Novel gene and protein encoded by the gene

TECHNICAL FIELD

The present invention relates to DNA and a gene containing the DNA, and a recombinant polypeptide encoded by the DNA and a novel recombinant protein containing the polypeptide.

BACKGROUND ART

An enormous amount of information on the nucleotide sequence of the human genome has been obtained by large-scale sequencing in the Human Genome Project and analysis of the information is continuing on a daily basis.

The ultimate goal of the Human Genome Project is not just simple determination of the entire nucleotide sequence of the genome, but also the elucidation of various human life phenomena based on the structural information, that is the nucleotide sequence information of DNA.

Only limited regions of the human genome sequence encode proteins. Currently, the coding regions are predicted by the neural network or an information science technique, called the Hidden Markov Model. However, these models' predictive abilities are not yet sufficiently reliable.

DISCLOSURE OF THE INVENTION

For the purpose of finding novel genes, we have completed the present invention by succeeding in directly cloning novel DNAs comprising regions that encode proteins from cDNA libraries derived from the human adult whole brain, the human adult hippocampus and the human embryonic whole brain, and determining the nucleotide sequences thereof.

In a first embodiment, the present invention relates to DNA comprising a nucleotide sequence encoding the following (a) or (b):

(a) a polypeptide consisting of an amino acid sequence which is identical or substantially identical to an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70;
(b) a polypeptide consisting of an amino acid sequence derived from an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70 by deletion, substitution or addition of a section of amino acid(s), and having biological activity which is substantially the same characteristic with the function of the polypeptide of (a). Examples of such DNA include, but are not limited to, DNAs comprising the nucleotide sequences of SEQ ID NOS: 71 to 140.

In a second embodiment, the present invention further relates to a DNA hybridizing to the DNA of the first embodiment of the present invention under stringent conditions, and encoding a polypeptide having biological activity which is substantially the same characteristic with the function of the polypeptide of (a) above.

Hereinafter, the DNAs of the first and the second embodiments of the present invention are together referred to as “the DNA of the present invention.” Further, the present invention also relates to antisense DNA comprising a nucleotide sequence which is substantially complementary to the DNA of the present invention.

In a third embodiment, the present invention relates to a gene construct containing the DNA of the present invention. The term “gene construct” in the present specification refers to every artificially-engineered gene. Examples of the gene construct include, but are not limited to, a vector containing the DNA of the present invention or the antisense DNA of the DNA of the present invention, and an expression vector of the DNA of the present invention.

In a fourth embodiment, the present invention relates to the following (a) or (b):

(a) a polypeptide, consisting of an amino acid sequence which is identical or substantially identical to an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70;
(b) a polypeptide, consisting of an amino acid sequence derived from the amino acid sequence represented by any one of SEQ ID NOS: 1 to 70 by deletion, substitution or addition of a section of amino acids, and having biological activity which is substantially the same characteristic with the function of the polypeptide of (a).

In a fifth embodiment, the present invention relates to a recombinant polypeptide encoded by the gene construct of the third embodiment of the present invention.

Hereinafter, the above polypeptides are together also referred to as “the polypeptide of the present invention.” The term “polypeptide” in the present specification refers to “polymers of amino acids having every molecular weight.” The present invention also relates to a recombinant protein containing the polypeptide of the present invention. As defined above, in the present specification the term “polypeptide” is not to be limited by molecular weight, and therefore the term “the polypeptide of the present invention” also includes a recombinant protein containing the polypeptide of the present invention.

In a sixth embodiment, the present invention relates to an antibody against the polypeptide of the present invention.

In a seventh embodiment, the present invention relates to a DNA chip on which the DNAs of the present invention are arrayed.

In an eighth embodiment, the present invention relates to a polypeptide chip on which the polypeptides of the present invention are arrayed.

In a ninth embodiment, the present invention relates to an antibody chip on which the antibodies of the sixth embodiment of the present invention are arrayed.

Table 1 shows the names of clones having the DNA of the present invention, lengths of the polypeptide of the present invention, their putative functions and grounds for prediction.

The DNAs of the present invention are identified by determining the nucleotide sequences after isolating them as cDNA fragments from cDNA libraries that we have prepared using as a starter material the commercially available (Clontech) mRNA of human adult whole brain, the human adult hippocampus and the human embryonic whole brain.

Specifically, clones are randomly isolated from cDNA libraries derived from the human adult whole brain, the human adult hippocampus and the human embryonic whole brain prepared according to the method of Ohara et al. (DNA Research 4:53-59 (1997)).

Next, redundant clones (clones containing the same sequences) are removed by hybridization, followed by in vitro transcription and translation. Both termini of its nucleotide sequence are determined for a clone that has been confirmed to have products of 50 kDa or more.

Homology searches are performed with databases of known genes using the thus obtained terminal nucleotide sequences as queries. As a result, the full-length nucleotide sequence of a clone that is shown to be new is determined.

As described above, unknown genes that cannot be obtained by standard cloning techniques, which rely on known genes, can now be cloned systematically.

Further, the entire region of a human-derived gene containing the DNA of the present invention can also be prepared by a PCR method, such as RACE, while exercising proper care so as not to cause short fragments or any artificial mistakes in obtained sequences.

Furthermore, the present invention provides a recombinant vector which comprises the DNA of the present invention or a gene construct containing the DNA of the present invention; a transformant retaining the recombinant vector; a method for producing the polypeptide of the present invention or a recombinant protein containing the polypeptide, or salts thereof, which comprises the steps of culturing the transformant, producing and accumulating the polypeptide of the present invention or the recombinant protein containing the polypeptide, and collecting these products; and the thus produced polypeptide of the present invention or the recombinant protein containing the polypeptide, or salts thereof.

The present invention also relates to a pharmaceutical preparation comprising the DNA of the present invention or the gene construct; a pharmaceutical preparation comprising a polynucleotide (DNA) comprising a nucleotide sequence which encodes the polypeptide of the present invention or a partial polypeptide thereof, or a recombinant protein containing the polypeptides, an antisense nucleotide comprising a nucleotide sequence substantially complementary to the nucleotide sequence which encodes the polypeptide of the present invention or a partial polypeptide thereof, or a recombinant protein containing the polypeptides; a pharmaceutical preparation comprising the polynucleotide of the present invention and the antisense nucleotide , and a pharmaceutical preparation comprising the polypeptide of the present invention or a partial polypeptide thereof, and a recombinant protein containing the polypeptides.

The present invention further relates to a DNA chip, a peptide chip and an antibody chip that are prepared by arraying the DNAs of the present invention, the polypeptides of the present invention and the antibodies against the polypeptide of the present invention, respectively.

The present invention further relates to an antibody against the polypeptide of the present invention or a partial polypeptide thereof or a recombinant protein containing the polypeptides, or against salts thereof, and a method for screening a substance which specifically interacts with the polypeptide of the present invention by using the polypeptide of the present invention, a partial polypeptide thereof or a recombinant protein containing the polypeptides, or salts thereof, or antibodies against these substances; a kit for screening; and the substance (compound) itself which is identified by the screening method.

Any DNA can be used as the DNA of the present invention, so far as it comprises a nucleotide sequence encoding the above-mentioned polypeptide of the present invention. Further, the DNA of the present invention may be cDNA identified and isolated from cDNA libraries or the like derived from the human brain, from cells or tissues other than the brain, such as the heart, lung, liver, spleen, kidney, and testicle, or synthetic DNA.

A vector used for constructing libraries may be a bacteriophage, a plasmid, a cosmid, or a phagemid. In addition, using total RNA fractions or mRNA fractions prepared from the above cells or tissues, amplification can be performed directly by a reverse transcriptase-polymerase chain reaction (hereinafter, abbreviated as “RT-PCR method.”).

Any antisense DNA may be used as an antisense oligonucleotide (DNA) having a nucleotide sequence substantially complementary to the DNA that encodes the polypeptide of the present invention or a partial polypeptide thereof, so far as it comprises a nucleotide sequence substantially complementary to the nucleotide sequence of the DNA, and is capable of inhibiting the expression of the DNA. A substantially complementary sequence is, for example, a nucleotide sequence having preferably about 90% or more, more preferably about 95% or more, and most preferably 100% homology with the full-length or partial nucleotide sequence of the nucleotide sequence complementary to the DNA of the present invention. The antisense DNA of the present invention includes a nucleic acid sequence (RNA or DNA modified) having a similar function to that of the antisense DNA. These antisense DNAs can be produced using a known DNA synthesizer or the like.

The term “an amino acid sequence substantially identical to an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70” refers to an amino acid sequence having on the overall average about 70% or more, preferably about 80% or more, further preferably about 90% or more, and particularly preferably about 95% or more homology with each of all the amino acid sequences represented by any one of SEQ ID NOS: 1 to 70.

An example of a polypeptide consisting of an amino acid sequence substantially identical to an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70 of the present invention is a polypeptide having the above homology with the amino acid sequence represented by each of the above SEQ ID NOS, and having biological activity (function) which is substantially the same characteristic with the function of the polypeptide comprising the amino acid sequence represented by each SEQ ID NO. The term “substantially the same characteristic” refers to the activity (function) having the same characteristics.

Further, the polypeptide of the present invention also includes, for example, a polypeptide consisting of an amino acid sequence derived from an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70 by deletion, substitution or addition of a section of amino acids (preferably about 1 to 20, more preferably about 1 to 10, and further preferably several amino acids) or by a combination of these, and having biological activity (function) which is substantially the same characteristic with the function of a polypeptide comprising an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70.

The polypeptide consisting of an amino acid sequence which is substantially identical to the above amino acid sequence represented by any one of SEQ ID NOS: 1 to 70, or the polypeptide comprising an amino acid sequence derived from the above amino acid sequence by deletion, substitution or addition of a section of the amino acids can be easily produced by, for example, an appropriate combination of methods known by a person skilled in the art, such as site-directed mutagenesis, homologous recombination of genes, primer elongation and PCR.

For the polypeptide to have biological activity which is substantially the same characteristics, a possible method is substitution between homologous amino acids (polar or nonpolar amino acids, hydrophobic or hydrophilic amino acids, positively or negatively charged amino acids, aromatic amino acids and the like) among amino acids composing the polypeptide. To maintain biological activity that is substantially the same characteristics, it is preferred to retain amino acids within functional domains contained in each polypeptide of the present invention.

Further, the DNA of the present invention includes DNA comprising a nucleotide sequence encoding an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70, and a DNA hybridizing to the DNA under stringent conditions, and encoding a polypeptide having biological activity (function) which is the same characteristic with the function of a polypeptide consisting of an amino acid sequence represented by each of the sequences.

Under such conditions, examples of DNA capable of hybridizing to DNA comprising a nucleotide sequence encoding an amino acid sequence represented by each of the nucleotide sequences of SEQ ID NOS: 1 to 70 include DNA comprising a nucleotide sequence having on the overall average about 80% or more, preferably about 90% or more, more preferably about 95% or more homology with each of all the nucleotide sequences of the DNAs.

Hybridization can be performed by a method known in the art or a method according to any known methods, such as a method described in Current Protocols in Molecular Biology (edited by Frederick M. Ausubel et al., 1987). When a commercially available library is used, hybridization can also be performed by the method described in the attached instructions.

The term “stringent conditions” means, for example, conditions that allow hybridizing to the DNA probe of the present invention by southern blot hybridization under conditions that involve hybridization in an 7% SDS solution containing 1 mM sodium EDTA and 0.5 M dibasic sodium phosphate (pH 7.2) at 65° C., and washing membranes in a 1% SDS solution containing 1 mM sodium EDTA and 40 mM dibasic sodium phosphate (pH 7.2) at 65° C. The same stringency can also be achieved by conditions other than the above conditions.

To clone the DNA of the present invention, amplification is performed by a PCR method using a synthetic DNA primer having an appropriate nucleotide sequence of a part of the polypeptide of the present invention or the like, or the DNA can be selected by hybridization of DNA incorporated in an appropriate vector with DNA labeled using a DNA fragment or synthetic DNA which encodes a section or the full-length region of the polypeptide of the present invention.

Hybridization can be performed according to, for example, the above-described method in “Current Protocols in Molecular Biology” (edited by Frederick M. Ausubel et al., 1987). In addition, when commercially available libraries are used, hybridization can be performed according to the method described in the attached instructions.

Cloned DNA encoding a polypeptide can be used intact, or can be used after digestion with restriction enzymes if necessary, or after addition of linkers thereto, depending on the purposes. The DNA may contain ATG as a translation initiating codon at the 5′ terminal side, or TAA, TGA or TAG as a translation termination codon at the 3′ terminal side. These translation initiating and termination codons may be added using an appropriate synthetic DNA adaptor.

An expression vector for the polypeptide of the present invention can be produced according to any method known in the technical field. For example, the vector can be produced by (1) cleaving a DNA fragment containing the DNA of the present invention or a gene having the DNA of the present invention, and (2) ligating the DNA fragment downstream of a promoter in an appropriate expression vector.

