Patent Application
20110091473
The present invention relates to the use of an antibody capable of mediating effector function which specifically binds to a multiple membrane spanning antigen or to an antigen which forms dimers or multimers for the preparation of a medicament for administration in combination with a cholesterol-increasing agent for the treatment of a disease or disorder associated with said antigen, wherein antibody-induced effector function has a beneficial effect on said disease or disorder.
Furthermore, the invention relates to such antibody for use in combination with a cholesterol-increasing agent in the treatment of such disease or disorder, to the use of cholesterol-increasing agent for the preparation of a medicament for administration in combination with such antibody for the treatment of such disease or disorder, to a cholesterol-increasing agent for use in combination with such antibody in the treatment of such disease or disorder, to methods of treating such diseases or disorders, as well as to kits of parts comprising such antibody and a cholesterol-increasing agent.
In another aspect, the invention relates to the use of such antibody for the preparation of a medicament for the treatment of such disease or disorder, wherein the antibody is to be administered to a subject undergoing therapy with a cholesterol-lowering agent, such as a statin, and wherein the subject is withdrawn from treatment with the cholesterol-lowering agent prior to the administration of the antibody.
Furthermore, the invention relates to such antibody for use in the treatment of such disease or disorder as well as to methods of treating such diseases or disorders.
Antibodies are being used as therapeutic agents for a number of diseases and disorders, including cancer and autoimmune diseases. Antibodies are immunoglobulins that recognize specific antigens and mediate their effects via several mechanisms, including inhibition of ligand-receptor interactions, inhibition of receptor activation, mediation of receptor internalization and activation of effector functions, such as complement dependent cytotoxicity (CDC) and antibody-dependent cellular cytotoxicity (ADCC). There are five classes of immunoglobulins: IgG, IgA, IgM, IgD and IgE. The IgG class is further divided into subclasses IgG1, IgG2, IgG3 and IgG4.
Polyak M J et al. (2003) Leukemia, 17:1384-1389 disclose that cholesterol depletion reduced expression of the epitope of CD20 to which the anti-CD20 antibody FCM7 binds, whereas cholesterol enrichment enhanced its expression. It should be noted that the FMC7 antigen is still poorly characterized even though binding of anti-FMC7 monoclonal antibody is critically dependent on the presence of CD20 in the plasma membrane. Therefore, any conformational changes in CD20 might result in impaired binding to FMC7 antigen.
Janas E et al. (2005) Clinical and Experimental Immunology, 139:439-446 show that the integrity of lipid rafts seem to play a crucial role for CD20-induced calcium influx and induction of apopotosis, and that depletin of cholesterol with MβCD profoundly reduces apoptosis induced by Rituxan®-mediated cross-linking of CD20.
Cragg M S et al. (2005) Curr Dir Autoimmun, 8:140-174 disclose the results of testing the effect of cholesterol depletion (with MCD) and cholesterol enrichment, respectively, on the binding affinity of various anti-CD20 antibodies, including the FMC7 antibody. The authors conclude that the effect of cholesterol depletion is dependent on the particular antibody and cell line used, some of the antibodies being relatively unaffected. FMC7 is the most sensitive. In the experiment loading the cells with cholesterol prior to antibody binding only FMC7 shows a positive effect.
The present invention provides new regimens for antibodies targeting multiple membrane spanning antigens or antigens which form dimers or multimers based on the finding that depletion of cholesterol decreases effector function induced by anti-CD20 antibodies, whereas enrichment with cholesterol increases effector function. By increasing the serum cholesterol the effector function induced by the antibodies will increase thereby resulting in a higher efficacy of the antibodies. The invention will therefore be useful for therapeutic antibodies capable of mediating effector function which specifically bind to multiple membrane spanning antigens or antigens which form dimers or multimers, and wherein effector function is significantly or mainly contributing to the therapeutic effect.
Other features and advantages of the instant invention will be apparent from the following detailed description and examples which should not be construed as limiting.
The terms “CD20” and “CD20 antigen” are used interchangeably herein, and include any variants, isoforms and species homologs of human CD20, which are naturally expressed by cells or are expressed on cells transfected with the CD20 gene. Synonyms of CD20, as recognized in the art, include B-lymphocyte surface antigen B1, Leu-16 and Bp35. Human CD20 has UniProtKB/Swiss-Prot entry P11836.
The term “immunoglobulin” as used herein refers to a class of structurally related glycoproteins consisting of two pairs of polypeptide chains, one pair of light (L) low molecular weight chains and one pair of heavy (H) chains, all four inter-connected by disulfide bonds. The structure of immunoglobulins has been well characterized. See for instance Fundamental Immunology Ch. 7 (Paul, W., ed., 2nd ed. Raven Press, N.Y. (1989)). Briefly, each heavy chain typically is comprised of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region. The heavy chain constant region, CH, typically is comprised of three domains, CH1, CH2, and CH3. Each light chain typically is comprised of a light chain variable region (abbreviated herein as VL) and a light chain constant region. The light chain constant region typically is comprised of one domain, CL. The VH and VL regions may be further subdivided into regions of hypervariability (or hypervariable regions which may be hypervariable in sequence and/or form of structurally defined loops), also termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FRs).
Each VH and VL is typically composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4 (see also Chothia and Lesk J. Mol. Biol. 196, 901-917 (1987)). Typically, the numbering of amino acid residues in this region is performed by the method described in Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991) (phrases, such as variable domain residue numbering as in Kabat or according to Kabat herein refer to this numbering system for heavy chain variable domains or light chain variable domains). Using this numbering system, the actual linear amino acid sequence of a peptide may contain fewer or additional amino acids corresponding to a shortening of, or insertion into, a FR or CDR of the variable domain. For example, a heavy chain variable domain may include a single amino acid insert (for instance residue 52a according to Kabat) after residue 52 of VH CDR2 and inserted residues (for instance residues 82a, 82 and 82c, etc. according to Kabat) after heavy chain FR residue 82. The Kabat numbering of residues may be determined for a given antibody by alignment at regions of homology of the sequence of the antibody with a “standard” Kabat numbered sequence.
The term “antibody” as used herein refers to an immunoglobulin molecule, a fragment of an immunoglobulin molecule, or a derivative of either thereof, which has the ability to specifically bind to an antigen under typical physiological conditions for a significant period of time, such as at least about 30 minutes, at least about 45 minutes, at least about one hour, at least about two hours, at least about four hours, at least about 8 hours, at least about 12 hours, about 24 hours or more, about 48 hours or more, about 3, 4, 5, 6, 7 or more days, etc., or any other relevant functionally-defined period (such as a time sufficient to induce, promote, enhance, and/or modulate a physiological response associated with antibody binding to the antigen and/or a time sufficient for the antibody to recruit an Fc-mediated effector activity).
The term “anti-CD20 antibody” as used herein refer to any molecule that specifically binds to a portion of CD20 under cellular and/or physiological conditions for an amount of time sufficient to inhibit the activity of CD20 expressing cells and/or otherwise modulate a physiological effect associated with CD20; to allow detection by ELISA, western blot, or other similarly suitable binding technique described herein and/or known in the art and/or to otherwise be detectably bound thereto after a relevant period of time (for instance at least about 15 minutes, such as at least about 30 minutes, at least about 45 minutes, at least about 1 hour, at least about 2 hours, at least about 4 hours, at least about 6 hours, at least about 12 hours, such as about 1-24 hours, about 1-36 hours, about 1-48 hours, about 1-72 hours, about one week, or longer).
The variable regions of the heavy and light chains of the immunoglobulin molecule contain a binding domain that interacts with an antigen. The constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (such as effector cells) and components of the complement system such as C1q, the first component in the classical pathway of complement activation.
The antibody may be mono-, bi- or multispecific.
As indicated above, the term “antibody” as used herein, unless otherwise stated or clearly contradicted by the context, includes fragments of an antibody provided by any known technique, such as enzymatic cleavage, peptide synthesis and recombinant techniques that retain the ability to specifically bind to an antigen. It has been shown that the antigen-binding function of an antibody may be performed by fragments of a full-length (intact) antibody. Examples of antigen-binding fragments encompassed within the term “antibody” include, but are not limited to (i) a Fab fragment, a monovalent fragment consisting of the V1, VH, CL and CH1 domains; (ii) F(ab)2 and F(ab′)2 fragments, bivalent fragments comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting essentially of the VH and CH1 domains; (iv) a Fv fragment consisting essentially of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment (Ward et al., Nature 341, 544-546 (1989)), which consists essentially of a VH domain and also called domain antibodies (Holt et al. (November 2003) Trends Biotechnol. 21(11):484-90); (vi) a camelid antibody or nanobody (Revets et al. (January 2005) Expert Opin Biol Ther. 5(1):111-24), (vii) an isolated complementarity determining region (CDR), such as a VH CDR3, (viii) a UniBody® molecule, a monovalent antibody as disclosed in WO 2007/059782, (ix) a single chain antibody or single chain Fv (scFv), see for instance Bird et al., Science 242, 423-426 (1988) and Huston et al., PNAS USA 85, 5879-5883 (1988)), (x) a diabody (a scFv dimer), which can be monospecific or bispecific (see for instance PNAS USA 90(14), 6444-6448 (1993), EP 404097 or WO 93/11161 for a description of diabodies), a triabody or a tetrabody.
Although such fragments are generally included within the definition of an antibody, they collectively and each independently are unique features of the present invention, exhibiting different biological properties and utility. These and other useful antibody fragments in the context of the present invention are discussed further herein.
As used herein, “specific binding” refers to the binding of a binding molecule, such as a full-length antibody or an antigen-binding fragment thereof, to a predetermined antigen. Typically, the antibody binds with an affinity corresponding to a KD of about 10−7 M or less, such as about 10−8 M or less, such as about 10−9 M or less, about 10−10 M or less, or about 10−11 M or even less, when measured for instance using sulfon plasmon resonance on BIAcore or as apparent affinities based on IC50 values in FACS or ELISA, and binds to the predetermined antigen with an affinity corresponding to a KD that is at least ten-fold lower, such as at least 100 fold lower, for instance at least 1000 fold lower, such as at least 10,000 fold lower, for instance at least 100,000 fold lower than its affinity for binding to a non-specific antigen (e.g., BSA, casein) other than the predetermined antigen or a closely-related antigen. When the KD of the antigen binding peptide is very low (that is, the antigen binding peptide is highly specific), then the affinity for the antigen may be at least 10,000 or 100,000 fold lower than the affinity for a non-specific antigen.
It should be understood that the term antibody generally includes monoclonal antibodies as well as polyclonal antibodies. The antibodies can be human, humanized, chimeric, murine, etc. An antibody as generated can possess any isotype.
The term “human antibody”, as used herein, is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences. The human antibodies of the present invention may include amino acid residues not encoded by human germline immunoglobulin sequences (for instance mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo). However, the term “human antibody”, as used herein, is not intended to include antibodies in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted into human framework sequences:
As used herein, a human antibody is “derived from” a particular germline sequence if the antibody is obtained from a system using human immunoglobulin sequences, for instance by immunizing a transgenic mouse carrying human immunoglobulin genes or by screening a human immunoglobulin gene library, and wherein the selected human antibody is at least 90%, such as at least 95%, for instance at least 96%, such as at least 97%, for instance at least 98%, or such as at least 99% identical in amino acid sequence to the amino acid sequence encoded by the germline immunoglobulin gene. Typically, a human antibody derived from a particular human germline sequence will display no more than 10 amino acid differences, such as no more than 5, for instance no more than 4, 3, 2, or 1 amino acid difference from the amino acid sequence encoded by the germline immunoglobulin gene. For VH antibody sequences the VH CDR3 domain is not included in such comparison.
