Patent Application
20230027317
The present invention relates to a non-human primate model animal of Alzheimer's disease and a method for producing the model animal.
Alzheimer's disease (AD) is a major cause of dementia, with the number of patients with AD anticipated to exceed 50 million worldwide. However, no effective measures have been established to prevent or treat AD, which is due in part to a lack of useful animal models. Some mice models have been established, but cannot reflect human AD disease states in most parts due to biological differences from primates.
Non-Patent Literature 1
Non-Patent Literature 2
Non-Patent Literature 3
An objective of the present invention is to provide a world's first non-human primate AD model.
To attain the above objective, the inventors performed various experiments and found that mutant PSEN1 marmoset individuals whose 3′-splice site (acceptor site) of exon 9 in the PSEN1 gene (that encodes presenilin 1 protein) was partly or completely deleted by Transcription Activator-Like Effector Nuclease (TALEN) in marmoset embryos and individuals could replicate a pathological status observed in human AD patients. On the basis of this finding, the inventors completed the present invention. Specifically, the present invention includes the following features.
(1) A non-human primate model animal of Alzheimer's disease, including: the PSEN1 gene in which a site including at least a 5′- or 3′-splice site of exon 9 and being related to splicing of exon 9 is deficient.
(2) The non-human primate model animal of Alzheimer's disease described in (1), wherein the non-human primate is a marmoset.
(3) A method for producing a non-human primate model animal of Alzheimer's disease, the method including: making a site of the PSEN1 gene deficient by a genome-editing technology, the site including at least a 5′- or 3′-splice site of exon 9 in the PSEN1 gene and being related to splicing of exon 9.
(4) The method described in (3), wherein the site including at least the 5′- or 3′-splice site of exon 9 in the PSEN1 gene and being related to splicing of exon 9 is made deficient in an ovum.
(5) The method described in (3) or (4), wherein the non-human primate is a marmoset.
In another aspect, the present invention includes the following features:
(6) A non-human primate model animal of Alzheimer's disease including: the PSEN1 gene in which an acceptor site of exon 9 is deficient.
(7) The non-human primate model animal of Alzheimer's disease described in (6), wherein the non-human primate is a marmoset.
(8) A method for producing a non-human primate model animal of Alzheimer's disease, the method including: making an acceptor site of exon 9 in the PSEN1 gene deficient by a genome-editing technology.
(9) The method described in (8), wherein the acceptor site of exon 9 in the PSEN1 gene is made deficient in an ovum.
In accordance with an aspect of the present invention, it is possible to replicate a human AD disease state.
a of
a of
a of
a of
The present invention relates to non-human primate models of AD. There is no particular limitation on the kind of non-human primate, provided that the primate can have Alzheimer's disease. Examples of the primate encompass Strepsirrhini (e.g., lemurs, lorises, and galagos) and Haplorhini (e.g., tarsiers, spider monkeys, capuchin monkeys, marmosets, guenons, colobi, and anthropoid apes). However, this is not limitative. In a preferred aspect, examples of the non-human primates encompass guenons (e.g., rhesus monkeys and crab-eating macaques) and marmosets (e.g., common marmosets and black-eared marmosets). A marmoset AD model in accordance with an aspect of the present invention is advantageous for AD research for the following reasons: marmosets have a genetic background and a brain structure close to those of humans; marmosets exhibit human-like cognitive behaviors associated with prefrontal cortex; marmosets are able to communicate by visual and auditory information: marmosets have a small body size (e.g., 350 to 500 g); marmosets have a relatively short gestation period (145 days) and their reproductive efficiency is high (40 to 80 neonates per female); and marmosets have a relatively long life span (10 to 13 years in captivity). Marmosets are advantageous also for the following reasons: marmosets exhibit deposition of amyloid β protein with aging starting around 7 years; and the marmoset amyloid β protein has a sequence identical to that of human amyloid β protein.
A marmoset AD model in accordance with an aspect of the present invention has the PSEN1 gene in which a splice site of exon 9 is destroyed. The destruction of the splice site may be carried out by a known genome-editing technology, examples of which encompass CRISPR-Cas9 system and Transcription Activator-Like Effector Nuclease (TALEN). In an aspect, the destruction is preferably carried out by Platinum TALEN. It has been reported that a deletion mutation in exon 9 or a point mutation at a splice site of exon 9 in the PSEN1 gene instigates exclusion of exon 9 in an mRNA due to alternative splicing. The inventors are the first to actually succeed in production of a non-human primate AD model by destruction of this site.