Examples of vectors that can be used herein include plasmids derived from Escherichia coli, (for example, pBR322, pBR325, pUC18 and pUC118), plasmids derived from Bacillus subtilis (for example, pUB110, pTP5 and pC194), plasmids derived from yeast (for example, pSH19 and pSH15), bacteriophages, such as λ phages, and animal viruses, such as retrovirus, vaccinia virus, baculovirus and the like.

Any promoter can be used in the present invention, so far as it is appropriate for a host to be used for gene expression. Preferred examples of promoters include, when the host is Escherichia coli, trp promoters, lac promoters, recA promoters, λPL promoters and lpp promoters; when the host is Bacillus subtilis, SPO1 promoters, SPO2 promoters and penP promoters; and when the host is yeast, PHO5 promoters, PGK promoters, GAP promoters and ADH promoters. When animal cells are used as hosts, examples of promoters include SRα promoters, SV40 promoters, LTR promoters, CMV promoters and HSV-TK promoters.

In addition to the above substances, an enhancer, splicing signal, polyA addition signal, a selection marker, SV40 replication origin and the like that are known in the technical field can be added to the expression vector, if desired. Further, if necessary, a protein encoded by the DNA of the present invention can be expressed as a fusion protein with another protein (for example, glutathione S transferase and protein A). Such a fusion protein can be cleaved with appropriate protease and then separated into each protein.

Examples of host cells that are used herein include bacteria of the genus Escherichia or the genus Bacillus, yeast, insect cells, insects, and animal cells.

Specific examples of bacteria of the genus Escherichia that are used herein include Escherichia coli K12/DH1 (Proc. Natl. Acad. Sci. USA, 60:160 (1968)), JM103 (Nucleic Acids Research, 9:309 (1981)), JA221 (Journal of Molecular Biology, 120:517 (1978)), and HB 101 (Journal of Molecular Biology, 41:459 (1969)).

Examples of bacteria of the genus Bacillus that are used herein include Bacillus subtilis MI114 (Gene, 24:255(1983)) and 207-21 [Journal of Biochemistry, 95:87 (1984)].

Examples of yeast that are used herein include Saccaromyces, such as Saccaromyces cerevisiae AH22, AH22R-, NA87-11A, DKD-5D and 20B-12; Schizosaccaromyces pombe NCYC1913 and NCYC2036; and Pichia pastoris.

Examples of animal cells that are used herein include monkey cells, such as COS-7 and Vero, Chinese hamster ovary cells, such as CHO (hereinafter, abbreviated as CHO cells), dhfr gene-deficient CHO cells; mouse L cells, mouse AtT-20, mouse myeloma cells, rat GH3, and human FL cells.

These host cells can be transformed according to a method known in the technical field. For example, transformation can be performed by referring to Proc. Natl. Acad. Sci. USA, 69:2110 (1972); Gene, 17:107 (1982); Molecular & General Genetics, 168:111 (1979); “Methods in Enzymology,” vol. 194, p 182-187 (1991); Proc. Natl. Acad. Sci. USA, 75:1929 (1978); A Separate Volume 8 of Cell Technology, New Experimental Protocols in Cell Technology, p 263-267 (1995) (issued by Shujunsha); and Virology, 52:456 (1973).

The thus obtained transformant, which has been transformed with an expression vector containing the DNA of the present invention or a gene containing the DNA of the present invention, can be cultured according to a method known in the technical field.

For example, when hosts are bacteria of the genus Escherichia, culturing is performed normally at about 15° C. to 43° C. for about 3 to 24 hours, and if necessary, aeration and agitation may be performed. When hosts are bacteria of the genus Bacillus, culturing is performed normally at about 30° C. to 40° C. for about 6 to 24 hours, and if necessary, aeration and agitation may be performed.

A transformant whose host is yeast is normally cultured using media adjusted to have pH of approximately 5 to 8, at about 20° C. to 35° C. for about 24 to 72 hours, and if necessary, aeration and agitation may be performed.

A transformant whose host is an animal cell is normally cultured using media adjusted to have pH of about 6 to 8, at about 30° C. to 40° C. for about 15 to 60 hours, and if necessary, aeration and agitation may be performed.

To isolate and purify the polypeptide or the protein of the present invention from the above culture product, for example, bacteria or cells are collected by a known method after culturing, suspended in an appropriate buffer, disrupted by ultrasonication, lysozyme and/or freezing and thawing, and then centrifuged or filtered, thereby obtaining a crude protein extract. The buffer may contain a protein denaturing agent, such as urea or guanidine hydrochloride, or a surfactant, such as Triton X-100 (trade-mark). When the protein is secreted in a culture solution, bacteria or cells are separated after culturing from the supernatant by a known method, thereby collecting the supernatant. The thus obtained culture supernatant or the protein contained in an extract can be purified by an appropriate combination of known isolation and purification methods.

The thus obtained polypeptide of the present invention can be converted to a salt by a known method or a method according to the known method. Conversely, when the polypeptide is obtained as a salt, it can be converted to an educt or another salt by a known method or a method according to the known method. Further before or after purification, the protein produced by a recombinant can be freely modified by allowing an appropriate protein modification enzyme, such as trypsin and chymotrypsin, to act on the protein, or polypeptides can be partially removed.

The presence of the polypeptide of the present invention or its salt can be measured by various binding assays and enzyme immunoassay using a specific antibody.

The C terminus of the polypeptide of the present invention is normally a carboxyl group (—COOH) or a carboxylate (—COO—), and the C terminus may be an amide (—CONH₂) or ester (—COOR). Here, examples of R in ester that are used herein include a C1-6 alkyl group, such as methyl, ethyl, n-propyl, isopropyl or n-butyl; a C3-8 cycloalkyl group, such as cyclopentyl or cyclohexyl; a C6-12 aryl group, such as phenyl or α-naphthyl; a phenyl-C1-2 alkyl group, such as benzyl or phenethyl; and a C7-14 aralkyl group, such as an α-naphthyl-C1-2 alkyl group, e.g., α-naphthyl methyl. Further, pivaloyl-oxymethylester which is generally used as oral administration may also be used.

When the polypeptide of the present invention has a carboxyl group (or carboxylate) at the terminus other than the C terminus, the carboxyl group is amidated or esterified. The polypeptide of the present invention encompasses such a polypeptide. An example of ester that is used in this case is the above-mentioned ester at the C-terminus. Moreover, the polypeptide of the present invention also encompasses a polypeptide wherein an amino group of a methionine residue at the N-terminus is protected with a protecting group (for example, a C1-6 acyl group, such as a formyl group or an acetyl group); a polypeptide wherein a glutamic acid residue at the N-terminus which is generated by in vivo cleavage is pyroglutamated; a polypeptide wherein OH, COOH, NH₂, SH and the like on the side chain of intramolecular amino acids are protected with appropriate protecting groups (for example, a C1-6 acyl group, such as a formyl group and an acetyl group); or a complex protein, such as a so-called glycoprotein formed by the binding of sugar chains.

A partial polypeptide of the polypeptide of the present invention may be any polypeptide which is a partial peptide of the above-mentioned polypeptide of the present invention and has activity which has substantially the same characteristics. For example, a peptide that is used herein comprises a sequence of at least 10 or more, preferably 50 or more, further preferably 70 or more, further more preferably 100 or more, and most preferably 200 or more amino acids of the amino acid sequence composing the polypeptide of the present invention, and, for example, has biological activity substantially the same characteristic with the function of the polypeptide of the present invention. An example of a preferable partial polypeptide of the present invention contains each functional domain. Further, the partial peptide of the present invention normally has a carboxyl group (—COOH) or a carboxylate (—COO—) at the C terminus, and it may also have an amide (—CONH₂) or an ester (—COOR) at the C terminus like the above polypeptide of the present invention may have. Further, examples of the partial peptide of the present invention, similar to the polypeptide of the present invention described above, include a peptide wherein an amino group of a methionine residue at the N terminus is protected with a protecting group; a peptide wherein a glutamyl residue at the N-terminus which is generated by in vivo cleavage is pyroglutamated; a peptide wherein a substituent on the side chain of intramolecular amino acids is protected with an appropriate protecting group; a complex peptide, such as a so-called glycopeptide formed by the binding of sugar chains, or the like. The partial peptide of the present invention can be used as, for example, a reagent, reference materials for experiments, or an immunogen or a portion thereof.

Particularly preferred salts of the polypeptide of the present invention or the partial peptide are physiologically acceptable acid-added salts. Examples of such salts that are used herein include a salt formed with inorganic acid (for example, hydrochloric acid, phosphoric acid, hydrobromic acid and sulfuric acid), and a salt formed with organic acid (for example, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methane sulfonic acid and benzenesulfonic acid).

The polypeptide of the present invention, the partial peptide thereof or salts thereof, or amides thereof can be prepared by a chemical synthesis method known in the technical field.

For example, amino acids whose α-amino groups and side chain functional groups are appropriately protected are condensed on resin (which is commercially available resin for protein synthesis) in accordance with the sequence of a target polypeptide, according to various condensation methods known in the art. Various protecting groups are then removed simultaneously with cleavage of the polypeptide from the resin at the end of reaction. Further, reaction for forming an intramolecular disulfide linkage is conducted in a highly diluted solution, thereby obtaining a target polypeptide, the partial peptide thereof or amides thereof. Examples of activation reagents that can be used to condense the above protected amino acids include those that can be used for polypeptide synthesis and are represented by carbodiimides, such as DCC, N,N′-diisopropylcarbodiimide and N-ethyl-N′-(3-dimethylaminopropyl) carbodiimide. For activation by such reagents, both protected amino acids and a racemization-suppressing additive (for example, HOBt or HOOBt) are directly added to the resin; or protected amino acids can be previously activated with acid anhydride as a control, or HOBt ester or HOOBt ester, and then added to the resin.

Solvents used for activation of protected amino acids and condensation with resin can be appropriately selected from solvents known in the art as applicable to polypeptide condensation reaction, such as acid amides, halogenated hydrocarbons, alcohols, sulfoxides and ethers. A reaction temperature is appropriately selected from a known range that can be used for reaction of polypeptide linkage formation. Activated amino acid derivatives are normally used in 1.5 to 4-fold excess. When condensation is insufficient as a result of a test using ninhydrin reaction, sufficient condensation can be performed by repeating condensation reaction without eliminating protecting groups. When condensation is still insufficient even when reaction is repeated, unreacted amino acids are acetylated using acetic anhydride or acetylimidazole so as not to affect the subsequent reaction.

Protecting groups which are normally employed in the technical field can be used for raw materials, such as those for each of amino groups, carboxyl groups and serine hydroxyl groups.

The protection of functional groups that should not involve the reaction of raw materials, protecting groups, and the elimination of the protecting groups, and the activation of functional groups that involve reaction and the like can be appropriately selected from known groups or performed by known measures.

The partial peptide of the present invention or a salt thereof can be produced according to a peptide synthesis method known in the technical field, or by cleaving the polypeptide of the present invention with appropriate peptidase. For example, the peptide synthesis method may be either a solid-phase synthesis method or a liquid phase synthesis method. Examples of a known condensation method and a method of elimination of protecting groups are described in Nobuo IZUMIYA et al., Basics and Experiment for Peptide Synthesis, Maruzen (1975); Haruaki YAJIMA and Shunpei SAKAKIBARA, Experiment Course for Biochemistry 1, Protein Chemistry IV, 205 (1977); and Development of Pharmaceutical Preparation 2, vol. 14, Peptide Synthesis, under the editorship of Haruaki YAJIMA, Hirokawa Publishing Co.

After reaction, the partial peptide of the present invention can be purified and isolated using known methods, such as solvent extraction, distillation, column chromatography, liquid chromatography, recrystallization and the like in combination. When the partial peptide obtained by the above methods is an educt, it can be converted to an appropriate salt by a known method. Conversely, when the peptide is obtained as a salt, it can be converted to an educt by a known method.

The antibody for the polypeptide of the present invention, the partial peptide thereof or salts thereof may be either a polyclonal or a monoclonal antibody, so far as it can recognize these substances. The antibody for the polypeptide of the present invention, the partial peptide thereof or salts thereof can be produced using as an antigen the polypeptide of the present invention or the partial peptide thereof according to a known method for producing antibodies or anti-serum.

The antibody of the present invention can be used to detect the polypeptide of the present invention and the like which are present in a specimen, such as body fluid, tissues or the like. In addition, the antibody can be used for preparing an antibody column to be used for purifying these substances; detecting the polypeptide of the present invention in each fraction upon purification; analyzing the behavior of the polypeptide of the present invention within the cells of a specimen; and the like.

The use of the DNA, the polypeptide and the antibody of the present invention will be further described below.

Using as a probe the DNA of the present invention, the antisense DNA of the DNA of the present invention, or a gene construct containing these DNAs, abnormalities (of the gene) in DNA or mRNA encoding the polypeptide of the present invention or the partial peptide thereof can be detected.