The term “chimeric antibody” refers to an antibody that contains one or more regions from one antibody and one or more regions from one or more other antibodies. The term “chimeric antibody” includes monovalent, divalent, or polyvalent antibodies. A monovalent chimeric antibody is a dimer (HL) formed by a chimeric H chain associated through disulfide bridges with a chimeric L chain. A divalent chimeric antibody is a tetramer (H2L2) formed by two HL dimers associated through at least one disulfide bridge. A polyvalent chimeric antibody may also be produced, for example, by employing a CH region that assembles into a molecule with 2+ binding sites (for instance from an IgM H chain, or μ chain). Typically, a chimeric antibody refers to an antibody in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (see for instance U.S. Pat. No. 4,816,567 and Morrison et al., PNAS USA 81, 6851-6855 (1984)). Chimeric antibodies are produced by recombinant processes well known in the art (see for instance Cabilly et al., PNAS USA 81, 3273-3277 (1984), Morrison et al., PNAS USA 81, 6851-6855 (1984), Boulianne et al., Nature 312, 643-646 (1984), EP125023, Neuberger et al., Nature 314, 268-270 (1985), EP171496, EP173494, WO 86/01533, EP184187, Sahagan et al., J. Immunol. 137, 1066-1074 (1986), WO 87/02671, Liu et al., PNAS USA 84, 3439-3443 (1987), Sun et al., PNAS USA 84, 214-218 (1987), Better et al., Science 240, 1041-1043 (1988) and Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., (1988)).
The term “humanized antibody” refers to a human antibody which contains minimal sequences derived from a non-human antibody. Typically, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a hypervariable region of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody), such as mouse, rat, rabbit or non-human primate having the desired specificity, affinity, and capacity.
Furthermore, humanized antibodies may comprise residues which are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance. In general, a humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin sequence. A humanized antibody optionally also will comprise at least a portion of a human immunoglobulin constant region. For further details, see Jones et al., Nature 321, 522-525 (1986), Riechmann et al., Nature 332, 323-329 (1988) and Presta, Curr. Op. Struct. Biol. 2, 593-596 (1992).
The terms “monoclonal antibody” or “monoclonal antibody composition” as used herein refer to a preparation of antibody molecules of single molecular composition. A monoclonal antibody composition displays a single binding specificity and affinity for a particular epitope. Accordingly, the term “human monoclonal antibody” refers to antibodies displaying a single binding specificity which have variable and constant regions derived from human germline immunoglobulin sequences. The human monoclonal antibodies may be generated by a hybridoma which includes a B cell obtained from a transgenic or transchromosomal nonhuman animal, such as a transgenic mouse, having a genome comprising a human heavy chain transgene and a light chain transgene, fused to an immortalized cell.
The term “recombinant human antibody”, as used herein, includes all human antibodies that are prepared, expressed, created or isolated by recombinant means, such as (a) antibodies isolated from an animal (such as a mouse) that is transgenic or transchromosomal for human immunoglobulin genes or a hybridoma prepared therefrom (described further elsewhere herein), (b) antibodies isolated from a host cell transformed to express the antibody, such as from a transfectoma, (c) antibodies isolated from a recombinant, combinatorial human antibody library, and (d) antibodies prepared, expressed, created or isolated by any other means that involve splicing of human immunoglobulin gene sequences to other DNA sequences. Such recombinant human antibodies have variable and constant regions derived from human germline immunoglobulin sequences. In certain embodiments, however, such recombinant human antibodies may be subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and thus the amino acid sequences of the VH and VL regions of the recombinant antibodies are sequences that, while derived from and related to human germline VH and VL sequences, may not naturally exist within the human antibody germline repertoire in vivo.
The terms “transgenic, non-human animal” refers to a non-human animal having a genome comprising one or more human heavy and/or light chain transgenes or transchromosomes (either integrated or non-integrated into the animal's natural genomic DNA) and which is capable of expressing fully human antibodies. For example, a transgenic mouse can have a human light chain transgene and either a human heavy chain transgene or human heavy chain transchromosome, such that the mouse produces human anti-CD20 antibodies when immunized with CD20 antigen and/or cells expressing CD20. The human heavy chain transgene may be integrated into the chromosomal DNA of the mouse, as is the case for transgenic mice, for instance the HuMAb-Mouse®, such as HCo7 or HCo12 mice as described in in detail in Taylor L et al. (1992) Nucleic Acids Research 20:6287-6295; Chen 7 et al. (1993) International Immunology 5:647-656; Tuaillon et al. (1994) J. Immunol. 152:2912-2920; Lonberg N et al. (1994) Nature 368(6474):856-859; Lonberg N (1994) Handbook of Experimental Pharmacology 113:49-101; Taylor L et al. (1994) International Immunology 6: 579-591; Lonberg N and Huszar D (1995) Intern. Rev. Immunol. Vol. 13:65-93; Harding F and Lonberg N (1995) Ann. N.Y. Acad. Sci 764:536-546; Fishwild D et al. (1996) Nature Biotechnology 14:845-851. See further, U.S. Pat. Nos. 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,789,650; 5,877,397; 5,661,016; 5,814,318; 5,874,299; and 5,770,429; all to Lonberg and Kay, as well as U.S. Pat. No. 5,545,807 to Surani et al.; WO 98/24884, WO 94/25585, WO 93/1227, WO 92/22645, WO 92/03918 and WO 01/09187, or the human heavy chain transgene may be maintained extrachromosomally, as is the case for the transchromosomal KM-Mouse® as described in WO 02/43478. Such transgenic and transchromosomal mice (collectively referred to herein as “transgenic mice”) are capable of producing multiple isotypes of human monoclonal antibodies to a given antigen (such as IgG, IgA, IgM, IgD and/or IgE) by undergoing V-D-J recombination and isotype switching. Transgenic, nonhuman animals can also be used for production of antibodies against a specific antigen by introducing genes encoding such specific antibody, for example by operatively linking the genes to a gene which is expressed in the milk of the animal.
The term “treatment” as used herein means the administration of an effective amount of a therapeutically active compound of the present invention with the purpose of easing, ameliorating, arresting, or eradicating (curing) symptoms or disease states.
In one aspect the invention relates to the use of an antibody capable of mediating effector function which specifically binds to a multiple membrane spanning antigen or to an antigen which forms dimers or multimers for the preparation of a medicament for administration in combination with a cholesterol-increasing agent for the treatment of a disease or disorder associated with said antigen, wherein antibody-induced effector function has a beneficial effect on said disease or disorder.
In one embodiment thereof, the cholesterol-increasing agent is administered prior to administration of the antibody.
In another embodiment thereof, the cholesterol-increasing agent is administered in a regimen starting at least 7 days, such as 14 days, 30 days, 45 days, 60 days or 90 days prior to the first administration of the antibody and ending at least 7 days, such as 14 days, 30 days, 45 days, 60 days or 90 days after the last administration of the antibody in a regimen.
In one aspect the invention relates to the use of an antibody capable of mediating effector function which specifically binds to a multiple membrane spanning antigen or to an antigen which forms dimers or multimers for the preparation of a medicament for the treatment of a disease or disorder associated with said antigen, wherein antibody-induced effector function has a beneficial effect on said disease or disorder, wherein the medicament is to be administered to a subject undergoing therapy with a cholesterol-lowering agent, such as a statin, and wherein the subject is withdrawn from treatment with the cholesterol-lowering agent prior to the administration of the antibody.
In one embodiment thereof the subject is withdrawn from treatment with the cholesterol-lowering agent for a period of from at least 7 days, such as 14 days, 30 days, 45 days, 60 days or 90 days prior to the first administration of the antibody until at least 7 days, such as 14 days, 30 days, 45 days, 60 days or 90 days after the last administration of the antibody in a regimen.
In one embodiment of the invention, the antibody is a monoclonal antibody, such as a human monoclonal antibody. The antibody may be a full-length antibody, such as a full-length IgG1 antibody, or an antibody fragment retaining binding specificity to the antigen, such as a scFv or a UniBody® molecule (a monovalent antibody as disclosed in WO 2007/059782).
In one embodiment of the invention, the cholesterol-increasing agent is selected from a cholesterol rich diet; cholesterol; retinoids, such as retinoic acid (vitamin A), bexarotene (Targretin®), and isotretinoin (Roaccutane®); cholecalciferol (vitamin D3); and ergocalciferol (vitamin D2).
In one embodiment of the invention, the antibody medicament is suitable for intravenous, intraperitoneal, inhalation, intrabronchial, intraalveolar, intramuscular, subcutaneous or oral administration, such as intravenous injection or infusion.
In one embodiment of the invention, the antibody medicament is suitable for administration of the antibody in an amount of from 10-2000 mg.
In one embodiment of the invention, the antibody specifically binds to a multiple membrane spanning antigen selected from G protein coupled receptors (GPCRs), such as LGR4, LGR7, GPR49 and CCR5; tetraspannins, such as Tspan6 (TM4SF6), CD9, CD53, CD63, CD81, CD82, CD151 and NAG-2; MS4A gene family, such as CD20; ATP-binding casette (ABC) transporters; multi-drug resistance associated proteins, such as P-glycoprotein (MDR-1), MRP-1, lung resistance-related protein (LRP), breast cancer resistance protein (BCRP/MXR) and drug resistance-associated protein (DRP); ATP-binding cassette protein (ABCP); TDE1; and ion channel receptors, such as voltage-gated ion channels.
In one embodiment of the invention, the antibody specifically binds to an antigen which forms dimers or multimers selected from receptor tyrosine kinases, such as the ErbB protein family, for example Erb-B1 (EGFR), Erb-B2 (HER2), erb-B3 (HER3), and erb-B4 (HER4); the insulin receptor; the PDGF receptor family, for example PDGF-A, -B, -C and -D; the FGF receptor family, for example FGFR1, FGFR2, FGFR3 and FGFR4; the VEGF receptor family, for example VEGF-A; VEGF-B; VEGF-C and VEGF-D; c-Met; the EPH receptor family, for example EPHA1, EPHA2, EPHA3, EPHA4, EPHA5, EPHA6, EPHA7, EPHA8, EPHA9, EPHA10 and EPHB1; ephrins, such as ephrin-A1, ephrin-A2, ephrin-A3, ephrin-A4, ephrin-A5, ephrin-A6, ephrin-B1, ephrin-B2 and ephrin-B3; angiopoietin receptors, such as Tie-1 and Tie-2; Toll-like receptors, such as TLR-3 and TLR-9; the insulin-like growth factor 1 (IGF-1) receptor; angiopoietins, such as angiopoietin-1 and angiopoietin-2; and cytokine receptors, such as the TNF receptor family, for example CD30, CD40, p55, p75 and Fas; and the interferon receptor family, for example CD118 and CD119.
In one embodiment of the invention, the antibody specifically binds to CD20.
In one embodiment thereof, the antibody against CD20 binds to mutant P172S CD20 (proline at position 172 mutated to serine) with at least the same affinity as to human CD20.
In one embodiment thereof, the antibody against CD20 binds to an epitope on CD20
In one embodiment thereof, the antibody against CD20 has one or more of the following characteristics:
In one embodiment thereof, the antibody against CD20 binds to a discontinuous epitope on CD20, wherein the epitope comprises part of the first small extracellular loop and part of the second extracellular loop.
