Patent Application
20240011005
The instant application contains a Sequence Listing XML which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on Jun. 7, 2023, is named 132045-10301_SL.xml and is 539,016 bytes in size.
According to WIPO Standard ST.26, symbol “t” is used to denote both T in DNA and U in RNA (See “Table 1: List of nucleotides symbols”, the definition of symbol “t” is “thymine in DNA/uracil in RNA (t/u)”). Thus, in a sequence listing prepared according to ST.26, wherever a sequence is an RNA, the T in the sequence shall be deemed as U.
Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR-associated (Cas) genes, collectively known as CRISPR-Cas or CRISPR/Cas systems, are adaptive immune systems in archaea and bacteria that defend particular species against foreign genetic elements.
Citation or identification of any document in the disclosure is not an admission that such a document is available as prior art to the disclosure. Each of the references mentioned or cited in the disclosure is incorporated by reference in its entirety.
It is against the above background that the disclosure provides certain advantages and advancements over the prior art. Although the disclosure is not limited to specific advantages or functionalities, in one aspect, the disclosure provides a Cas12f polypeptide comprising an amino acid sequence having a sequence identity of at least about 60% (e.g., at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) to any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31, and 32).
In another aspect, the disclosure provides a system comprising:
In yet another aspect, the disclosure provides polynucleotide encoding the Cas12f polypeptide of the disclosure.
In yet another aspect, the disclosure provides delivery system comprising (1) the Cas12f polypeptide of the disclosure, the polynucleotide of the disclosure, or the system of the disclosure; and (2) a delivery vehicle.
In yet another aspect, the disclosure provides vector comprising the polynucleotide of the disclosure; optionally wherein the vector encodes a guide nucleic acid as defined in the disclosure; optionally wherein the vector is a plasmid vector, a recombinant AAV (rAAV) vector, or a recombinant lentivirus vector.
In yet another aspect, the disclosure provides ribonucleoprotein (RNP) comprising the Cas12f polypeptide of the disclosure and a guide nucleic acid optionally as defined in the disclosure.
In yet another aspect, the disclosure provides lipid nanoparticle (LNP) comprising the Cas12f polypeptide of the disclosure 9 or the system of the disclosure.
In yet another aspect, the disclosure provides method for modifying a target DNA, comprising contacting the target DNA with the system of the disclosure, the vector of the disclosure, the ribonucleoprotein of the disclosure, or the lipid nanoparticle of the disclosure, wherein the spacer sequence is capable of hybridizing to a target sequence of the target DNA, wherein the target DNA is modified by the complex.
In yet another aspect, the disclosure provides cell modified by the method of the disclosure.
In yet another aspect, the disclosure provides pharmaceutical composition comprising (1) the system of the disclosure, the vector of the disclosure, the ribonucleoprotein of the disclosure, the lipid nanoparticle of the disclosure, or the cell of the disclosure; and (2) a pharmaceutically acceptable excipient.
In yet another aspect, the disclosure provides method for diagnosing, preventing, or treating a disease in a subject in need thereof, comprising administering to the subject the system of the disclosure, the vector of claim 29, the ribonucleoprotein of the disclosure, the lipid nanoparticle of the disclosure, the cell of the disclosure, or the pharmaceutical composition of the disclosure, wherein the disease is associated with a target DNA, wherein the spacer sequence is capable of hybridizing to a target sequence of the target DNA, wherein the target DNA is modified by the complex, and wherein the modification of the target DNA diagnose, prevents, or treats the disease.
The details of one or more embodiments of the disclosure are set forth in the description below. Other features or advantages of the disclosure will be apparent from the following drawings and detailed description of several embodiments, and also from the appended claims. It is understood that any aspect or embodiment of the disclosure can be combined with any other aspect or embodiment of the disclosure to constitute another embodiment explicitly or implicitly disclosed herein unless otherwise indicated.
Cas12f, as a subtype of Class 2, Type V CRISPR associated protein (Cas12), is capable of binding to or function on a target nucleic acid (e.g., a dsDNA) as guided by a guide nucleic acid (e.g., a guide RNA (gRNA, used interchangeably with single guide RNA or sgRNA in the disclosure)) comprising a guide sequence targeting the target nucleic acid. In some embodiments, the target nucleic acid is eukaryotic.
Without wishing to be bound by theory, in some embodiments, the guide nucleic acid comprises a scaffold sequence responsible for forming a complex with the Cas12f, and a guide sequence (used interchangeable with a spacer sequence in the disclosure) that is intentionally designed to be responsible for hybridizing to a target sequence of the target nucleic acid, thereby guiding the complex comprising the Cas12f and the guide nucleic acid to the target nucleic acid.
Referring to
An exemplary guide nucleic acid is depicted to comprise a guide sequence and a scaffold sequence. The guide sequence is designed to hybridize to a part of the 3′ to 5′ single DNA strand, and so the guide sequence “targets” that part. And thus, the 3′ to 5′ single DNA strand is referred to as a “target strand (TS)” of the target dsDNA, while the opposite 5′ to 3′ single DNA strand is referred to as a “nontarget strand (NTS)” of the target dsDNA. That part of the target strand based on which the guide sequence is designed and to which the guide sequence may hybridize is referred to as a “target sequence”, while the opposite part on the nontarget strand corresponding to that part is referred to as the “protospacer sequence”, which is 100% (fully) reversely complementary to the target sequence.
Generally, a nucleic acid sequence (e.g., a DNA sequence, an RNA sequence) is written in 5′ to 3′ direction/orientation.
For example, for a DNA sequence of ATGC, it is usually understood as 5′-ATGC-3′ unless otherwise indicated. Its reverse sequence is 5′-CGTA-3′, its fully complement sequence is 5′-TACG-3′, and its fully reverse complement sequence is 5′-GCAT-3′.
Generally, the double-strand sequence of a dsDNA may be represented with the sequence of its 5′ to 3′ single DNA strand conventionally written in 5′ to 3′ direction/orientation unless otherwise indicated.
For example, for a dsDNA having a 5′ to 3′ single DNA strand of 5′-ATGC-3′ and a 3′ to 5′ single DNA strand of 3′-TACG-5′, the dsDNA may be simply represented as 5′-ATGC-3′.
It should be noted that either the 5′ to 3′ single DNA strand or the 3′ to 5′ single DNA strand of a dsDNA can be a nontarget strand from which a protospacer sequence is selected or a target strand to which the guide sequence is designed to hybridize.
Generally, for a gene as a dsDNA, the 5′ to 3′ single DNA strand is the sense strand of the gene, and the 3′ to 5′ single DNA strand is the antisense strand of the gene. But it should be noted that either the sense strand or the antisense strand of a gene can be a nontarget strand from which a protospacer sequence is selected or a target strand to which the guide sequence is designed to hybridize.
To hybridize to a target dsDNA, in one embodiment, the guide sequence of a guide nucleic acid (e.g., a guide RNA) is designed to have a RNA sequence of 5′-AUGC-3′ that is fully reversely complementary to the 3′ to 5′ strand of the target dsRNA, which would be set forth in ATGC in the electric sequence listing but annotated as RNA; and in another embodiment, the guide sequence of a guide nucleic acid (e.g., a guide RNA) is designed to have a RNA sequence of 5′-GCAU-3′ that is fully reversely complementary to the 5′ to 3′ strand of the target dsRNA, which would be set forth in GCAT in the electric sequence listing but annotated as RNA.
In the case that the guide sequence of a guide nucleic acid is fully reversely complementary to the target sequence and the target sequence is fully reversely complementary to the protospacer sequence, the guide sequence is identical to the protospacer sequence except for the U in the guide sequence if it is an RNA sequence and correspondingly the T in the protospacer sequence. According to WIPO standard ST.26, symbol “t” is used to denote both T in DNA and U in RNA (See “Table 1: List of nucleotides symbols”, the definition of symbol “t” is “thymine in DNA/uracil in RNA (t/u)”). Thus, in the sequence listing of the disclosure prepared according to ST.26, such a guide sequence could be set forth in the same sequence as a corresponding protospacer sequence. For convenience, a single SEQ ID NO in the sequence listing can be used to denote both such guide sequence and protospacer sequence, although such a single SEQ ID NO may be marked as either DNA or RNA in the sequence listing. When a reference is made to such a SEQ ID NO that sets forth a protospacer/guide sequence, it refers to either a protospacer sequence that is a DNA sequence or a guide sequence that may be an RNA sequence depending on the context, no matter whether it is marked as DNA or RNA in the sequence listing.
Unless otherwise specified, all technical and scientific terms used in the disclosure have the meaning commonly understood by one of ordinary skill in the art to which the disclosure belongs. Throughout the specification, several terms are employed that are defined in the following paragraphs. Other definitions are also found within the body of the specification.
As used herein, the terms “nucleic acid”, “nucleic acid molecule”, or “polynucleotide” are used interchangeably. They refer to a polymer of deoxyribonucleotides or ribonucleotides or their mixtures in either single- or double-stranded form, and unless otherwise stated, encompass known analogs of natural nucleotides that can function in a similar manner as naturally occurring nucleotides. The terms encompass nucleic acid-like structures with synthetic backbones, as well as amplification products. DNAs and RNAs are both polynucleotides. The polymer may include natural nucleosides (i.e., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine), nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, C5-propynylcytidine, C5-propynyluridine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-methylcytidine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine), chemically modified bases, biologically modified bases (e.g., methylated bases), intercalated bases, modified sugars (e.g., 2′-fluororibose, ribose, 2′-deoxyribose, arabinose, and hexose), or modified phosphate groups (e.g., phosphorothioates and 5′-N-phosphoramidite linkages).
As used herein, the term “polypeptide” and “protein” are used interchangeably to refer to polymers of amino acids of any length. The polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids. The terms also encompass an amino acid polymer that has been modified; for example, by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component.
As used herein, a “fusion protein” refers to a protein created through the joining of two or more originally separate proteins, or portions thereof. In some embodiments, a linker may be present between each protein.
As used herein, the term “heterologous,” in reference to polypeptide domains, refers to the fact that the polypeptide domains do not naturally occur together (e.g., in the same polypeptide). For example, in fusion proteins generated by the hand of man, a polypeptide domain from one polypeptide may be fused to a polypeptide domain from a different polypeptide. The two polypeptide domains would be considered “heterologous” with respect to each other, as they do not naturally occur together.
As used herein, the term “nuclease” refers to a polypeptide capable of cleaving the phosphodiester bonds between the nucleotide subunits of nucleic acids; the term “endonuclease” refers to a polypeptide capable of cleaving the phosphodiester bond within a polynucleotide chain.
As used herein, the term “Cas12f” is used interchangeably with Cas12f protein or Cas12f polypeptide in the disclosure and used in its broadest sense and includes parental or reference Cas12f proteins (e.g., Cas12f protein comprising any of SEQ ID NOs: 1-34), derivatives or variants thereof, and functional fragments such as nucleic acid-binding fragments thereof, including endonuclease deficient (dead) Cas12f polypeptides, and Cas12f nickases.
As used herein, the term “guide nucleic acid” refers to a nucleic acid-based molecule capable of forming a complex with a CRISPR-Cas protein (e.g., a Cas12f of the disclosure) (e.g., via a scaffold sequence of the guide nucleic acid), and comprises a sequence (e.g., guide sequences) that are sufficiently complementary to a target nucleic acid to hybridize to the target nucleic acid and guide the complex to the target nucleic acid, which include but are not limited to RNA-based molecules, e.g., guide RNA. As used herein, the term “single guide RNA (sgRNA)” is used interchangeably with guide RNA (gRNA) or RNA guide. As used in the disclosure, the term “guide sequence” is used interchangeably with the term “spacer sequence”. The guide nucleic acid may be a DNA molecule, an RNA molecule, or a DNA/RNA mixture molecule. By “DNA/RNA mixture molecule” it refers to a nucleic acid comprising both one or more modified or unmodified ribonucleotides and one or more modified or unmodified deoxyribonucleotides, whether consecutive or not. However, by “DNA molecule” or “RNA molecule” it may also refer to a DNA molecule containing one or more modified or unmodified ribonucleotides, whether consecutive or not, or an RNA molecule containing one or more modified or unmodified deoxyribonucleotides, whether consecutive or not.
As used herein, the term “complex” refers to a grouping of two or more molecules. In some embodiments, the complex comprises a polypeptide and a nucleic acid interacting with (e.g., binding to, coming into contact with, adhering to) one another. As used herein, the term “complex” can refer to a grouping of a guide nucleic acid and a polypeptide (e.g., a Cas12f polypeptide). As used herein, the term “complex” can refer to a grouping of a guide nucleic acid, a polypeptide, and a target nucleic acid.
As used herein, the term “activity” refers to a biological activity. In some embodiments, the activity includes enzymatic activity, e.g., catalytic ability of an effector. For example, the activity can include nuclease activity, e.g., DNA nuclease activity, dsDNA endonuclease activity, guide sequence-specific (on-target) dsDNA endonuclease activity, guide sequence-independent (off-target) dsDNA endonuclease activity.
As used herein, the term “guide sequence-specific (on-target) dsDNA cleavage” may be termed as “dsDNA cleavage” for short unless otherwise indicated.
As used herein, the term “cleavage” refers to the breakage of the covalent backbone of a DNA molecule. Cleavage can be initiated by a variety of methods including, but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Both single-stranded cleavage and double-stranded cleavage are possible, and double-stranded cleavage can occur as a result of two distinct single-stranded cleavage events. DNA cleavage can result in the production of either blunt ends or cohesive ends.
As used herein, the meanings of “cleaving a nucleic acid” or “modifying a nucleic acid” may overlap. Modifying a nucleic acid includes not only modification of a mononucleotide but also insertion or deletion of a nucleic acid fragment.
As used herein, the term “on-target” refers to binding, cleavage, and/or editing of an intended or expected region of DNA, for example, by Cas12f of the disclosure.
As used herein, the term “off-target” refers to binding, cleavage, and/or editing of an unintended or unexpected region of DNA, for example, by Cas12f of the disclosure. In some embodiments, a region of DNA is an off-target region when it differs from the region of DNA intended or expected to be bound, cleaved and/or edited by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides.
As used herein, if a DNA sequence, for example, 5′-ATGC-3′ is transcribed to an RNA sequence, with each dT (deoxythymidine, or “T” for short) in the primary sequence of the DNA sequence replaced with a U (uridine) and each dA (deoxyadenosine, or “A” for short), dG (deoxyguanosine, or “G” for short), and dC (deoxycytidine, or “C” for short) replaced with A (adenosine), G (guanosine), and C (cytidine), respectively, for example, 5′-AUGC-3′, it is said in the disclosure that the DNA sequence “encodes” the RNA sequence.
As used herein, the term “protospacer adjacent motif’ or “PAM” refers to a short sequence (or a motif) adjacent to a protospacer sequence on the nontarget strand of a dsDNA recognized by CRISPR complexes.
As used herein, the term “adjacent” includes instances wherein there is no nucleotide between the protospacer sequence and the PAM and also instances wherein there are a small number (e.g., 1, 2, 3, 4, or 5) of nucleotides between the protospacer sequence and the PAM. As used herein, A “immediately adjacent (to)” B, A “immediately 5′ to” B, and A “immediately 3′ to” B mean that there is no nucleotide between A and B.
As described herein, the guide sequence is so designed to be capable of hybridizing to a target sequence. As used herein, the term “hybridize”, “hybridizing”, or “hybridization” refers to a reaction in which one or more polynucleotide sequences react to form a complex that is stabilized via hydrogen bonding between the bases of the one or more polynucleotide sequences. The hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner. A polynucleotide sequence capable of hybridizing to a given polynucleotide sequence is referred to as the “complement” of the given polynucleotide sequence. As used herein, the hybridization of a guide sequence and a target sequence is so stabilized to permit a Cas12f polypeptide that is complexed with a guide nucleic acid comprising the guide sequence or a function domain (e.g., a deaminase domain) associated (e.g., fused) with the Cas12f polypeptide to act (e.g., cleave, deaminize) at or near the target sequence or its complement (e.g., a sequence of a target DNA or its complement).