The DNA, the antisense DNA or the gene construct of the present invention are useful as a genetic diagnostic agent for, for example, damages, mutation or hypoexpression in the DNA or mRNA, and an increase or hyperexpression of the DNA or mRNA. The above gene diagnosis using the DNA of the present invention can be performed by, for example, a known northern hybridization or a PCR-SSCP method (Genomics, 5:874-879(1989), Proc. Natl. Acad. Sci. USA, 86:2766-2770 (1989)).

Moreover, for patients who cannot exert normal in vivo functions because of abnormalities or deletions in the DNA or the gene of the present invention, or because the expression amount of the DNA or the gene of the present invention is reduced, it is effective that the DNA or the gene construct of the present invention is introduced for expression into the bodies of the patients by gene therapy using as vehicles appropriate vectors, such as retrovirus vectors, adenovirus vectors and adenovirus-associated virus vectors according to known techniques. Further, when patients cannot exert normal functions because of an increased expression amount, introduction of antisense can be effective.

The DNA, the antisense DNA of the present invention, or the gene construct thereof can be administered alone, or in combination with an adjuvant to promote uptake using a gene gun or a catheter, such as a hydrogel catheter.

In another example, injection of the polypeptide of the present invention or the like into patients with the above diseases also enables the polypeptide of the present invention or the like to exert its function in the patients.

Furthermore, the antibody of the present invention can be used for quantitatively determining the polypeptide of the present invention in a test liquid by a known method. Specifically, the antibody of the present invention can be used for quantitative determination by a sandwich immuno-assay using monoclonal antibodies, detection by tissue staining, and the like, by which, for example, diseases that involve the polypeptide of the present invention or the like can be diagnosed.

For these purposes, an antibody molecule itself can be used, or the antibody molecules F(ab′)2, Fab′ or Fab fractions can be used. Quantitative determination methods for the polypeptide of the present invention using the antibody of the present invention are not specifically limited. Any measurement method can be used, so far as it involves detecting the amount of antibodies, antigens or antibody-antigen complexes corresponding to the amount of antigens (for example, protein amount) in a test liquid by chemical or physical means, and calculating with a calibration curve which has been prepared using a standardized solution containing a known amount of antigens. For example, nephrometry, competitive assay, immunometric assay and sandwich assay are preferably used, and a later described sandwich assay is preferred in terms of sensitivity and specificity. Examples of a labeling agent that can be used in a measurement method using a labeling substance include a substance known in the technical field, such as radioisotopes, enzymes, fluorescent materials and light-emitting materials.

Details about the general technical procedures concerning these measurement and detection methods can be referred to in a review, reference book or the like, such as Radioimmunoassay 2 edited by Hiroshi IRIE, (Kodansha, issued in 1979); Enzyme Immunoassay edited by Eiji ISHIKAWA et al., (3^rdedition; Igaku-Shoin, issued in 1987); and Methods in Enzymology (issued by Academic Press), vol. 70, “Immunochemical Techniques (Part A),” vol. 73, “Immunochemical Techniques (Part B),” vol. 74, “Immunochemical Techniques (Part C),” vol. 84, “Immunochemical Techniques (Part D: Selected Immunoassays),” vol. 92, “Immunochemical Techniques (Part E: Monoclonal Antibodies and General Immunoassay Methods),” and vol. 121, “Immunochemical Techniques (Part I: Hybridoma Technology and Monoclonal Antibodies).”

Moreover, DNA chips prepared by arraying the DNA of the present invention are useful in detecting mutations and polymorphism of the DNA of the present invention, and monitoring the DNA dynamics. Regarding DNA array, which is a type of DNA chip, see “DNA Microarray and Current PCR method” (a separate volume of Cell Technology, Genome Science Series 1, under the editorship of Masaaki MURAMATSU and Hiroyuki NABA, 1^stimpression of the first edition, issued on Mar. 16, 2000) and the like.

Further, polypeptide chip prepared by arraying the polypeptides of the present invention can be a strong tool for functional analysis on the expression, interaction and posttranslational modification of the polypeptides of the present invention, and for identification and purification of proteins.

Antibody chip prepared by arraying antibodies against the polypeptides of the present invention are very useful in analyzing the correlation between the polypeptides of the present invention and diseases, disorders, or other physiological phenomena.

Methods and materials for preparing the chip are known by persons skilled in the art.

Furthermore, the polypeptides of the present invention or the like are useful as reagents for screening compounds which interact specifically with these substances. Specifically, the present invention provides a method for screening compounds which specifically interact with the polypeptide of the present invention, a partial peptide thereof or salts thereof, or antibodies against them by using these substances; and provides the screening kit therefor.

Compounds or salts thereof that are identified using the screening method or the screening kit of the present invention are selected from the above test compounds. The compounds interact with the polypeptide of the present invention or the like. For example, the compounds regulate, inhibit, promote or antagonize the biological activity of the polypeptide of the present invention or the like. The compound or a salt thereof may directly act on the activity of the polypeptide of the present invention or the like, or indirectly act on the activity of the polypeptide of the present invention or the like by acting on the expression of the polypeptide of the present invention or the like. An example of the salt of the compound that is used herein is a pharmaceutically acceptable salt. Specific examples of such salts include a salt formed with inorganic base, a salt formed with organic base, a salt formed with inorganic acid, a salt formed with organic acid, and a salt formed with basic or acidic amino acid. Compounds which inhibit the biological activity of the polypeptide of the present invention or the like can also be used as pharmaceutical preparations, such as therapeutic agents and preventive agents for each of the above-mentioned diseases.

When nucleotides (bases) and amino acids are indicated with abbreviations in the present specification, the abbreviations follow the IUPAC-IUB Joint Commission on Biochemical Nomenclature, or those commonly used in the art. Amino acids for which optical isomerism is possible are, unless otherwise specified, in the L form.

BEST MODE FOR CARRYING OUT THE INVENTION

The present invention will now be further described by means of examples that are not intended to limit the present invention. The various gene manipulations employed in the examples are according to the methods described in the above Current Protocols in Molecular Biology (edited by Frederick M. Ausubel et al., 1987).

(1) Construction of cDNA Library Derived from Human Adult Whole Brain, Human Adult Hippocampus and Human Embryonic Whole Brain

Double-stranded cDNA was synthesized using an oligonucleotide having Not-I site (GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)₁₅) (Invitrogen) as a primer, mRNAs (Clontech) derived from the human adult whole brain, the human adult hippocampus and the human embryonic whole brain as templates, and a SuperScriptII reverse transcriptase kit (Invitrogen). Next, an adaptor (Invitrogen) having SalI site was ligated to the cDNA, followed by digestion with NotI and 1% low-melt agarose electrophoresis. Thus, DNA fragments of 3 kb or more were purified.

The purified cDNA fragment was ligated to pBluescript IISK+ plasmid pre-treated with SalI-NotI restriction enzymes. The recombinant plasmid was introduced into Escherichia coli strain ElectroMax DH10B (Invitrogen) by electroporation.

(2) Screening

Subsequently, clones were randomly picked up from the constructed cDNA library, and then spotted onto membranes. The mixture of oligo DNAs (each comprising 21 nucleotides) was prepared based on each of the full-length nucleotide sequences of approximately 1300 clones that we had previously analyzed. Each 3′ terminus of the oligo DNAs was labeled with DIG using terminal transferase. Using the DIG-labeled DNAs as probes, dot hybridization (Current Protocols in Molecular Biology, edited by Frederick M. Ausubel et al, 1987) was performed so as to remove redundant clones (clones containing the same sequences).

Next, in vitro transcription and translation (Promega, TNT T7 Quick Coupled Transcription/Translation System cat. No. L1107) were performed, thereby selecting clones for which products of 50 kDa or more had been confirmed.

The terminal nucleotide sequences of the selected clones were then determined. Using the obtained sequences as queries, a homology search program BLASTN 2.0.14 (Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), “Gapped BLAST and PSI-BLAST: a new generation of protein database search programs,” Nucleic Acids Res. 25:3389-3402) was run on nr database (GenBank+EMBL+DDBJ+PDB sequences which do not contain EST, STS, GSS or HTGS (phase 0, 1 or 2) sequences). As a result, the full-length nucleotide sequences of novel genes, for which no homologous gene was present, were determined.

For sequencing, a DNA sequencer (ABI PRISM377) and a reaction kit which are manufactured by PE Applied Biosystems were used. Most sequences were determined by a dye terminator method using shotgun clones. Part of the nucleotide sequences was determined by synthesizing oligonucleotides based on the determined nucleotide sequences, and then performing a primer walking method.

As described above, screening for novel DNAs or genes was performed. As a result, a novel DNA or a gene represented by any one of SEQ ID NOS: 71 to 140 in the sequence listing was detected.

The nucleotide sequences of these novel DNAs or genes were determined by the above sequencing method. Table 1 shows the names of clones having the DNA or the gene of the present invention, the length of a polypeptide encoded by the gene in the clone, its putative function and the grounds for prediction.