In one embodiment thereof, the antibody against CD20 binds to a discontinuous epitope on CD20, wherein the epitope has residues AGIYAP of the small first extracellular loop and residues MESLNFIRAHTPYI of the second extracellular loop.
In one embodiment thereof, the antibody against CD20 comprises a VH CDR3 sequence selected from SEQ ID NOs: 5, 9, and 11.
In one embodiment of the invention, the antibody against CD20 comprises a VH CDR1 of SEQ ID NO:3, a VH CDR2 of SEQ ID NO:4, a VH CDR3 of SEQ ID NO:5, a VL CDR1 of SEQ ID NO:6, a VL CDR2 of SEQ ID NO:7 and a VL CDR3 sequence of SEQ ID NO:8.
In one embodiment thereof, the antibody against CD20 comprises a VH CDR1-CDR3 spanning sequence of SEQ ID NO:10.
In one embodiment thereof, the antibody against CD20 has human heavy chain and human light chain variable regions comprising the amino acid sequences as set forth in SEQ ID NO:1 and SEQ ID NO:2, respectively; or amino acid sequences which are at least 95% homologous, and more preferably at least 98%, or at least 99% homologous to the amino acid sequences as set forth in SEQ ID NO:1 and SEQ ID NO:2, respectively.
In one embodiment of the invention the CD20 binding molecule is selected from one of the anti-CD20 antibodies disclosed in WO 2004/035607, such as ofatumumab (2F2), 11B8, or 7D8, one of the antibodies disclosed in WO 2005/103081, such as 2C6, one of the antibodies disclosed in WO 2004/103404, AME-133 (humanized and optimized anti-CD20 monoclonal antibody, developed by Applied Molecular Evolution), one of the antibodies disclosed in US 2003/0118592, TRU-015 (CytoxB20G, a small modular immunopharmaceutical fusion protein derived from key domains on an anti-CD20 antibody, developed by Trubion Pharmaceuticals Inc), one of the antibodies disclosed in WO 2003/68821, IMMU-106 (a humanized anti-CD20 monoclonal antibody), one of the antibodies disclosed in WO 2004/56312, ocrelizumab (2H7.v16, PRO-70769, R-1594), Bexxar® (tositumomab), and Rituxan®/MabThera® (rituximab).
In one embodiment thereof, the anti-CD20 antibody is selected from ofatumumab (2F2), 11B8, 7D8, 2C6, AME-133, TRU-015, IMMU-106, ocrelizumab (2H7.v16, PRO-70769, R-1594), Bexxar® (tositumomab) and Rituxan®/MabThera® (rituximab).
In a further embodiment thereof, the antibody is a tetravalent anti-CD20 antibody, such as 2F2(ScFvHL)4-Fc or C2B82F2(ScFvHL)4-Fc, as described by Guo Y et al. (2008) Cancer Res, 68(7):2400-2408.
In one embodiment thereof, the antibody against CD20 is obtained by:
In one embodiment thereof, the antibody against CD20 comprises a heavy chain variable region amino acid sequence derived from a human VH DP-44/D3-10/JH6b germline sequence (SEQ ID NO:12) and a light chain variable region amino acid sequence derived from a human VL L6/JK4 (SEQ ID NO:13) germline sequence; or a heavy chain variable region amino acid sequence derived from a human VH 3-09/D4-11/JH6b germline sequence (SEQ ID NO:14) and a light chain variable region amino acid sequence derived from a human VL L6/JK5 germline sequence (SEQ ID NO:15), wherein the human antibody specifically binds to CD20.
In one embodiment of the invention, the antibody specifically binds to CD20 as defined in any of the above embodiments, and the disease is selected from B cell lymphoma, B cell leukemia or an autoimmune disease, such as follicular lymphoma (FL), chronic lymphocytic leukemia (CLL), diffuse large B-cell lymphoma (DLBCL), rheumatoid arthritis (RA), systemic lupus erythematosus (SLE), multiple sclerosis (MS), Sjögren's syndrome (SS), and chronic obstructive pulmonary disease (COPD).
In one embodiment of the invention, the antibody specifically binds to CD20 as defined in any of the above embodiments, and the disease is Waldenström's macroglobulinemia.
In one embodiment of the invention, the antibody specifically binds to CCR5.
In one embodiment of the invention, the antibody specifically binds to CCR5, and the disease is selected from inflammatory diseases or HIV-1 infection.
In one embodiment of the invention, the antibody specifically binds to Tspan6.
In one embodiment of the invention, the antibody specifically binds to Tspan6, and the disease is selected from non-steroid dependent cancers, such as colon cancer.
In one embodiment of the invention, the antibody specifically binds to GPR49.
In one embodiment of the invention, the antibody specifically binds to GPR49, and the disease is colorectal cancer.
In one embodiment of the invention, the treatment further comprises one or more further therapeutic agents selected from
anti-inflammatory agents, such as aspirin and other salicylates, Cox-2 inhibitors, such as rofecoxib (Vioxx) and celecoxib (Celebrex), a steroidal drug, or a NSAID (nonsteroidal anti-inflammatory drug), such as ibuprofen (Motrin, Advil), fenoprofen (Nalfon), naproxen (Naprosyn), sulindac (Clinoril), diclofenac (Voltaren), piroxicam (Feldene), ketoprofen (Orudis), diflunisal (Dolobid), nabumetone (Relafen), etodolac (Lodine), oxaprozin (Daypro), and indomethacin (Indocin);
immunosuppressive agents, such as cyclosporine (Sandimmune, Neoral) and azathioprine (Imural);
DMARDs, such as methotrexate (Rheumatrex), hydroxychloroquine (Plaquenil), sulfasalazine (Asulfidine), pyrimidine synthesis inhibitors, e.g., leflunomide (Arava), IL-1 receptor blocking agents, e.g., anakinra (Kineret), and TNF-α blocking agents, e.g., etanercept (Enbrel), infliximab (Remicade) and adalimumab;
chemotherapeutics, such as doxorubicin (Adriamycin), cisplatin (Platinol), bleomycin (Blenoxane), carmustine (Gliadel), cyclophosphamide (Cytoxan, Procytox, Neosar), and chlorambucil (Leukeran).
In one embodiment of the invention, the treatment further comprises a combination with chlorambucil and prednisolone; cyclophosphamide and prednisolone; cyclophosphamide, vincristine, and prednisone; cyclophosphamide, vincristine, doxorubicin, and prednisone; fludarabine and anthracycline; or a combination with other common multi-drugs regimens for NHL, such as disclosed, e.g., in Non-Hodgkin's Lymphomas: Making sense of Diagnosis, Treatment, and Options, Lorraine Johnston, 1999, O'Reilly and Associates, Inc.
In one embodiment of the invention, the treatment further comprises combination with one or more antibodies, targeting the same or different antigen(s).
In one embodiment of the invention, the treatment further comprises radiotherapy and/or autologous peripheral stem cell or bone marrow transplantation. Such treatment may further be combined with one or more therapeuticatic agents, such as those mentioned above.
In one embodiment of the invention, the antibody is capable of mediating CDC, and the antibody-induced CDC has a beneficial effect on the disease or disorder to be treated.
In one embodiment of the invention, the antibody is capable of mediating ADCC, and the antibody-induced ADCC has a beneficial effect on the disease or disorder to be treated.
In one aspect the invention relates to an antibody capable of mediating effector function which specifically binds to a multiple membrane spanning antigen or to an antigen which forms dimers or multimers for use in combination with a cholesterol-increasing agent in the treatment of a disease or disorder associated with said antigen, wherein antibody-induced effector function has a beneficial effect on said disease or disorder.
Further embodiments thereof comprise one or more of the above feature(s).
In one aspect the invention relates to an antibody capable of mediating effector function which specifically binds to a multiple membrane spanning antigen or an to antigen which forms dimers or multimers for use in the treatment of a disease or disorder associated with said antigen, wherein antibody-induced effector function has a beneficial effect on said disease or disorder, wherein the antibody is to be administered to a subject undergoing therapy with a cholesterol-lowering agent, such as a statin, wherein the subject is withdrawn from treatment with the cholesterol-lowering agent prior to the administration of the antibody.
Further embodiments thereof comprise one or more of the above feature(s).
In one aspect the invention relates to a method of treating a disease or disorder, wherein antibody-induced effector function has a beneficial effect, by administering to a subject in need thereof an antibody capable of mediating effector function which specifically binds to a multiple membrane spanning antigen or to an antigen which forms dimers or multimers, which antigen is associated with said disease or disorder, in combination with a cholesterol-increasing agent.
Further embodiments thereof comprise one or more of the above feature(s).
In one aspect the invention relates to a method of treating a disease or disorder, wherein antibody-induced effector function has a beneficial effect, by administering to a subject in need thereof undergoing therapy with a cholesterol-lowering agent, such as a statin, an antibody capable of mediating effector function which specifically binds to a multiple membrane spanning antigen or to an antigen which forms dimers or multimers, which antigen is associated with said disease or disorder, and wherein the subject is withdrawn from treatment with the cholesterol-lowering agent prior to the treatment with the antibody.
Further embodiments thereof comprise one or more of the above feature(s).
In one aspect the invention relates to the use of a cholesterol-increasing agent for the preparation of a medicament for administration in combination with an antibody capable of mediating effector function which specifically binds to a multiple membrane spanning antigen or to an antigen which forms dimers or multimers for the treatment of a disease or disorder associated with said antigen, wherein antibody-induced effector function has a beneficial effect on said disease or disorder.
Further embodiments thereof comprise one or more of the above feature(s).
In one aspect the invention relates to a cholesterol-increasing agent for use in combination with antibody capable of mediating effector function which specifically binds to a multiple membrane spanning antigen or to an antigen which forms dimers or multimers in the treatment of a disease or disorder associated with said antigen, wherein antibody-induced effector function has a beneficial effect on said disease or disorder.
Further embodiments thereof comprise one or more of the above feature(s).
In one aspect the invention relates to a kit of parts comprising
(a) an antibody capable of mediating effector function which specifically binds to a multiple membrane spanning antigen or to an antigen which forms dimers or multimers,
(b) a cholesterol-increasing agent,
wherein components (a) and (b) are each provided in a form, which may be the same or different, that is suitable for administration in conjunction with each other.
In one embodiment thereof components (a) and (b) are suitable for sequential, separate and/or simultaneous administration, such as for administration as defined above.
In one embodiment thereof component (a) is as defined in any one of the above embodiments.
In one embodiment thereof component (b) is as defined in any one of the above embodiments.
In one embodiment thereof, the kit of parts as defined in any one of the above embodiments is for use in medical therapy, such as for use in the treatment of a disease or disorder associated with the antigen to which component (a) specifically binds, wherein antibody-induced effector function has a beneficial effect on said disease or disorder.
In one embodiment thereof, component (a) is:
(i) an antibody specifically binding to CD20, such as defined in any one of the above embodiments, and the disease or disorder is selected from B cell lymphoma, B cell leukemia or an an autoimmune disease, such as follicular lymphoma (FL), chronic lymphocytic leukemia (CLL), diffuse large B-cell lymphoma (DLBCL), rheumatoid arthritis (RA), systemic lupus erythematosus (SLE), multiple sclerosis (MS), Sjögren's syndrome (SS), and chronic obstructive pulmonary disease (COPD),
(ii) an antibody specifically binding to CCR5, and the disease or disorder is selected from inflammatory diseases and HIV-1 infection,
(iii) an antibody specifically binding to Tspan6, and the disease or disorder is selected from non-steroid dependent cancers, such as colon cancer, or
(iv) an antibody specifically binding to GPR49, and the disease or disorder is colorectal cancer.