For the purpose of hybridization, in some embodiments, the guide sequence is reversely complementary to a target sequence. As used herein, the term “complementary” refers to the ability of nucleobases of a first polynucleotide sequence, such as a guide sequence, to base pair with nucleobases of a second polynucleotide sequence, such as a target sequence, by traditional Watson-Crick base-pairing. Two complementary polynucleotide sequences are able to non-covalently bind under appropriate temperature and solution ionic strength conditions. In some embodiments, a first polynucleotide sequence (e.g., a guide sequence) comprises 100% (fully) complementarity to a second nucleic acid (e.g., a target sequence). In some embodiments, a first polynucleotide sequence (e.g., a guide sequence) is complementary to a second polynucleotide sequence (e.g., a target sequence) if the first polynucleotide sequence comprises at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementarity to the second nucleic acid. As used herein, the term “substantially complementary” refers to a polynucleotide sequence (e.g., a guide sequence) that has a certain level of complementarity to a second polynucleotide sequence (e.g., a target sequence) such that the first polynucleotide sequence (e.g., a guide sequence) can hybridize to the second polynucleotide sequence (e.g., a target sequence) with sufficient affinity to permit a Cas12f polypeptide that is complexed with the first polynucleotide sequence or a nucleic acid comprising the first polynucleotide sequence or a function domain associated (e.g., fused) with the Cas12f polypeptide to act (e.g., cleave, deaminize) on the target sequence or its complement (e.g., a sequence of a target DNA or its complement). In some embodiments, a guide sequence that is substantially complementary to a target sequence has 100% or less than 100% complementarity to the target sequence. In some embodiments, a guide sequence that is substantially complementary to a target sequence has at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementarity to the target sequence.
As used herein, the term “identity” refers to the overall relatedness between polymeric molecules, e.g., between nucleic acid molecules (e.g., DNA molecules and/or RNA molecules) and/or between polypeptide molecules. In some embodiments, polymeric molecules are considered to be “substantially identical” to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. Calculation of the percent identity of two nucleic acid or polypeptide sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of a reference sequence. The nucleotides at corresponding positions are then compared. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. As is well known in the art, amino acid or nucleic acid sequences may be compared using any of a variety of algorithms, including those available in commercial computer programs such as BLASTN for nucleotide sequences and BLASTP, gapped BLAST, and PSI-BLAST for amino acid sequences. In some embodiments, the sequence identity is calculated by global alignment, for example, using the Needleman-Wunsch algorithm and an online tool at ebi.ac.uk/Tools/psa/emboss_needle/. In some embodiments, the sequence identity is calculated by local alignment, for example, using the Smith-Waterman algorithm and an online tool at ebi.ac.uk/Tools/psa/emboss_water/.
As used herein, the term “variant” refers to an entity that shows significant structural identity with a reference entity (e.g., a wild-type sequence) but differs structurally from the reference entity in the presence or level of one or more chemical moieties as compared with the reference entity. In many embodiments, a variant also differs functionally from its reference entity. In general, whether a particular entity is properly considered to be a “variant” of a reference entity is based on its degree of structural identity with the reference entity. As will be appreciated by those skilled in the art, any biological or chemical reference entity has certain characteristic structural elements. A variant, by definition, is a distinct chemical entity that shares one or more such characteristic structural elements. To give but a few examples, a polypeptide may have a characteristic sequence element comprising a plurality of amino acids having designated positions relative to one another in linear or three-dimensional space and/or contributing to a particular biological function; a nucleic acid may have a characteristic sequence element comprising a plurality of nucleotide residues having designated positions relative to one another in linear or three-dimensional space. For example, a variant polypeptide may differ from a reference polypeptide as a result of one or more differences in amino acid sequence and/or one or more differences in chemical moieties (e.g., carbohydrates, lipids, etc.) covalently attached to the polypeptide backbone. In some embodiments, a variant polypeptide shows an overall sequence identity with a reference polypeptide (e.g., a nuclease described herein) that is at least 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. Alternatively or additionally, in some embodiments, a variant polypeptide does not share at least one characteristic sequence element with a reference polypeptide. In some embodiments, the reference polypeptide has one or more biological activities. In some embodiments, a variant polypeptide shares one or more of the biological activities of the reference polypeptide, e.g., nuclease activity. In some embodiments, a variant polypeptide lacks one or more of the biological activities of the reference polypeptide. In some embodiments, a variant polypeptide shows a reduced level of one or more biological activities (e.g., nuclease activity, e.g., off-target nuclease activity) as compared with the reference polypeptide. In some embodiments, a polypeptide of interest is considered to be a “variant” of a parent or reference polypeptide if the polypeptide of interest has an amino acid sequence that is identical to that of the parent but for a small number of sequence alterations at particular positions. Typically, fewer than 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of the residues in the variant are substituted as compared with the parent or reference polypeptide. In some embodiments, a variant has 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 substituted residue as compared with a parent or reference polypeptide. Often, a variant has a very small number (e.g., fewer than 5, 4, 3, 2, or 1) of substituted functional residues (i.e., residues that participate in a particular biological activity). In some embodiments, a variant has not more than 5, 4, 3, 2, or 1 additions or deletions, and often has no additions or deletions, as compared with the parent or reference polypeptide. Moreover, any additions or deletions are typically fewer than about 25, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 12, about 11, about 10, about 9, about 8, about 7, about 6, and commonly are fewer than about 5, about 4, about 3, or about 2 residues. In some embodiments, the parent or reference polypeptide is a wild type. A variant of a polynucleotide or polypeptide may be naturally occurring such as an allelic variant, or it may be a variant that is not known to occur naturally. Non-naturally occurring variants of polynucleotides and polypeptides may be made by mutagenesis techniques, by direct synthesis, and by other recombinant methods known to skilled artisans.
As used herein, the terms “non-naturally occurring” and “engineered” are used interchangeably and refer to artificial participation. When these terms are used to describe a nucleic acid or a polypeptide, it is meant that the nucleic acid or polypeptide is at least substantially freed from at least one other component of its association in nature or as found in nature.
Conservative substitutions of non-critical amino acids of a protein may be made without affecting the normal functions of the protein. Conservative substitutions refer to the substitution of amino acids with chemically or functionally similar amino acids. In some embodiments, a conservative amino acid substitution refers to an amino acid substitution that does not alter the relative charge or size characteristics of the protein in which the amino acid substitution was made. In some embodiments, a “conservative substitution” refers to a substitution of an amino acid made among amino acids within the following groups: i) methionine, isoleucine, leucine, valine, ii) phenylalanine, tyrosine, tryptophan, iii) lysine, arginine, histidine, iv) alanine, glycine, v) serine, threonine, vi) glutamine, asparagine and vii) glutamic acid, aspartic acid.
As used herein, the term “wild type” has the meaning commonly understood by those skilled in the art to mean a typical form of an organism, a strain, a gene, or a feature that distinguishes it from a mutant or variant when it exists in nature. It can be isolated from sources in nature and not intentionally modified.
As used herein, the description of “a variant (e.g., a Cas12f polypeptide) comprising an amino acid mutation (e.g., substitution) at a given position (e.g., position 52) of a given polypeptide (e.g., SEQ ID NO: 1)” or similar description means that the polypeptide as set forth in the amino acid sequence of the given polypeptide serves as a parent or reference polypeptide, and the variant is a variant of the parent or reference polypeptide and comprises an amino acid mutation at a position of the amino acid sequence of the variant corresponding to the given position of the amino acid sequence of the given polypeptide. The position of the amino acid mutation in the amino acid sequence of the variant may be the same as the given position of the given polypeptide, for example, when the variant comprises just an amino acid substitution as compared with the given polypeptide and has the same length as the given polypeptide. The position of the amino acid mutation in the amino acid sequence of the variant may also be different from the given position of the given polypeptide, for example, when the variant comprises a N-terminal truncation as compared with the given polypeptide and the first N-terminal amino acid of the variant is not corresponding to the first N-terminal amino acid of the given polypeptide but to an amino acid within the given polypeptide, but the position of the amino acid mutation can be determined by alignment of the variant and the given polypeptide to identify the corresponding amino acids in their sequences as understood by a skilled in the art. For example, if the variant has a N-terminal truncation of 20 amino acids as compared with the given polypeptide, then the variant comprising an amino acid mutation at position 52 of a given polypeptide means that the variant comprises an amino acid mutation at position 32 of the variant since position 32 in the variant is corresponding to position 52 in the given polypeptide as determined by alignment of the variant and the given polypeptide.
As used herein, the description of “a variant (e.g., a Cas12f polypeptide) comprising a given amino acid substitution (e.g., D52R) relative to a given polypeptide (e.g., SEQ ID NO: 1)” means that the polypeptide as set forth in the amino acid sequence of the given polypeptide serves as a parent or reference polypeptide that does not comprise the given amino acid substitution, and the variant is a variant of the parent or reference polypeptide and comprises an amino acid substitution having the same type of substitution as the given amino acid substitution and at a position in the amino acid sequence of the variant corresponding to the position of the given amino acid substitution. For example, a Cas12f polypeptide comprising an amino acid substitution D52R relative to SEQ ID NO: 1 refers to the fact that the amino acid sequence of SEQ ID NO: 1 comprises amino acid D at position 52, and the Cas12f polypeptide comprises amino acid R at a position corresponding to position 52 of the amino acid sequence of SEQ ID NO: 1. The corresponding relationship of positions in two amino acid sequences as determined by alignment is explained in the previous paragraph.
As used herein, the terms “upstream” and “downstream” refer to relative positions within a single nucleic acid (e.g., DNA) sequence in a nucleic acid. “Upstream” and “downstream” relate to the 5′ to 3′ direction, respectively, in which transcription occurs. For a first sequence and a second sequence present on the same strand of a single nucleic acid written in 5′ to 3′ direction, the first sequence is upstream of the second sequence when the 3′ end of the first sequence is on the left side of the 5′ end of the second sequence, and the first sequence is downstream of the second sequence when the 5′ end of the first sequence is on the right side of the 3′ end of the second sequence. For example, a promoter is usually at the upstream of a sequence under the regulation of the promoter; and on the other hand, a sequence under the regulation of a promoter is usually at the downstream of the promoter.
As used herein, the term “regulatory element” refers to a DNA sequence that controls or impacts one or more aspects of transcription and/or expression is intended to include promoters, enhancers, silencers, termination signals, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals such as polyadenylation signals and poly-U sequences). Regulatory elements include those that direct constitutive expression of a nucleotide sequence in many types of host cells and those that direct expression of a nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). Regulatory elements may also direct expression in a time-dependent manner, e.g., in a cell cycle-dependent or developmental stage-dependent manner, which may or may not be tissue or cell type specific.
As used herein, the term “operably linked” refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. A regulatory element “operably linked” to a functional element is associated in such a way that transcription, expression, and/or activity of the functional element is achieved under conditions compatible with the regulatory element. In some embodiments, “operably linked” regulatory elements are contiguous (e.g., covalently linked) with the functional elements of interest; in some embodiments, regulatory elements act in trans to or otherwise at a distance from the functional elements of interest.
As used herein, the term “cell” is understood to refer not only to a particular individual cell, but to the progeny or potential progeny of the cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term.
As used herein, the term “in vivo” means inside the body of an organism, and the terms “ex vivo” or “in vitro” means outside the body of an organism.
As used herein, the term “treat”, “treatment”, or “treating” is an approach for obtaining beneficial or desired results including clinical results. For purposes of the disclosure, the beneficial or desired clinical results include, but are not limited to, one or more of the following: alleviating one or more symptoms resulting from a disease, diminishing the extent of a disease, stabilizing a disease (e.g., preventing or delaying the worsening of a disease), preventing or delaying the spread (e.g., metastasis) of a disease, preventing or delaying the recurrence of a disease, reducing recurrence rate of a disease, delay or slowing the progression of a disease, ameliorating a disease state, providing a remission (partial or total) of a disease, decreasing the dose of one or more other medications required to treat a disease, delaying the progression of a disease, increasing the quality of life, and prolonging survival. Also encompassed by the term is a reduction of pathological consequence of a disease (such as cancer). The methods of the disclosure contemplate any one or more of these aspects of treatment.
As used herein, the term “disease” includes the terms “disorder” and “condition” and is not limited to those specific diseases that have been medically or clinically defined.
As used herein, reference to “not” a value or parameter generally means and describes “other than” a value or parameter. For example, the method is not used to treat cancer of type X means the method may be used to treat cancer of types other than X.
As used herein, the singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise. That is, articles “a/an” and “the” are used herein to refer to one or more than one (i.e., at least one) grammatical object of the article. For example, “an element” means one element or more than one element, e.g., two elements.
As used herein, the term “and/or” in a phrase such as “A and/or B” is intended to mean either or both of the alternatives, including both A and B, A or B, A (alone), and B (alone). Likewise, the term “and/or” in a phrase such as “A, B, and/or C” is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).
As used herein, when the term “about” is ahead of a serious of numbers (for example, about 1, 2, 3), it is understood that each of the serious of numbers is modified by the term “about” (that is, about 1, about 2, about 3). The term “about X-Y” used herein has the same meaning as “about X to about Y.”
As used herein, the terms “about” and “approximately,” in reference to a number, is used herein to include numbers that fall within a range of 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% in either direction (greater than or less than) of the number unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
As used herein, a numerical range includes the end values of the range, and each specific value within the range, for example, “16 to 100 nucleotides” includes 16 nucleotides and 100 nucleotides, and each specific value between 16 and 100, e.g., 17, 23, 34, 52, 78.
As used herein, the terms “comprise”, “include”, “contain”, and “have” are to be understood as implying that a stated element or a group of elements is included, but not excluding any other element or a group of elements, unless the context requires otherwise. In certain embodiments, the terms “comprise”, “include”, “contain”, and “have” are used synonymously.
As used herein, the phrase “consist essentially of” is intended to include any element listed after the phrase “consist essentially of” and is limited to other elements that do not interfere with or contribute to the activities or actions specified in the disclosure of the listed elements. Thus, the phrase “consist essentially of” is intended to indicate that the listed elements are required, but no other elements are optional, and may or may not be present depending on whether they affect the activities or actions of the listed elements.
As used herein, the phrase “consist of” means including but limited to any element after the phrase “consist of”. Thus, the phrase “consist of” indicates that the listed elements are required, and that no other elements can be present.
As used herein, the term “comprises” also encompasses the terms “consists essentially of” and “consists of”. It is understood that the “comprising” embodiments of the disclosure described herein also include “consisting essentially of” and “consisting” embodiments.
Throughout the specification, reference to “one embodiment”, “embodiment”, “a specific embodiment”, “a related embodiment”, “an embodiment”, “another embodiment”, or “a further embodiment” or a combination thereof means that specific elements, features, structures, or characteristics described in connection with the embodiment are included in at least one embodiment of the disclosure. Accordingly, the appearances of the foregoing phrases in various places throughout the specification are not necessarily all referring to the same embodiments. Furthermore, specific elements, features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.
It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely”, “only”, and the like in connection with the recitation of claim elements, or use of a “negative” limitation.
An understanding of the features and advantages of the disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure may be utilized, and the accompanying drawings of which:
The figures herein are for illustrative purposes only and are not necessarily drawn to scale.
The disclosure provides Cas12f polypeptides, and Cas12f polypeptides with high spacer sequence-specific (on-target) dsDNA cleavage activity and/or low spacer sequence-independent (off-target) dsDNA cleavage activity based on parent or reference Cas12f polypeptides, and fusions and uses thereof.
In some embodiments, the parent or reference Cas12f polypeptide may be: (i) any one of SEQ ID NOs: 1-34 of the disclosure or a known Cas12f polypeptide, (ii) a naturally-occurring ortholog, paralog, or homolog of any one of (i); (iii) a Cas12f polypeptide having a sequence identity of at least about 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% to any one of (i) and (ii); or (iv) any mutant or variant of (i) to (iii). The parent or reference Cas12f polypeptide may be a wild type or not.
As representatives of the disclosure, in an aspect, the disclosure provides a Cas12f polypeptide comprising an amino acid sequence having a sequence identity of at least about 60% (e.g., at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) to any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31, and 32).
In some embodiments, the Cas12f polypeptide is not any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31, and 32).
