision treatment on Daoy cell with low expression of PPIF protein.


The above is an embodiment designed for a specific case of the present invention. It should be understood for the skilled in the art the improvements can be made without departing from the principles of the present invention, and these improvements should also be considered as the scope of protection of the present invention.

Claims
  • 1-14. (canceled)
  • 15. A compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof;
  • 16. The compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof of claim 15, wherein R1 and R2 are each independently hydrogen, deuterium, halogen, substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C3-C10 cycloalkyl, substituted or unsubstituted 3-10 membered heterocycloalkyl, substituted or unsubstituted C1-C10 haloalkyl, substituted or unsubstituted C3-C10 halocycloalkyl, substituted or unsubstituted C6-C10 aryl, substituted or unsubstituted 5-10 membered heteroaryl; R3, R4 and R5 are each independently hydrogen, halogen (e.g, Cl, Br), R17—O—, R17—S—, (R18R19)N—; or R3 and R4, or R4 and R5 are connected to form
  • 17. The compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof of claim 15, wherein R1 and R2 are each independently hydrogen, deuterium, halogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C3-C8 cycloalkyl, substituted or unsubstituted 3-8 membered heterocycloalkyl, substituted or unsubstituted C1-C6 haloalkyl, substituted or unsubstituted C3-C8 halocycloalkyl, substituted or unsubstituted C6-C8 aryl, substituted or unsubstituted 5-8 membered heteroaryl; R3, R4 and R5 are each independently hydrogen, halogen (e.g, Cl, Br), R17—O—, R17—S—, (R18R19)N—; or R3 and R4, or R4 and R5 are connected to form
  • 18. The compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof of claim 15, wherein R1 and R2 are each independently hydrogen, deuterium, halogen, methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, halomethyl, haloethyl, halopropyl, halobutyl halopentyl, halohexyl, phenyl, acetyl-methyl-, pyridinyl, pyrrolyl, cyclohexanone group; R3, R4 and R5 are each independently hydrogen, halogen (e.g, Cl, Br), R17—O—, R17—S—, (R18R19)N—; or R3 and R4, or R4 and R5 are connected to form
  • 19. The compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof of claim 15, wherein R1 and R2 are each independently hydrogen, deuterium, trichloromethyl, methyl, cyclobutyl, cyclopentyl, butyl, hexyl, phenyl; R3, R4 and R5 are each independently hydrogen, halogen (e.g, Cl, Br), R17—O—, R17—S—, (R18R19)N—; or R3 and R4, or R4 and R5 are connected to form
  • 20. The compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof of claim 15, wherein the pharmaceutically acceptable salt of the compound of formula I comprises the salt formed by the compound of formula I and one or more of hydrochloric acid, mucic acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid and glutamic acid.
  • 21. The compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof of claim 15, wherein the compound is selected from the following group:
  • 22. A composition, wherein the composition comprises (a) the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof of claim 15; and (b) a pharmaceutically acceptable carrier.
  • 23. The composition of claim 22, wherein the composition is pharmaceutical composition; the composition further comprises a pharmaceutically acceptable carrier;the dosage form of the composition is a solid preparation, liquid preparation or semi-solid preparation; and/orthe dosage form of the composition is oral preparation, external preparation or injection preparation.
  • 24. A method for preventing and/or treating tumor, which comprises administering a compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof of claim 15 to a subject in need.
  • 25. The method of claim 24, wherein the tumor comprises tumor with low expression, no expression, low activity or no activity of mitochondria permeability transition pore; and/or the tumor comprises tumor with low expression, no expression, low activity or no activity of peptidyl-prolyl cis-trans isomerase F.
  • 26. The method of claim 25, wherein the low expression or low activity of mitochondria permeability transition pore means the ratio (H1/H0) of the expression level or activity level H1 of mitochondria permeability transition pore in the tumor cell to the expression level or activity level H0 of mitochondria permeability transition pore in the same type of cell is <1.0, preferably ≤0.8, more preferably ≤0.7, more preferably ≤0.6, more preferably ≤0.5, more preferably ≤0.4, more preferably ≤0.3, more preferably ≤0.2, more preferably ≤0.1, more preferably ≤0.05, more preferably ≤0.01, more preferably ≤0.005, more preferably ≤0.001, more preferably ≤0.0001, more preferably ≤0.00001, more preferably ≤0.000001, more preferably ≤0.000000; and/or the low expression or low activity of peptidyl-prolyl cis-trans isomerase F means the ratio (C1/C0) of the expression level or activity level C1 of peptidyl-prolyl cis-trans isomerase F in the tumor cell to the expression level or activity level C0 of peptidyl-prolyl cis-trans isomerase F in the same type of cell is <1.0, preferably ≤0.8, more preferably ≤0.7, more preferably ≤0.6, more preferably ≤0.5, more preferably ≤0.4, more preferably ≤0.3, more preferably ≤0.2, more preferably ≤0.1, more preferably ≤0.05, more preferably ≤0.01, more preferably ≤0.005, more preferably ≤0.001, more preferably ≤0.0001, more preferably ≤0.00001, more preferably ≤0.000001, more preferably ≤0.0000001.
  • 27. The method of claim 26, wherein the same type of cell comprises the same type of tumor cell with normal expression, high expression, normal activity or high activity of mitochondria permeability transition pore; and/or the same type of cell comprises the same type of tumor cell with normal expression, high expression, normal activity or high activity of peptidyl-prolyl cis-trans isomerase F.
  • 28. The method of claim 24, wherein the tumor is human tumor; and/or the tumor comprises brain tumor.
  • 29. The method of claim 28, wherein the brain tumor comprises glioma and/or medulloblastoma.
Priority Claims (6)
Number Date Country Kind
202210256272.2 Mar 2022 CN national
202210256355.1 Mar 2022 CN national
202210481050.0 May 2022 CN national
202210482528.1 May 2022 CN national
202210482536.6 May 2022 CN national
202211590192.7 Dec 2022 CN national
PCT Information
Filing Document Filing Date Country Kind
PCT/CN2023/081964 3/16/2023 WO