In another embodiment thereof, component (a) is an antibody specifically binding to CD20, and the disease or disorder is Waldenström's macroglobulinemia.
In a particular embodiment, the antibody is an anti-CD20 antibody which is used to treat or to prevent B cell lymphoma, e.g. non-Hodgkin's lymphoma (NHL), as the antibodies deplete the CD20 bearing tumor cells. CD20 is usually expressed at elevated levels on neoplastic (i.e., tumorigenic) B cells associated with NHL. Accordingly, CD20 binding antibodies of the invention can be used to deplete CD20 bearing tumor cells which lead to NHL and, thus, can be used to prevent or treat this disease.
Non-Hodgkin's lymphoma is a type of B cell lymphoma. Lymphomas, e.g., B cell lymphomas, are a group of related cancers that arise when a lymphocyte (a blood cell) becomes malignant. The normal function of lymphocytes is to defend the body against invaders: germs, viruses, fungi, even cancer. There are many subtypes and maturation stages of lymphocytes and, therefore, there are many kinds of lymphomas. Like normal cells, malignant lymphocytes can move to many parts of the body. Typically, lymphoma cells form tumors in the lymphatic system: bone marrow, lymph nodes, spleen, and blood. However, these cells can migrate to other organs. Certain types of lymphoma will tend to grow in locations in which the normal version of the cell resides. For example, it is common for follicular NHL tumors to develop in the lymph nodes.
Examples of non-Hodgkin's lymphoma (NHL) include precursor B cell lymphoblastic leukemia/lymphoma and mature B cell neoplasms, such as B cell chronic lymhocytic leukemia (CLL)/small lymphocytic lymphoma (SLL), B cell prolymphocytic leukemia, lymphoplasmacytic lymphoma, mantle cell lymphoma (MCL), follicular lymphoma (FL), including low-grade, intermediate-grade and high-grade FL, cutaneous follicle center lymphoma, marginal zone B cell lymphoma (MALT type, nodal and splenic type), hairy cell leukemia, diffuse large B-cell lymphoma (DLBCL), Burkitt's lymphoma, plasmacytoma, plasma cell myeloma, post-transplant lymphoproliferative disorder, Waldenström's macroglobulinemia, anaplastic large-cell lymphoma (ALCL), lymphomatoid granulomatosis, primary effusion lymphoma, intravascular large B cell lymphoma, mediastinal large B cell lymphoma, heavy chain diseases (including γ, μ, and α disease), lymphomas induced by therapy with immunosuppressive agents, such as cyclosporine-induced lymphoma, and methotrexate-induced lymphoma.
In one embodiment the disease is follicular lymphoma (FL). In another embodiment the disease is lymhocytic leukemia (CLL)/small lymphocytic lymphoma (SLL). In yet another embodiment the disease is diffuse large B-cell lymphoma (DLBCL).
In a further embodiment, the human antibodies of the present invention can be used to treat Hodgkin's lymphoma.
Human antibodies (e.g., human monoclonal antibodies, multispecific and bispecific molecules) of the present invention also can be used to block or inhibit other effects of CD20. For example, it is known that CD20 is expressed on B lymphocytes and is involved in the proliferation and/or differentiation of these cells. Since B lymphocytes function as immunomodulators, CD20 is an important target for antibody mediated therapy to target B lymphocytes, e.g., to inactivate or kill B lymphocytes, involved in immune, autoimmune, inflammatory or infectious disease or disorder involving human CD20 expressing cells.
Examples of diseases and disorders in which CD20 expressing B cells are involved and which can be treated and/or prevented include immune, autoimmune, inflammatory and infectious diseases and disorders, such as psoriasis, psoriatic arthritis, dermatitis, systemic sclerosis, inflammatory bowel disease (IBD), Crohn's disease, ulcerative colitis, respiratory distress syndrome, meningitis, encephalitis, uveitis, glomerulonephritis, eczema, asthma, atherosclerosis, leukocyte adhesion deficiency, multiple sclerosis (MS), Raynaud's syndrome, Sjögren's syndrome (SS), juvenile onset diabetes, Reiter's disease, Behçet's disease, immune complex nephritis, IgA nephropathy, IgM polyneuropathies, immune-mediated thrombocytopenias, such as acute idiopathic thrombocytopenic purpura and chronic idiopathic thrombocytopenic purpura, hemolytic anemia, myasthenia gravis, lupus nephritis, systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), atopic dermatitis, pemphigus, Graves' disease, severe acute respiratory distress syndrome, choreoretinitis. Hashimoto's thyroiditis, Wegener's granulomatosis, Omenn's syndrome, chronic renal failure, acute infectious mononucleosis, HIV, herpes virus associated diseases, as well as diseases and disorders caused by or mediated by infection of B cells with virus, such as Epstein-Barr virus (EBV).
Further examples of inflammatory, immune and/or autoimmune disorders in which autoantibodies and/or excessive B lymphocyte activity are prominent and which can be treated and/or prevented, include the following:
vasculitides and other vessel disorders, such as microscopic polyangiitis, Churg-Strauss syndrome, and other ANCA-associated vasculitides, polyarteritis nodosa, essential cryoglobulinaemic vasculitis, cutaneous leukocytoclastic angiitis, Kawasaki disease, Takayasu arteritis, giant cell arthritis, Henoch-Schönlein purpura, primary or isolated cerebral angiitis, erythema nodosum, thrombangiitis obliterans, thrombotic thrombocytopenic purpura (including hemolytic uremic syndrome), and secondary vasculitides, including cutaneous leukocytoclastic vasculitis (e.g., secondary to hepatitis B, hepatitis C, Waldenström's macroglobulinemia, B cell neoplasias, rheumatoid arthritis (RA), Sjögren's syndrome (SS), and systemic lupus erythematosus (SLE)), erythema nodosum, allergic vasculitis, panniculitis, Weber-Christian disease, purpura hyperglobulinaemica, and Buerger's disease;
skin disorders, such as contact dermatitis, linear IgA dermatosis, vitiligo, pyoderma gangrenosum, epidermolysis bullosa acquisita, pemphigus vulgaris (including cicatricial pemphigoid and bullous pemphigoid), alopecia areata (including alopecia universalis and alopecia totalis), dermatitis herpetiformis, erythema multiforme, and chronic autoimmune urticaria (including angioneurotic edema and urticarial vasculitis);
immune-mediated cytopenias, such as autoimmune neutropenia, and pure red cell aplasia;
connective tissue disorders, such as CNS lupus, discoid lupus erythematosus, CREST syndrome, mixed connective tissue disease, polymyositis/dermatomyositis, inclusion body myositis, secondary amyloidosis, cryoglobulinemia type I and type II, fibromyalgia, phospholipid antibody syndrome, secondary hemophilia, relapsing polychondritis, sarcoidosis, stiff man syndrome, rheumatic fever, and eosinophil fasciitis;
arthritides, such as ankylosing spondylitis, juvenile chronic arthritis, adult Still's disease, SAPHO syndrome, sacroileitis, reactive arthritis, Still's disease, and gout;
hematologic disorders, such as aplastic anemia, primary hemolytic anemia (including cold agglutinin syndrome), hemolytic anemia with warm autoantibodies, hemolytic anemia secondary to CLL or systemic lupus erythematosus (SLE); POEMS syndrome, pernicious anemia, Waldemström's purpura hyperglobulinaemica, Evans syndrome, agranulocytosis, autoimmune neutropenia, Franklin's disease, Seligmann's disease, μ-chain disease, factor VIII inhibitor formation, factor IX inhibitor formation, and paraneoplastic syndrome secondary to thymoma and lymphomas;
endocrinopathies, such as polyendocrinopathy, and Addison's disease; further examples are autoimmune hypoglycemia, autoimmune hypothyroidism, autoimmune insulin syndrome, de Quervain's thyroiditis, and insulin receptor antibody-mediated insulin resistance;
hepato-gastrointestinal disorders, such as celiac disease, Whipple's disease, primary biliary cirrhosis, chronic active hepatitis, primary sclerosing cholangiitis, and autoimmune gastritis;
nephropathies, such as rapid progressive glomerulonephritis, post-streptococcal nephritis, Goodpasture's syndrome, membranous glomerulonephritis, cryoglobulinemic nephritis, minimal change disease, and steroid-dependent nephritic syndrome;
neurological disorders, such as autoimmune neuropathies, mononeuritis multiplex, Lambert-Eaton's myasthenic syndrome, Sydenham's chorea, tabes dorsalis, and Guillain-Barré's syndrome; further examples are myelopathy/tropical spastic paraparesis, myasthenia gravis, acute inflammatory demyelinating polyneuropathy, and chronic inflammatory demyelinating polyneuropathy;
cardiac and pulmonary disorders, such as fibrosing alveolitis, bronchiolitis obliterans, allergic aspergillosis, cystic fibrosis, Löffler's syndrome, myocarditis, and pericarditis; further examples are hypersensitivity pneumonitis, and paraneoplastic syndrome secondary to lung cancer;
allergic disorders, such as bronchial asthma, hyper-IgE syndrome, and angioneurotic syndrome;
ophthalmologic disorders, such as idiopathic chorioretinitis, and amaurosis fugax; infectious diseases, such as parvovirus B infection (including hands-and-socks syndrome);
gynecological-obstretical disorders, such as recurrent abortion, recurrent fetal loss, intrauterine growth retardation, and paraneoplastic syndrome secondary to gynaecological neoplasms;
male reproductive disorders, such as paraneoplastic syndrome secondary to testicular neoplasms; and
transplantation-derived disorders, such as allograft and xenograft rejection, and graft-versus-host disease.
In one embodiment, the disease is rheumatoid arthritis (RA).
In another embodiment, the disease is selected from inflammatory bowel disease (IBD), ulcerative colitis, Crohn's disease, juvenile onset diabetes, multiple sclerosis (MS), immune-mediated thrombocytopenias, such as acute idiopathic thrombocytopenic purpura and chronic idiopathic thrombocytopenic purpura, hemolytic anemia (including autoimmune hemolytic anemia), myasthenia gravis, systemic sclerosis, and pemphigus vulgaris.
In yet a further embodiment of the invention, the disease is selected from rheumatoid arthritis (RA), systemic lupus erythematosus (SLE), multiple sclerosis (MS), Sjögren's syndrome (SS), and chronic obstructive pulmonary disease (COPD).
In yet a further embodiment of the invention, the disease is Waldenström's macroglobulinemia.
The antibodies may be administered via any suitable route, such as an oral, nasal, inhalable, intrabronchial, intraalveolar, topical (including buccal, transdermal and sublingual), rectal, vaginal and/or parenteral route
In one embodiment, the antibody composition is administered parenterally.
The phrases “parenteral administration” and “administered parenterally” as used herein means modes of administration other than enteral and topical administration, usually by injection, and include epidermal, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, intratendinous, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, intracranial, intrathoracic, epidural and intrasternal injection and infusion.
In one embodiment, the antibody composition is administered by intravenous or subcutaneous injection or infusion. For example the pharmaceutical composition may be administered over 2-8 hours, such as 4 hours, in order to reduce side effects.
In one embodiment, the pharmaceutical composition is administered by inhalation. Fab fragments of antibodies may be suitable for such administration route, cf. Crowe et al. (Feb. 15, 1994) Proc Natl Acad Sci USA, 91(4):1386-1390.