In some aspects of the disclosure, the Cas12f polypeptide of the disclosure has or retains or has improved endonuclease activity against a target DNA for on-target DNA cleavage. Still for the purpose of on-target DNA cleavage, the Cas12f polypeptide of the disclosure may not only have on-target endonuclease activity but also substantially lack off-target endonuclease activity such that it can have specificity for a target DNA. On the other hand, the Cas12f polypeptide of the disclosure can be engineered to substantially lack endonuclease activity (either on-target or off-target) but retain its ability of complexing with a guide nucleic acid and thus being guided to a target DNA, so as to indirectly guide a functional domain associated with the Cas12f polypeptide to the target DNA. Therefore, the characterization of the Cas12f polypeptide of the disclosure is not limited to its ability of on-target DNA cleavage.
In some embodiments, the Cas12f polypeptide has a function (e.g., a modified function that is either increased or decreased compared to that) of any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31, and 32) (e.g., an ability to form a complex with a guide nucleic acid capable of forming a complex with any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31, and 32); and/or, a guide sequence-specific dsDNA cleavage activity).
In some embodiments, the Cas12f polypeptide has guide sequence-specific (on-target) dsDNA cleavage activity.
In some embodiments, the Cas12f polypeptide substantially retains the guide sequence-specific (on-target) dsDNA cleavage activity of any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31, and 32).
In some embodiments, the Cas12f polypeptide has an increased guide sequence-specific (on-target) dsDNA cleavage activity compared to that of any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31, and 32) when both are used in combination with a same guide nucleic acid, e.g., an increase by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, or more.
In some embodiments, the Cas12f polypeptide comprises an amino acid substitution at position 46, 49, 50, 52, 53, 54, 56, 57, 62, 63, 66, 70, 71, 72, 119, 120, 127, 132, 136, 141, 144, 146, 147, 148, 150, 264, 292, 293, 311, 313, 314, and/or 315 of SEQ ID NO: 1 (OsCas12f1 (ME-B.3)).
In some embodiments, the Cas12f polypeptide comprises an amino acid substitution at position 10, 11, 13, 14, 15, 17, 18, 19, 20, 27, 28, 31, 32, 40, 44, 47, 49, 51, 52, 55, 56, 59, 61, 63, 65, 68, 71, 84, 91, 94, 96, 99, 111, 112, 124, 125, 126, 127, 128, 129, 130, 131, 139, 140, 141, 146, 147, 150, 151, 156, 160, 163, 167, 170, 173, 178, 179, 180, 183, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 206, 215, 224, 225, 226, 227, 230, 235, 249, 254, 256, 257, 264, 265, 266, 269, 270, 272, 273, 276, 280, 283, 292, 295, 303, 309, 311, 313, 314, 316, 318, 319, 320, 321, 334, 337, 341, 344, 346, 349, 358, 363, 365, 366, 367, 368, 371, 372, 374, 375, 377, 380, 382, 393, 399, 403, 404, 406, 408, 409, 410, 411, 413, and/or 414 of SEQ ID NO: 2 (RhCas12f1 (ME-A.1)).
Typically, amino acid substitution is a substitution with a non-polar amino acid residue (such as, Glycine (Gly/G), Alanine (Ala/A), Valine (Val/V), Cysteine (Cys/C), Proline (Pro/P), Leucine (Leu/L), Isoleucine (Ile/I), Methionine (Met/M), Tryptophan (Trp/W), Phenylalanine (Phe/F), a polar amino acid residue (such as, Serine (Ser/S), Threonine (Thr/T), Tyrosine (Tyr/Y), Asparagine (Asn/N), Glutamine (Gln/Q)), a positively charged amino acid residue (such as, Lysine (Lys/K), Arginine (Arg/R), Histidine (His/H)), or a negatively charged amino acid residue (such as, Aspartic Acid (Asp/D), Glutamic Acid (Glue/E)).
In some embodiments, the amino acid substitution is a substitution with a positively charged amino acid residue (such as, Lysine (Lys/K), Arginine (Arg/R), Histidine (His/H)), and optionally a substitution with Arginine (Arg/R).
In some embodiments, the Cas12f polypeptide comprises an amino acid substitution D52R and/or T132R relative to SEQ ID NO: 1.
In some embodiments, the Cas12f polypeptide comprises substitutions D52R and T132R relative to SEQ ID NO: 1.
In some embodiments, the Cas12f polypeptide comprises the amino acid sequence of SEQ ID NO: 226, or an amino acid sequence having a sequence identity of at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) to the amino acid sequence of SEQ ID NO: 226.
In some embodiments, the Cas12f polypeptide comprises an amino acid substitution A56R, Y125R, S130R, T131R, I264R, L270R, and/or A273R relative to SEQ ID NO: 2.
In some embodiments, the Cas12f polypeptide comprises an amino acid substitution L270R relative to SEQ ID NO: 2.
In some embodiments, the Cas12f polypeptide comprises the amino acid sequence of SEQ ID NO: 227, or an amino acid sequence having a sequence identity of at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) to the amino acid sequence of SEQ ID NO: 227.
In some embodiments, the Cas12f polypeptide substantially lacks guide sequence-independent (off-target) dsDNA cleavage activity.
In some embodiments, the Cas12f polypeptide substantially lacks the guide sequence-independent (off-target) dsDNA cleavage activity of any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31, and 32).
In some embodiments, the Cas12f polypeptide has a decreased guide sequence-independent (off-target) dsDNA cleavage activity compared to that of any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31, and 32) when both are used in combination with a same guide nucleic acid, e.g., a decrease by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.
In some aspects, the disclosure provides a Cas12f polypeptide that is endonuclease deficient, which means the Cas12f polypeptide is substantially incapable of functioning as an endonuclease to cleave (either double strands or a single strand of) a dsDNA or a ssDNA, either against a target DNA or against a non-target DNA (For convenience of experiment design, performance, and evaluation, the defect of endonuclease activity is usually indicated by substantial loss of spacer sequence-specific dsDNA cleavage activity against a target DNA). Such a Cas12f polypeptide is named as “dead Cas12f (dCas12f)” and may be generated based on the parent or reference Cas12f polypeptide, for example, by mutating one or more functional domains of the parent or reference Cas12f polypeptide that is/are responsible for endonuclease activity.
In some embodiments, the Cas12f polypeptide is further engineered to substantially lack guide sequence-specific (on-target) dsDNA cleavage activity.
In some embodiments, the Cas12f polypeptide substantially lacks the guide sequence-specific (on-target) dsDNA cleavage activity of any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31, and 32).
In some embodiments, the Cas12f polypeptide has a decreased guide sequence-specific (on-target) dsDNA cleavage activity compared to that of any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31, and 32) when both used in combination with a same guide nucleic acid, e.g., a decrease by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.
In some embodiments, the Cas12f polypeptide comprises an amino acid substitution at position 44, 79, 81, 82, 125, 131, 133, 138, 149, 151, 153, 228, 268, 270, 271, 274, 275, 277, 279, 282, 287, 291, 305, 308, 312, and/or 406 of SEQ ID NO: 1.
In some embodiments, the Cas12f polypeptide comprises an amino acid substitution at position 4, 7, 9, 23, 30, 33, 34, 35, 37, 38, 39, 41, 42, 46, 60, 62, 67, 69, 72, 75, 76, 77, 78, 80, 81, 82, 86, 90, 93, 97, 98, 101, 105, 107, 108, 114, 116, 121, 123, 135, 137, 143, 145, 148, 162, 165, 177, 185, 187, 189, 190, 207, 208, 209, 210, 212, 216, 217, 218, 219, 220, 231, 243, 278, 289, 290, 293, 296, 297, 302, 305, 307, 308, 310, 326, 327, 328, 329, 332, 336, 340, 347, 350, 356, 359, 362, 376, 378, 381, 388, 390, 391, 392, 395, and/or 396 of SEQ ID NO: 2.
Typically, amino acid substitution is a substitution with a non-polar amino acid residue (such as, Glycine (Gly/G), Alanine (Ala/A), Valine (Val/V), Cysteine (Cys/C), Proline (Pro/P), Leucine (Leu/L), Isoleucine (Ile/I), Methionine (Met/M), Tryptophan (Trp/W), Phenylalanine (Phe/F), a polar amino acid residue (such as, Serine (Ser/S), Threonine (Thr/T), Tyrosine (Tyr/Y), Asparagine (Asn/N), Glutamine (Gln/Q)), a positively charged amino acid residue (such as, Lysine (Lys/K), Arginine (Arg/R), Histidine (His/H)), or a negatively charged amino acid residue (such as, Aspartic Acid (Asp/D), Glutamic Acid (Glue/E)).
In some embodiments, the amino acid substitution is a substitution with (1) a positively charged amino acid residue (such as, Lysine (Lys/K), Arginine (Arg/R), Histidine (His/H)), and optionally a substitution with Arginine (Arg/R); or (2) a non-polar amino acid residue (such as, Glycine (Gly/G), Alanine (Ala/A), Valine (Val/V), Cysteine (Cys/C), Proline (Pro/P), Leucine (Leu/L), Isoleucine (Ile/I), Methionine (Met/M), Tryptophan (Trp/W), Phenylalanine (Phe/F)), and optionally a substitution with Alanine (Ala/A).
In some embodiments, the Cas12f polypeptide comprises an amino acid substitution D228A and/or D406A relative to SEQ ID NO: 1.
In some embodiments, the Cas12f polypeptide comprises the amino acid sequence of SEQ ID NO: 221 or 222, or an amino acid sequence having a sequence identity of at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) to the amino acid sequence of SEQ ID NO: 221 or 222.
In some embodiments, the Cas12f polypeptide comprises amino acid substitutions D52R and T132R relative to SEQ ID NO: 1.
In some embodiments, the Cas12f polypeptide comprises amino acid substitutions D52R, T132R, D228A, and D406A relative to SEQ ID NO: 1.
In some embodiments, the Cas12f polypeptide comprises the amino acid sequence of SEQ ID NO: 513 (denOsCas12f1 (OsCas12f1-D52R+T132R+D228A+D406A)), or an amino acid sequence having a sequence identity of at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) to the amino acid sequence of SEQ ID NO: 513.
In some embodiments, the Cas12f polypeptide comprises an amino acid substitution D210A and/or D388A relative to SEQ ID NO: 2.
In some embodiments, the Cas12f polypeptide comprises the amino acid sequence of SEQ ID NO: 223 or 224, or an amino acid sequence having a sequence identity of at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) to the amino acid sequence of SEQ ID NO: 223 or 224.
In some embodiments, the Cas12f polypeptide comprises an amino acid substitution L270R relative to SEQ ID NO: 2.
In some embodiments, the Cas12f polypeptide comprises amino acid substitutions D210A, L270R, and D388A relative to SEQ ID NO: 2.
In some embodiments, the Cas12f polypeptide comprises the amino acid sequence of SEQ ID NO: 515 (denRhCas12f1 (RhCas12f1-D210A+L270R+D388A)), or an amino acid sequence having a sequence identity of at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) to the amino acid sequence of SEQ ID NO: 515.
In some aspects, the disclosure provides a Cas12f polypeptide that is not completely endonuclease deficient but the endonuclease activity is not against the double strand of a dsDNA but against one strand (the sense or nonsense strand; or the target or nontarget strand) of a dsDNA or a ssDNA, which means the Cas12f polypeptide is substantially incapable of functioning as a dsDNA endonuclease to cleave double strands of a dsDNA, either against a target DNA or against a non-target DNA, but is substantially capable of functioning as a ssDNA endonuclease to cleave a ssDNA or “nick” one strand of a dsDNA. Such a Cas12f polypeptide is named as “nickase” and may be generated based on the parent or reference Cas12f polypeptide, for example, by mutating one or more functional domains of the parent or reference Cas12f polypeptide that is/are responsible for endonuclease activity.
In some embodiments, the Cas12f polypeptide is further engineered to be a nickase.
In some aspects, the disclosure provides a fusion protein comprising the Cas12f polypeptide and a functional domain. In some embodiments, the functional domain is a heterologous functional domain. Such a function protein may also be regarded as a Cas12f polypeptide further comprising a functional domain fused to the Cas12f polypeptide.
In some embodiments, the Cas12f polypeptide further comprises a functional domain fused to the Cas12f polypeptide.
In some embodiments, the functional domain is selected from the group consisting of a nuclear localization signal (NLS), a nuclear export signal (NES), a base editing domain, for example, a deaminase or a catalytic domain thereof, a base excising domain, an uracil glycosylase inhibitor (UGI) or a catalytic domain thereof, an uracil glycosylase (UNG) or a catalytic domain thereof, a methylpurine glycosylase (MPG) or a catalytic domain thereof, a methylase or a catalytic domain thereof, a demethylase or a catalytic domain thereof, an transcription activating domain (e.g., VP64 or VPR), an transcription inhibiting domain (e.g., KRAB moiety or SID moiety), a reverse transcriptase or a catalytic domain thereof, an exonuclease (e.g., T5E (SEQ ID NO: 449)) or a catalytic domain thereof, a destabilized domain (e.g., destabilized domains (DD) of E. coli dihydrofolate reductase (ecDHFR)), a histone residue modification domain, a nuclease catalytic domain (e.g., FokI), a transcription modification factor, a light gating factor, a chemical inducible factor, a chromatin visualization factor, a targeting polypeptide for providing binding to a cell surface portion on a target cell or a target cell type, a reporter (e.g., fluorescent) polypeptide or a detection label (e.g., GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, BFP), a localization signal, a polypeptide targeting moiety, a DNA binding domain (e.g., MBP, Lex A DBD, Gal4 DBD), an epitope tag (e.g., His, myc, V5, FLAG, HA, VSV-G, Trx, etc), a transcription release factor, an HDAC, a moiety having ssRNA cleavage activity, a moiety having dsRNA cleavage activity, a moiety having ssDNA cleavage activity, a moiety having dsDNA cleavage activity, a DNA or RNA ligase, a functional domain exhibiting activity to modify a target DNA, selected from the group consisting of: methyltransferase activity, DNA repair activity, DNA damage activity, dismutase activity, alkylation activity, dealkylation activity, depurination activity, oxidation activity, deoxidation activity, pyrimidine dimer forming activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolyase activity, glycosylase activity, acetyl transferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity, deubiquitination activity, adenylation activity, deadenylation activity, SUMOylation activity, deSUMOylation activity, ribosylation activity, deribosylation activity, myristoylation activity, demyristoylation activity, glycosylation activity (e.g., from O-GlcNAc transferase), deglycosylation activity, and a catalytic domain thereof, and a functional fragment (e.g., a functional truncation) thereof, and any combination thereof.
In some embodiments, the NLS comprises or is SV40 NLS (such as, SEQ ID NO: 216; coded by, such as, SEQ ID NO: 217), bpSV40 NLS (BP NLS, bpNLS), or NP NLS (Xenopus laevis Nucleoplasmin NLS, nucleoplasmin NLS) (such as, SEQ ID NO: 218; coded by, such as, SEQ ID NO: 219).
In some embodiments, the base editing domain is capable of substituting a base of a nucleotide with a different base.
In some embodiments, the base editing domain is capable of deaminating a base of a nucleotide.
In some embodiments, the base editing domain comprises a deaminase domain capable of deaminating a base (e.g., an adenine, a guanine, a cytosine, a thymine, an uracil) of a nucleotide. In some embodiments, the deaminase domain is capable of deaminating an adenine (A) to a hypoxanthine (I). In some embodiments, the deamination of the adenine to the hypoxanthine converts the adenosine (A) or deoxyadenosine (dA) containing the adenine to a guanosine (G) or deoxyguanosine (dG). In some embodiments, the deaminase domain is capable of deaminating a cytosine (C) to an uracil (U). In some embodiments, the deamination of the cytosine to the uracil converts the cytidine (C) or deoxycytidine (dC) containing the cytosine to a uridine (U) or a deoxythymidine (dT).
In some embodiments, the base editing domain is capable of excising a base (e.g., an adenine, a guanine, a cytosine, a thymine, an uracil) of a nucleotide.
In some embodiments, the base editing domain comprises a base excising domain capable of excising a base of a nucleotide.
In some embodiments, the base editing domain comprises a deaminase domain and a base excising domain.