TABLE 1Clone Name and Putative FunctionCloneSEQName/Protein length/IDFull length or partialGrounds forNO:sequencePutative functionprediction 1fg01864323PartialInvolved in mitoses, cell motilityPartially has a regionsequenceand phagocytosis through thehaving 50% homology toregulation of the cytoskeleton.coronin-, actin-bindingUseful in therapy and diagnosis inprotein 1C.the field of regulating the dynamicstates of cells, such as suppressionof cancer metastasis and the actionof immunocytes. 2fg02011314PartialRegulates gene expression by bindingPartially has a regionsequenceof C2H2 type zinc finger motif tohaving 42% homology toDNA, and interaction betweenzinc finger protein 91Kruppel-associated box (KRAB)and has zf-C2H2 motifs.domain and the other transcriptionalapparatus. The deletion or themutation of the protein may causeabnormalities in morphogenesis orcell proliferation. The detectionof the mutation is useful indiagnosing cancer and theintroduction of the normal gene isuseful in treating cancer. 3fg02301187PartialA molecule inferred to be involved inPartially has a regionsequencecell adhesion because it has ahaving 39% homology totransmembrane domain and threethe immunoglobulinIg-like C2-type domains, and sharessuperfamily, and has ighigh homology with NCAM1 and NCAM2.motifs and a sosuiSince the molecule regulatestransmembrane domain.intercellular adhesion, it is usefulin diagnosing and treatingcanceration of cells and cancermetastasis, and screening for thetherapeutic agent. 4fg029361479PartialA membrane protein expressed in thePartially has a regionsequencenerve system. Inferred to functionhaving 99% homology toas receptors for semaphorins, theNOV/plexin-A1 proteinguidance factor to elongate neuraland has the functionaxial filaments, thus regulatingmotifs of each of Sema,neuron formation. With itsPlexin_repeat, integrin_—function to regulate the growth ofB, and TIG.neural axial filaments, it is usefulin diagnosing and treating a varietyof neuropsychiatric diseases, orscreening for the therapeutic agent. 5fg04068258PartialEncodes a guanine nucleotidePartially has a regionsequenceexchange factor (GEF) whose targethaving 91% homology to ais Rho-type GTPase. Activates Rhoneuronal guaninesignal by converting Rho to GTP type.nucleotide exchangeThe expression of the protein is highfactor, and has a PHin the brain, suggesting that it isdomain motif.involved in brain functions.Useful in diagnosing and treatingcancer, and screening for thetherapeutic agent. Also inferredto be useful in improving brainfunctions, since it is stronglyexpressed in the brain and is thoughtto be involved in recognitionfunctions. 6fg05423675PartialA DNA-binding protein having a zincPartially has a regionsequencefinger motif, and is ahaving 51% homology totranscriptional regulatory factor.EVI1 protein, and hasInferred to be a protooncogene,zf-C2H2 motifs and asimilar to EVI-1, or a causativezf-BED motif.protein of osteomyelodysplasiasyndrome. Thus, it is thought to beuseful in diagnosing and treatingcancer or osteomyelodysplasia, andin screening for the therapeuticagent. 7fg06344248PartialInferred to synthesize acetylPartially has a regionsequencecoenzyme A. The protein may behaving 60% homology touseful in screening for anticanceracetyl CoA synthetase.agents and immunosuppressantagents. 8fg06691193PartialInferred to have high homology withPartially has a regionsequencean enzyme, proline dehydrogenase,having 93% homology toand has functions similar to prolineproline dehydrogenase.dehydrogenase. Oxidizes proline to1-proline-5-carboxilic acid. Thedeletion of the enzyme causeshyperprolinemia. Prolineregulates transmission byglutamate-operated synapses, andcontrols neurotransmission in thebrain. Elevated blood prolinelevels lead to abnormal sensorymotor. Thus, it is useful indiagnosing and treating mentaldisorders due to hyperprolinemia andproline metabolic disorders. 9fh02216373PartialHas α1,2-mannosidase activity toPartially has a regionsequenceremove the terminal mannose ofhaving 100% homology toMan9GlcNac2-, the precursor, formedα1,2-mannosidase, andin ER during the biosynthetichas a Glyco_hydro_47pathways of N-glycoside-bindingmotif and a sosuisugar chain; and plays an importanttransmembrane domain.role in sugar chain synthesis ofN-glycoside-binding glycoprotein.The N-glycoside-binding sugar chainfunctions everywhere in vivo. Thedeletion of the protein may causediseases induced by deficientN-glycoside binding sugar chain.The protein is useful in treating anddiagnosing these diseases.10fh02982215PartialRegulates exocytosis, triggered byPartially has a regionsequenceCa2+, of neurotransmitters inhaving 68% homology tosynapse. Inferred to be useful inNIM3, and has a C2 domaindiagnosing and treating nervousmotif.diseases.11fh032031134PartialAn extracellular matrixPartially has a regionsequenceglycoprotein which responds tohaving 37% homology topheromone and is transcribed.hydroxyproline-richInvolved in biophylaxis.glycoprotein DZ-HRGP.12fh05673438PartialExpressed upon cephalization to be aPartially has a regionsequenceguidance for the growth of neuralhaving 57% homology toaxial filaments. Not a type whichnetrin-G1c and has aacts by diffusion, but acts locallylaminin_Nterm motif and aon the surface of a cell membrane.laminin_EGF motif.Useful in diagnosing and treatingvarious neuropsychiatric diseases,or screening for the therapeuticagents for these diseases, since theprotein regulates the growth ofneural axial filaments.13fh06634505PartialOne of the proteins forming anPartially has a regionsequenceadaptor molecule complex whichhaving 100% homology totransduces a signal from tyrosineguaninekinase to Ras. Functions as guaninenucleotide-releasingnucleotide-releasing factor 2 forfactor 2, and has aRas. Since the protein is involvedRasGEFN motif and ain signal transduction from aRasGEF motif.receptor to Ras, it is useful indiagnosing and treating cancerthrough the regulation of cellproliferation, and screening for thetherapeutic agent.14fh08795572PartialPromotes GTPase activity ofPartially has a regionsequenceRas-related nuclear protein Ran,having 100% homology towhich is involved in cell cycle; thusRan GTPase activatingpromotes conversion of activeprotein 1.GTP-Ran to inactive GDP-Ran, therebyregulating initiation of cellmitosis. Useful in diagnosing andtreating cancer, and screening forthe therapeutic agent, sinceabnormalities in the protein cancause canceration.15fh133101051PartialInferred to help the migration ofPartially has a regionsequencehnRNPA1 from cytoplasms to nuclei byhaving 98% homology tobinding to hnRNPA1, which is akaryopherinβ2b,protein controlling mRNA processingtransportin, and hasand the transport of mRNA from nucleiArmadillo_seg motifs andto cytoplasms. Useful inHEAT motifs.diagnosing and treating cancer byregulating the gene.16fh18356887PartialInferred to be a factor which isPartially has a regionsequenceinduced in blastocysts byhaving 94% homology toparathyroid hormone, and involved inPTH-responsivethe activation of blastocysts byosteosarcome B1 protein.parathyroid hormone andosteogenesis. Useful in diagnosingand treating bone diseases, such asosteoporosis and a variety ofcancers, and screening for thetherapeutic agent for thesediseases.17fh18358689PartialPromotes the formation ofPartially has a regionsequenceCDC25c/14-3-3 protein complex byhaving 64% homology tophosphorylating Ser216 ofCdc25C associatedCDC25c; and regulates the initiationprotein kinase C-TAK1,of cell mitosis through the complex.and has a pkinase motifUseful in diagnosing and treatingand a UBA motif.cancer and screening for thetherapeutic agent, since it isinvolved in the regulation of celldivision.18fh205391004PartialHas the ankyrin repeat and isPartially has a regionsequenceinvolved in protein interaction.having 35% homology toUseful in treating cystic fibrosis,FRANK2 protein, and hassince it is involved in regulatingank repeat motifs.CFTR expression.19fh22167761PartialSerine/threonine kinase in thePartially has a regionsequenceintracellular signal transductionhaving 30% homology tosystem. Useful in screening a drugprotein kinase WNK1.for diseases which involve thesignal transduction system.20fh23421480PartialA nuclear protein involved in mRNAHas 97% homology to asequencesplicing. Concentrated in portionsputative splicingreferred to as nuclear TY body, andfactor, YT521-B.inferred to provide a site for mRNAsplicing. Useful in diagnosing andtreating cancer, and screening forthe therapeutic agent, since it isinvolved in regulating expressionand cell proliferation. Alsouseful in the field of regenerationmedicine.21fh24594762PartialInvolved in binding synaptosomePartially has a regionsequencebinding protein (SNAP-25) to thehaving 94% homology tocytoskeleton, and regulatingSNAP-25-interactingexocytosis. Useful in diagnosing,protein, and has apreventing and treating nervousTroponin motif.diseases, since it is involved inregulating the release ofneurotransmitters.22fh262071094PartialA GnRH-like decapeptide precursorPartially has a regionsequenceacting as gonadotropin releasinghaving 98% homology tohormone. Useful in diagnosing,putative preopticpreventing and treatingregulatory factor-2abnormalities in sex hormones, suchprecursor.as infertility and cancer.23fj00154388PartialAn enzyme which substitutesPartially has a regionsequenceadenosine residue 37 of alanine tRNAhaving 99% homology towith an inosine residue. Useful inadenosine deaminasepreventing, treating and diagnosingacting on tRNA 1, and hasdiseases involved in modifying, suchA_deamin motifs.as tRNA.24fj00597s1523FullInferred to transport iron or otherPartially has a regionlengthdivalent cations or to function as ahaving 39% homology tomembrane-binding receptor. ForTTYH1, and has sosuiexample, iron metabolic disorderstransmembrane motifs.cause blood diseases, such asanemia, the disease of nervousdegeneration and the like. Thus itis useful in diagnosing and treatingsuch diseases by detecting andregulating the expression and thefunction of the protein.25fj03879s11653PartialActs on protein interaction since itPartially has a regionsequencehas a PH domain. Inferred to act onhaving 44% homology tothe morphological changes inP116 RHO-interactingneurons. Also inferred to inhibitprotein (P116RIP)cell expansion and the elongation of(RIP3), and has a PHneurons by acting on Rho. Useful indomain motif.diagnosing and treating nervousdiseases and cancer, and screeningfor the therapeutic agents for thesediseases by regulating the gene.26fj04226959PartialA microtubule-associated proteinPartially has a regionsequencewhich regulates microtubulehaving 61% homology tokinetics and interaction betweenmicrotubule-associatedmicrotubules and otherprotein 4, and hasintracellular molecules. With thetubulin-binding motifs.strong involvement of amicrotubule-associated protein incancer and Alzheimer's disease, theprotein, a putative member of theprotein family, is useful indiagnosing and treating thesediseases.27fj04751878FullA protein which binds to oxysterol,Partially has a regionlengthand plays an important role inhaving 60% homology toregulating cholesterol metabolism.oxysterol-bindingUseful in diagnosing and treatingprotein, and has a PHcardiovascular diseases caused bydomain and anabnormalities in cholesterolOxysterol_Bp motif.metabolism, and screening for thedrug.28fj05456281PartialInferred to act as a cytoskeletonPartially has a regionsequencefactor in neurons of the brain.having 32% homology to aThis protein has 5 kelch motifs,ring canal protein, andwhile Gigaxonin (mutated Gigaxoninhas Kelch motifs.is found in giant axonal neuropathy)has the BTB domain and 6 Kelchmotifs. The protein is useful indiagnosing and treating giant axonalneuropathy and degenerativedisorders in the nervous system(e.g., amyotrophic lateralsclerosis, amyotrophy,charcot-Marie-tooth disease).29fj06918707PartialPresent in neurons, and co-existsPartially has a regionsequencewith ion channels. Involved inhaving 46% homology to adifferentiation of the functionalcell recognitiondomain of axial filaments. Usefulmolecule, Caspr2, and hasin treating, preventing, andlaminin_G motifs and andiagnosing nervous diseases, andEGF motif.screening for the therapeutic agent.30fj08985341PartialA protein having a motif which bindsPartially has a regionsequenceto GTP-Rho, and which plays a role inhaving 80% homology totransducing Rho signal to otherGTP-rho binding proteinproteins. Involved in the regulation1, and has a BRO1 motif.of the cytoskeleton which is based onactin, the contraction of the smoothmuscle, transcription, cellproliferation, and the regulation ofcell cycle. Useful in diagnosingand treating diseases caused byabnormalities in the cytoskeletonand morphogenesis, and cancer, andscreening for the therapeutic agent.31fj10564531PartialAn isozyme of phosphoenzyme whichPartially has a regionsequenceconverts inositol triphosphate tohaving 100% homology toinositol tetraphosphate.inositol1, 4,5-Regulates intracellular calciumtriphosphate3-kinaselevels and is involved in signal(IP3K).transduction. Expressed in thehippocampus. Useful in screeningfor an agent selectively acting onthe inositol phosphate pathway.32fj114711199PartialHas domains involved inhistogenesisPartially has a regionsequenceand development of extremities.having 37% homology toPossible involvement in cellFH1/FH2localization, cell division and thedomain-containingregulation of the cytoskeleton.protein FHOS, and has aHigh expression of this protein inFH2 motif.the spleen suggests its involvementin maturation and development of Bcells and erythrocytes. Useful indiagnosing and treating diseasescaused by cell or tissuedevelopment, morphogenesis andmaturation, and in regenerationmedicine.33fj12188449PartialRegulates the binding and fusion ofPartially has a regionsequencesynaptic vesicles at the synaptichaving 51% homology totermini in the brain. Useful inserine/threonine-treating and diagnosing diseasesprotein kinase DCAMKL1,with abnormalities in neuraland has a pkinase motif.transmission.34fj144061354PartialA motor molecule which converts ATPPartially has a regionsequence(chemical energy) into physicalhaving 37% homology to 1force so as to move alongβ dynein heavy chain,microtubules. While dyneinsand has a Dynein_heavyinvolved in mitosis, vesiclemotif.transport, and the movement of ciliaand fragella exist as multisubunitcomplexes, the protein functions as1β dynein heavy chain which is acomponent of the complex. Useful indiagnosing and treating cancer, andscreening for the therapeutic agent.Also useful in diagnosing cranialnerve diseases, such ashydrencephaly, infertility andrespiratory apparatus-relateddiseases.35fj15278966PartialInvolved in regulation of bindingHas 95% homology toSequenceand fusion of synaptic vesicles torsec8.pre-synaptic membranes. Acomponent of a complex involved inneural transmission. Useful intreating and diagnosing diseaseswith abnormalities in neuraltransmission.36fj16085s11766PartialRegulates cell