In a preferred embodiment, the expression “3′-splice site of exon 9 in the PSEN1 gene” indicates two nucleotides existing at the 3′-terminal of intron 8 for splicing of exon 8 and exon 9, as shown in
The deficiency is any of (i) partial deletion of the 3′-terminal (including the above-described nucleotides AG) of intron 8 and the 5′-terminal of exon 9, (ii) partial deletion of the 3′-terminal (including the above-described nucleotides AG or nucleotide A) of intron 8, and (iii) partial deletion of the nucleotide G or nucleotides AG and the 5′-terminal of exon 9. The full length of the deletion causing the deficiency may be arbitrarily selected, provided that the deletion includes one or both of the two nucleotides and does not give any effect on splicing of any other exon than exon 9.
In another embodiment different from the preferred embodiment shown in
1. The “3′-splice site” may be replaced with “5′-splice site”.
2. The “exon 8 and exon 9” may be replaced with “exon 9 and exon 10”.
3. The “3′-terminal of intron 8” may be replaced with “5′-terminal of intron 9”.
4. The “5′-terminal of exon 9” may be replaced with “3′-terminal of exon 9”.
5. The “nucleotide A” may be replaced with “nucleotide G”, the “nucleotide G” may be replaced with “nucleotide T”, and “nucleotides AG” may be replaced with “nucleotides GT”.
In another embodiment different from the above two embodiments, the “deficiency of a site including at least the 5′-splice site or the 3′-splice site of exon 9 in the PSEN1 gene (the site being related to splicing of exon 9)” can be caused by deletion of a branch site existing in intron. The intron can be either of or both intron 8 and intron 9 in the PSEN1 gene. It is known that the branch site exits near the 3′-terminal in the intron and is followed by, on its downstream side, a polypyrimidine region (repetition of Py). In an aspect of the present invention, the branch site can be a site including nucleotide A located 20 to 40 (said to be 21 to 34 nucleotides) nucleotides upstream of the 3′-splice site. The deletion of the branch site means deletion of at least the above-described nucleotide A.
Note that a genome of a marmoset AD model in accordance with an aspect of the present invention may have all of or any two of the above-described three different deletions.
A method for producing a marmoset AD model in accordance with an aspect of the present invention is, for example, as follows. TALEN mRNAs targeting the 3′-splice site of exon 9 in the marmoset PSEN1 gene are introduced into the nuclei of marmoset fertilized ova. The resulting products may be subcloned, followed by surveyor assay and sequencing analysis. Alternatively, only embryos in which a target site including the 3′-splice site is deficient may be collected. The deficiency can be induced at a high possibility, e.g., two out of three. After the introduction of TALEN, RT-PCR and cDNA sequencing can be carried out to confirm exclusion of exon 9 in the PSEN1 mRNA. According to this method, there is no wild-type sequence in an RNA extracted from a 4-cell-stage fertilized ovum or a single blastomere, and the 3′-splice site can be made deficient in a biallelic manner.
Preferably, TALEN mRNAs are introduced into ova, and then the ova are fertilized. After fertilization, the fertilized ova are developed to a 6-cell stage or more. Then, the fertilized ova can be transferred to surrogate mothers. The introduction of TALEN does not cause any distinct adverse reaction in pregnancy or following development. In this manner, it is possible to obtain marmosets carrying, e.g., a 6-bp deficiency including the 3′-splice site in a heterozygous state. It is possible to confirm exclusion of exon 9 by carrying out, on mRNAs from the obtained marmoset AD models (e.g., the mRNAs extracted from hair roots of the marmosets), RT-PCR and then cDNA sequencing.
As indicated in the later-described Examples, a marmoset AD model in accordance with an aspect of the present invention exhibits an increase of Aβ42/Aβ40 ratio compared to that of a wild-type marmoset, where Aβ42 is amyloid β protein Aβ42 and Aβ40 is amyloid β protein Aβ40. For example, a marmoset AD model in accordance with an aspect of the present invention has a value of Aβ42/Aβ40 that is 1.4-fold or more, 1.6-fold or more, 1.8-fold or more, or 2-fold or more greater than that of the wild-type.
Examples are indicated below. However, the present invention is not limited to these Examples.
All the animal experiments described below were conducted in accordance with the guidelines for animal experimentation as determined by the Central Institute for Experimental Animals on the basis of “the Act on Welfare and Management of Animals”, “Standard relating to the Care and Keeping and Reducing Pain of Laboratory Animals” and “Fundamental Guidelines for Proper Conduct of Animal Experiment and Related Activities in Academic Research Institutions (notified by the Ministry of Education, Culture, Sports, Science and technology of Japan)”.