In some embodiments, the deaminase domain is tRNA adenosine deaminase (TadA), or the deaminase domain thereof, or a functional variant or fragment thereof, e.g., TadA8e, TadA8.17, TadA8.20, TadA9, TadA8EV106W, TadA8EV106W+D108Q TadA-CDa, TadA-CDb, TadA-CDc, TadA-CDd, TadA-CDe, TadA-dual, TADAC-1.2, TADAC-1.14, TADAC-1.17, TADAC-1.19, TADAC-2.5, TADAC-2.6, TADAC-2.9, TADAC-2.19, TADAC-2.23, TadA8e-N46L, TadA8e-N46P.
In some embodiments, the deaminase domain is an apolipoprotein B mRNA-editing complex (APOBEC) family deaminase, an activation induced deaminase (AID), a cytidine deaminase 1 from Petromyzon marinus (pmCDA1), or the deaminase domain thereof, or a functional variant or fragment thereof, e.g., APOBEC1, APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D, APOBEC3F, APOBEC3G, APOBEC3H.
In some embodiments, the deaminase or catalytic domain thereof is an adenine deaminase (e.g., TadA, such as, TadA8e, TadA8.17, TadA8.20, TadA9) or a catalytic domain thereof, for example, TadA8e-V106W, TadA8e-W106V.
In some embodiments, the deaminase or catalytic domain thereof is a cytidine deaminase (e.g., APOBEC, such as, APOBEC3, for example, APOBEC3A, APOBEC3B, APOBEC3C; DddA) or a catalytic domain thereof, for example, hAPOBEC3-W104A.
In some embodiments, the UGI is human UGI domain.
In some embodiments, the Cas12f polypeptide comprises amino acid substitutions D52R, T132R, D228A, and D406A relative to SEQ ID NO: 1, and a base editing domain, for example, a deaminase or a catalytic domain thereof.
In some embodiments, the Cas12f polypeptide comprises the amino acid sequence of any one of SEQ ID NOs: 260-265, or an amino acid sequence having a sequence identity of at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) to the amino acid sequence of any one of SEQ ID NOs: 260-265.
In some embodiments, the functional domain comprises a reverse transcriptase (RT) or a catalytic domain thereof. In some embodiments, the guide nucleic acid further comprises or is used in combination with a reverse transcription donor RNA (RT donor RNA) comprising a primer binding site (PBS) and a template sequence. For details of prime editing with Class 2, Type V Cas proteins, references is made to WO2022256440A3, which is incorporated herein by reference in its entirety.
The Cas12f polypeptide of the disclosure may be used in combination with and guided by a guide nucleic acid to a target DNA to function on the target DNA.
In another aspect, the disclosure provides a system comprising:
In some embodiments, the system is a non-naturally occurring or engineered system.
In some embodiments, the system is a complex comprising the Cas12f polypeptide complexed with the guide nucleic acid. In some embodiments, the complex further comprises the target DNA hybridized with the target sequence.
In some embodiments, the Cas12f polypeptide comprises an amino acid sequence having a sequence identity of at least about 60% (e.g., at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) to any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31, and 32).
In some embodiments, the Cas12f polypeptide is a mutant of any one of SEQ ID NOs: 1-34 (optionally any one of SEQ ID NOs: 1, 2, 4, 5, 15, 28, 29, 31, and 32) as described herein.
In another aspect, the disclosure provides a guide nucleic acid comprising:
In some embodiments, the guide nucleic acid is a guide RNA (gRNA), e.g., a single guide RNA (sgRNA). In some embodiments, the guide nucleic acid comprises a crRNA. In some embodiments, the guide nucleic acid comprises a tracrRNA.
In some embodiments, the scaffold sequence is 5′ to the spacer sequence.
In some embodiments, the guide nucleic acid further comprises a polyU sequence having at least four consecutive U (uridine) 3′ to the guide sequence.
In some embodiments, the polyU sequence further comprises one A (adenosine) downstream of the at least four consecutive U.
In some embodiments, the sequence encoding the polyU sequence comprises a sequence having a sequence identity of at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) to the sequence of SEQ ID NO:220; or a sequence having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide differences, whether consecutive or not, compared to the sequence of SEQ ID NO: 220.
For the purpose of the disclosure, in some embodiments, the protospacer sequence or target sequence is located such that the target DNA is specifically modified by the Cas12f polypeptide.
To facilitate the evaluation of selected protospacer sequences or target sequence and designed guide sequences in mouse models, in some embodiments, the protospacer sequence or target sequence is located such that a mouse target DNA is specifically modified by the Cas12f polypeptide. In some embodiments, the protospacer sequence or target sequence is located such that both a human target DNA and a mouse target DNA are specifically modified by the Cas12f polypeptide. That is, the protospacer sequence or target sequence is selected to be cross-reactive to both human and mouse species.
In some embodiments, the protospacer sequence is a stretch of contiguous nucleotides identified from the nontarget strand of the target DNA by identifying the stretch of contiguous nucleotides immediately 3′ to the PAM on the nontarget strand. In some embodiments, the PAM is 5′-TTN or 5′-CCN, wherein N is A, T, G, or C. The protospacer sequence is the reversely complementary sequence of the target sequence.
In some embodiments, the protospacer sequence is a stretch of about or at least about 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, or more contiguous nucleotides of the target DNA, or a stretch of contiguous nucleotides of the target DNA in a numerical range between any two of the preceding values, e.g., a stretch of from about 16 to about 50, or from about 17 to about 22 contiguous nucleotides. In some embodiments, the protospacer sequence is a stretch of about 20 contiguous nucleotides of the target DNA.
In some embodiments, the protospacer sequence comprises about or at least about 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, or more contiguous nucleotides of the target DNA, or contiguous nucleotides in a numerical range between any two of the preceding values, e.g., from about 16 to about 50, or from about 17 to about 22 contiguous nucleotides of the target DNA. In some embodiments, the protospacer sequence comprises about 20 contiguous nucleotides of the target DNA.
In some embodiments, the target sequence is a stretch of contiguous nucleotides identified from the target strand of the target DNA. The target sequence is the reversely complementary sequence of the protospacer sequence.
In some embodiments, the target sequence is a stretch of about or at least about 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, or more contiguous nucleotides on the target strand of the target DNA, or a stretch of contiguous nucleotides on the target strand of the target DNA in a numerical range between any two of the preceding values, e.g., a stretch of from about 16 to about 50, or from about 17 to about 22 contiguous nucleotides. In some embodiments, the target sequence is a stretch of about 20 contiguous nucleotides on the target strand of the target DNA.
In some embodiments, the target sequence comprises about or at least about 16 contiguous nucleotides of the target DNA, e.g., about or at least about 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, or more contiguous nucleotides of the target DNA, or in a numerical range between any two of the preceding values, e.g., from about 16 to about 50, or from about 17 to about 22 contiguous nucleotides of the target DNA. In some embodiments, the target sequence comprises about 20 contiguous nucleotides of the target DNA.
In some embodiments, the target sequence comprises about or at least about 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, or more contiguous nucleotides on the target strand of the target DNA, or contiguous nucleotides in a numerical range between any two of the preceding values, e.g., from about 16 to about 50, or from about 17 to about 22 contiguous nucleotides on the target strand of the target DNA. In some embodiments, the target sequence comprises about 20 contiguous nucleotides on the target strand of the target DNA.
In some embodiments, the nontarget strand is the sense strand of the target DNA.
In some embodiments, the nontarget strand is the antisense strand of the target DNA.
In some embodiments, the target strand is the sense strand of the target DNA.
In some embodiments, the target strand is the antisense strand of the target DNA.
In some embodiments, the protospacer sequence or target sequence is located within Exon 1 of the target DNA.
In some embodiments, the protospacer sequence or target sequence is located within about 50, 100, 150, 200, 250, 300, or more 5′ end nucleotides of Exon 1 of the target DNA.
In some embodiments, the target DNA comprises a pathogenic mutation.
In some embodiments, the target DNA comprises a premature stop codon (e.g., TAG).
In some embodiments, the target DNA is a dsDNA, such as, a eukaryotic dsDNA, e.g., a gene in a eukaryotic cell.
In some embodiments, the target DNA is human target DNA, non-human primate target DNA, or mouse target DNA.
In some embodiments, the target DNA is in a eukaryotic cell, for example, a human cell, a non-human primate cell, or a mouse cell.
In some embodiments, the guide sequence is about or at least about 16 nucleotides in length, e.g., about or at least about 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, or more nucleotides in length, or in a length of a numerical range between any two of the preceding values, e.g., in a length of from about 16 to about 50 nucleotides, or from about 17 to about 22 nucleotides. In some embodiments, the guide sequence is about 20 nucleotides in length.
In some embodiments, (1) the guide sequence is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% (fully), optionally about 100% (fully), reversely complementary to the target sequence; (2) the guide sequence contains no more than 5, 4, 3, 2, or 1 mismatch or contains no mismatch with the target sequence; or (3) the guide sequence comprises no mismatch with the target sequence in the first 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 nucleotides at the 5′ end of the guide sequence. In some embodiments, the guide sequence is about 100% (fully), reversely complementary to the target sequence.
In some embodiments, the protospacer sequence, the target sequence, or the guide sequence is selected such that the target DNA is modified by the system of the disclosure. In some embodiments, the modification decreases or eliminates the transcription of the target DNA and/or translation of a transcript (e.g., mRNA) of the target DNA.
In some embodiments, the level of the transcript (e.g., mRNA) of the target DNA is decreased in a cell model (e.g., HEK293T cell model) or an animal model (e.g., a mouse model, a non-human primate model) by at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, or more, upon administration of the system of the disclosure to the cell model or the animal model, compared to the level of the transcript (e.g., mRNA) of the target DNA in the same cell model or animal model that does not receive the administration.
In some embodiments, the level of the transcript (e.g., mRNA) of the target DNA is increased in a cell model (e.g., HEK293T cell model) or an animal model (e.g., a mouse model, a non-human primate model) by at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, or more, upon administration of the system of the disclosure to the cell model or the animal model, compared to the level of the transcript (e.g., mRNA) of the target DNA in the same cell model or animal model that does not receive the administration.
In some embodiments, the level of the expression product (e.g., protein) of the target DNA is decreased in a cell model (e.g., HEK293T cell model) or an animal model (e.g., a mouse model, a non-human primate model) by at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, or more, upon administration of the system of the disclosure to the cell or the animal model, compared to the level of the expression product (e.g., protein) of the target DNA in the same cell model or animal model that does not receive the administration.
In some embodiments, the level of the expression product (e.g., protein) of the target DNA is increased in a cell model (e.g., HEK293T cell model) or an animal model (e.g., a mouse model, a non-human primate model) by at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, or more, upon administration of the system of the disclosure to the cell or the animal model, compared to the level of the expression product (e.g., protein) of the target DNA in the same cell model or animal model that does not receive the administration. In some embodiments, the expression product is a functional mutant of the expression product of the target DNA.
In some embodiments, the guide nucleic acid is a single molecule.
In some embodiments, the guide nucleic acid comprises one guide sequence capable of hybridizing to one target sequence.
In some embodiments, the guide nucleic acid comprises a plurality (e.g., 2, 3, 4, 5 or more) of the guide sequences capable of hybridizing to a plurality of the target sequences, respectively.
In some embodiments, the guide nucleic acid comprises, from 5′ to 3′, the direct repeat sequence, the guide sequence, the direct repeat sequence, the guide sequence, and the direct repeat sequence.
In some embodiments, the guide nucleic acid comprises one scaffold sequence and one guide sequence.
In some embodiments, the guide nucleic acid comprises one scaffold sequence 5′ to one guide sequence. In some embodiments, the guide nucleic acid comprises one scaffold sequence 3′ to one guide sequence.
In some embodiments, the guide nucleic acid comprises one or more scaffold sequence and/or one or more guide sequence, provided that the guide nucleic acid does not comprise one scaffold sequence and one guide sequence.
In some embodiments, the guide nucleic acid comprises, from 5′ to 3′, one scaffold sequence, one guide sequence, and one scaffold sequence, wherein scaffold sequences are the same or different.
In some embodiments, the guide nucleic acid comprises, from 5′ to 3′, one guide sequence, one scaffold sequence, and one guide sequence, wherein guide sequences are the same or different.
In some embodiments, the guide nucleic acid comprises, from 5′ to 3′, one scaffold sequence, one guide sequence, one scaffold sequence, and one guide sequence, wherein scaffold sequences are the same or different, and wherein guide sequences are the same or different.
In some embodiments, the guide nucleic acid comprises, from 5′ to 3′, one guide sequence, one scaffold sequence, one guide sequence, and one scaffold sequence, wherein scaffold sequences are the same or different, and wherein guide sequences are the same or different.
In some embodiments, the guide nucleic acid comprises, from 5′ to 3′, one scaffold sequence, one guide sequence, one scaffold sequence, one guide sequence, and one scaffold sequence, wherein scaffold sequences are the same or different, and wherein guide sequences are the same or different.
In some embodiments, the guide nucleic acid comprises, from 5′ to 3′, one guide sequence, one scaffold sequence, one guide sequence, one scaffold sequence, and one guide sequence, wherein scaffold sequences are the same or different, and wherein guide sequences are the same or different.
In some embodiments, the guide nucleic acid comprises, from 5′ to 3′, one scaffold sequence, one guide sequence, one scaffold sequence, one guide sequence, one scaffold sequence, and one guide sequence, wherein scaffold sequences are the same or different, and wherein guide sequences are the same or different.
In some embodiments, the guide nucleic acid comprises, from 5′ to 3′, one guide sequence, one scaffold sequence, one guide sequence, one scaffold sequence, one guide sequence, and one scaffold sequence, wherein scaffold sequences are the same or different, and wherein guide sequences are the same or different.
In some embodiments, the guide nucleic acid comprises a linker or no linker between any adjacent scaffold sequence and guide sequence. In some embodiments, the guide nucleic acid comprises no linker between any adjacent scaffold sequence and guide sequence.
The system of the disclosure may comprise or encode one guide nucleic acid or comprise or encode multiple (e.g., 2, 3, 4, or more) guide nucleic acids, e.g., for the purpose of improving the editing efficiency of the system on target DNA.
In some embodiments, the system further comprises one or more additional guide nucleic acids, or the first polynucleotide sequence further comprises one or more additional sequences encoding one or more additional guide nucleic acids, each of the additional guide nucleic acids comprising:
In some embodiments, the additional protospacer sequence is on the same strand as the protospacer sequence.
In some embodiments, the additional protospacer sequence is on the different strand from the protospacer sequence.
In some embodiments, the additional protospacer sequence is the same or different from the protospacer sequence.
In some embodiments, the additional target sequence is the same or different from the target sequence.
In some embodiments, the additional guide sequence is the same or different from the guide sequence.
In some embodiments, the additional scaffold sequence is the same or different from the scaffold sequence. In some embodiments wherein the system comprises the same Cas12f polypeptide and multiple guide nucleic acids, the scaffold sequences of the multiple guide nucleic acids may be the same or different (e.g., different by no more than 5, 4, 3, 2, or 1 nucleotide) to be compatible to the same Cas12f polypeptide. In some embodiments wherein that the system comprises different Cas12f polypeptides and multiple guide nucleic acids, the scaffold sequences of the multiple guide nucleic acids may be different to be compatible to the different Cas12f polypeptides.
In some embodiments, the additional guide nucleic acid and the guide nucleic acid are operably linked to or under the regulation of the same regulatory element (e.g., promoter) or separate regulatory elements (e.g., promoters).
In some embodiments, the system comprises two or more guide nuclei acids comprising two or more guide sequences capable of hybridizing to two or more target sequences of the same target DNA or different target DNAs, wherein the two or more guide sequences are the same or different, and wherein the two or more target sequences are the same or different.
In some embodiments, the guide nucleic acid (e.g., the guide nucleic acid, the additional guide nucleic acid) is an RNA. In some embodiments, the guide nucleic acid is an unmodified guide RNA. In some embodiments, the guide nucleic acid is a modified guide RNA. In some embodiments, the guide nucleic acid comprises a modification. In some embodiments, the guide nucleic acid is a modified RNA containing a modified ribonucleotide. In some embodiments, the guide nucleic acid is a modified RNA containing a deoxyribonucleotide. In some embodiments, the guide nucleic acid is a modified RNA containing a modified deoxyribonucleotide. In some embodiments, the guide nucleic acid comprises a modified or unmodified deoxyribonucleotide and a modified or unmodified ribonucleotide.