In one embodiment, the pharmaceutical composition is administered in crystalline form by subcutaneous injection, cf. Yang et al., PNAS USA 100(12), 6934-6939 (2003).
Regardless of the route of administration selected, the antibodies, which may be used in the form of a pharmaceutically acceptable salt or in a suitable hydrated form, are formulated into pharmaceutically acceptable dosage forms by conventional methods known to those of skill in the art. A “pharmaceutically acceptable salt” refers to a salt that retains the desired biological activity of the parent compound and does not impart any undesired toxicological effects (see for instance Berge, S. M. et al., J. Pharm. Sci. 66, 1-19 (1977)). Examples of such salts include acid addition salts and base addition salts. Acid addition salts include those derived from nontoxic inorganic acids, such as hydrochloric, nitric, phosphoric, sulfuric, hydrobromic, hydroiodic, phosphorous acids and the like, as well as from nontoxic organic acids, such as aliphatic mono- and dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxy alkanoic acids, aromatic acids, aliphatic and aromatic sulfonic acids and the like. Base addition salts include those derived from alkaline earth metals, such as sodium, potassium, magnesium, calcium and the like, as well as from nontoxic organic amines, such as N,N′-dibenzylethylenediamine, N-methylglucamine, chloroprocaine, choline, diethanolamine, ethylenediamine, procaine and the like.
Pharmaceutically acceptable carriers include any and all suitable solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonicity agents, antioxidants and absorption delaying agents, and the like that are physiologically compatible with a compound of the present invention.
Examples of suitable aqueous and nonaqueous carriers which may be employed in the pharmaceutical compositions of the present invention include water, saline, phosphate buffered saline, ethanol, dextrose, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, corn oil, peanut oil, cottonseed oil, and sesame oil, carboxymethyl cellulose colloidal solutions, tragacanth gum and injectable organic esters, such as ethyl oleate, and/or various buffers. Other carriers are well known in the pharmaceutical arts.
Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. The use of such media and agents for pharmaceutically active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the pharmaceutical compositions of the present invention is contemplated.
Proper fluidity may be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
Pharmaceutical compositions containing the antibodies may also comprise pharmaceutically acceptable antioxidants for instance (1) water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.
Pharmaceutical compositions of the present invention may also comprise isotonicity agents, such as sugars, polyalcohols such as mannitol, sorbitol, glycerol or sodium chloride in the compositions.
Pharmaceutically acceptable diluents include saline and aqueous buffer solutions.
The pharmaceutical compositions containing the antibodies may also contain one or more adjuvants appropriate for the chosen route of administration, such as preservatives, wetting agents, emulsifying agents, dispersing agents, preservatives or buffers, which may enhance the shelf life or effectiveness of the pharmaceutical composition. Compounds of the present invention may for instance be admixed with lactose, sucrose, powders (e.g., starch powder), cellulose esters of alkanoic acids, stearic acid, talc, magnesium stearate, magnesium oxide, sodium and calcium salts of phosphoric and sulphuric acids, acacia, gelatin, sodium alginate, polyvinylpyrrolidine, and/or polyvinyl alcohol. Other examples of adjuvants are QS21, GM-CSF, SRL-172, histamine dihydrochloride, thymocartin, Tio-TEPA, monophosphoryl-lipid A/microbacteria compositions, alum, incomplete Freund's adjuvant, montanide ISA, ribi adjuvant system, TiterMax adjuvant, syntex adjuvant formulations, immune-stimulating complexes (ISCOMs), gerbu adjuvant, CpG oligodeoxynucleotides, lipopolysaccharide, and polyinosinic:polycytidylic acid.
Prevention of presence of microorganisms may be ensured both by sterilization procedures and by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol, sorbic acid, and the like. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption, such as aluminum monostearate and gelatin.
The pharmaceutical compositions containing the antibodies comprising a compound of the present invention may also include a suitable salt therefore. Any suitable salt, such as an alkaline earth metal salt in any suitable form (e.g., a buffer salt), may be used in the stabilization of the compound of the present invention. Suitable salts typically include sodium chloride, sodium succinate, sodium sulfate, potassium chloride, magnesium chloride, magnesium sulfate, and calcium chloride. In one embodiment, an aluminum salt is used to stabilize a compound of the present invention in a pharmaceutical composition of the present invention, which aluminum salt also may serve as an adjuvant when such a composition is administered to a patient.
The pharmaceutical compositions containing the antibodies may be in a variety of suitable forms. Such forms include, for example, liquid, semi-solid and solid dosage forms, such as liquid solutions (e.g., injectable and infusible solutions), dispersions or suspensions, emulsions, microemulsions, gels, creams, granules, powders, tablets, pills, powders, liposomes, dendrimers and other nanoparticles (see for instance Baek et al., Methods Enzymol. 362, 240-9 (2003), Nigavekar et al., Pharm Res. 21(3), 476-83 (2004), microparticles, and suppositories.
The optimal form depends on the mode of administration chosen and the nature of the composition. Formulations may include, for instance, powders, pastes, ointments, jellies, waxes, oils, lipids, lipid (cationic or anionic) containing vesicles, DNA conjugates, anhydrous absorption pastes, oil-in-water and water-in-oil emulsions, emulsions carbowax (polyethylene glycols of various molecular weights), semi-solid gels, and semi-solid mixtures containing carbowax. Any of the foregoing may be appropriate in treatments and therapies in accordance with the present invention, provided that the antibody in the pharmaceutical composition is not inactivated by the formulation and the formulation is physiologically compatible and tolerable with the route of administration. See also for instance Powell et al., “Compendium of excipients for parenteral formulations” PDA J Pharm Sci Technol. 52, 238-311 (1998) and the citations therein for additional information related to excipients and carriers well known to pharmaceutical chemists.
The antibodies may be prepared with carriers that will protect the compound against rapid release, such as a controlled release formulation, including implants, transdermal patches, and microencapsulated delivery systems. Such carriers may include gelatin, glyceryl monostearate, glyceryl distearate, biodegradable, biocompatible polymers, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid alone or with a wax, or other materials well known in the art. Methods for the preparation of such formulations are generally known to those skilled in the art. See e.g., Sustained and Controlled Release Drug Delivery Systems, J. R. Robinson, ed., Marcel Dekker, Inc., New York, 1978.
To administer the pharmaceutical compositions containing the antibodies by certain routes of administration according to the invention, it may be necessary to coat the antibody with, or co-administer the antibody with, a material to prevent its inactivation. For example, the antibody may be administered to a subject in an appropriate carrier, for example, liposomes, or a diluent. Liposomes include water-in-oil-in-water CGF emulsions as well as conventional liposomes (Strejan et al., J. Neuroimmunol. 7, 27 (1984)).
Depending on the route of administration, the antibody may be coated in a material to protect the antibody from the action of acids and other natural conditions that may inactivate the compound. For example, the antibody may be administered to a subject in an appropriate carrier, for example, liposomes. Liposomes include water-in-oil-in-water CGF emulsions as well as conventional liposomes (Strejan et al., 3. Neuroimmunol. 7, 27 (1984)).
Pharmaceutically acceptable carriers for parenteral administration include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. The use of such media and agents for pharmaceutically active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the pharmaceutical compositions of the present invention is contemplated. Supplementary active compounds may also be incorporated into the compositions.
Pharmaceutical compositions for injection must typically be sterile and stable under the conditions of manufacture and storage. The composition may be formulated as a solution, microemulsion, liposome, or other ordered structure suitable to high drug concentration. The carrier may be a aqueous or nonaqueous solvent or dispersion medium containing for instance water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. The proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols, such as glycerol, mannitol, sorbitol, or sodium chloride in the composition. Prolonged absorption of the injectable compositions may be brought about by including in the composition an agent that delays absorption, for example, monostearate salts and gelatin. Sterile injectable solutions may be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients e.g. as enumerated above, as required, followed by sterilization microfiltration.
Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients e.g. from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, examples of methods of preparation are vacuum drying and freeze-drying (lyophilization) that yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
Sterile injectable solutions may be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by sterilization microfiltration. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, examples of methods of preparation are vacuum drying and freeze-drying (lyophilization) that yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
The pharmaceutical composition may contain a combination of multiple (e.g., two or more) antibodies targeting the same antigen which act by different mechanisms, e.g., one anti-CD20 antibody which predominately acts by inducing CDC in combination with another anti-CD20 antibody which predominately acts by inducing apoptosis.
The present invention is further illustrated by the following examples which should not be construed as further limiting.
The following CD20 expressing cell lines were used in the experiments:
Daudi: a human negroid Burkitt's lymphoma cell line obtained from ECACC, Porton Down, United Kingdom
RAJI and RAM-CD20high: human negroid Burkitt's lymphoma cell lines obtained from ECACC, Porton Down, United Kingdom. The two RAJI cell lines differ in binding intensity of anti-CD20 mAbs. Furtherhmore, RAJI-CD20high cell line shows a higher binding of mAbs directed against all other cell surface proteins except for the complement regulatory protein CD59 and the B cell protein CD19 which showed a lower expression compared to RAJI cells. Both cell lines did not stain positive for CD3 (negative control).
These cell lines were cultured in RPMI 1640 supplemented with 10% heat-inactivated cosmic calf serum (CCS), 1 U/ml penicillin, 1 μg/ml streptomycin, and 4 mM L-glutamine (all from Invitrogen, Carlsbad, Calif.).
WIL2-S: A hereditary spherocytosis cell line WIL2-S (ATCC, Teddington, United Kingdom) was cultured in HyQ ADCF (Hyclone, Logan, Utah, United states) supplemented with 100 U/ml penicillin, 100 U/ml streptomycin and 100 mM sodium pyruvate (all from Invitrogen, Carlsbad, Calif.).
For the functional experiments, viability of the cell lines was tested by 0.4% trypan blue (Sigma, Zwijndrecht, Netherlands) exclusion. The cell lines were washed twice in PBS and re-suspended in test medium (RPMI 1640, 100 U/ml penicillin, 100 U/ml streptomycin, 0.1% BSA) at a concentration of 2×106 viable cells/ml.
To deplete cholesterol from the cell membrane, methyl-beta-cyclodextrin (MβCD, Sigma, Zwijndrecht, The Netherlands) was added in varying concentrations to Daudi cells and RAJI-CD20high cells and incubated for 30 minutes at 37° C. under gentle shaking conditions. After incubation the cells were washed twice in PBS and resuspended in test medium to a concentration of 2×106 viable cells/ml. MβCD-treated Daudi cells (1×105) were incubated with a saturating concentration of FITC-conjugated human anti-CD20 mAb 2F2 or the anti-CD20 mAb B9E9 (Beckman Coulter Inc., Fullerton, Calif.) for 30 minutes at 4° C. After washing twice with FACS buffer (PBS, 0.1% Bovine Serum Albumine, 0.02% Sodium Azide), cells were analyzed on a FACS Calibur (Becton Dickinson, Breda, The Netherlands). A dose-dependent decrease in binding of FITC-conjugated anti-CD20 mAb 2F2 to CD20 expressed by MβCD-treated Daudi cells was observed (
Statins are competitive inhibitors of 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMG-CoAR). HMG-CoAR is a rate-limiting enzyme of the mevalonate pathway essential for the synthesis of isoprenoid compounds including cholesterol (McTaggart S J (2006) Isoprenylated proteins. Cell Mol Life Sci 63:255-267). By inhibiting HMG-CoAR, statins can lower the cholesterol blood level and extract cholesterol from the cell membrane. To determine the effect of statin-mediated cholesterol depletion on immunotherapy RAJI-CD20high cells were cultured with a concentration range of lovastatin or diluent for 48 hours.