Materials and Method
Preparation of TALEN Plasmids
Platinum Gate TALEN Kit (Addgene) was used to prepare TALEN plasmids in accordance with a method described in SCIENTIFIC REPORTS 2013, November 29; 3: 3379. Doi:10.1038/srep03379. This method will be briefly explained below. Platinum Gate TALEN kit (Addgene; cat #1000000043) was used to carry out two-step Golden Gate assembly method, so as to construct Platinum TALEN containing a homodimer-type FokI nuclease domain. The assembled repeat arrays were subsequently inserted into a final destination vector, ptCMV-153/47-VR. TALEN mRNA was synthesized with use of “mMESSAGE mMACHINE T7 Ultra Transcription Kit” (Thermo Fisher Scientific, AM1345). Transcribed mRNA was purified with use of “MEGAclear Transcription Clean-Up Kit” (Thermo Fisher Scientific, AM1908). The full-length sequences of the plasmids thus prepared are indicated as SEQ ID NO: 1 (Left_TALEN) and SEQ ID NO: 2 (Right_TALEN) in the sequence listing.
Sequences of TALEN Vectors
In Vitro Maturation and In Vitro Fertilization
The TALEN injected ova were incubated for 24 hours or more in Porcine Oocyte Medium (Research Institute for the Functional Peptides, IFP1010P) containing inactivated FBS (final concentration: 5%), hFSH (Fuji Pharma, final concentration: 0.15 IU/mL), and hCG (ASKA Pharmaceutical, final concentration: 10 IU/mL). Then, the ova matured to MI (Metaphase I) or more were collected. Semen used for fertilization was collected from wild-type male marmosets, and in vitro fertilization (IVF) was carried out with use of TYH medium (LSI medience, DR01031). The next day (approximately 16 hours after the start of IVF), IVF was released. It was determined whether the fertilization was succeeded or not in accordance with the presence or absence of a prokaryotic cell. The fertilized ova thus obtained were collected.
Embryo Transfer and Pregnancy Management
The fertilized ova were subjected to early-stage in vitro incubation in Sequencial Cleav (Origio, 83040010A). Two or three days after the start of the incubation, the embryos grown to a 4-cell stage or higher were collected. The embryos thus collected were subjected to later-stage in vitro incubation in a medium that was Sequencial Blast (Origio, 83060010A) containing inactivated FBS (final concentration: 10%) and L-glutamine (final concentration: 2 mM). One week after the injection of TALEN, the embryos were transferred into the uteri of surrogate mothers through a noninvasive catheter operation. After the transfer of the embryos, the surrogate mothers were measured for a P4-value in the blood and undergone uterus observation by ultrasonic diagnostic equipment so as to determine pregnancy. Individuals confirmed to be pregnant undergone a periodical examination once a week so as to observe a fetal heart rate, and the presence or absence of a morphological abnormality, etc. A method for obtaining newborns was based on natural delivery. If natural delivery was judged to be difficult from the state(s) of the surrogate mother and/or fetus, a caesarean section was performed to obtain a newborn.
Genomic DNA Analysis
Genomic DNA was extracted, with use of QIAamp DNA
Micro Kit (Qiagen, 56304), from hair of a newborn or cord blood obtained at the caesarean section. PCR for analyzing the PSEN1 gene was carried out with use of KOD plus neo (TOYOBO, 401) and two primers, Psen_1_Ex9_up1 (ACCCGCGACTCCCTATTATT: SEQ ID NO: 3) and Psen_1_Ex9_dn1 (TGCCTTGACTGTATTGTTGG: SEQ ID NO: 4). The reaction was carried out under the following reaction condition: After heating at 94° C. for 2 minutes, 35 cycles of 98° C. for 10 seconds, 60° C. for 10 seconds, and 68° C. for 30 seconds were carried out. After the reaction, some of the resultants were subjected to electrophoresis on an agarose gel to check for amplification. Some of the amplification products were subjected to surveyor assay, with which genetic modification can be visually detected. The remaining ones were cloned to a sequence vector with use of Zero Blunt PCR Cloning Kit (Thermo fisher scientific, K275040), and the plasmids were introduced into Escherichia coli (strain DH5a) for transformation. From the resulting subclones, plasmids were collected and subjected to sequence analysis.