For the purpose of the disclosure, the scaffold sequence is compatible with the Cas12f polypeptide of the disclosure and is capable of complexing with the Cas12f polypeptide. The scaffold sequence may be a naturally occurring scaffold sequence identified along with the Cas12f polypeptide, or a variant thereof maintaining the ability to complex with the Cas12f polypeptide. Generally, the ability to complex with the Cas12f polypeptide is maintained as long as the secondary structure of the variant is substantially identical to the secondary structure of the naturally occurring scaffold sequence. A nucleotide deletion, insertion, or substitution in the primary sequence of the scaffold sequence may not necessarily change the secondary structure of the scaffold sequence (e.g., the relative locations and/or sizes of the stems, bulges, and loops of the scaffold sequence do not significantly deviate from that of the original stems, bulges, and loops). For example, the nucleotide deletion, insertion, or substitution may be in a bulge or loop region of the scaffold sequence so that the overall symmetry of the bulge and hence the secondary structure remains largely the same. The nucleotide deletion, insertion, or substitution may also be in the stems of the scaffold sequence so that the lengths of the stems do not significantly deviate from that of the original stems (e.g., adding or deleting one base pair in each of two stems correspond to 4 total base changes).
Referring to
In some embodiments, the scaffold sequence comprises a tracrRNA sequence of any one of SEQ ID NOs: 111-144.
In some embodiments, the scaffold sequence comprises a repeat sequence of any one of SEQ ID NOs: 145-178.
In some embodiments, the crRNA sequence comprises a repeat sequence of any one of SEQ ID NOs: 145-178 and a guide sequence.
In some embodiments, the tracrRNA sequence comprises an anti-repeat sequence at its 3′ end that can form a duplex with the repeat sequence.
The repeat sequence is derived from the direct repeat (DR) sequence identified along with the cognate Cas12f polypeptide. In some embodiments, the repeat sequence is derived from the direct repeat sequence of any one of SEQ ID NOs: 179-212.
In some embodiments, the scaffold sequence or the additional scaffold sequence has substantially the same secondary structure as the secondary structure of any one of SEQ ID NOs: 73-106 (optionally any one of SEQ ID NOs: 73, 74, 76, 77, 87, 100, 101, 103, and 104).
In some embodiments, the scaffold sequence or the additional scaffold sequence:
Engineering or optimization strategy may be applied to the scaffold sequence of the guide nucleic acid of the disclosure to assist in the on-target cleavage by the Cas12f polypeptide of the disclosure.
In some embodiments, the scaffold sequence leads to an increased guide sequence-specific (on-target) dsDNA cleavage activity compared to that led by any one of SEQ ID NOs: 73-106 (optionally any one of SEQ ID NOs: 73, 74, 76, 77, 87, 100, 101, 103, and 104) when both are used in otherwise identical guide nucleic acid in combination with a same Cas12f polypeptide (e.g., the Cas12f polypeptide of any preceding claim), e.g., an increase by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, or more.
In some embodiments, the scaffold sequence comprises a base pair substitution of a thermodynamically unstable base pair (e.g., a A-U base pair or a mismatched base pair) with a G-C base pair.
In some embodiments, the scaffold sequence comprises a base pair substitution of a thermodynamically unstable base pair (e.g., a A-U base pair or a mismatched base pair) with a G-C base pair relative to SEQ ID NO: 73 and comprises the polynucleotide sequence of any one of SEQ ID NOs: 234-236, 239-242, 244-247, and 250-251, or a polynucleotide sequence having a sequence identity of at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) to the polynucleotide sequence of any one of SEQ ID NOs: 234-236, 239-242, 244-247, and 250-251; optionally, wherein the scaffold sequence comprises the polynucleotide sequence of SEQ ID NO: 244.
In some embodiments, the scaffold sequence comprises a base pair substitution of a thermodynamically unstable base pair (e.g., a A-U base pair or a mismatched base pair) with a G-C base pair relative to SEQ ID NO: 74 and comprises the polynucleotide sequence of SEQ ID NO: 257, or a polynucleotide sequence having a sequence identity of at least about 80% (e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%) to the polynucleotide sequence of SEQ ID NO: 257.
The scaffold sequence of the guide nucleic acid of the disclosure is required to be compatible with the Cas12f polypeptide of the disclosure so as to allow the complexing of the Cas12f polypeptide of the disclosure and the guide nucleic acid of the disclosure. One scaffold sequence may be compatible with several Cas12f polypeptides, and vice versa. Non-limiting combinations are provided in below.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 1 or a mutant thereof as defined in any preceding claim (e.g., SEQ ID NO: 226), and wherein the scaffold sequence comprises SEQ ID NO: 73 or a mutant thereof as defined in any preceding claim (e.g., SEQ ID NO: 244).
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 2 or a mutant thereof as defined in any preceding claim (e.g., SEQ ID NO: 227), and wherein the scaffold sequence comprises SEQ ID NO: 74 or a mutant thereof as defined in any preceding claim (e.g., SEQ ID NO: 257).
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 3 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 75 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 4 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 76 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 5 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 77 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 6 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 78 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 7 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 79 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 8 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 80 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 9 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 81 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 10 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 82 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 11 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 83 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 12 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 84 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 13 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 85 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 14 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 86 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 15 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 87 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 16 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 88 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 17 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 89 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 18 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 90 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 19 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 91 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 20 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 92 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 21 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 93 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 22 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 94 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 23 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 95 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 24 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO:96 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 25 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 97 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 26 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 98 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 27 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 99 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 28 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 100 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 29 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 101 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 30 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 102 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 31 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 103 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 32 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 104 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 33 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 105 or a mutant thereof as defined in any preceding claim.
In some embodiments, the Cas12f polypeptide comprises SEQ ID NO: 34 or a mutant thereof, and wherein the scaffold sequence comprises SEQ ID NO: 106 or a mutant thereof as defined in any preceding claim.
In some embodiments, the polynucleotide encoding the guide nucleic acid is a DNA, a RNA, or a DNA/RNA mixture. By “DNA/RNA mixture” it refers to a nucleic acid comprising both one or more modified or unmodified ribonucleotides and one or more modified or unmodified deoxyribonucleotides, whether consecutive or not. However, by “DNA” or “RNA” it may also refer to a DNA containing one or more modified or unmodified ribonucleotides, whether consecutive or not, or an RNA containing one or more modified or unmodified deoxyribonucleotides, whether consecutive or not.
In some embodiments, the guide nucleic acid is operably linked to or under the regulation of a promoter.
In some embodiments, the promoter is a ubiquitous, tissue-specific, cell-type specific, constitutive, or inducible promoter.
Suitable promoters are known in the art and include, for example, a Cbh promoter, a Cba promoter, a pol I promoter, a pol II promoter, a pol III promoter, a T7 promoter, a U6 promoter, a H1 promoter, a retroviral Rous sarcoma virus LTR promoter, a cytomegalovirus (CMV) promoter, a SV40 promoter, a dihydrofolate reductase promoter, a β-actin promoter, an elongation factor 1α short (EFS) promoter, a β glucuronidase (GUSB) promoter, a cytomegalovirus (CMV) immediate-early (Ie) enhancer and/or promoter, a chicken β-actin (CBA) promoter or derivative thereof such as a CAG promoter, CB promoter, a (human) elongation factor 1α-subunit (EF1α) promoter, a ubiquitin C (UBC) promoter, a prion promoter, a neuron-specific enolase (NSE), a neurofilament light (NFL) promoter, a neurofilament heavy (NFH) promoter, a platelet-derived growth factor (PDGF) promoter, a platelet-derived growth factor B-chain (PDGF-β) promoter, a synapsin (Syn) promoter, a synapsin 1 (Syn1) promoter, a methyl-CpG binding protein 2 (MeCP2) promoter, a Ca2+/calmodulin-dependent protein kinase II (CaMKII) promoter, a metabotropic glutamate receptor 2 (mGluR2) promoter, a neurofilament light (NFL) promoter, a neurofilament heavy (NFH) promoter, a β-globin minigene nβ2 promoter, a preproenkephalin (PPE) promoter, an enkephalin (Enk) promoter, an excitatory amino acid transporter 2 (EAAT2) promoter, a glial fibrillary acidic protein (GFAP) promoter, and a myelin basic protein (MBP) promoter.
In some embodiments, the polynucleotide encoding the Cas12f polypeptide is a DNA, a RNA, or a DNA/RNA mixture. By “DNA/RNA mixture” it refers to a nucleic acid comprising both one or more modified or unmodified ribonucleotides and one or more modified or unmodified deoxyribonucleotides, whether consecutive or not. However, by “DNA” or “RNA” it may also refer to a DNA containing one or more modified or unmodified ribonucleotides, whether consecutive or not, or an RNA containing one or more modified or unmodified deoxyribonucleotides, whether consecutive or not.
In some embodiments, the polynucleotide encoding the Cas12f polypeptide is operably linked to or under the regulation of a promoter.
In some embodiments, the promoter is a ubiquitous, tissue-specific, cell-type specific, constitutive, or inducible promoter.
Suitable promoters are known in the art and include, for example, a Cbh promoter, a Cba promoter, a pol I promoter, a pol II promoter, a pol III promoter, a T7 promoter, a U6 promoter, a H1 promoter, a retroviral Rous sarcoma virus LTR promoter, a cytomegalovirus (CMV) promoter, a SV40 promoter, a dihydrofolate reductase promoter, a β-actin promoter, an elongation factor 1α short (EFS) promoter, a β glucuronidase (GUSB) promoter, a cytomegalovirus (CMV) immediate-early (Ie) enhancer and/or promoter, a chicken β-actin (CBA) promoter or derivative thereof such as a CAG promoter, CB promoter, a (human) elongation factor 1α-subunit (EF1α) promoter, a ubiquitin C (UBC) promoter, a prion promoter, a neuron-specific enolase (NSE), a neurofilament light (NFL) promoter, a neurofilament heavy (NFH) promoter, a platelet-derived growth factor (PDGF) promoter, a platelet-derived growth factor B-chain (PDGF-β) promoter, a synapsin (Syn) promoter, a human synapsin (hSyn) promoter, a synapsin 1 (Syn1) promoter, a methyl-CpG binding protein 2 (MeCP2) promoter, a Ca2+/calmodulin-dependent protein kinase II (CaMKII) promoter, a metabotropic glutamate receptor 2 (mGluR2) promoter, a neurofilament light (NFL) promoter, a neurofilament heavy (NFH) promoter, a β-globin minigene nβ2 promoter, a preproenkephalin (PPE) promoter, an enkephalin (Enk) promoter, an excitatory amino acid transporter 2 (EAAT2) promoter, a glial fibrillary acidic protein (GFAP) promoter, a myelin basic protein (MBP) promoter, a OTOF promoter, a GRK1 promoter, a CRX promoter, a NRL promoter, a MECP2 promoter, a mMECP2 promoter, a hMECP2 promoter, an APP promoter, and a RCVRN promoter.
Various ways of delivery can be applied to the Cas12f polypeptide of the disclosure or the system of the disclosure as needed in practices.
In yet another aspect, the disclosure provides a polynucleotide encoding the Cas12f polypeptide of the disclosure, e.g., any one of SEQ ID NO: 39-72.
In yet another aspect, the disclosure provides a delivery system comprising (1) the Cas12f polypeptide of the disclosure, the polynucleotide of the disclosure, or the system of the disclosure; and (2) a delivery vehicle.
In yet another aspect, the disclosure provides a vector comprising the polynucleotide of the disclosure. In some embodiments, the vector encodes a guide nucleic acid of the disclosure. In some embodiments, the vector is a plasmid vector, a recombinant AAV (rAAV) vector (vector genome), or a recombinant lentivirus vector.
In yet another aspect, the disclosure provides a recombinant AAV (rAAV) particle comprising the rAAV vector genome of the disclosure. A simple introduction of AAV for delivery may refer to “Adeno-associated Virus (AAV) Guide” (addgene.org/guides/aav/).
Adeno-associated virus (AAV), when engineered to delivery, e.g., a protein-encoding sequence of interest, may be termed as a (r)AAV vector, a (r)AAV vector particle, or a (r)AAV particle, where “r” stands for “recombinant”. And the genome packaged in AAV vectors for delivery may be termed as a (r)AAV vector genome, vector genome, or vg for short, while viral genome may refer to the original viral genome of natural AAVs.
The serotypes of the capsids of rAAV particles can be matched to the types of target cells. For example, Table 2 of WO2018002719A1 lists exemplary cell types that can be transduced by the indicated AAV serotypes (incorporated herein by reference).
In some embodiments, the rAAV particle comprising a capsid with a serotype suitable for delivery into ear cells (e.g., inner hair cells). In some embodiments, the rAAV particle comprising a capsid with a serotype of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAVrh74, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, or AAV.PHP.eB, a member of the Clade to which any of the AAV1-AAV13 belong, or a functional variant (e.g., a functional truncation) thereof, encapsidating the rAAV vector genome. In some embodiments, the serotype of the capsid is AAV9 or a functional variant thereof.
General principles of rAAV particle production are known in the art. In some embodiments, rAAV particles may be produced using the triple transfection method (described in detail in U.S. Pat. No. 6,001,650).
The vector titers are usually expressed as vector genomes per ml (vg/ml). In some embodiments, the vector titer is above 1×109, above 5×1010, above 1×1011, above 5×1011, above 1×1012, above 5×1012, or above 1×1013 vg/ml.
Instead of packaging a single strand (ss)DNA sequence as a vector genome of a rAAV particle, systems and methods of packaging an RNA sequence as a vector genome into a rAAV particle is recently developed and applicable herein. See PCT/CN2022/075366, which is incorporated herein by reference in its entirety.
When the vector genome is RNA as in, for example, PCT/CN2022/075366, for simplicity of description and claiming, sequence elements described herein for DNA vector genomes, when present in RNA vector genomes, should generally be considered to be applicable for the RNA vector genomes except that the deoxyribonucleotides in the DNA sequence are the corresponding ribonucleotides in the RNA sequence (e.g., dT is equivalent to U, and dA is equivalent to A) and/or the element in the DNA sequence is replaced with the corresponding element with a corresponding function in the RNA sequence or omitted because its function is unnecessary in the RNA sequence and/or an additional element necessary for the RNA vector genome is introduced.
As used herein, a coding sequence, e.g., as a sequence element of rAAV vector genomes herein, is construed, understood, and considered as covering and covers both a DNA coding sequence and an RNA coding sequence. When it is a DNA coding sequence, an RNA sequence can be transcribed from the DNA coding sequence, and optionally further a protein can be translated from the transcribed RNA sequence as necessary. When it is an RNA coding sequence, the RNA coding sequence per se can be a functional RNA sequence for use, or an RNA sequence can be produced from the RNA coding sequence, e.g., by RNA processing, or a protein can be translated from the RNA coding sequence.
For example, a Cas13 coding sequence encoding a Cas13 polypeptide covers either a Cas13 DNA coding sequence from which a Cas13 polypeptide is expressed (indirectly via transcription and translation) or a Cas13 RNA coding sequence from which a Cas13 polypeptide is translated (directly).
For example, a gRNA coding sequence encoding a gRNA covers either a gRNA DNA coding sequence from which a gRNA is transcribed or a gRNA RNA coding sequence (1) which per se is the functional gRNA for use, or (2) from which a gRNA is produced, e.g., by RNA processing.
In some embodiments for rAAV RNA vector genomes, 5′-ITR and/or 3′-ITR as DNA packaging signals may be unnecessary and can be omitted at least partly, while RNA packaging signals can be introduced.
In some embodiments for rAAV RNA vector genomes, a promoter to drive transcription of DNA sequences may be unnecessary and can be omitted at least partly.
In some embodiments for rAAV RNA vector genomes, a sequence encoding a polyA signal may be unnecessary and can be omitted at least partly, while a polyA tail can be introduced.
Similarly, other DNA elements of rAAV DNA vector genomes can be either omitted or replaced with corresponding RNA elements and/or additional RNA elements can be introduced, in order to adapt to the strategy of delivering an RNA vector genome by rAAV particles.
In yet another aspect, the disclosure provides a ribonucleoprotein (RNP) comprising the Cas12f polypeptide of the disclosure and a guide nucleic acid of the disclosure.