differentiation andPartially has a regionsequencecell proliferation by interactinghaving 57% homology towith proteins having the SET domain.nuclear dual-specificityUseful in diagnosing and treatingphosphatase, and has acancer, and screening for theDENN, a GRAM and a PHtherapeutic agent.domain motif.37fj17028498PartialProduces phospholipids, the secondPartially has a regionsequencemessenger, and involved inhaving 95% homology tointracellular reactions includingphosphatidicproduction of hyperoxides inacid-preferringneutrophils, actin polymerizationphospholipase A1, and hasand the like. Useful in diagnosinga DDHD motif.and treating infectious diseases,inflammation and immune diseases,and screening for the drug.38fj17066389FullRegulates the expression of homeoticPartially has a regionlengthgenes by modifying the structure ofhaving 87% homology tochromosomes, and inhibitschromobox homolog 8, and(functions to perform silencing)has a chromo motif.gene expression. Useful indiagnosing and treating cancer, andscreening for the therapeutic agent.Also useful in gene diagnosis ofmalformation, teratogeny and thelike, and in the field ofregeneration medicine.39gh01817b380PartialDissociates a transcribed complexPartially has a regionsequencefrom a template. Can be used forhaving 92% homology toanalyzing the transcriptionalpolymerase I and amechanism.transcript releasefactor.40gh13812360PartialA regulatory subunit of phosphatasePartially has a regionsequencewhich regulates the activity of ahaving 93% homology topyruvate dehydrogenase complex.pyruvate dehydrogenaseUseful in diagnosing and treatingphosphatase regulatorycancer, and screening for thesubunit precursor, andtherapeutic agent. Also useful inhas a GCV_T motif.screening for an antiobestic drug.41hh05136b832PartialA homologue of collagen V precursor.Partially has a regionsequenceCollagen V plays an important role inhaving 46% homology toforming extracellular matrix.collagen α1 (V) chainUseful in diagnosing cirrhosis, andprecursor, and hasas biological base materials inCollagen motifs and COLFIregeneration medicine.motifs.42hh05356370PartialForms a spindle during cellPartially has a regionsequencedivision, and delivers chromosomeshaving 97% homology toto daughter cells. Involved intubulin β-5 chain (β-constructing and maintaining thetubulin class-V).three-dimensional structure of acytoplasm together with actin fibersand intermediate filaments. Usefulin diagnosing and treating cancer,and screening for the therapeuticagent.43hh10052412PartialInferred to be the gene product of aPartially has a regionsequencenovel human cartilage link proteinhaving 49% homology tofamily, which is important inproteoglycan linkdifferentiation and proliferationprotein precursorof cartilage cells. Useful in(cartilage linkregeneration of the cartilage.protein), and has an igmotif and Xlink motifs.44hh13045803PartialInferred to be novel cadherinPartially has a regionsequencemolecules, since they have cadherinhaving 30% homology torepeats. Involved in cellFAT tumor suppressor, andadhesion. Possible involvement inhas cadherin motifs.segregation of cancer cells fromprimary layers and infiltrationwithcancer cells. Useful in diagnosingand treating cancer, and screeningfor the therapeutic agent. Alsouseful as a marker for renaldiseases, because of its highexpression in kidney.45hh141801036Full(Threonin)-0-bindingHas a region having 99%lengthN-acetylglucosamine transferase,homology towhich controls activities of variousN-acetylglucosaminylproteins including a transcriptiontransferase 110 KDAfactor, a nuclear membrane protein,subunit, and has TPRa cytoskeletal protein and amotifs.cancer-related protein within thenucleus and cytoplasm. Useful indiagnosing and treating variousdiseases, such as cancer, andscreening for the therapeutic agent.46hj02562277PartialA protein which may function as aHas a region having 88%sequenceco-activator in RNA polymerase IIhomology to PC2 glutaminecomplexes. Possible involvement inrich binding protein.cranial nerve diseases, such asAlzheimer's disease andParkinson's disease, because theyhave glutamate repeats. Useful indiagnosing cranial nerve diseases,such as Alzheimer's disease andParkinson's disease, and as atarget therapeutic agent to bedeveloped.47hj038651115PartialHas 98% homology to aPartially has a regionsequencehuntingtin-associated proteinhaving 98% homology tointeracting protein (HAPIP) whichhuntingtin-associatedbinds to a protein (Duo) binding toprotein interactinghuntingtin, the cause ofprotein, and has a RhoGEFHuntington's chorea. Highand a PH domain motif.expression in the brain. UNC-73,the C. elegans homologue of HAPIP,has been shown to involve axonalguidance. Suggested to be involvedin signal transduction, because ithas the RhoGEF motif. Inferred tobe useful in diagnosing and treatingHuntington's chorea. Useful as atarget gene for developing an agentfor nerve regeneration because ofthe involvement in axonal guidance.48hj05256783PartialInferred to be a transcriptionPartially has a regionsequencefactor, since the protein has thehaving 48% homology tozinc finger motif. A deletion or azinc finger protein 91,mutation in the protein may causeand has zf-C2H2 motifs.abnormalities in morphogenesis andcell proliferation. Detection of amutation in the gene is useful indiagnosing cancer, and introductionof the normal gene is useful intreating cancer.49hk02174797PartialA protein, which is accumulated inPartially has a regionsequencesignificant amount in thehaving 94% homology topost-synaptic density of excitableproline rich synapsesynapses. Inferred to be a geneassociated protein 2, andencoding a protein which anchorshas a SAM motif.SAP90/PSD-95, the scaffold for amembrane receptor, to thecytoskeleton in synapses usingglutamate in the central nervesystem.The protein may have influence on thegeneration of the neural network,and establishment of memory andlearning. Useful in diagnosingvarious neuropsychiatric disorders,and screening for the therapeuticagent.50pf00330s11043FullA protein, the scaffold for ephr in B,Partially has a regionlengthwhich plays an important role byhaving 87% homology toguiding axial filaments in theglutamate receptorembryogenesis, to form a complexinteracting protein 2,that transduces signal. Inferredand has PDZ motifs.to involve neural circuit formation.Useful in gene diagnosis and thefield of regeneration medicine.51pf00447421PartialIt may bind to a protein having thePartially has a regionsequenceSH3 domain, because the protein ishaving 41% homology tohomologous to SH3-domain bindingSH3-domain bindingprotein. Since the protein havingprotein 5the SH3-domain is often involved in(BTK-associated).intracellular signal transduction,it can be inferred that the proteinhas similar functions. Useful indiagnosing and treating cancer, andscreening for the therapeutic agent.52pg002391644PartialInferred to perform proteinPartially has a regionsequenceinteraction, since the protein hashaving 30% homology tothe ankyrin repeat. Possibleankyrin 3, and has ankinvolvement in signal transductionrepeat motifs.and transcriptional control.Useful in diagnosing and treatingcancer, and screening for thetherapeutic agent.53pg00264534PartialInferred to be sialyltransferase,Partially has a regionsequenceand involve post-translationalhaving 54% homology tomodification of protein. Useful inCMP-N-acetylneuraminate-treating, preventing and diagnosingβ-galactosamide-α-2,cancer, and screening for the drug.6-siaryltransferase, andAlso useful in modifying the sugarhas a sosui transmembranechain of a recombinant protein,motif and asimilar to a human type.Glyco_transf_29 motif.54pg009331768PartialA motor molecule which converts ATPPartially has a regionsequence(chemical energy) into physicalhaving 98% homology toforce so as to move alongubiqutinating enzymemicrotubules. While dyneinsE2-230 kDa.involved in mitosis, vesicletransport, and the movement of ciliaand fragella exist as multisubunitcomplexes, the protein functions as1β dynein heavy chain which is acomponent of the complex. Useful indiagnosing and treating cancer, andscreening for the therapeutic agent.Also useful in diagnosing cranialnerve diseases, such ashydrencephaly, infertility andrespiratory apparatus-relateddiseases.55ph003311313PartialInferred to be ubiquitin-bindingPartially has a regionsequenceenzyme. It is known that with anhaving 73% homology toabnormal ubiquitinating process,dynein heavy chaincells are unable to differentiateisotype 6.and proliferate, inducing variousdiseases including cancer andParkinson's disease. Useful inscreening for the therapeutic agentof these diseases.56pj01645765PartialInferred to be a gene involved inPartially has a regionsequencecilia formation. Useful inhaving 76% homology todiagnosing and treating respiratoryKPL2.diseases and cilia dysfunction.57pj01649439FullMany microtubule-binding proteinsPartially has a regionlengthare present in neurons, and involvehaving 58% homology toneural axial filament formation.putativeTherefore abnormalmicrotubule-associatedmicrotubule-binding proteins affectprotein.neurogenesis and cause malformationand teratogeny. Useful indiagnosing and treating cancer, andscreening for the therapeutic agent.Also useful in gene diagnosis ofcongenital diseases and the field ofnerve regeneration medicine.58bf00083879FullA pyruvate dehydrogenaseHas a region having 91%lengthphosphatase activity regulatoryhomology to pyruvatesubunit. Inferred to involvedehydrogenaseregulating sugar metabolism.phosphatase regulatoryUseful in diagnosing and treatingsubunit precursor, andcancer, and screening for thehas a DAO, a Phytoene_dhtherapeutic agent. Also useful inand a GCV_T motifs.screening for an antiobestic agent.59bf00135699PartialKinesin light chain, the motorPartially has a regionsequenceprotein which moves alonghaving 36% homology tomicrotubules. Inferred to involvekinesin light chain, andthe intracellular transport ofhas TPR motifs.substances. Directly binds amyloidprotein precursor (APP), thecausative agent of Alzheimer withsubstances, so as to transport thesubstances along neural axialfilaments in neurons. Useful inpreventing diseases involved in theintracellular transport ofsubstances; and diagnosing andtreating Alzheimer, and screeningfor the therapeutic agent.60bg001841179PartialA novel transcription factor. ManyPartially has a regionsequenceof them are present as a nuclearhaving 99% homology toprotein in the cerebellum. UsefulTFNR.in diagnosing and treating cancer,and screening for the therapeuticagent.61bj00061802—A protein analogous to endozepine,Partially has a regionthe ligand of the receptor ofhaving 80% homology tobenzodiazepine which is classifiedendodiazepine-relatedas an antianxiety agent or sedativeprotein precursor, anddrug/hypnotics. Useful as anhas an ACBP motif and aanalgesic agent, antianxiety agentsosui transmembraneand anticonvulsant in diagnosing,motif.preventing and treating nervousdiseases.62bj001951194PartialType 1 hexokinase, which isPartially has a regionsequencetranscribed upon spermatogenesis.having 94% homology toThe protein is present in thecytoplasmic dynein heavyacrosome of a sperm, and functions aschain 2.a receptor for ZP3 protein, thepellucid zone of an egg, uponfertilization. Useful indiscriminating the maturity ofsperms and suppressing the functionof sperm. Also useful in diagnosingand treating infertility, andcontraception.63fg012851560PartialA protein analogous to myosin, whichPartially has a regionsequenceis involved in intracellularhaving 35% homology totransport and induces dysgenicmyosin XV, and has acongenital asymptomatic auditorymyosin_head motif and adisorder DFNB3. Useful inMyTH4 motif.preventing, diagnosing and treatingnervous diseases involvingintracellular transport. Alsouseful in the filed of medicine ofnerve regeneration.64fh17057958PartialInferred to be breakpoint clusterPresent on chromosome 14,sequenceregion protein 2, the product of apartially has a regionhouse keeping gene which encodes ahaving 99% homology toprotein necessary for cellbreakpoint clustersurvival. Useful in diagnosingregion protein 2, and hasand treating cancer, and screeningWD40 motifs.for the therapeutic agent.65ha06731715PartialAn analogous protein of HrPOPK-1,Partially has a regionsequencewhich is inferred to havehaving 51% homology toserine/threonine kinase activity,HrPOPK-1, and has a sosuiand have regulatory functions intransmembrane motif.generation/differentiation, such asdetermination of the embryonic axis.Useful in gene diagnosis ofcongenital abnormalities andteratogeny, and in the field ofregeneration medicine. Further,useful in diagnosing and treatingcancer, and screening for thetherapeutic agent.66hj05226105—Homologous to a part of EGF-likePartially has a regiondomains in a protein (MEGF) havinghaving 52% homology tomany EGF-like domains. It is knownMEGF6, and has EGFthat mutations in the domains affectmotifs.cell-to-cell interaction in thebrain and ligand-receptorinteraction, so as to cause auxesisof the nerve system ordisorganization of the brain cortex,thus induces dementia or the like.Useful in diagnosing and treatingdiseases of the brain and the nervoussystem.67pf010121192—Homologous to a part of EGF-likePartially has a regiondomains in a protein (MEGF) havinghaving 32% homology tomany EGF-like domains. It is knownMEGF6, and has EGFthat mutations in the domains affectmotifs.cell-to-cell interaction in thebrain and ligand-receptorinteraction, so as to cause auxesisof the nerve system ordisorganization of the brain cortex,thus induces dementia or the like.Useful in diagnosing and treatingdiseases of the brain and the nervoussystem.68fg02852350PartialAn analogous protein of p150-SpirPartially has a regionsequenceprotein which regulateshaving 42% homology toreconstruction of actin by beingp150-Spir protein.phosphorylated withstress-responsive phosphoenzymeJNK. Useful in diagnosing andtreating cancer, and screening forthe therapeutic agent.69fh21913a244PartialA protein analogous to fibrillinPartially has a regionsequencewhich is a major component of a thinhaving 74% homology tofiber network formed by assembly offibrillin 5, and has EGFelastin proteins and is presentmotifs and a TB motif.extensively over the connectivetissue. With its possibleinvolvement in a hereditary disease,Marfans syndrome, associated withcardiovascular and visualdisorders, it is useful in thediagnosis and the treatment.70fj225641299—A protein having C2H2 type zincPartially has a regionfinger motifs. One of intranuclearhaving 96% homology toproteins expressed in embryonic stemzinc finger protein andcells. Inferred to involvehas zf-C2H2 motifs.development, differentiation andproliferation. With possibleinvolvement in development of earlyembryos, it is inferred to involvecell proliferation ordifferentiation. Thus it is usefulin diagnosing and treating cancer,and screening for the therapeuticagent. Also it is useful inregeneration medicine or genediagnosis of congenitalabnormalities and teratogeny.