Lovastatin-treated cells were subjected to mAb-induced CDC by incubating cells (1×105/well) for 60 minutes with 10 pg/ml rituximab in the presence of 10% complement active serum. Cell viability was measured in a MTT assay in which 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) solution (5 mg/ml, Roche, Diagnostics, Almere, The Netherlands) was added to each well (flat-bottom microtiter plates; Nunc, Rochester, N.Y.). The reaction was stopped after 4 hours of incubation at 37° C. by the addition of 100 μl of 20% SDS (Roche Diagnostics, Almere, The Netherlands). After overnight incubation at 37° C. the absorbance of the samples was measured at 550-525 nm using an Elisa reader (EL808x, Biotek instruments, Highland park, Vt., USA). Cytotoxicity was expressed as a relative viability of the rituximab-mediated CDC of lovastatin-treated cells compared to cells incubated with medium only and was calculated as follows: relative viability=[(Ae−Ab)/(Ac−Ab)]*100, where Ab is the background absorbance, Ae is experimental absorbance of the lysed cells and Ac is the absorbance of untreated cells. The viability was expressed as percentage survival in comparison to non-cholesterol depleted cells (control).
A concentration-dependent protection of RAJI-CD20high cells from rituximab-induced CDC was observed upon incubation of cells with lovastatin for 48 hours (
Cholesterol was depleted from RAJI-CD20high cell line using the cholesterol-depleting agents MβCD or lovastatin, as described in Examples 2 and 3, respectively. The cells were washed twice in PBS and resuspended in test medium to a concentration of 2×106 viable cells/ml. As a control an untreated RAJI-CD20high cell line was included.
To reconstitute cholesterol into the cell membrane of the cells or increase the cholesterol content of the untreated cells, cholesterol (ICN Biomedicals, Zoetermeer, The Netherlands) was added to the test medium in a final concentration of 5 mg/ml 2 hours prior to FACS analysis. The cells were incubated for 30 minutes at 37° C. under gentle shaking conditions, after which the cells were washed twice in PBS and resuspended to 2×106 viable cells/ml. For comparison MβCD- and lovastatin-treated cell lines treated with only diluent were included.
To determine the effect of adding cholesterol on CD20 mAb binding, all cell lines (1×105) were incubated with a saturating concentration of B9E9 for 30 minutes at 4° C. After washing twice with FACS buffer (PBS, 0.1% Bovine Serum Albumine, 0.02% Sodium Azide), the cells were analyzed on a FACS Calibur (Becton Dickinson, Breda, The Netherlands).
Incubation of RAJI-CD20high cells with cholesterol upon pre-treatment with either lovastatin (
B cells (either non-treated cells, cholesterol-depleted cells via MβCD or lovastatin, or cholesterol-reconstituted cells) were characterized for quantitative surface expression of the B cell markers CD19, CD20, and CD21, the T-cell marker CD3, complement regulatory proteins CD55 and CD59, and HLA-DR and CD81 by direct immunofluorescence. 1×105 target cells were incubated with human anti-CD20 mAb 2F2 as well as mouse mAb SJ25CI (CD19-PE), B-Ly4 (CD21-PE), UCHT-1 (CD3-APC), IA10 (CD55-APC), p282 (CD59-FITC,) TU36 (HLA-DR-PE), and JS-81 (CD81-PE) (all from BD Pharmingen, Franklin Lakes, N.J.) at saturating concentrations for 30 minutes at 4° C. After washing twice with FACS buffer (PBS, 0.1% Bovine Serum Albumine, 0.02% Sodium Azide), the cells were analyzed on a flow cytometer.
Binding of various mAbs to RAJI cells incubated with increasing concentrations of MβCD as cholesterol depleting agent and measured by FACS analysis is shown in
Similar observations were made when depleting cholesterol from the membrane upon culture of RAJI cells with 10 μM of lovastatin (
Binding of various mAbs to cell surface proteins of WIL2-S cells replenished with cholesterol after incubation with lovastatin showed that binding of most mAb is dependent on the cholesterol concentration in the cell membrane (
Cholesterol was depleted from the cell membrane of various B cells using varying concentrations of MβCD (as described in Example 2). Cells (1×105 cells/staining) were incubated with a serial dilution of human CD20 mAb 2F2 starting at saturating concentrations for 30 minutes at 4° C. After washing with FACS buffer, polyclonal rabbit-anti-human IgG-FITC (DAKO A/S, Denmark) was added for 30 minutes at 4° C. The cells were washed again, resuspended in FACS buffer and analyzed by flow cytometry. The mean fluorescence intensity (MFI) is a measure for CD20 binding of the mAb. Sigmoidal dose-response curves were calculated using non-linear regression and the EC50 of mAb binding were determined (using GraphPad Prism 4 statistical software).
A decrease in anti-CD20 mAb binding on Daudi cells incubated with a dose range of MβCD was observed (
Cholesterol was depleted from the cell membrane of various B cells using varying concentrations of lovastatin (as described in Example 3) and CD20 mAb binding was determined. Cells (1×105 cells/staining) were incubated with a FITC-conjugated B9E9 for 30 minutes at 4° C. Cells were washed and resuspended in FACS buffer and analyzed by flow cytometry. The mean fluorescence intensity (MFI) is a measure for CD20 binding of the mAb.
Binding of B9E9 to CD20 was reduced on lovastatin-treated RAJI-CD20high cells compared to non-treated cells. RAJI-CD20 high cells were incubated with either diluent (control; black line) or lovastatin (10 μM for 48 hours; dark grey line). Treated cells were incubated with saturating amounts of FITC-conjugated B9E9 for 30 minutes at room temperature and analyzed using a flow cytometer. On the Y-axis the number of positive stained cells indicated by counts is shown, and on the X-axis the staining intensity is shown. Whereas over 95% of control RAJI-CD20high cells stained positive for B9E9, only 30% of cells showed significant binding to CD20 after 48 hours of treatment with 10 μM lovastatin (
To exclude the possibility that the presence of drugs might interfere with mAb binding the expression of HMG-CoAR was silenced with siRNA. 24 hours before transfection RAJI-CD20high cells were seeded from single-cell suspension at 2×105 cells/well in a 24 well plate. After overnight culture, cells were transfected with siRNA against HMG-CoAR (sequences provided by Qiagen) using HiPerFect Transfection Reagent (Qiagen) according to manufacturer's protocol. 24 hours after transfection cells were stained with anti-CD20 mAb to detect the expression of CD20, as described above. Inhibition of HMG-CoAR expression resulted in a decreased binding of anti-CD20 mAb to RAJI-CD20high cells (
This decrease in binding might be related to a decreased CD20 expression or a reduced mAb binding affinity, and this was studied in more detail in Examples 8 to 10.
In addition to lowering of cholesterol synthesis, statins exert pleitropic effects thereby influencing the expression of a number of genes, cf. Liao J K, Laufs U (2005) Pleiotropic effects of statins. Annu Rev Pharmacol Toxicol 45: 89-118; Alegret M, Silvestre JS (2006) Pleiotropic effects of statins and related pharmacological experimental approaches. Methods Find Exp Clin Pharmacol 28: 627-656; Ito M K, Talbert R L, Tsimikas S (2006) Statin-associated pleiotropy: possible effects beyond cholesterol reduction. Pharmacotherapy 26: 85S-97S.
To analyze whether lovastatin treatment would influence CD20 expression mRNA expression of the target was determined. RAJI-CD20high cells were incubated with either diluent (control) or 10 μM of lovastatin for different time periods (1-48 hours). Cells were washed twice with PBS, pelleted and treated with 1 ml of TRIzol Reagent (Invitrogen) to extract total RNA according to the manufacturer's protocol. RNA concentration was measured with Eppendorf Biophotometer (Eppendorf, Hamburg, Germany). The first strand cDNA synthesis containing 1 μg of total RNA was primed with oligo(dT) using Omniscript RT Kit (Qiagen, Chatsworth, Calif.). Primers used for CD20 PCR amplification were: forward-5′ TGAATGGGCTCTTCCACATTGCC3′ and reverse-5′ CCTGGAAGAAGGCAAAGATCAGC3′. The cycling conditions in the Mastercycler personal (Eppendorf) consisted of a first step of 94° C. denaturation for 10 minutes, followed by 35 cycles of annealing at 54° C. for 60 sec, extension at 75° C. for 90 sec, and denaturation at 94° C. for 30 sec, with a final elongation step at 75° C. for 10 minutes using HotStart Taq DNA Polymerase (Qiagen). Amplification products were analyzed by 1.5% agarose gel electrophoresis. The mRNA level for CD20 remained constant after lovastatin treatment in a time course over 48 hours (
Although CD20 mRNA expression remained constant, lovastatin might have affected the CD20 protein levels. Control cells or cells incubated with 10 μM lovastatin for 48 hours, washed twice with PBS, were pelleted and lysed with radioimmunoprecipitation assay (RIPA) buffer containing Tris base 50 mM, NaCl 150 mM, NP-40 1%, sodium deoxycholate 0.25% and EDTA 1 mM supplemented with Complete® protease inhibitor cocktail tablets (Roche Diagnostics, Mannheim, Germany). Protein concentration was measured using Bio-Rad Protein Assay (BioRad, Hercules, Calif., USA). Equal amounts of whole cell proteins were separated on 12.5% SDS-polyacrylamide gel, transferred onto Protran® nitrocellulose membranes (Schleicher and Schuell BioScience Inc., Keene, N.H.), blocked with TBST (Tris buffered saline (pH 7.4) and 0.05% Tween 20) supplemented with 5% nonfat milk and 5% FBS. The following mAb (at 1:1000 dilution) were used for the overnight incubation: anti-CD20 (NCL-CD20-L26, Novocastra Laboratories Ltd, UK), anti-ICAM-1 (Santa Cruz, Santa Cruz, Calif.). After extensive washing with TBST, the membranes were incubated for 45 minutes with peroxidase conjugated ImmunoPure Goat Anti-Mouse IgG [F(ab′)2] (Jackson ImmunoResearch Laboratories Inc, Pa.). The chemiluminescence reaction for horseradish peroxidase was developed using SuperSignal WestPico Trail Kit® (Pierce, Rockford, Ill.) on a standard x-ray film. The blots were stripped in 0.1 M glycine pH 2.6 and reprobed with anti-tubulin mouse mAb (Calbiochem) to control for loading differences. 48 hours incubation with different concentrations of lovastatin (from 5-30 μM) did not influence the total cellular CD20 protein level (
Decreased binding of anti-CD20 molecules with simultaneous stable levels of mRNA and protein in total cell lysates might be explained by either retention/redistribution of CD20 in cytosolic compartments or shedding from the plasma membrane. To examine localization of CD20 in RAJI-CD20high cells a double immunofluorescence staining with anti-CD20 mAb directed against an extracellular conformational epitope of CD20, and, after cell permeabilization, with a mAb against a linear epitope in the cytosolic tail of this molecule was performed.