In yet another aspect, the disclosure provides a lipid nanoparticle (LNP) comprising an RNA (e.g., mRNA) encoding the Cas12f polypeptide of the disclosure and a guide nucleic acid of the disclosure.
The CRISPR-Cas12f system of the disclosure comprising the Cas12f polypeptide of the disclosure has a wide variety of utilities, including modifying (e.g., cleaving, deleting, inserting, translocating, inactivating, or activating) a target DNA in a multiplicity of cell types. The CRISPR-Cas12f systems have a broad spectrum of applications requiring high cleavage activity and small sizes, e.g., drug screening, disease diagnosis and prognosis, and treating various genetic disorders.
The methods and/or the systems of the disclosure can be used to modify a target DNA, for example, to modify the translation and/or transcription of one or more genes of the cells. For example, the modification may lead to increased transcription/translation/expression of a gene. In other embodiments, the modification may lead to decreased transcription/translation/expression of a gene.
In yet another aspect, the disclosure provides a method for modifying a target DNA, comprising contacting the target DNA with the system of the disclosure, the vector of the disclosure, the ribonucleoprotein of the disclosure, or the lipid nanoparticle of the disclosure, wherein the guide sequence is capable of hybridizing to a target sequence of the target DNA, wherein the target DNA is modified by the complex.
In some embodiments, the target DNA is in a cell.
In some embodiments, the modification comprises one or more of cleavage, base editing, repairing, and exogenous sequence insertion or integration of the target DNA.
The methods of the disclosure can be used to introduce the systems of the disclosure into a cell and cause the cell to alter the production of one or more cellular produces, such as antibody, starch, ethanol, or any other desired products. Such cells and progenies thereof are within the scope of the disclosure.
In yet another aspect, the disclosure provides a cell comprising the system of the disclosure. In some embodiments, the cell is a eukaryote. In some embodiments, the cell is a human cell.
In yet another aspect, the disclosure provides a cell modified by the system of the disclosure or the method of the disclosure. In some embodiments, the cell is a eukaryote. In some embodiments, the cell is a human cell. In some embodiments, the cell is modified in vitro, in vivo, or ex vivo.
In some embodiments, the cell is a stem cell. In some embodiments, the cell is not a human embryonic stem cell. In some embodiments, the cell is not a human germ cell.
In some embodiments, the cell is a prokaryotic cell.
In some embodiments, the cell is a eukaryotic cell (e.g., an animal cell, a vertebrate cell, a mammalian cell, a non-human mammalian cell, a non-human primate cell, a rodent (e.g., mouse or rat) cell, a human cell, a plant cell, or a yeast cell) or a prokaryotic cell (e.g., a bacteria cell).
In some embodiments, the cell is from a plant or an animal.
In some embodiments, the plant is a dicotyledon. In some embodiments, the dicotyledon is selected from the group consisting of soybean, cabbage (e.g., Chinese cabbage), rapeseed, Brassica, watermelon, melon, potato, tomato, tobacco, eggplant, pepper, cucumber, cotton, alfalfa, eggplant, grape.
In some embodiments, the plant is a monocotyledon. In some embodiments, the monocotyledon is selected from the group consisting of rice, corn, wheat, barley, oat, sorghum, millet, grasses, Poaceae, Zizania, Avena, Coix, Hordeum, Oryza, Panicum (e.g., Panicum miliaceum), Secale, Setaria (e.g., Setaria italica), Sorghum, Triticum, Zea, Cymbopogon, Saccharum (e.g., Saccharum officinarum), Phyllostachys, Dendrocalamus, Bambusa, Yushania.
In some embodiments, the animal is selected from the group consisting of pig, ox, sheep, goat, mouse, rat, alpaca, monkey, rabbit, chicken, duck, goose, fish (e.g., zebra fish).
In some embodiments, the cell is a eukaryotic cell, such as a mammalian cell, including a human cell (a primary human cell or an established human cell line). In some embodiments, the cell is a non-human mammalian cell, such as a cell from a non-human primate (e.g., monkey), a cow/bull/cattle, sheep, goat, pig, horse, dog, cat, rodent (such as rabbit, mouse, rat, hamster, etc.). In some embodiments, the cell is from fish (such as salmon), bird (such as poultry bird, including chick, duck, goose), reptile, shellfish (e.g., oyster, claim, lobster, shrimp), insect, worm, yeast, etc. In some embodiments, the cell is from a plant, such as monocot or dicot. In certain embodiment, the plant is a food crop such as barley, cassava, cotton, groundnuts or peanuts, maize, millet, oil palm fruit, potatoes, pulses, rapeseed or canola, rice, rye, sorghum, soybeans, sugar cane, sugar beets, sunflower, and wheat. In certain embodiment, the plant is a cereal (barley, maize, millet, rice, rye, sorghum, and wheat). In certain embodiment, the plant is a tuber (cassava and potatoes). In certain embodiment, the plant is a sugar crop (sugar beets and sugar cane). In certain embodiment, the plant is an oil-bearing crop (soybeans, groundnuts or peanuts, rapeseed or canola, sunflower, and oil palm fruit). In certain embodiment, the plant is a fiber crop (cotton). In certain embodiment, the plant is a tree (such as a peach or a nectarine tree, an apple or pear tree, a nut tree such as almond or walnut or pistachio tree, or a citrus tree, e.g., orange, grapefruit or lemon tree), a grass, a vegetable, a fruit, or an algae. In certain embodiment, the plant is a nightshade plant; a plant of the genus Brassica; a plant of the genus Lactuca; a plant of the genus Spinacia; a plant of the genus Capsicum; cotton, tobacco, asparagus, carrot, cabbage, broccoli, cauliflower, tomato, eggplant, pepper, lettuce, spinach, strawberry, blueberry, raspberry, blackberry, grape, coffee, cocoa, etc.
In yet another aspect, the disclosure provides a pharmaceutical composition comprising (1) the system of the disclosure, the vector of the disclosure, the ribonucleoprotein of the disclosure, the lipid nanoparticle of the disclosure, or the cell of the disclosure; and (2) a pharmaceutically acceptable excipient.
In some embodiments, the pharmaceutical composition comprises the rAAV particle in a concentration selected from the group consisting of about 1×1010 vg/mL, 2×1010 vg/mL, 3×1010 vg/mL, 4×1010 vg/mL, 5×1010 vg/mL, 6×1010 vg/mL, 7×1010 vg/mL, 8×1010 vg/mL, 9×1010 vg/mL, 1×1011 vg/mL, 2×1011 vg/mL, 3×1011 vg/mL, 4×1011 vg/mL, 5×1011 vg/mL, 6×1011 vg/mL, 7×1011 vg/mL, 8×1011 vg/mL, 9×1011 vg/mL, 1×1012 vg/mL, 2×1012 vg/mL, 3×1012 vg/mL, 4×1012 vg/mL, 5×1012 vg/mL, 6×1012 vg/mL, 7×1012 vg/mL, 8×1012 vg/mL, 9×1012 vg/mL, 1×1013 vg/mL, or in a concentration of a numerical range between any of two preceding values, e.g., in a concentration of from about 9×1010 vg/mL to about 8×1011 vg/mL.
In some embodiments, the pharmaceutical composition is an injection.
In some embodiments, the volume of the injection is selected from the group consisting of about 1 microliter, 10 microliters, 50 microliters, 100 microliters, 150 microliters, 200 microliters, 250 microliters, 300 microliters, 350 microliters, 400 microliters, 450 microliters, 500 microliters, 550 microliters, 600 microliters, 650 microliters, 700 microliters, 750 microliters, 800 microliters, 850 microliters, 900 microliters, 950 microliters, 1000 microliters, and a volume of a numerical range between any of two preceding values, e.g., in a concentration of from about 10 microliters to about 750 microliters.
In yet another aspect, the disclosure provides a method for diagnosing, preventing, or treating a disease in a subject in need thereof, comprising administering to the subject (e.g., a therapeutically effective dose of) the system of the disclosure, the vector of the disclosure, the ribonucleoprotein of the disclosure, the lipid nanoparticle of the disclosure, the cell of the disclosure, or the pharmaceutical composition of the disclosure, wherein the disease is associated with a target DNA, wherein the guide sequence is capable of hybridizing to a target sequence of the target DNA, wherein the target DNA is modified by the complex, and wherein the modification of the target DNA diagnose, prevents, or treats the disease.
In some embodiments, the disease is selected from the group consisting of Angelman syndrome (AS), Alzheimer's disease (AD), transthyretin amyloidosis (ATTR), transthyretin amyloid cardiomyopathy (ATTR-CM), cystic fibrosis (CF), hereditary angioedema, diabetes, progressive pseudohypertrophic muscular dystrophy, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), spinal muscular atrophy (SMA), alpha-1-antitrypsin deficiency, Pompe disease, myotonic dystrophy, Huntington's disease (HTT), fragile X syndrome, Friedreich ataxia, amyotrophic lateral sclerosis (ALS), frontotemporal dementia, hereditary chronic kidney disease, hyperlipidemia, Leber congenital amaurosis (LCA), sickle cell disease, thalassemia (e.g., β-thalassemia), Parkinson's disease (PD), myelodysplastic syndrome (MDS), retinitis pigmentosa (RP), age-related macular degeneration (AMD), Hepatitis B, nonalcoholic fatty liver disease (NAFLD), Acquired Immune Deficiency Syndrome, corneal dystrophy (CD), hypercholesterolemia, familial hypercholesterolemia (FH), heart disease (e.g., hypertrophic cardiomyopathy (HCM)), and cancer.
In some embodiments, the target DNA encodes a mRNA, a tRNA, a ribosomal RNA (rRNA), a microRNA (miRNA), a non-coding RNA, a long non-coding (lnc) RNA, a nuclear RNA, an interfering RNA (iRNA), a small interfering RNA (siRNA), a ribozyme, a riboswitch, a satellite RNA, a microswitch, a microzyme, or a viral RNA.
In some embodiments, the target DNA is a eukaryotic DNA.
In some embodiments, the eukaryotic DNA is a mammal DNA, such as a non-human mammalian DNA, a non-human primate DNA, a human DNA, a plant DNA, an insect DNA, a bird DNA, a reptile DNA, a rodent (e.g., mouse, rat) DNA, a fish DNA, a nematode DNA, or a yeast DNA.
In some embodiments, the target DNA is in a eukaryotic cell, for example, a human cell, a non-human primate cell, or a mouse cell.
In some embodiments, the administrating comprises local administration or systemic administration.
In some embodiments, the administrating comprises intrathecal administration, intramuscular administration, intravenous administration, transdermal administration, intranasal administration, oral administration, mucosal administration, intraperitoneal administration, intracranial administration, intracerebroventricular administration, or stereotaxic administration.
In some embodiments, the administration is injection or infusion.
In some embodiments, the subject is a human, a non-human primate, or a mouse.
In some embodiments, the level of the transcript (e.g., mRNA) of the target DNA is decreased in the subject by at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, or more compared to the level of the transcript (e.g., mRNA) of the target DNA in the subject prior to the administration.
In some embodiments, the level of the transcript (e.g., mRNA) of the target DNA is increased in the subject by at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, or more compared to the level of the transcript (e.g., mRNA) of the target DNA in the subject prior to the administration.
In some embodiments, the level of the expression product (e.g., protein) of the target DNA is decreased in the subject by at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, or more compared to the level of the expression product (e.g., protein) of the target DNA in the subject prior to the administration.
In some embodiments, the level of the expression product (e.g., protein) of the target DNA is increased in the subject by at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, or more compared to the level of the expression product (e.g., protein) of the target DNA in the subject prior to the administration. In some embodiments, the expression product is a functional mutant of the expression product of the target DNA.
In some embodiments, the median survival of the subject suffering from the disease but receiving the administration is 5 days, 10 days, 20 days, 30 days, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 1.5 year, 2 years, 2.5 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years or more longer than that of a subject or a population of subjects suffering from the disease and not receiving the administration.
The therapeutically effective dose may be either via a single dose, or multiple doses. One skilled in the art understands that the actual dose may vary greatly depending upon a variety of factors, such as the vector choices, the target cells, organisms, tissues, the general conditions of the subject to be treated, the degrees of transformation/modification sought, the administration routes, the administration modes, the types of transformation/modification sought, etc.
For example, the therapeutically effective dose of the rAAV particle may be about 1.0E+8, 2.0E+8, 3.0E+8, 4.0E+8, 6.0E+8, 8.0E+8, 1.0E+9, 2.0E+9, 3.0E+9, 4.0E+9, 6.0E+9, 8.0E+9, 1.0E+10, 2.0E+10, 3.0E+10, 4.0E+10, 6.0E+10, 8.0E+10, 1.0E+11, 2.0E+11, 3.0E+11, 4.0E+11, 6.0E+11, 8.0E+11, 1.0E+12, 2.0E+12, 3.0E+12, 4.0E+12, 6.0E+12, 8.0E+12, 1.0E+13, 2.0E+13, 3.0E+13, 4.0E+13, 6.0E+13, 8.0E+13, 1.0E+14, 2.0E+14, 3.0E+14, 4.0E+14, 6.0E+14, 8.0E+14, 1.0E+15, 2.0E+15, 3.0E+15, 4.0E+15, 6.0E+15, 8.0E+15, 1.0E+16, 2.0E+16, 3.0E+16, 4.0E+16, 6.0E+16, 8.0E+16, or 1.0E+17 vg, or within a range of any two of the those point values. vg stands for vector genomes of rAAV particles for administration.
In yet another aspect, the disclosure provides a method of detecting a target DNA, comprising contacting the target DNA with the system of the disclosure, wherein the target DNA is modified by the complex, and wherein the modification detects the target DNA. In some embodiments, the modification generates a detectable signal, e.g., a fluorescent signal.
In yet another aspect, the disclosure provides a kit comprising the Cas12f polypeptide of the disclosure, the system of the disclosure, the polynucleotide of the disclosure, the vector of the disclosure, the RNP of the disclosure, the LNP of the disclosure, the delivery system of the disclosure, the cell of the disclosure, or the pharmaceutical composition of the disclosure, or any one, two, or all components of the same.
In some embodiments, the kit further comprises an instruction to use the component(s) contained therein, and/or instructions for combining with additional component(s) that may be available or necessary elsewhere.
In some embodiments, the kit further comprises one or more buffers that may be used to dissolve any of the component(s) contained therein, and/or to provide suitable reaction conditions for one or more of the component(s). Such buffers may include one or more of PBS, HEPES, Tris, MOPS, Na2CO3, NaHCO3, NaB, or combinations thereof. In some embodiments, the reaction condition includes a proper pH, such as a basic pH. In some embodiments, the pH is between 7-10.
In some embodiments, any one or more of the kit components may be stored in a suitable container or at a suitable temperature, e.g., 4 Celsius degree.
Further embodiments are illustrated in the following Examples which are given for illustrative purposes only and are not intended to limit the scope of the disclosure.
Among others, two hypercompact Cas12f1 from Oscillibacter sp. (OsCas12f1) and Ruminiclostridium herbifermentans (RhCas12f1) were presented herein. Through protein engineering and sgRNA optimization, enhanced OsCas12f1 (enOsCas12f1) and enhanced RhCas12f1 (enRhCas12f1) systems were generated, showing both high on-target cleavage activity and low off-target cleavage activity, and also a wide range of target recognition in human cells. Furthermore, enOsCas12f1 and its inducible version achieved efficient restoration of dystrophin in humanized mdx mice by single AAV delivery. Additionally, enOsCas12f1 was engineered for both epigenome editing and gene activation.
Unless otherwise specified, the experimental methods used in the Examples are conventional.
Unless otherwise specified, the materials, reagents, etc., used in the Examples are commercially available.
Unless otherwise specified, the following materials and experimental methods were used in the Examples.
All the research in the disclosure complies with all relevant ethical regulations, and animal experiments have been approved by the Animal Care and Use Committee of HuidaGene Therapeutics Co., Ltd, Shanghai, China.
More than 200,000 bacteria genomes were downloaded from NCBI database. Firstly, the applicant used TBLASTN and UnCas12f protein to identify Cas12f-containing sequences of bacteria genomes downloaded from NCBI with E value<1e-10. Then, “0.Cas-Finder.pl” script was used to annotate the CRISPR array and Cas proteins of Cas12f-containing sequences. The applicant further used “1.Cas12f-Finder.pl” to annotate the Cas12f proteins with conserve RuvC and Zn finger domain.