(3) Homology Search for the DNA of the Present Invention

Next, based on the thus obtained full-length nucleotide sequences, the amino acid sequences of the clones were searched on the library of known sequences, nr release 122, using an analysis program BLASTP 2.0.14 (the above-mentioned “Gapped BLAST and PSI-BLAST: a new generation of protein database search programs”). Thus, it was shown that the clones were homologous to each homologous genes listed in Table 2. Table 2 shows the information on these homologous genes, specifically, the name, database ID, biological species, nomenclature, protein length and the literature containing the information.

TABLE 2Homologous Gene of Each Gene and Biological SpeciesSEQHomologous geneIDDatabaseBiologicalProteinNO:NameIDspecies^※lengthLiterature 1coronin, actin binding proteingi|6753496Mouse474DNA Cell Biol. 17 (9),1C779-787 (1998) 2zinc finger protein 91gi|4508041Human1191Proc. Natl. Acad. Sci.U.S.A. 88 (9),3608-3612 (1991) 3immunoglobulin superfamilygi|7657226Human442Genomics 62 (2),139-146 (1999) 4NOV/plexin-A1 proteinemb|CAB57274.1|Human1754Proc. Natl. Acad. Sci.U.S.A. 93 (2), 674-678(1996) 5neuronal guanine nucleotidegi|9845277Mouse554Genomics 65 (1), 53-61exchange factor(2000) 6EVI1 proteinpir||S41705Human1042EMBO J. 13 (3),504-510 (1994) 7acetyl-coenzyme A synthetasegb|AAG08119.1|AE004887_3Bacillus of green pus645Nature 406 (6799),959-964 (2000) 8proline dehydrogenasegb|AAD24775.1|AF120278_1Human516Nat. Genet. 21 (4),434-439 (1999) 9alpha 1,2-mannosidasegi|7706437Human699Glycobiology 9 (10),1073-1078 (1999)10NIM3gb|AAF81657.1|AF199335_1Rat285J. Biol. Chem. 275(26), 20033-20044(2000)11hydroxyproline-richemb|CAB62280.1|Volvox409J. Biol. Chem. 274glycoprotein DZ-HRGP(49), 35023-35028(1999)12Netrin-G1cdbj|BAB12008.1|Mouse438J. Neurosci. 20 (17),6540-6550 (2000)13guanine nucleotide-releasinggi|4885357Human1077Proc. Natl. Acad. Sci.factor 2U.S.A. 91 (8),3443-3447 (1994)14Ran GTPase activating protein 1gi|4506411Human587Proc. Natl. Acad. Sci.U.S.A. 91 (7),2587-2591 (1994)15karyopherin beta 2b,gi|7305595Human887J. Cell Biol. 138transportin(6), 1181-1192 (1997)16PTH-responsive osteosarcomagb|AAD25981.1|AF095771_1Human802Bone 24 (4), 305-313B1 protein(1999)17Cdc25C associated proteingb|AAC15093.1|Human729Cell Growth Differ. 9kinase C-TAK1(3), 197-208 (1998)18FRANK2 proteinemb|CAB96906.1|Hawaii's1596Genome Res. 10 (8),sea urchin1194-1203 (2000)19protein kinase WNK1gb|AAF74258.1|AF227741_1Rat2126J. Biol. Chem. 275(22), 16795-16801(2000)20putative splicing factorgb|AAD55973.1|AF144731_1Rat738Mol. Biol. Cell 10YT521-B(11), 3909-3926(1999)21SNAP-25-interacting proteingi|9507127Rat1197J. Biol. Chem. 275(2), 1191-1200 (2000)22PUTATIVE PREOPTIC REGULATORYsp|P18890|PRF2_—Rat75Mol. Endocrinol. 4FACTOR-2 PRECURSOR(8), 1205-1210 (1990)23adenosine deaminase acting ongi|6912230Human502Proc. Natl. Acad. Sci.tRNA 1U.S.A. 96 (16),8895-8900 (1999)24TTYH1gb|AAG02580.1|AF177909_1Human450Genomics 68 (1),89-92 (2000)25P116 RHO-INTERACTING PROTEINsp|P97434|RIP3Mouse1024J. Cell Biol. 137 (7),(P116RIP) (RIP3)1603-1613 (1997)26microtubule-associatedgi|4505099Human1152Cell Motil.protein 4Cytoskeleton 23 (4),236-243 (1992)27OXYSTEROL-BINDING PROTEINsp|P16258|OXYBRabbit809J. Biol. Chem. 264(28), 16798-16803(1989)28ring canal proteingb|AAA53472.2|Fruit fly1477Cell 72 (5), 681-693(1993)29cell recognition moleculegi|7662350Human1331Neuron 24 (4),Caspr21037-1047 (1999)30GTP-rho binding protein 1gi|6680085Mouse643Science 271 (5249),645-648 (1996)31INOSITOL 1,4,5-TRISPHOSPHATEsp|P27987|IP3LHuman505Biochem. J. 278 (Pt3-KINASE (IP3K)3), 883-886 (1991)32FH1/FH2 domain-containinggi|7019375Human1164Gene 232 (2), 173-182protein FHOS(1999)33SERINE/THREONINE-PROTEINsp|008875|DCK1Rat433J. Mol. Neurosci. 10KINASE DCAMKL1(2), 75-98 (1998)341 beta dynein heavy chainemb|CAB99316.1|Chlamydomonas4513Mol. Biol. Cell 11(7), 2297-2313 (2000)35rsec8pir||I59422Rat975Proc. Natl. Acad. Sci.U.S.A. 92 (21),9613-9617 (1995)36nuclear dual-specificitygb|AAC39675.1|Human1697Nature Genet. 18 (4),phosphatase331-337 (1998)37phosphatidic acid-preferringgb|AAC03019.1|Bovine875J. Biol. Chem. 273phospholipase A1(1998) 5468-547738chromobox homolog 8gi|7304947Mouse362Gene 242 (1-2), 31-40(2000)39polymerase I and transcriptgi|6679567Mouse392EMBO J. 17 (10),release factor2855-2864 (1998)40pyruvate dehydrogenasegb|AAC48785.1|Bovine878J. Biol. Chem. 272phosphatase regulatory(50), 31625-31629subunit precursor(1997)41collagen alpha 1(V) chainpir||CGHU1VHuman1838J. Biol. Chem. 261precursor(11), 5034-5040(1986)42TUBULIN BETA-5 CHAINsp|P09653|TBB5_—Gallus446Mol. Cell. Biol. 6(BETA-TUBULIN CLASS-V)CHICK(12), 4409-4418(1986)43PROTEOGLYCAN LINK PROTEINsp|P07354|PLK_CHICKGallus355Proc. Natl. Acad. Sci.PRECURSOR (CARTILAGE LINKU.S.A. 83 (11),PROTEIN)3766-3770 (1986)44FAT tumor suppressorgi|4885229Human4590Genomics 30 (2),207-223 (1995)45N-ACETYLGLUCOSAMINYLTRANSFERASEsp|P56558|OGT1Rat1036J. Biol. Chem. 272110 KDA SUBUNIT(14), 9308-9315(1997)46OPA-containing protein 1gb|AAC83164.1|Mouse2074Mol. Psych. 3 (4),303-309 (1998)47huntingtin-associated proteingi|4504335Human1663Hum. Mol. Genet. 6interacting protein(9), 1519-1525 (1997)48zinc finger protein 91gi|4508041Human1191Proc. Natl. Acad. Sci.U.S.A. 88 (9),3608-3612 (1991)49Proline rich synapseemb|CAB45688.1|Rat1806Biochem. Biophys.associated protein 2Res. Commun. 264,2476-2528 (1999)50glutamate receptorgb|AAD25916.1|AF072509_1Rat1043Neuron 22, 511-524interacting protein 2(1999)51SH3-domain binding protein 5gi|4759058Human425Biochem. Biophys.(BTK-associated)Res. Commun. 245 (2),337-343 (1998)52ankyrin 3gb|AAB01607.1|Mouse1961J. Cell Biol. 130(2), 313-330 (1995)53CMP-N-ACETYLNEURAMINATE-BETA-sp|Q92182|CAG1_—Gallus413Eur. J. Biochem. 219GALACTOSAMIDE-ALPHA-2,CHICK(1-2), 375-381 (1994)6-SIALYLTRANSFERASE54dynein heavy chain isotype 6pir||T30298Globe fish1125Mol. Biol. Cell 5 (1),57-70 (1994)55ubiquitinating enzyme E2-230 kDapir||I49264Mouse299Proc. Natl. Acad.Sci. U.S.A. 92 (11),4982-4986 (1995)56KPL2gb|AAD56310.1|AF102129_1Rat1744Am. J. Respir. CellMol. Biol. 20 (4),675-683 (1999)57putative microtubulegb|AAC79958.1|Gallus369J. Med. Dent. Sci. 45,associated protein123-133 (1998)58pyruvate dehydrogenasegb|AAC48785.1|Bovine878J. Biol. Chem. 272phosphatase regulatory(50), 31625-31629subunit precursor(1997)59kinesin light chaingb|AAB87735.1|Plectonema490DNA Cell Biol. 16 (6),787-795 (1997)60TFNRemb|CAC21448.1|Human2187Genomics 70, 315-326(2000)61ENDOZEPINE-RELATED PROTEINsp|P07106|ENDRBovine533DNA 6 (1), 71-79PRECURSOR(1987)62cytoplasmic dynein heavy chain 2gi|12711694Rat4306Mol. Biol. Cell 9, 276(1998)63Myosin XVgi|6754780Mouse3511Genomics 61 (3),243-258 (1999)64breakpoint cluster regiongb|AAC08965.1|Human510Genomics 52 (1), 17-26protein 2(1998)65HrPOPK-1dbj|BAA28663.1|Ascidian698Mech. Dev. 76 (1-2),161-163 (1998)66MEGF6gi|12621134Rat1574Genomics 51 (1), 27-34(1998)67MEGF6gi|12621134Rat1574Genomics 51 (1), 27-34(1998)68p150-Spir proteinemb|CAB62901.1|Fruit fly1020Curr. Biol. 10 (6),345-348 (2000)69fibrillin 5emb|CAB56757.1|Human754Nature 352 (6333),330-334 (1991)70zinc finger proteinpir||B38203Mouse191Genes Dev. 6 (6),903-918 (1992)
^※Nomenclature of each biological species is as follows: mouse = Mus musculus; human = Homo sapiens; bacillus of green pus = Pseudomonas aeruginosa; rat = Rattus norvegicus; volvox = Volvox carteri f. nagariensis; Hawaii's sea urchin = Tripneustes gratilla; rabbit = Oryctolagus cuniculus; fruit fly = Drosophila melanogaster; chlamydomonas = Chlamydomonas reinhardtii;
# bovine = Bos taurus; gallus = Gallus gallus; globe fish = Takifugu rubripes; plectonema = Plectonema boryanum; ascidian = Halocynthia roretzi.

Table 3 summarizes a variety of data concerning homology between the DNA or the gene of the present invention contained in each clone and each homologous gene listed in Table 2. The meaning of each item in Table 3 is as follows:

Score: the higher the value, the higher the reliability
E-value: the closer this value to 0, the higher the reliability
Starting point: an amino acid position as a starting point of the homologous region
End point: an amino acid position as an end point of the homologous region
Homology: the proportion (degree) of amino acid residues that are identical in a homologous region.

Homologous region %: the proportion (%) of a homologous region in a homologous gene.

TABLE 3Homology between each gene and homologous geneHomologous regionHomologousSEQclonegeneHomology valueIDStartingEndStartingEndHomologousNO:pointpointpointpointScoreE-valueHomologyregion % 1203182114722954e−7950%(155/310)55% 2118397511661563e−3742%(81/192)16% 3201872594421223e−2739%(74/187)42% 41132427816012708099%(1321/1324)75% 5712173224682662e−7091%(135/147)27% 64653294923599 e−17051%(343/661)60% 712353035343253e−8860%(142/235)36% 8511932834252753e−7393%(134/143)28% 992373418699591 e−168100%(282/282)40%106215762853039e−8268%(143/210)74%118751130272771446e−3337%(96/256)61%123638028372444 e−12457%(199/346)79%134750561910779280100%(459/459)43%143753014949630100%(494/494)84%15165105118871794098%(874/887)100% 166285617551499094%(753/795)94%1726691655816064%(435/674)90%1829985151592593 e−16835%(398/1127)68%1918774873913281899e−4730%(188/625)28%2014802517381001097%(476/488)66%21171845711731364094%(683/719)60%22102010941751521e−3598%(74/75)100% 232638897459738099%(360/363)72%24641374173063e−8239%(163/411)91%2510631644383975452 e−12544%(273/611)58%261409133321089835061%(491/793)66%275487820809965060%(498/830)98%2812784086841363e−3132%(91/284)19%2917055971329663046%(343/736)55%30942591603252671e−7080%(133/166)26%313195193203419 e−116100%(201/201)40%3223612165691822e−4437%(142/379)30%33308445752121527e−3651%(71/138)32%341135332054512966037%(515/1363)29%35196699751816095%(921/967)99%361101762516301828057%(957/1674)96%374498381875979095%(475/495)57%3813891362667087%(341/389)100% 39138011392682092%(355/382)97%401360519878715093%(336/360)41%4125926341274545 e−15446%(304/647)35%421436990445720097%(346/356)80%4336376193533617e−9949%(171/345)94%443615297935762551e−6630%(189/618)13%4511036110362117099%(1030/1036)100% 46129263191120521017e−2150%(72/144) 7%4753111558816632132098%(1063/1076)65%48667604251157744048%(365/758)62%491797101018061504094%(754/799)44%50410431110431814087%(912/1040)99%518036572692132e−5441%(120/287)62%5265810572136111492e−3430%(126/413)20%53211524100413371 e−10254%(172/315)76%547171768110471570073%(774/1060)93%551293681240497 e−13998%(236/240)80%56673596517151195076%(579/753)43%5714391369472 e−13258%(258/440)100% 58187918781680091%(804/878)100% 592645571794461535e−3636%(108/294)55%601742144621871463099%(741/742)34%61643793533722080%(357/443)83%6211194311343062274094%(1126/1194)28%6314696516532499494 e−13835%(319/888)24%6427878715101048099%(508/510)100% 65165044647611 e−17451%(346/678)87%664943304191175e−2652%(48/91) 6%6774892321002499 e−13932%(315/982)62%68623182134561896e−4742%(109/259)24%691242163405435 e−12174%(181/243)32%707989881191389 e−10696%(185/191)100%

(4) Search for Each Domain

Using as queries the amino acid sequence encoded by DNAs contained in the clones, functional domains were searched with a search tool contained in Pfam 6.0 (Pfam HMM ver. 2.1 Search (HMMPFAM), Sonnhammer, E. L. L., Eddy, S. R., Birney, E., Bateman, A., and Durbin, R. (1998) “Pfam: multiple sequence alignments and HMM-profiles of protein domains” Nucleic Acids Res. 26:320-322).