Control and lovastatin-pretreated RAJI-CD20high cells were stained in suspension at a density of 5×105/ml with FITC-conjugated B9E9 (1:10 in PBS, Immunotech Coulter Company, France) for 30 minutes at room temperature. After washing in PBS (three times), 200 μl of the cell suspension was spun onto a Cytospin slide. The slides were air-dried, acetone-fixed for 15 minutes at room temperature, washed three times with PBS, incubated with anti-CD20 mAb (Novocastra) (1:100 in PBS with 5% normal donkey serum (Jackson)) for 60 minutes at room temperature. The slides were washed three times in PBS and incubated with donkey anti-mouse Alexa555 conjugated antibody (Molecular Probes, CA) (1:200 for 30 minutes at room temperature). The slides were washed, mounted in Vectashield (Vector Laboratories, CA.) and examined by fluorescence microscopy (Leica TCS SP2).
To further elucidate these observations control and lovastatin-treated cells were labeled with EZ-link® sulfo-NHS-biotin. This water-soluble and membrane impermeable reagent stably binds to primary amino (—NH2) groups of extracellular portions of transmembrane proteins. Control and lovastatin-treated cells, washed three times with ice-cold PBS (pH 8.0) and resuspended at a density of 25×106 cells/ml were surface-labeled with 2 mM (final concentration) EZ-link® sulfo-NHS-biotin (Pierce) for 30 minutes at room temperature. Cells were washed three times (in PBS with 100 mM glycine) and lysed with RIPA lysis buffer containing proteases inhibitors (as described earlier, see Example 8). Biotinylated proteins were precipitated with immobilized NeutrAvidin protein (Pierce) by mixing the suspension for 1 hour at room temperature to separate the biotinylated surface protein from non-biotinylated ones. After five washes, gel-bound complexes were boiled in 2× Laemmli sample buffer and analyzed for CD20 by Western blotting using anti-CD20 mAb (NCL-CD20-L26, Novocastra) as described in Example 8.
Electrophoresis of the precipitates followed by blotting with anti-CD20 mAb (targeting the cytoplasmic portion of CD20) revealed that CD20 is detectable in lovastatin-treated cells in comparable amounts as compared with controls (
To confirm that lovastatin treatment might result in a change in CD20 mAb binding affinity lovastatin-treated RAJI cells were stained with a concentration curve of CD20 mAb. Cells (1×105 cells/staining) were incubated with a serial dilution of CD20 mAb (2F2, rituximab or 11B8) starting at saturating concentrations for 30 minutes at 4° C. After washing with FACS buffer, polyclonal rabbit-anti-human IgG-FITC (DAKO A/S, Denmark) was added for 30 minutes at 4° C. to detect the bound CD20 mAb. Cells were washed again, resuspended in FACS buffer and analyzed on a flow cytometer. The mean fluorescence intensity (MFI) was taken as measure for CD20 binding of the mAb.
The data confirmed that the lovastatin treatment resulted in a decrease in affinity of anti-CD20 mAb binding to the target as observed by the shift in the binding curves when compared to non-treated cells (control) (
Summarizing, the studies confirm that CD20 is present in the plasma membrane of lovastatin-treated cells, but that it becomes more difficult to target CD20 by binding of mAb directed against an extracellular epitope on the target.
Binding of anti-CD20 mAb to CD20 on various B cell lines could be restored upon replenishment of the cell membrane cholesterol content via addition of cholesterol (according to procedure as described in Example 4) to either MβCD- or lovastatin-treated cells, as measured by FACS analysis (
Data show a reduced affinity in binding of 2F2 (A), rituximab (B) or 11B8 (C) to cells depleted for cholesterol with lovastatin. Replenishing of cholesterol restores affinity to the level of non-treated cells.
In summary, depeleting cholesterol from the cell membrane with either MβCD or lovastatin reduces the binding affinity of anti-CD20 mAb to CD20. Replenishment of the cholesterol membrane content restores or further improves the binding of the anti-CD20 mAb to CD20. This is observed for both 2F2, rituximab as well as 11B8.
Cells were either non-treated or cholesterol-depleted as described in Example 2, Example 3 and Example 4, and resuspended in test medium to a concentration of 2×106 viable cells/ml. Daudi cells were used as target cells in a mAb-induced CDC assay. 50 μl of cell suspension was incubated with 50 μl anti-CD20 mAb in a serial dilution for 15 minutes at room temperature. After the incubation period, Normal Human Serum (M0008, Sanquin, Amsterdam, The Netherlands) was added as a source of complement (final concentration, 15%) to the cell suspension in round-bottomed microtiter plates (Nunc, Rochester, N.Y.). The mixture was incubated for 45 minutes at 37° C. after which the reaction was stopped by placing the samples on ice. Propidium iodide (PI, Sigma Aldrich, Zwijndrecht, The Netherlands) was added as a means to visualize the DNA content which becomes accessible upon permeabilisation of the cell membrane. The amount of PI-positive cells is directly correlated to the amount of dead cells, and measured using flow cytometry.
11B8 was not able to lyse either non-treated or lovastatin- or MβCD-mediated (
Lovastatin-treated WIL2-S cells were in comparison to non-treated cells also less sensitive for CDC induction by 2F2 and rituximab (
In summary, depleting cholesterol from the cell membrane with either MβCD or lovastatin reduces the CDC-inducing capacity of anti-CD20 mAb. Replenishment of the cholesterol membrane content restores or further improves the lysing potential of the anti-CD20 mAb, depending on the B cell line used. This is observed for the type I anti-CD20 antibodies, i.e. antibodies having high CDC and ADCC activity, but low apoptosis activity, such as 2F2 and rituximab, but not for the type II anti-CD20 antibodies, i.e. antibodies having low or no CDC activity, but high ADCC and apoptosis activity, such as 11B8, which have no CDC lysing capacity at all.
CDC was induced by incubating B cells with anti-CD20 mAb (as described in Example 2). After 1-hour incubation (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) solution (5 mg/ml, Roche, Diagnostics, Almere, The Netherlands) was added to each well (flat-bottom microtiter plates; Nunc, Rochester, N.Y.). The reaction was stopped after 4 hours of incubation at 37° C. by the addition of 100 μl of 20% SDS (Roche Diagnostics, Almere, The Netherlands). After overnight incubation at 37° C. the absorbance of the samples was measured at 550-525 nm using an Elisa reader (EL808x, Biotek instruments, Highland park, Vt., USA). Cytotoxicity was expressed as a relative viability of the stimulated cells compared to cells incubated with medium only and was calculated as follows: relative viability=[(Ae−Ab)/(Ac−Ab)]*100, where Ab is the background absorbance, Ae is experimental absorbance of the lysed cells and Ac is the absorbance of untreated cells. The viability was expressed as percentage survival in comparison to non-cholesterol depleted cells (control).
In addition to detection via PI/FACS analysis, the increased survival after CDC induction by rituximab of cholesterol-depleted RAJI cells was also observed using the MTT assay.
CDC was induced by incubating RAJI cells with anti-CD20 mAb (as described under Example 2). After 30 minutes of incubation, Alamar blue solution (Biosource, Camarillo, Calif., USA) was added to each well in the flat-bottomed microtiter plates (Nunc, Rochester, N.Y.). The reaction was incubated for 5 hours at 37° C. after which the conversion of the Alamar blue dye into a red fluorescent color was measured using the Synergy HT fluorometer (Biotek instruments, Highland park, Vt., USA). Cell viability was detected as relative fluorescence units (RFI). Cytotoxicity was expressed as a relative viability of the stimulated cells compared to cells incubated with medium only and was calculated as follows: relative viability=[(RFIe−RFIb)/(RFIc−RFIb)]*100, where RFIb is the background RFI, RFIe is experimental RFI of the lysed cells and RFIc is the absorbance of untreated cells. The viability was expressed as percentage survival in comparison to non-cholesterol depleted cells (control).
The enhanced survival of lovastatin-treated Daudi cells upon 2F2- and rituximab-induced CDC could also be detected using the Alamar blue assay (
Binding of type I anti-CD20 mAbs has been shown to induce translocation of CD20 into cholesterol-rich microdomains, also referred to as lipid rafts, in the plasma membrane and this effect was associated with activation of CDC. Statins, by inhibiting cholesterol biosynthesis, have been shown to interfere with the formation of lipid rafts. Therefore, it was tested whether the impaired rituximab-mediated CDC induction was either dependent on the inability of CD20 to translocate into lipid rafts or dependent on the diminished cholesterol content. B cells were treated with chemicals either known to interfere with cholesterol synthesis, such as Berberine chloride, or known to interfere with cholesterol by disrupting its capacity to form lipid rafts, such as Fillipin III. Whereas Berberine chloride inhibits cholesterol synthesis by a HMG-CoAR-independent mechanism (cf. Kong W, et al. (2004) Berberine is a novel cholesterol-lowering drug working through a unique mechanism distinct from statins. Nat Med 10: 1344-1351), Fillipin III binds stoichometrically to cholesterol (cf. Smart E J et al. (2002) Alterations in membrane cholesterol that affect structure and function of caveolae. Methods Enzymol 353: 131-139), thereby introducing additional charge that forces cholesterol molecules to distribute evenly within the plasma membrane and prevent lipid raft formation.
RAJI-CD20high cells were incubated with diluents (control) or a concentration range of either Fillipin III for 30 minutes or Berberine chloride for 24 hours. Cells (1×105/well) were subjected to mAb-induced CDC by incubating the treated cells 60 minutes with 10 μg/ml rituximab in the presence of 10% complement active serum. The cytotoxic effects were measured in a MTT assay. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) solution (5 mg/ml, Roche, Diagnostics, Almere, The Netherlands) was added to each well in the flat-bottomed microtiter plates (Nunc, Rochester, N.Y.). The reaction was stopped after 4 hours of incubation at 37° C. by the addition of 100 μl of 20% SDS (Roche Diagnostics, Almere, The Netherlands). After overnight incubation at 37° C. the absorbance of the samples was measured at 550-525 nm using an Elisa reader (EL808x, Biotek instruments, Highland park, Vt., USA). Cytotoxicity was expressed as a relative viability of the stimulated cells compared to cells incubated with medium only and was calculated as follows: relative viability=[(Ae−Ab)/(Ac−Ab)]*100, where Ab is the background absorbance, Ae is experimental absorbance of the lysed cells and Ac is the absorbance of untreated cells. The viability was expressed as percentage survival in comparison to non-cholesterol depleted cells (control).
A 24-hour incubation of RAJI-CD20high cells with Berberine chloride significantly abrogated the rituximab-mediated CDC whereas upon Fillipin III pre-incubation the cells remained sensitive to CDC induction with a single concentration of rituximab (
The capacity of Fillipin III-treated or Berberine chloride-treated cells to bind B9E9 was determined by incubating treated cells with FITC-conjugated B9E9 for 30 minutes at 4° C. After washing twice with FACS buffer (PBS, 0.1% Bovine Serum Albumine, 0.02% Sodium Azide), cells were analyzed on a FACS Calibur (Becton Dickinson, Breda, The Netherlands).
As observed for induction of CDC, Berberine chloride-treated cells showed an impaired binding of B9E9 to RAJI-CD20high cells which was not observed for Fillipin III-treated cells (
Summarizing, the presence of cholesterol and not necessarily lipid rafts in the plasma membrane is critical for binding of anti-CD20 mAb as well as for anti-CD20-mediated CDC of lymphoma B cells.
Blood was obtained from a donor (either from a healthy volunteer or from patients included in clinical trials related to 2F2). Informed consent was provided according to the Declaration of Helsinki. The blood was used to isolate peripheral blood mononuclear cells (PMBC) via sucrose gradient separation. Briefly, 10 ml of whole blood was supplemented with 20-25 ml PBS (Braun, Oss, Netherlands). 13 ml of Lymphocyte Separation Medium (Lonza, Verviers, Belgium) was pipetted carefully underneath the diluted whole blood solution. The solution was centrifuged at 2000 rpm for 20 minutes whereupon the interphase containing the PBMC was collected. The cells were washed twice in PBS, counted with trypan blue and suspended in test medium (RMPI 1640/pen strep/0.1% BSA) at a concentration of 2-4×106 viable cells/ml. Cells were used to enrich B cells via negative depletion as described in Example 8.