Then, the definition of the 5′ boundary of crRNA depends on the prediction of anti-repeat in tracrRNA. The direct repeats of mature Cas12s′ crRNAs are generally in the 3′ end sequence of about 22 nt. Therefore, the applicant used the 22 nt sequence at the 3′ end of DR to search the non-coding sequence between the Cas12f gene and CRISPR array.
The applicant defined the non-coding sequence containing at least 9 A-U/C-G pairs, and at least 65% of A-U/C-G/G-U pairs with 22 nt sequence at the 3′ end of DR as the anti-repeat sequence. The applicant further extended 150 nt upstream of anti-repeat to obtain potential tracrRNA sequences. Then, using RNAfold to predict the secondary structure of the potential tracrRNA sequences, the applicant retained the sequences with conservative secondary structure in Cas12f family. Based on the above principles, the applicant wrote “2.Cas12f.tracrRNA.Finder.pl” script to predict the tracrRNA sequences of Cas12f variants.
The applicant initially predicted the PAMs for 34 CRISPR-Cas12f systems by CRISPRTarget, ten of these CRISPR-Cas12f systems were successfully predicted (Table 1). The PAMs of the other CRISPR-Cas12f systems were then predicted based on the protein homology with those Cas12f1 whose PAMs were successfully obtained by CRISPRTarget.
Human codon-optimized Cas12f1 proteins and sgRNA were synthesized and cloned to generate pCAG_NLS-Cas12f-NLS_pA_pU6_gRNA scaffold-2× BpiI_pCMV_mCherry_pA by NEBuilder (New England Biolabs). The spacer sequences were annealed and ligated to BpiI sites.
For the generation of Cas12f1 mutants, region 1˜3 of OsCas12f1 and RhCas12f1 were divided into 11 segments containing 17 amino acid residues in length. Eleven backbone mutants for OsCas12f1 and RhCas12f1, respectively, were generated by replacing the above mentioned 11 segments with BpiI recognition sequence by PCR and Gibson assembly method using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). The specific mutation is then introduced by incorporation of annealed oligos containing mutation by BpiI digestion and T4 DNA ligase ligation.
Full length OsCas12f1, enOsCas12f1, RhCas12f1, or enRhCas12f1 was cloned into pET-32a to express Cas12f1 proteins with C-terminal 6×His. Plasmids were transformed into Escherichia coli BL21(DE3) cells and grown at 37° C. to OD600 of 0.6 and then induced for protein expression by 0.5 mM IPTG incubated at 18° C. overnight. Cells were harvested and lysed by sonication in Buffer A (50 mM Tris-HCl (PH=8.0), 50 mM imidazole, 1.5 M NaCl). After centrifugation, the supernatant was gathered and loaded onto the HisTrap HP column (Cytiva) and eluted with Buffer B (50 mM Tris-HCl (PH=8.0), 600 mM imidazole, 1.5 M NaCl). The eluted protein was exchanged into Buffer C containing 20 mM Tris-HCl (PH=8.0), 0.3 M NaCl, 1 mM DTT, and 2% (v/v) glycerol. The protein was then loaded on a HiTrap Heparin HP column (Cytiva), equilibrated with Buffer C, and eluted using a linear gradient of increasing NaCl concentration from 0.3 M to 2.0 M. The obtained protein was stored in Buffer D (25 mM Tris-HCl (PH=8.0), 150 mM NaCl, 2 mM DTT and 1 mM MgCl2). For long-term storage, the protein was supplemented with 10% (v/v) glycerol, then flash-frozen in liquid nitrogen and stored at −80° C.
sgRNA Synthesis
The sgRNAs were prepared by in vitro transcription using a MEGA shortscript T7 kit (Life Technologies) and purified by a MEGA clear kit (Life Technologies). DNA templates for T7 transcription were generated by PCR using primers containing a T7 promoter. Sequences of these sgRNAs are provided in Table 5.
Cas12f1 ribonucleoprotein (RNP, 1 μM) complexes were assembled by mixing Cas12f1 protein with sgRNA at 1:1 molar ratio followed by incubation assembly buffer (10 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1 mM EDTA, 1 mM DTT) at 37° C. for 30 min. Five nM of supercoiled or linear plasmids containing target sequences were incubated with 250 nM Cas12f1 RNP in reaction buffer (2.5 mM Tris-HCl, pH 7.5, 25 mM NaCl, 0.25 mM DTT, and 10 mM MgCl2) at 46° C. or indicated temperature for testing optimal temperature for one hour. The reaction was stopped with quenching buffer (20 mM EDTA, 0.1 mg/ml proteinase K). The digested product was analyzed with 1% of agarose gel. For run-off sequencing the digested product was purified and subjected to Sanger sequencing.
In vitro PAM characterization was performed as previously described. Briefly, the dsDNA library with 7-bp random sequences followed by protospacer sequence was created by PCR with primer with 7N. The in vitro cleavage was performed as above mentioned. The cleaved product with 7 N sequence was gel purified, adapter ligated, and PCR for NGS. The top 1000 enriched PAM sequences were used to draw PAM motifs by WebLogo.
To validate the Cas12f1-sgRNA complex formation, Cas12f1 RNP was assembled in vitro with 4:3 molar ratio of protein:gRNA in buffer D at 37° C. for 30 min and analyzed on Superdex 200 Increase 10/300 column (Cytiva), equilibrated with Buffer D. Buffer E (20 mM Tris-HCl (PH=8.0), 500 mM NaCl, 1 mM DTT and 5 mM MgCl2) was used for analysis of Cas12f1 protein without sgRNA in view of the fact that OsCas12f1 protein could not be eluted from the column equilibrated with Buffer D, which may be due to non-specific interaction with the resin. The Gel Filtration Standard (Bio-Rad, #1511901) was used for calibration.
HEK293T cells (Stem Cell Bank, Chinese Academy of Sciences) cultured in DMEM supplemented with 10% FBS and penicillin/streptomycin were seeded on 24-well poly-D-lysine coated plates (Corning). For EGFP activation assay, transfection was conducted following the manufacturer's manual with 3.2 μl of PEI (Polyscience) and 1.6 μg of plasmids (0.8 μg of reporter plasmids+0.8 μg of Cas12f expressing plasmids). Forty-eight hours after transfection, flow cytometry analysis was performed to evaluate the EGFP activation efficiency. For analyzing the indel efficiency of endogenous gene, HEK293T cells were transfected with 2 μl of PEI and 1 μg of plasmids expressing Cas12f and sgRNA cassette. The mCherry-positive cells were collected by FACS sorting at 72 h after transfection.
Eight thousand sorted cells were harvested for genomic DNA extraction by addition of 20 μl of lysis buffer (Vazyme) following the manufacturer's manual. For TIDER test, the genomic region in the vicinity of Cas nuclease target site was amplified by Phanta Max Super-Fidelity DNA Polymerase (Vazyme) using nested PCR. Purified PCR products were Sanger sequenced and analyzed as previously described. For deep sequencing analysis, the targeted genomic region was amplified by Phanta Max Super-Fidelity DNA Polymerase (Vazyme) using nested PCR, primers with barcode were used. PCR products were purified by Gel extraction kit (Vazyme) and sequenced on an Illumina HiSeq X System (150-bp paired-end reads). Forward reads were aligned to the reference sequences using BWA (v0.7.17-r1188) with parameter of “bwa mem -A2 -O3 -E1”. At each target, editing was calculated as the percentage of total reads containing desired edits without indels within a 10-bp window of the cut site. The target site information is provided in Table 4.
PEM-seq in HEK293 cells was performed as previously described. Briefly, expression plasmids for enOsCas12f1, LbCas12a, SpCas9, and Un1Cas12f_ge4.1 targeted at target 36, as well as enRhCas12f1 and SpCas9 targeted at PCSK9 were transfected into HEK293 cells by PEI, respectively, and after 72 h, positive cells were harvested for DNA extraction. The 20 μg genomic DNA was fragmented with a peak length of 300-700 bp by Covaris sonication. DNA fragments were tagged with biotin by a one-round biotinylated primer extension at 5′-end, and then primer removal by AMPure XP beads and purified by streptavidin beads. The single-stranded DNA on streptavidin beads is ligased with a bridge adapter containing 14-bp RMB, and PCR product was performed nested PCR for enriching DNA fragment containing the bait DSB and tagged with illumine adapter sequences. The prepared sequencing library was sequenced on a Hi-seq 2500, with a 2×150 bp.
All animal experiments were performed and approved by the Animal Care and Use Committee of HuidaGene Therapeutics Co., Ltd, Shanghai, China. Mice were housed in a barrier facility with a 12-hour light/dark cycle and 18-23° C. with 40-60% humidity. Diet and water were accessible at all times. DMD mice were generated in the C57BL/6 J background using the CRISPR-Cas9 system. Duchenne muscular dystrophy (DMD) is the most common sex-linked lethal disease in man, thus male mice were selected for this study.
rAAV9 particles were produced by PackGene Biotech (Guangzhou, China), and applied iodixanol density gradient centrifugation for purification. For intramuscular injection, DMD mice were anesthetized, and TA (tibialis anterior) muscle was injected with 50 μL of AAV9 (5×1011 vg) preparations or with same volume saline solution. 3 weeks after rAAV9 intramuscular injection, mice were anesthetized and euthanized, and TA (tibialis anterior) muscle was collection.
Muscle total mRNA was extracted, and cDNA was synthesized using a HiScript II One Step RT-PCR Kit (Vazyme, P611-01) following the manufacturer's protocol. Then, each 20 μl PCR reaction contained approximately 2 μl cDNA, 0.25 μM of each of forward and reverse primers, and 10 μl of Ex taq (Takara, RR001A) was performed on a C1000 Touch Thermal Cycler (Bio-Rad). Amplification conditions consisted of an initial hold for 5 min followed by 35 cycles of 95° C. for 30 s, 60° C. for 30 s, and 72° C. for 30 s. PCR products were analyzed by gel electrophoresis.
For detected RNA splicing, TA cloning was performed according to the protocol of the pEASY-T5 Zero Cloning Kit (TransGen Biotech, CT501-01). Brief, PCR products were used agarose gel electrophoresis to verify the quality and quantity. 4 μl PCR products and pEASY-T5 Zero Cloning vector were gently mixed well, incubate at room temperature for 10 minutes, and then add the ligated products to 50 μl of Trams 1-T1 phage resistant chemically competent cell and plated on LB/Amp+, followed by sequencing with M13F.
Muscle samples were homogenized with RIPA buffer supplemented with protease inhibitor cocktail. Lysate supernatants were quantified with Pierce BCA protein assay kit (Thermo Fisher Scientific, 23225) and adjusted to an identical concentration using H2O. Samples were mixed with in NuPAGE LDS sample buffer (Invitrogen, NP0007) and 10% β-mercaptoethanol followed by boiled at 70° C. for 10 min. 20 μg total protein per lane was loaded into 3 to 8% tris-acetate gel (Invitrogen, EA03752BOX) and electrophoresed for 1 hours at 200 V. Protein was transferred on a PVDF membrane under the wet condition at 350 mA for 3.5 hours. The membrane was blocked in 5% non-fat milk in TBST buffer and then incubated with primary antibody labeling specific protein. After washing three times with TBST, the membrane was further incubated with HRP conjugated secondary antibody (1:1000 dilution, Beyotime, A0216) specific to the IgG of the species of primary antibody against dystrophin (1:1000 dilution, Sigma, D8168) and vinculin (1:1000 dilution, CST, 13901 S). The target proteins were visualized with Chemiluminescent substrates (Invitrogen, WP20005).
Tissues were collected and mounted in optimal cutting temperature (OCT) compound and snap-frozen in liquid nitrogen. Serial frozen cryosections (10 μm) were fixed for 2 hours in 37° C. followed by permeabilized with PBS+0.4% Triton-X for 30 min. After washing with PBS, samples were blocked with 10% goat serum for 1 hours at room temperature. Then, the slides were incubated overnight at 4° C. with primary antibodies against dystrophin (1:100 dilution, Abcam, ab15277) and spectrin (1:500 dilution, Millipore, MAB1622). After that, samples were washed extensively PBS and incubated with compatible secondary antibodies (Alexa Fluor 488 AffiniPure donkey anti-rabbit IgG (1:1000 dilution, Jackson ImmunoResearch labs, 711-545-152) or Alexa Fluor 647 AffiniPure donkey anti-mouse IgG (1:1000 dilution, Jackson ImmunoResearch labs, 715-605-151)) and DAPI for 2 h at room temperature. Samples were washed for 10 min with PBS and repeated three times. And then, slides were sealed with fluoromount-G mounting medium. All images were visualized under Nikon C2. The amount of dystrophin-positive muscle fibers is represented as a percentage of total spectrin-positive muscle fibers.
Efficiency Detection on miniCRISPRoff
One microgram of mCherry containing plasmids expressing miniCRISPRoff and CRIPSRoff were transfected into Snrp-GFP stablely expressed HEK293T cells. Two days after transfection, mCherry-positive cells were sorted and cultured for FACS analysis at the indicated time.
For bisulfite sequencing analysis, genomic DNA was treated by BisulFlash DNA Modification Kit (EPIGENTEK) as the manufacturer's protocols. PCR amplicon of GAPDH-Snrp promoter was purified and cloned into TA cloning vector (VAYZYME). Colonies were randomly picked for Sanger sequencing.
Frequency, mean, and standard deviations were calculated using GraphPad Prism 8. Whole-genome sequencing analysis was conducted using BWA (v0.7.17-r1188) with parameter of “bwa mem -A2 -O3 -E1”. PEM-seq data analysis was performed using PEM-Q pipeline with default parameters. Two or three biologically independent replicates were performed, which was demonstrated in the figure legend. In this study, no statistical method was used to predetermine sample size, and no data were excluded from the analyses. The experiments were not randomized, and the Investigators were not blinded to allocation during experiments and outcome assessment.
34 previously undocumented and uncharacterized CRISPR-Cas12f systems (Table 1) were identified using self-developed computational pipeline to annotate Cas12f orthologs, CRISPR array, tracrRNAs, and PAM preferences. The amino acid sequences of the Cas12f1 proteins of the 34 identified systems and the 4 reported Cas12f systems (controls; Table 1) are set forth in SEQ ID NOs: 1-38, respectively. The codon-optimized coding sequences for the 34 identified Cas12f1 proteins are set forth in SEQ ID NOs: 39-72, respectively. The direct repeat (DR) sequences accompanying the Cas12f1 proteins are set forth in SEQ ID NOs: 179-212, respectively. The reported CRISPR-Cas12f systems were used as control for comparison.
Oscillibacter sp.
Ruminiclostridium
herbifermentans
Oscillospiraceae bacterium
Oscillospiraceae bacterium
Clostridia bacterium
Clostridia bacterium
Clostridiales bacterium
Oscillospiraceae bacterium
Eubacterium siraeum
Parageobacillus
thermoglucosidasius
Ruminiclostridium hungatei
Bacillus cereus
Bacillus fungorum
Bacillus thuringiensis
Clostridium ihumii
Clostridium paraputrificum
Sarcina ventriculi
Bacillus cereus
Clostridioides difficile
Clostridium sporogenes
Clostridium botulinum
Clostridium baratii
Blautia sp. M16 M6_ctg015
Parageobacillus
thermoglucosidasius
Cellulosilyticum ruminicola
Clostridium hiranonis
Clostridium sp
Peptacetobacter hiranonis
Opitutae bacterium
Clostridium novyi
Uncultured bacterium
Syntrophomonas palmitatica
Acidibacillus sulfuroxidans
To evaluate the efficiency of the spacer sequence-specific (on-target) dsDNA cleavage (“dsDNA cleavage” for short unless otherwise indicated) in eukaryotic cells by these CRISPR-Cas12f systems, an enhanced green fluorescent protein (EGFP) reporter system activatable by single-strand annealing (SSA)-mediated repair pathway in HEK293T cells was designed (
The reporter plasmid ( which is replaceable to adapt to the PAM preference of various Cas12 proteins, premature stop codon
to prevent expression of EGFP, and 3′ PAM
to adapt to Cas9 protein) between EGFx (EGFP CDS 1-561 bp) and xFP (EGFP CDS 112-720 bp) (referring to Table 1 for PAM for each Cas12f1 protein). The BFP indicated successful transfection and expression of the reporter plasmid in host cells.