Further, transmembrane domains were searched with a prediction program for membrane proteins, the SOSUI system (ver. 1.0/10, March, 1996) (Takatsugu Hirokawa, Seah Chieng and Shigeki Mitaku, SOSUI: Classification and Secondary Structure Prediction System for Membrane Proteins), Bioinformatics (formerly CABIOS) 1998 May; 14(4):378-379).

Table 4 shows the detected functional domains and transmembrane domains for each clone.

The meaning of each item in Table 4 is as follows:

Functional domain: a domain detected by Pfam or SOSUI
Starting point: an amino acid position as a starting point of a functional domain
End point: an amino acid position as an end point of a functional domain.
Score (Pfam only): the higher the value, the higher the reliability
Exp (Pfam only): the closer the value to 0, the higher the reliability

Table 5 shows the complete notation of each functional domain.

TABLE 4Functional domainSEQCloneHomologous geneIDFunctionalStartingEndFunctionalStartingEndNO:domainpointpointScoreExpdomainpointpointScoreExp1WD407210933.16.2e−06WD4012215928.60.00015WD4016620221.40.0222zf-C2H2456731.22.4e−05KRAB1375159.55.6e−44zf-C2H2739537.13.9e−07zf-C2H2182200−1.91.3e+02zf-C2H212314523.20.0063zf-C2H221023221.80.017zf-C2H215117331.32.2e−05zf-C2H223826033.16.3e−06zf-C2H217920127.70.00026zf-C2H2266288343.4e−06zf-C2H226128331.32.3e−05zf-C2H229431637.92.3e−07zf-C2H228931138.41.6e−07zf-C2H232234437.92.2e−07zf-C2H235037236.17.8e−07zf-C2H237840034.91.8e−06zf-C2H240642835.31.4e−06zf-C2H243445635.31.4e−06zf-C2H246248433.83.9e−06zf-C2H249051237.14e−07zf-C2H251854015.71.1zf-C2H254656832.41.1e−05zf-C2H2574596343.4e−06zf-C2H260262434.23.1e−06zf-C2H263065237.92.2e−07zf-C2H265868036.17.8e−07zf-C2H268670834.91.8e−06zf-C2H271473635.31.4e−06zf-C2H274276436.85e−07zf-C2H2770792351.7e−06zf-C2H279882037.33.4e−07zf-C2H282684834.82e−06zf-C2H2854876374.2e−07zf-C2H288590411.36.3zf-C2H291093238.21.9e−07zf-C2H293896036.55.9e−07zf-C2H296698834.32.8e−06zf-C2H29941016391.1e−07zf-C2H21022104435.11.6e−06zf-C2H21050107233.83.8e−06zf-C2H210781100391.1e−07zf-C2H21106112832.97.5e−06zf-C2H21134115619.50.0813ig218716.90.0012sosui1638——sosui120142——ig5712623.31.1e−05ig1592229.60.21ig26031536.68.6e−10sosui374396——4Sema1419678.32.9e−20Sema29473198.88.3e−56Plexin_repeat21526558.11.9e−13Plexin_repeat49254258.11.9e−13integrin_B2212375.10.18integrin_B4985145.10.18Plexin_repeat36140859.85.7e−14Plexin_repeat63868559.85.7e−14Plexin_repeat50956350.73.3e−11Plexin_repeat78684050.73.3e−11integrin_B5165359.40.006integrin_B7938129.40.006TIG56566075.51.1e−18TIG84293775.51.1e−18TIG66274686.36.3e−22TIG939102386.36.3e−22TIG74984871.32e−17TIG1026112571.32e−17TIG85193742.97.2e−09TIG1128121442.97.2e−09sosui943965——5PH8319443.67.7e−11RhoGEF12129771.22.2e−17PH33444542.81.3e−10SH345951547.33.3e−106zf-C2H244947137.33.4e−07zf-C2H2214426.30.00074zf-BED46250111.30.073zf-C2H2759726.50.00061zf-C2H247750033.54.8e−06zf-C2H210312535.11.6e−06zf-C2H250652826.50.00061zf-BED116155−0.31.5zf-C2H213115437.23.8e−07zf-C2H2160182321.4e−05zf-C2H218821026.50.00064zf-C2H221723929.57.8e−05zf-C2H272474637.33.4e−07zf-BED73777611.30.073zf-C2H275277533.54.8e−06zf-C2H278180327.50.00037AMP-binding108544446.81.8e−1308Pro_dh143498582.72.4e−1719Glyco_hydro_4723692051.2e−57sosui83105——sosui1739——Glyco_hydro_472566956961.9e−20510C27616345.61.1e−09C214623361.91.4e−1412BNR44559.434sosui123——laminin_Nterm58304305.4e−12laminin_Nterm5029537.31.6e−12BNR17118211.716laminin_EGF29734133.35.4e−06laminin_EGF30636335.21.5e−06sosui419438——13RasGEFN11417036.75.3e−07RasGEFN68674236.75.3e−07RasGEF265442206.63.8e−58RasGEF8371014206.63.8e−5815Armadillo_seg28131913.42.6Armadillo_seg11715513.42.6Armadillo_seg3644060.484Armadillo_seg2002420.484HEAT37340810.99HEAT20924410.99HEAT55158910.311HEAT38742510.311Armadillo_seg59062819.80.064Armadillo_seg42646419.80.064HEAT5926301.41.1e+02HEAT4284661.41.1e+02HEAT7187581.71e+02HEAT5545941.71e+02Armadillo_seg8198571.268HEAT65769511.77.3HEAT82185911.67.6Armadillo_seg69573417.30.37Armadillo_seg85989811.44.517pkinase60311351.31.1e−101pkinase56307345.65.3e−100UBA33137030.83.1e−05UBA32736631.12.6e−0518ank50836.336ank5635944.658ank8411642.31.1e−08ank62765918.10.2ank11714939.48.3e−08ank66069242.87.6e−09ank15018240.15e−08ank69372539.86e−08ank18321718.50.16ank72676025.90.00094ank25328623.40.005319Pkinase221479215.77e−6121Troponin230378−18.40.97Troponin685833−17.80.8722WW37674.52.3Sosui123——WW7610623.40.0054MyTH477289078.51.4e−19RhoGAP920106776.17.3e−1923A_deamin277617.70.0003A_deamin6314786.33.9e−24A_deamin22029576.33.2e−21A_deamin43149716.10.0008424sosui119——sosui4668——sosui4365——sosui87108——sosui83104——sosui214236——sosui175197——sosui247269——sosui209231——sosui390412——sosui240262——sosui388410——25PH1067117577.32.6e−20PH4414549.81.4e−12PH38748275.29.6e−2026tubulin-binding74777754.81.1e−14tubulin-binding92395354.81.1e−14tubulin-binding81684661.89.4e−17tubulin-binding992102261.89.4e−17tubulin-binding847877611.6e−16tubulin-binding10231053611.6e−16tubulin-binding87890936.53.2e−09tubulin-binding1054108536.53.2e−0927PH14523678.71e−20PH9118387.82.8e−23Oxysterol_BP446868506.22.4e−148Oxysterol_BP383799770.37.5e−22828Kelch3279305.5e−05BTB141253127.62.3e−34Kelch8112643.26e−09Kelch39243620.40.042Kelch12817630.15.1e−05Kelch43848344.62.3e−09Kelch17821842.87.5e−09Kelch48553052.78.3e−12Kelch22026748.31.7e−10Kelch53257949.95.5e−11Kelch581626491.1e−10Kelch62867348.91.1e−1029laminin_G22034276.11.6e−20sosui729——EGF36139519.30.089F5_F8_type_C38178216.54e−61TSPN380577−42.40.71laminin_G21634862.21.5e−16laminin_G4725308.40.37laminin_G40153248.51.3e−12sosui639661——EGF55859030.34.4e−05laminin_G82794853.83.8e−14EGF967100118.20.19Laminin_G1055118515.60.003230BR0166201123.24.7e−33HR14211489.28.4e−23BR01115267276.14.6e−79PDZ500577451.6e−0932FH26611157178.11.5e−49FH25941069187.12.7e−5233pkinase316445170.23.4e−47pkinase83340326.33.5e−9434Dynein_heavy59713519206.8e−273Dynein_heavy38044510910.45.1e−27036DENN44183111.17e−30DENN578702.2e−18GRAM75684246.63.8e−12GRAM65073662.49.1e−17PH16611764681e−17PH1529163263.61.8e−1637DDHD237484401.48.6e−117DDHD614861431.38.9e−12638chromo84867.72.1e−18chromo84867.72.1e−1840GCV_T4344556.61.6e−163DAO42403−70.50.0014Phytoene_dh44405−327.70.14UPF007952149−47.50.26GCV_T522862593.61.2e−17441Collagen56446.84.9e−10TSPN39230289.83.3e−83Collagen6512450.15.1e−11Collagen46952823.80.00018Collagen12518452.11.2e−11Collagen55461227.70.00011Collagen18824748.81.2e−10Collagen61367261.81.5e−14Collagen25131053.83.7e−12Collagen67373260.83e−14Collagen31237158.41.5e−13Collagen73379242.87.5e−09Collagen38444348.51.5e−10Collagen79385237.72.7e−07Collagen45050950.83e−11Collagen85391243.93.6e−09Collagen53459344.81.9e−09Collagen91397259.95.4e−14COLFI64870692.71e−35Collagen985104454.42.5e−12COLFI71583156.71.1e−21Collagen1045110455.21.5e−12Collagen1105116455.79.9e−13Collagen1165122449.57.2e−11Collagen1225128446.75.3e−10Collagen1285134448.91.1e−10Collagen1345140443.54.7e−09Collagen1405146446.46.3e−10Collagen1465152455.99.1e−13Collagen1525158418.90.00032COLFI16251836484.11.1e−18842tubulin143477378e−21843sosui1636——ig5414225.82e−06ig7115523.88e−06Xlink159254220.37.1e−95Xlink1722771621.2e−69Xlink2603511962.3e−84Xlink2833741321.3e−5644cadherin5614386.55.3e−22sosui426——cadherin15725381.71.5e−20cadherin3914014.80.04cadherin26736069.76.2e−17cadherin15424870.43.8e−17cadherin37447050.83.1e−11cadherin37245420.60.013cadherin48657794.61.9e−24cadherin46856069.28.8e−17cadherin59168272.49.5e−18cadherin57466424.70.0022cadherin72281368.81.1e−16cadherin82791898.31.5e−25cadherin932102396.93.9e−25cadherin1039113083.93.3e−21cadherin11441236105.78.8e−28cadherin12501346412.7e−08cadherin1363144746.36.6e−10cadherin1461155353.54.7e−12cadherin1567166189.56.6e−23cadherin1675175969.76e−17cadherin1773187147.72.7e−10cadherin1887197336.75.4e−07cadherin1987207329.57.9e−05cadherin2089217843.93.6e−09cadherin2190227753.83.9e−12cadherin2291238496.17e−25cadherin2398248644.13.1e−09cadherin2500259048.61.4e−10cadherin2604269647.13.9e−10cadherin2710280235.41.3e−06cadherin2816291181.51.8e−20cadherin2925301668.31.7e−16cadherin3030311894.12.8e−24cadherin3132322399.95e−26cadherin32373328104.81.7e−27cadherin33423433106.64.8e−28cadherin3447353847.23.7e−10cadherin3553363411.50.077EGF3796382819.50.077laminin_G3861399075.52.3e−20EGF4019405136.84.9e−07EGF4058408931.71.7e−05EGF4095412635.61.1e−06EGF4133416432.97.2e−0645TPR11441.631TPR11441.631TPR7911250.73.3e−11TPR7911250.73.3e−11TPR11314626.30.00073TPR11314626.30.00073TPR147180312.8e−05TPR147180312.8e−05TPR18121439.86.1e−08TPR18121439.86.1e−08TPR21524831.91.5e−05TPR21524831.91.5e−05TPR24928238.81.3e−07TPR24928238.81.3e−07TPR28331639.57.4e−08TPR28331639.57.4e−08TPR31735040.15e−08TPR31735040.15e−08TPR35138439.76.4e−08TPR35138439.76.4e−08TPR38541841.42e−08TPR38541841.42e−08TPR41945238.21.9e−07TPR41945238.21.9e−0746sosui179200——sosui266288——47RhoGEF737907120.33.6e−32spectrin188235120.074PH921103245.62.1e−11spectrin2793089.60.34spectrin31041623.74.2e−05spectrin53664220.10.00043spectrin803877−9.23.5e+04spectrin89093771.8spectrin95810047.81.1spectrin1130122217.60.0021RhoGEF12851455120.33.6e−32PH1469158045.62.1e−1148zf-C2H210312538.11.9e−07KRAB1375159.55.6e−44zf-C2H213115331.81.6e−05zf-C2H2182200−1.91.3e+02zf-C2H215918134.52.4e−06zf-C2H221023221.80.017zf-C2H218720935.51.2e−06zf-C2H223826033.16.3e−06zf-C2H221523730.83.2e−05zf-C2H2266288343.4e−06zf-C2H224326530.15.2e−05zf-C2H229431637.92.3e−07zf-C2H227129328.60.00015zf-C2H232234437.92.2e−07zf-C2H229932129.67.4e−05zf-C2H235037236.17.8e−07zf-C2H235237420.20.051zf-C2H237840034.91.8e−06zf-C2H238040237.23.7e−07zf-C2H240642835.31.4e−06zf-BED3934315.60.32zf-C2H243445635.31.4e−06zf-C2H240843030.24.7e−05zf-C2H246248433.83.9e−06zf-C2H243645838.12e−07zf-C2H249051237.14e−07zf-C2H246448637.62.9e−07zf-C2H251854015.71.1zf-C2H249251425.40.0013zf-C2H254656832.41.1e−05zf-C2H254456622.80.0079zf-C2H2574596343.4e−06zf-C2H257259437.23.7e−07zf-C2H260262434.23.1e−06zf-BED5856233.90.5zf-C2H263065237.92.2e−07zf-C2H260062234.91.9e−06zf-C2H265868036.17.8e−07zf-C2H262865038.21.9e−07zf-C2H268670834.91.8e−06zf-C2H265667832.69.3e−06zf-C2H271473635.31.4e−06zf-C2H268470624.40.0026zf-C2H274276436.85e−07zf-C2H273775920.90.03zf-C2H2770792351.7e−06zf-C2H279882037.33.4e−07zf-C2H282684834.82e−06zf-C2H2854876374.2e−07zf-C2H288590411.36.3zf-C2H291093238.21.9e−07zf-C2H293896036.55.9e−07zf-C2H296698834.32.8e−06zf-C2H29941016391.1e−07zf-C2H21022104435.11.6e−06zf-C2H21050107233.83.8e−06zf-C2H210781100391.1e−07zf-C2H21106112832.97.5e−06zf-C2H21134115619.50.08149SAM73279579.85.7e−20ank22325612.36.6ank257289280.00022ank29032312.66ank32435621.50.021ank35738937.14.1e−07SH354860236.56.2e−07PDZ64573822.20.007SAM1741180480.53.5e−2050PDZ4813051.22.3e−11PDZ5313548.81.2e−10PDZ14823354.13e−12PDZ15323853.54.7e−12PDZ24833142.31.1e−08PDZ25333646.75.3e−10PDZ45654442.59.2e−09PDZ458546391.1e−07PDZ557640621.3e−14PDZ55964255.71e−12PDZ65673769.47.5e−17PDZ65873965.61e−15PDZ941102236.46.5e−07PDZ942102326.60.000652ank6797146.633ank23553.580ank7177496.138ank568843.25.7e−09ank75078233.26.2e−06ank8912145.31.4e−09ank7838154.855ank12215442.78.4e−09ank8238594.167ank15518314.32.9ank86189331.51.9e−05ank18421618.60.15ank894926405.4e−08ank21724936.18e−07ank92795942.31.1e−08ank25028245.61.1e−09ank96099235.71.1e−06ank28331539.38.4e−08ank993102538.12e−07ank31634839.38.8e−08ank1026105812.95.5ank34938139.19.7e−08TPR107211050.243ank38241446.65.5e−10TPR1119115216.40.7ank41544739.76.7e−08TPR1153118625.60.0012ank44848042.69.1e−09ank48151340.24.7e−08ank51454649.76.5e−11ank54757943.64.5e−09ank58061238.31.7e−07ank61364547.23.6e−10ank64667836.37e−07ank67971142.78e−09ank71274443.83.9e−09ank745777412.8e−08ank7788102.21.1e+02ZU59831087229.64.4e−65death14791562111.41.8e−2953sosui1638——sosui930——Glyco_transf_29218512243.23.6e−69Glyco_transf_291074014488.2e−13154GSPII_E103210468.60.09255UQ_con97111360.92.6e−0657Ca_channel_B17756.50.0758DAO43404−61.80.00044DAO42403−70.50.0014Phytoene_dh45406−331.10.19Phytoene_dh44405−327.70.14GCV_T523863556.61.6e−163UPF007952149−47.50.26GCV_T522862593.61.2e−17459TPR2853189.64.2TPR15518910.73.2TPR32736021.60.018TPR19823130.93e−05TPR3694028.65.4TPR24027331.32.2e−05TPR43546819.90.06TPR28231515.11.1TPR47751028.80.00013TPR32435730.15.3e−05TPR51955223.60.0046TPR36639918.50.16TPR56159436.56.1e−07TPR40844110.63.3TPR60363619.70.07160Myb_DNA-binding30034518.80.001161ACBP543−18.10.014ACBP42130199.35.9e−56sosui405427——sosui503524——62Dynein_heavy4941192444.21.1e−12963myosin_head14728281.93.4e−23myosin_head12081871946.28.7e−281MyTH456167333.92.1e−06IQ1887190722.50.0097SH31455151180.013IQ1910193026.10.00081MyTH42088219571.81.4e−17MyTH430713185108.41.4e−2864WD40619822.40.011WD40124713.63.4WD4011014512.94.7WD406410019.90.059WD4015018725.30.0014WD4028932413.63.4WD4034137719.90.05965sosui152174——pkinase14265330.42e−95sosui193215——66EGF124720.70.035EGF12716225.50.0013EGF538610.62.5EGF16820343.54.6e−09EGF20924527.20.00038EGF25128629.29.5e−05EGF29232730.54e−05EGF33837327.20.0004EGF3794138.63.8EGF41945429.39e−05EGF52455521.30.022EGF56859823.20.0061EGF61164112.31.7EGF6456868.24.1EGF6997312.214EGF7357734.39.2EGF78681721.50.02EGF83086021.40.022EGF8739047.15.1EGF91794717.70.27EGF96099011.42.1EGF1003103322.80.0079EGF1046107621.60.018EGF1089111928.60.00015EGF1132116218.10.21EGF1175120521.80.017EGF120912490.620EGF1262129214.51.1EGF13051335151EGF1348137822.50.0099EGF13911421190.12EGF1434146416.50.62EGF147715079.23.3EGF1520155014.21.267EGF15718710.92.3EGF12716225.50.0013EGF20023015.60.88EGF16820343.54.6e−09EGF243273270.00045EGF20924527.20.00038EGF28631625.50.0012EGF25128629.29.5e−05EGF32935926.10.0008EGF29232730.54e−05EGF372402200.056EGF33837327.20.0004EGF41644811.81.9EGF3794138.63.8EGF46149123.20.006EGF41945429.39e−05EGF50453424.90.0019EGF52455521.30.022EGF54757723.90.0038EGF56859823.20.0061EGF59062012.61.6EGF61164112.31.7EGF63366321.60.019EGF6456868.24.1EGF6767089.92.9EGF6997312.214EGF72175115.80.84EGF7357734.39.2EGF764794220.014EGF78681721.50.02EGF80783718.60.15EGF83086021.40.022EGF85088018.20.19EGF8739047.15.1sosui909930——EGF91794717.70.27EGF96099011.42.1EGF1003103322.80.0079EGF1046107621.60.018EGF1089111928.60.00015EGF1132116218.10.21EGF1175120521.80.017EGF120912490.620EGF1262129214.51.1EGF13051335151EGF1348137822.50.0099EGF13911421190.12EGF1434146416.50.62EGF147715079.23.3EGF1520155014.21.268WH23994178.522WH246348017.20.3869EGF458143.64.4e−09EGF205636.84.9e−07TB9613742.87.5e−09EGF629837.72.6e−07EGF16219826.50.00063EGF10413831.91.5e−05EGF20424119.50.078TB15319456.94.5e−13EGF20724339.48e−08TB25829974.22.8e−18EGF32536123.40.0055EGF36740418.30.18EGF41044635.71e−06EGF45248824.60.0024EGF49452927.70.00027EGF53557128.80.00013EGF57761317.40.33EGF61965426.50.00061Plexin_repeat6256744.90.73EGF66069531.81.5e−05EGF70173734.82e−0670zf-C2H244676.319zf-C2H2214320.90.031zf-C2H21011244.331zf-C2H2507317.60.3zf-C2H220222516.10.87zf-C2H279102151.8zf-C2H22472705.623zf-C2H230933215.51.3zf-C2H239241516.10.84zf-C2H24294526.320zf-C2H24995221.855zf-C2H25786014.529zf-C2H262464618.90.12zf-C2H2700722116.7zf-C2H278480619.10.1zf-C2H281884020.90.031zf-C2H284787017.60.3zf-C2H2876899151.8zf-C2H298410073.835zf-C2H21013103615.41.4zf-C2H21047106912.84.4zf-C2H21093111520.50.039zf-C2H21121114416.60.58zf-C2H21207122927.40.00034