PBMC (obtained as described under Example 17) were used to enrich for B cells using the Dynal B cell negative isolation kit (Dynal, Invitrogen, Carlsbad, Calif.) according to manufacturer's instruction. In brief, PBMC were washed and incubated for 20 minutes with mouse monoclonal antibodies directed against CD2, CD14, CD16, CD36, CD43 or CD235a at 4° C. Magnetic beads coated with human IgG4 against mouse monoclonal antibodies were added and the mixture was again incubated for 15 minutes at 4° C. After incubation mouse mAb-stained cells were separated from the mixture using a magnet. The remaining cells are considered as the B cell enriched population. B cell enrichment was checked using flow cytometry detecting expression of CD20, CD19 and CD21 (as B cell markers), and CD3 and goat-anti-mouse IgG (Jackson Immunoresearch Ltd, Suffolk, UK) of the PBMC and B cell enriched cell population (data not shown).
Human B cells were isolated from whole blood of a healthy volunteer (donor A) as described under Example 17 and Example 18. The cell population was enriched for B cells from 13% (in PBMC) up to 87% CD20-positive cells (data not shown).
To determine the effect of cholesterol depletion on the expression of cell surface proteins, surface expression of several B cell markers (CD20, CD19, CD21) and complement regulatory proteins (CD55 and CD59) was detected using flow immunofluorescence. Detection of CD3 (T-cell markers) served as a negative control. 1×105 cells were incubated with human mAb 20030730 AKI (2F2-FITC), and mouse mAb SJ25CI (CD19-PE), B-Ly4 (CD21-PE), IA10 (CD55-APC), p282 (CD59-FITC), TU36 HLA-DR-PE) and UCHT-1 (CD3-APC) (all from BD Pharmingen, Franklin Lakes, N.J.) at saturating concentrations for 30 minutes at 4° C. After washing, cells were analyzed by flow cytometry. Identical stainings were performed on Daudi cells.
The B cell enriched cell population of donor A and Daudi cells were incubated with MβCD as described under Example 2 and cell surface protein expression and sensitivity for CDC was measured. As observed for Daudi cells, depletion of cholesterol out of the cell membrane of primary B cells resulted in a decreased binding of mAb to CD20 and CD19, whereas CD21 expression remained stable. Also the binding of the complement regulatory protein CD59 and of HLA-DR was diminished (
To extend these observations the influence of cholesterol depletion was studied in freshly isolated human lymphoma B cells. Tumor cells of three mantle cell lymphomas and a small B cell lymphoma were isolated out of bone marrow (10 ml) aspirated from the hip. The cell suspension was diluted twice with PBS (final volume 20 ml). 3 ml of Histopaque-1077 (Sigma Aldrich) was pipetted into two conical centrifuge tubes. 10 ml of diluted bone marrow was slowly layered on the top of Histopaque layer. Probes were centrifuged (400 g, 15 minutes, 25° C.) without brake. The white blood cell ring and plasma were isolated and washed twice with PBS. The leucocyte pellet was resuspeneded in 5 ml medium (RPMI or OptiMEM) and counted in a Bürker chamber using Turk dye. Cells were incubated with either diluent or MβCD (10 mg/ml) for 30 minutes. Treated cells were analyzed for their capacity to bind CD20 mAb as well as sensitivity for rituximab-mediated CDC induction.
Cells were incubated with saturating amounts of FITC-conjugated B9E9 for 30 minutes at room temperature. After washing twice in FACS buffer CD20 mAb binding was analysed using a flow cytometer. In all four cases it was shown that 30 minutes incubation of B lymphoma cells with 10 mg/ml MβCD significantly decreased binding of B9E9 (
For the rituximab-mediated CDC human CD20-positive lymphoma B cells were incubated with either diluent or 10 mg/ml MβCD for 30 minutes. Then, equal numbers of cells (1×105/well) were incubated for 60 minutes with 400 μg/ml rituximab in the presence of 10% complement active serum. The cytotoxic effects were measured in a MTT assay. The survival of cells is presented as % of corresponding diluent- or MβCD-pretreated cells without rituximab. Accordingly to mAb binding, incubation with MβCD significantly decreased rituximab-mediated CDC against freshly isolated human lymphoma B cells (
Further, the influence of cholesterol depletion in freshly isolated B cells of hypercholesterolemic patients treated with atorvastatin was studied. A small exploratory clinical trial was performed in which hypercholesterolemic patients (n=5) were treated with a single dose of 80 mg atorvastatin (taken in the evening) in order to reduce their cholesterol blood level and determine the effect on CD20 mAb binding on isolated B cells using flow cytometry. Approval of the study was obtained from the ethics review board of the Warsaw University Medical Center. Informed consent was provided according to the Declaration of Helsinki. Blood was drawn from patients in the morning after overnight abstention of food.
The cholesterol blood level was measured using automated dry chemistry system (Vitroz 250 System Chemistry (Ortho-Clinical Diagnostics, Johnson&Johnson, Piscataway, N.J.). A starting cholesterol blood level of 190 mg/ml was required for patients to enroll in the clinical trial. At time of recruitment, patient I.D.#4 presented with a cholesterol blood concentration >190 mg/ml, and as such was considered hypercholesterolemic. At time of recruitment the blood cholesterol level of patient I.D.#5 turned out to be below this cut off value, and thus it can be argued whether this patient should be considered hypercholesterolemic. As atovarstatin was already administered to this patient it was decided to include this patient in the trial. Cholesterol blood levels were subsequently measured on day 0 (pretreatment) and day 3 after treatment. In all five patients atorvastatin treatment induced a significant drop in blood cholesterol levels (
CD21 is a protein expressed by B cells. Its expression has been shown unaffected upon cholesterol depletion of a B cell line (Daudi) and for freshly isolated B cell enriched cell population of two independent donors (
To determine CD20 and CD21 expression on B cells of hypercholesterolemic patients treated with atorvastatin PBMC were isolated out of whole blood drawn on day 0 (pre-treatment) and day 3 after treatment (as described in Example 7). Freshly isolated B cells were stained with different FITC-conjugated CD20 mAbs 2F2, 11B8, B1 (GlaxoSmithKline, Stevenage, United Kingdom) and PE-conjugated CD21 mAb (B-Ly4, BD Pharmingen, Franklin Lakes, N.J.) by 30 minutes incubation at room temperature in the dark. Cells were washed and mAb binding intensity (MFI) was analysed using a FACS Calibur (Becton Dickinson, Breda, The Netherlands).
In all five patients three days after the single dose of atorvastatin a significant decrease of 18% (±4% SE, P=0.0010, paired t-test) in the average CD20 (2F2) expression (relative to CD21 (B-ly4) expression) on freshly isolated B cells was observed compared to day 0 (pretreatment) (
In the antibody-dependent cellular cytotoxicity (ADCC) assay target B cells are labelled with radioactive chromium (51Cr), and incubated with antibody and effector cells. Upon lysis the target cells release 51Cr which can be measured by separation of the supernatant from the cells and quantification using a scintillation counter.
RAJI cells (obtained from ECACC, Porton Down, United Kingdom) served as target cells, and were cultured in RPMI 1640 supplemented with 10% heat-inactivated cosmic calf serum (CCS), 1 U/ml penicillin, 1 μg/ml streptomycin, and 4 mM L-glutamine (all from Invitrogen, Carlsbad, Calif.). RAJI cells were either non-treated or cholesterol-depleted using lovastatin (10 μM) as described in Example 3, and re-suspended in test medium to a concentration of 2×106 viable cells/ml.
RAJI cells were labeled with 20 μCi51Cr (Amersham Biosciences, Uppsala, Sweden) for 2 hours. After extensive washing in medium, the cells were adjusted to 2×105 cells/ml. PBMCs were used as effector cells (50 μl, see Example 17 for isolation of PBMCs), a concentration curve of rituximab (50 μl) and medium (50 μl) were added to round-bottom microtiter plates (Greiner Bio-One GmbH, Frickenhausen, Germany). Assays were started by adding 51Cr-labeled RAH cells (50 μl) giving a final volume of 200 >l. For isolated effector cells, containing 20% NK cells, an effector to target (E:T) ratio of 100:1 was used. After incubation (4 hours, 37° C.), assays were stopped by centrifugation, and 51Cr release from triplicates was measured in counts per minute (cpm) in a scintillation counter. Percentage of cellular cytotoxicity was calculated using the following formula:
% specific lysis=(experimental cpm−basal cpm)/(maximal cpm−basal cpm)×100
with maximal 51Cr release determined by adding TritonX-100 (5% final concentration) to target cells, and basal release measured in the absence of sensitizing antibodies and effector cells.
A concentration-dependent induction of ADCC-mediated lysis of RAH cells in the presence of rituximab was observed. However, cholesterol-depleted cells (lovastatin) showed a reduced ADCC-mediated lysis of RAJI cells when compared to the non-treated cells (
The following 20 mg/ml aqueous formulation of ofatumumab is prepared by standard procedures:
Patients suffering from FL are treated with ofatumumab by intravenous infusion according to the following regimen: 8 weekly infusions of ofatumumab, the first infusion of 300 mg of ofatumumab and the subsequent infusions of each 1000 mg of ofatumumab.
Two months prior to the first administration of ofatumumab the patients start on a cholesterol rich diet to increase the cholesterol blood concentration, preferably to above 190 mg/ml. The cholesterol rich diet is maintained during the ofatumumab regimen. Two to three months after the last administration of ofatumumab the patients are withdrawn from the cholesterol rich diet.
Patients suffering from FL are treated with ofatumumab by intravenous infusion according to the following regimen: 8 weekly infusions of ofatumumab, the first infusion of 300 mg of ofatumumab and the subsequent infusions of each 1000 mg of ofatumumab.
Two months prior to the first administration of ofatumumab the patients start on bexarotene therapy to increase the cholesterol blood concentration, preferably to above 190 mg/ml. Bexarotene is administered in a dosage of from 200 to 300 mg/m2 per day. The bexarotene therapy is maintained during the ofatumumab regimen. Two to three months after the last administration of ofatumumab the patients are withdrawn from the bexarotene therapy.
Patients suffering from FL on statin therapy are withdrawn from statin therapy 3 months prior to the first administration of ofatumumab. Ofatumumab is administered by intravenous infusion according to the following regimen: 8 weekly infusions of ofatumumab, the first infusion of 300 mg of ofatumumab and the subsequent infusions of each 1000 mg of ofatumumab. Two to three months after the last administration of ofatumumab the patients are resuming statin therapy.
The cholesterol level may be monitored in the patients to evaluate the need for increasing the cholesterol level prior to administration with ofatumumab. The cholesterol blood level should preferably be above 130 mg/ml, such as above 160 mg/ml, 190 mg/ml or 220 mg/ml during administration of ofatumumab.
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents of the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims. Any combination of the embodiments disclosed in the dependent claims are also contemplated to be within the scope of the invention.
| Number | Date | Country | Kind |
|---|---|---|---|
| PA 2007 01519 | Oct 2007 | DK | national |
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/DK08/50256 | 10/22/2008 | WO | 00 | 12/22/2010 |