cDNA Analysis
Total RNA was extracted, with use of Nucleospin RNA plus XS (Takara, U0990B), from hair of a newborn or cord blood obtained at the caesarean section. Then, cDNA was synthesized with use of ReverTra Ace-α-(TOYOBO, FSK-101). PCR for checking for the deficiency of exon 9 in the PSEN1 gene was carried out with use of KOD plus neo and a set of two primers designed on an exon in the vicinity of the deficient site of exon 9. The set of two primers was either of (i) Pn1_on_Ex7_up1 (TACCTCCCTGAATGGACTGC: SEQ ID NO: 5) and Pn1_on_Ex11_dn2 (TGGTTGTGTTCCAGTCTCCA: SEQ ID NO: 6) and (ii) Pn1_on_Ex8_up1 (GGTCCACTTCGTATGCTGGT: SEQ ID NO: 7) and Pn1_on_Ex11_dn1 (GGCTGTTGCTGAGGCTTTAC: SEQ ID NO: 8). The reaction was carried out under the following reaction condition: After heating at 94° C. for 2 minutes, 35 cycles of 98° C. for 10 seconds, 60° C. for 10 seconds, and 68° C. for 30 seconds were carried out. The samples undergone the reaction were subjected to electrophoresis on a 1.5% agarose gel. In the amplified products, band shifting was found to estimate the deficiency of exon 9. Some of the amplified products were cloned to a sequence vector with use of Zero Blunt PCR Cloning Kit, and the plasmids were introduced into Escherichia coli (strain DH5a) for transformation. From the resulting subclones, plasmids were collected and subjected to sequence analysis.
Primary Culture
A small amount of tissues were excised from ear lobes of newborns, and were cut into small pieces. The tissue pieces were put on a cell culture dish, and were cultured at 37° C. in a 5% CO2 environment with use of D-MEM (Thermo fisher scientific, 10566016) containing 10% inactivated FBS.
TALEN mRNAs targeting the 3′-splice site of exon 9 in the marmoset PSEN1 gene were introduced into the nuclei of marmoset fertilized ova. Then, subcloning was carried out, followed by surveyor assay and sequencing assay. As shown in a of
On the basis of the results obtained from the fertilized ova, an attempt was made to introduce TALEN mRNAs into ova in the above-described manner and to fertilize the ova. After fertilization, the fertilized ova were developed to the morula stage, and were then transferred to surrogate mothers. The introduction of TALEN did not cause any distinct adverse reaction in pregnancy or following development. In this manner, F0 marmosets (PSEN1-ΔE9) carrying a 6-bp deletion including the 3′-splice site in a heterozygous state could be obtained (a of
ELISA (Wako, 294-62501, 290-62601) was used to quantify Aβ in culture media of primary skin fibroblasts of a wild-type marmoset and PSEN1-ΔE9 (I774gmF) marmoset. A result thereof is shown in
Genomic DNA analysis and cDNA analysis indicated that, in two individuals with a mutation in the PSEN1 gene, normal PSEN1 and exon 9-deficient PSEN1 appeared at a ratio of approximately 1:1. This strongly suggests that heterozygous state of PSEN1-ΔE9, which is found in human patients, could be replicated. In addition, according to the result of Aβ quantification in the fibroblast culture media, replication of an abnormality in Aβ production profile was found. From this, it is considered that the produced PSEN1-ΔE9 marmosets replicated a disease state of AD. The method, adopted in the Examples, for introducing a mutation in the 3′-splice site to induce exon skipping can be carried out by inducing DNA double strand break at a single site on a genomic DNA, and thus is considered to be more efficient and useful than a generally-conducted method for deleting an exon by cleaving both ends of the exon by genome editing and a knock-in method. Such a method for introducing, by genome editing, a mutation into a sequence related to splicing to produce a disease model that replicates a state of a disease (Alzheimer's disease) is considered to be useful. Furthermore, in a case where, as in the present invention, a targeted gene mutation can cause embryonic lethality if the gene mutation takes place in a homozygous status, a method for carrying out genome editing on ova and fertilizing the ova is considered to be useful for avoiding embryonic lethality.
In the same manner as that in Example 2, two PSEN1-ΔE9 neonate individuals (I943gmM and I949gmM) were further obtained (a of
Western blot analysis was carried out against PS1 protein in membrane fractions obtained from the fibroblasts of the wild-type (I774gmF) and PSEN1-ΔE9 (I943gmM and I949gmM) marmosets. A result thereof is shown in a of
In the culture media of the primary skin fibroblasts, Aβ was quantified by sandwich ELISA (Wako, 294-62501, 290-62601). A result thereof is shown in c of
A non-human primate AD model in accordance with an aspect of the present invention is very useful for development of a method for diagnosis and therapy of Alzheimer's disease.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/JP2020/047548 | 12/18/2020 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 62951498 | Dec 2019 | US |