CCATTACAG
GAGCATAC
,
CCATTACAGTAGGAGCATAC,
The expression plasmid (
Each of the Cas12f1 proteins was tagged with a SV40 nuclear localization sequence (SV40 NLS) (SEQ ID NO: 216; coded by SEQ ID NO: 217) at its N-terminal and a nucleoplasmin NLS (NP NLS, npNLS) (SEQ ID NO: 218; coded by SEQ ID NO: 219) at its C-terminal.
The polynucleotide sequences of the scaffold sequences of the sgRNAs corresponding to the 34 identified systems and the 4 reported systems are set forth in SEQ ID NOs: 73-110, respectively.
The sgRNA encoded on the expression plasmid was composed of, from 5′ to 3′ direction, one scaffold sequence (one of SEQ ID NOs: 73-110), one targeting spacer sequence (SEQ ID NO: 214) capable of hybridizing to the insertion sequence (SEQ ID NO: 213) in the reporter plasmid, and one stabilizing sequence (SEQ ID NO: 220) for increased sgRNA stability, with no linker between any two of the preceding components. Each of the scaffold sequences of SEQ ID NO: 73-106 was composed of, from 5′ to 3′ direction, one tracrRNA (one of SEQ ID NOs: 111-144), one GAAA tetraloop as a linker, and one repeat sequence (one of SEQ ID NOs: 145-178). In other words, the sgRNA was composed of, from 5′ to 3′ direction, one tracrRNA (one of SEQ ID NOs: 111-144), one GAAA tetraloop as a linker, one crRNA, and one stabilizing sequence (SEQ ID NO: 220), with no linker between any two of the preceding components, wherein the crRNA was composed of, from 5′ to 3′ direction, one repeat sequence (one of SEQ ID NOs: 145-178) and one targeting spacer sequence (SEQ ID NO: 214) with no linker therebetween. A non-targeting (NT) spacer sequence (SEQ ID NO: 215) incapable of hybridizing to the insertion sequence (SEQ ID NO: 213) was used in place of the spacer sequence (SEQ ID NO: 214) as a negative control. It is noted that in the scaffold sequence (SEQ ID NO: 88) of MsCas12f1 (ME-B.13), the tracrRNA (SEQ ID NO: 126) is direct fused to the repeat sequence (SEQ ID NO: 160) without the GAAA tetraloop. Each of the repeat sequences (SEQ ID NOs: 145-178) is derived from the corresponding DR sequence (SEQ ID NOs: 179-212).
The DSBs generated in the reporter plasmid by the dsDNA cleavage by the Cas12f1 protein as guided by the sgRNA targeting the insertion sequence would induce SSA-mediated repair of the GFxxFP coding sequence, consequently activating EGFP expression (
Using this fluorescent screen method, nine identified CRISPR-Cas12f systems (
Based on the observations of robust EGFP activation by OsCas12f1, HsCas12f1, Cb1Cas12f1, and RhCas12f1 in HEK293T cells, the frequency of indel generated by these Cas12f1 at endogenous genomic loci (PCKS9, TTR, DMD, and DNMT1 genes) was also validated. The dsDNA cleavage activity (genomic editing efficiency) was represented by % indel. The results showed that the genomic editing efficiencies of OsCas12f1, HsCas12f1, Cb1Cas12f1, and RhCas12f1 were modest, with indel frequencies ranging from about 1% to about 20% at various target loci (
The two CRISPR-Cas12f systems OsCas12f1 (433 aa) and RhCas12f1 (415 aa) with the highest dsDNA cleavage activity (as represented by GPF activation efficiency) were selected for further study, which recognized 5′ T-rich PAM (e.g., 5′-TTTC) and 5′ C-rich PAM (e.g., 5′-CCCA/TCCA), respectively. Both OsCas12f1 and RhCas12f1 are hypercompact, with a gene size that is less than half of SpCas9, LbCas12a, and SaCas9 (
Further, the in vitro cleavage of a DNA fragment library containing 7-bp random sequence indicated that OsCas12f1 and RhCas12f1 recognized 5′ PAMs of 5′-{C/T;T/C/A;T/C/A;C/A/T} (i.e., in the four-letter 5′ PAM, the first nucleotide can be C or T; the second nucleotide can be T or C or A; the third nucleotide can be T or C or A; and the fourth nucleotide can be C or A or T) and 5′-{N;C/A/G;C;A/T/G} (i.e., in the four-letter 5′ PAM, the first nucleotide can be A or T or G or C; the second nucleotide can be C or A or G; the third nucleotide can be Cl; and the fourth nucleotide can be A or T or G), respectively (
The effects of spacer length on cleavage efficiency of OsCas12f1 and RhCas12f1 were explored by designing insertion sequences and corresponding sgRNAs with various lengths of target sequences and corresponding spacer sequences, which showed that a length of at least 16 nt and an optimal length of 20 nt worked for both OsCas12f1 and RhCas12f1 (
By introducing point mutations that resulted in D228A (SEQ ID NO: 221) or D406A (SEQ ID NO: 222) residue conversions in the conserved active sites of the RuvC domain, the cleavage activity of OsCas12f1 was abolished, generating an endonuclease deficient (dead) OsCas12f1 variant (
The biochemical properties of OsCas12f1 and RhCas12f1 proteins (
Size-exclusion chromatography was performed to determine the complex formation of the Cas12f1 protein with its sgRNA, suggesting that both OsCas12f1 and RhCas12f1 could form dimer in presence of sgRNA at least in the tested condition, which was similar to that of Un1Cas12f1 (
Taken together, these results indicated that OsCas12f1 and RhCas12f1 offer hypercompact DNA editing tools with modest genomic editing efficiency and relatively wide target range.
In order to increase the cleavage efficiency of OsCas12f1 and RhCas12f1, these Cas12f1 proteins were engineered through mutagenesis and screening for higher efficiency variants using the same GFP activation reporter system, as described above (
Based on the protein alignment of OsCas12f1 and RhCas12f1 with Un1Cas12f1, three regions that potentially responding for binding nuclei acids were defined (
Two mutant libraries were generated in the first round within these three regions, each containing over 100 mutants of OsCas12f1 or RhCas12f1. These mutants were then individually co-transfected with the reporter plasmid into HEK293T cells, and EGFP activation efficiency evaluation by the reporter system in Example 1 was quantified by flow cytometry (
Second round iteration screen was performed by mutating OsCas12f1-D52R with one additional mutation that was identified as an enhanced OsCas12f1 mutant in the first round screen. Using a library containing 15 double mutants of OsCas12f1, it was found that R substitution at A54, S119, T132, and S141 further increased the activity of OsCas12f1-D52R (
A stabilizing sequence 5′-TTTTATTTTTTT-3′ was fused to the 3′ of sgRNAs for increased stability and hence improved editing efficiency, and an sgRNA optimization strategy was adopted to the scaffold sequence of sgRNA, including truncation or deletion of base pairs in the RNA stem region (
The A-U or mismatched base pairs was replaced in the scaffold sequences of sgRNAs with thermodynamically stable C-G base pair, which increased sgRNA stability (
It was further determined whether the respective increases in cleavage activity of OsCas12f1 through Cas protein engineering and sgRNA engineering were additive effects. The Os-sg1.1 sgRNA variant was first used to guide the OsCas12f1-D52R protein variant. This combined variant system showed higher cleavage activity than either variant system alone (Cas12f1 variant plus WT sgRNA, or WT Cas12f1 plus sgRNA variant) (
For generating enRhCas12f1, seven high-performance protein variants (T131R, S130R, A273R, I264R, L270R, Y125R, A56R) were chosen for combination with the most efficient sgRNA variants, Rh-sg1.1 (SEQ ID NO: 257) (
In addition, the in vitro PAM characterization assay was performed to determine the PAM preference of the engineered Cas12f1 proteins, indicating the enOsCas12f1 preferred PAM 5′-TTH (H=not G) than 5′-TTG, while enRhCas12f1 preferred PAM 5′-CCD (D=not C) (
Therefore, the protein engineering, which may increase the binding ability of the Cas12f1 proteins to nucleic acids, combined with C-G base pair substitution in the scaffold sequence of sgRNA, can improve the cleavage activity of OsCas12f1 and RhCas12f1 and broaden the target range of OsCas12f1.
It was further evaluated whether enOsCas12f1 and enRhCas12f1 could efficiently edit endogenous genomic loci in human cells. To comprehensively compare the editing efficiencies of enOsCas12f1, enRhCas12f1, and the published high-performance Cas12f1, Un1Cas12f1_ge4.1, their targeting at all access sites in the exons of PCSK9, TTR, and VEGFA was quantified, based strictly on PAM sequence without consideration for potential sgRNA and target feature contributing toward Cas nuclease activity, such as GC content. In total, the indel frequency was quantified at 30 sites targeted by enOsCas12f1 (5′-NTTC PAM), 61 sites targeted by enRhCas12f1 (5′-TCCA and 5′-CCCA PAM), and 27 sites targeted by Un1Cas12f1_ge4.1 (5′-TTTR PAM).
The results showed that enOsCas12f1 induced indels (>1%) in all of 30 tested sites with a maximal efficiency of 96.2%, while enRhCas12f1 induced indels (>1%) in 53 of the 61 tested loci with a maximal efficiency of 93.3%. By contrast, Un1Cas12f1_ge4.1 generated relatively lower indel frequencies (>1%) in 22 sites across 27 tested loci, with a maximal efficiency of 60.6% (
High throughput sequencing of target loci revealed that both enOsCas12f1 and enRhCas12f1 predominantly generated deletions that altered the protospacer sequences rather than insertions (
The mismatch tolerance of enOsCas12f1 and enRhCas12f1 was first evaluated by tilling single or adjacent two mismatches in spacer sequences. For the PCSK9 locus, enOsCas12f1 did not tolerate single mismatch at positions 3/5/11, while the mismatches at other positions slightly reduced enOsCas12f1-mediated editing efficiency (
The mismatch tolerance of enRhCas12f1 was assessed at endogenous PCSK9 locus or by GFP activation reporter system, indicating that enRhCas12f1 partially tolerates base pair mismatches at PAM-distal region, especially at positions 19 and 20, while the mismatches close to PAM could substantially reduce the activity of enRhCas12f1 (
Targeted deep sequencing was performed at in-silico predicted off-target sites (P2RX5-TAX1BP3, an intergenic region, NLRC4 and CLIC4). The targeted deep sequencing indicated that the on-target editing efficiency of enOsCas12f1 was comparable to that of LbCas12a, and slightly higher than that of Un1Cas12f1_ge4.1. Similar to LbCas12a and Un1Cas12f1_ge4.1, enOsCas12f1 showed strikingly low off-target effects at the potential off-target sites, while a low off-target effect was found at CLIC4 OT7 site for enOsCas12f1 (
Finally, PEM-seq was performed to quantify the genome-wide editing specificities of enOsCas12f1 and enRhCas12f1. When targeting target 36 site, five off-target sites were found to be induced by enOsCas12f1 and Un1Cas12f1_ge4.1, four and one of the off-target sites were found for LbCas12a and SpCas9, respectively (
The considerably small size of enOsCas12f1 suggested that its expression cassette could be packaged with multiple sgRNAs in a single rAAV vector, which could enable its therapeutic application to treat genetic disorders that require large fragment deletions, such as Duchenne muscular dystrophy (DMD). To test whether enOsCas12f1 could be harnessed for DMD exon 51 deletion, efficient sgRNAs flanking exon 51 (5′gRNA and 3′gRNA) were firstly screened, indicated that enOsCas12f1 efficiently induced indels, while enRhCas12f1 and Un1Cas12f1_ge4.1 exhibited relatively low editing efficiency at four of the target sites (
Precisely controlling of enOsCas12f1 activity across multiple dimensions such as dose and timing could undoubtedly reduce the potential toxicity and off-target effects induced by enOsCas12f1, especially for in vivo scenario where enOsCas12f1 is constitutively expressed via AAV delivery. To achieve precisely controlled enOsCas12f1, enOsCas12f1 was fused with the destabilized domains (DD) of E. coli dihydrofolate reductase (ecDHFR). The newly synthesized DD-enOsCas12f1 protein (SEQ ID NO: 260) is rapidly targeted for proteasomal degradation, which can be blocked by the small molecule trimethoprim (TMP) (
To assess the in vivo deletion efficiencies of DMD exon 51 induced by enOsCas12f1 and DD-enOsCas12f1, a mouse model of DMD with exon 52 deletion and exon 51 replaced by human exon 51 with flanking intron sequences was created (
Next, the efficiency of enOsCas12f1-mediated epigenome editing was tested, which was named miniCRISPRoff (1444 aa), by adopting the strategy of CRISPRoff, with protein size at 2,361 aa. Four version of miniCRISPRoff (v1-v4; SEQ ID NOs: 261-264, respectively) were generated with dead enOsCas12f1 (denOsCas12f1 (OsCas12f1-D52R+T132R+D228A+D406A), SEQ ID NO: 513) (
All the protospacer sequences and spacer sequences used in the above Examples are listed in Table 4.
Although compact Cas12f orthologs have been tested in the genome editing delivered by a single AAV vector in human cells, their relatively low editing efficiency and restricted PAM requirement constrained their further application. Here, a set of Class 2, Type V-F CRISPR-Cas (Cas12f) subfamily members from bacteria was characterized, and nine that are functional in human cells were identified (
Rational protein engineering combined with sgRNA optimization, which enable enhanced interaction of Cas protein with nucleic acid or sgRNA, and increased sgRNA stability, has been validated in the current study. It is worth to note that the efficiencies of both OsCas12f1 and RhCas12f1 were substantially improved by substituting the A-U base pair in the first stem of sgRNA with G-C base pair (
enOsCas12f1 enables robust and specific genomic editing in vitro and in vivo and can be applied for efficient deletion of large fragment in human genome, such as ˜1700 bp deletion of exon 51 of dystrophin (
The hypercompact size of enOsCas12f1 (433 aa) and enRhCas12f1 (415 aa) could potentially enable their use in derivative genome engineering applications, including base editing, prime editing, retron editing, epigenome editing, and gene expression regulation. Here, enOsCas12f1 was engineered for sufficient epigenome editing (miniCRISPRoff) and gene activation (enOsCas12f1-VPR). It is interesting to engineer miniCRISPRoff for more efficient and smaller size that can be packaged by single AAV in the future.
In summary, enOsCas12f1 and enRhCas12f1 represent high-performance gene editing tools with versatile applications, and the temporally and spatially controlled DD-enOsCas12f1 is a promising platform for gene therapy.
Various modifications and variations of the described products, methods, and uses of the disclosure will be apparent to those skilled in the art without departing from the scope and spirit of the disclosure. Although the disclosure has been described in connection with specific embodiments, it will be understood that it is capable of further modifications and that the disclosure as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the disclosure that are obvious to those skilled in the art are intended to be within the scope of the disclosure. This application is intended to cover any variations, uses, or adaptations of the disclosure following, in general, the principles of the disclosure and including such departures from the present disclosure come within known customary practice within the art to which the disclosure pertains and may be applied to the essential features herein before set forth.
A
TATGGAATGTAAAT
A
TATATGATGTGAAT
GAAA
CAAAGAAAGGAATGCAAC
| Number | Date | Country | Kind |
|---|---|---|---|
| PCT/CN2022/089053 | Apr 2022 | WO | international |
| PCT/CN2022/142467 | Dec 2022 | WO | international |
This application is a continuation of PCT Patent Application No. PCT/CN2023/090685, filed on Apr. 25, 2023, which claims the benefits of and priorities to PCT Patent Application No. PCT/CN2022/089053, filed on Apr. 25, 2022, entitled “NOVEL CRISPR-CAS SYSTEMS AND USES THEREOF”, and PCT Patent Application No. PCT/CN2022/142467, filed on Dec. 27, 2022, entitled “NOVEL CRISPR-CAS SYSTEMS AND USES THEREOF”. The entire contents of each of the foregoing applications, including any sequence listing and drawings, are incorporated herein by reference in their entireties.
| Number | Date | Country | |
|---|---|---|---|
| Parent | PCT/CN23/90685 | Apr 2023 | US |
| Child | 18331431 | US |