TABLE 5

Complete notation of each functional domain

Abbreviated notation
Complete notation

A_deamin
Adenosine-deaminase (editase) domain

ACBP
Acetyl CoA binding protein

AMP-binding
AMP-binding enzyme

ank
Ank repeat

Armadillo_—
Armadillo/beta-catenin-like repeat

seg

BNR
BNR repeat

BR01
BR01-like domain

BTB
BTB/POZ domain

C2
C2 domain

Ca_channel_B
Dihydropyridine sensitive L-type calcium

channel (Beta subunit)

cadherin
Cadherin domain

chromo
‘chromo’ (CHRomatin Organization MOdifier)

domain

COLFI
Fibrillar collagen C-terminal domain

Collagen
Collagen triple helix repeat (20 copies)

DAO
FAD dependent oxidoreductase

DDHD
DDHD domain

death
Death domain

DENN
DENN (AEX-3) domain

Dynein_heavy
Dynein heavy chain

EGF
EGF-like domain

F5_F8_type_C
F5/8 type C domain

FH2
Formin Homology 2 Domain

GCV_T
Glycine cleavage T-protein (aminomethyl

transferase)

Glyco_hydro_47
Glycosyl hydrolase family 47

Glyco_transf_29
Glycosyltransferase family 29

(sialyltransferase)

GRAM
GRAM domain

GSPII_E
Bacterial type II secretion system protein

HEAT
HEAT repeat

HR1
Hr1 repeat motif

integrin_B
Integrins, beta chain

IQ
IQ calmodulin-binding motif

Kelch
Kelch motif

KRAB
KRAB box

Laminin_EGF
Laminin EGF-like

(Domains III and V)

laminin_G
Laminin G domain

Laminin_Nterm
Laminin N-terminal

(Domain VI)

myb_DNA-binding
Myb-like DNA-binding domain

myosin_head
Myosin head (motor domain)

MyTH4
MyTH4 domain

Oxysterol_BP
Oxysterol-binding protein

PDZ
PDZ domain

(Also known as DHR or GLGF).

PH
PH domain

Phytoene_dh
Phytoene dehydrogenase related enzyme

pkinase
Protein kinase domain

Plexin_repeat
Plexin repeat

Pro_dh
Proline dehydrogenase

RasGEF
RasGEF domain

RasGEFN
Guanine nucleotide exchange factor

for Ras-like GTPases;

N-terminal motif

RhoGAP
RhoGAP domain

RhoGEF
RhoGEF domain

SAM
SAM domain

(Sterile alpha motif)

Sema
Sema domain

SH3
SH3 domain

spectrin
Spectrin repeat

TB
TB domain

TIG
IPT/TIG domain

TPR
TPR Domain

Troponin
Troponin

TSPN
Thrombospondin

N-terminal-like domain

tubulin
Tubulin/FtsZ family

tubulin-binding
Tau and MAP protein,

Tubulin-binding repeat

UBA
UBA/TS-N domain

UPF0079
Uncharacterised P-loop

hydrolase UPF0079

UQ_con
Ubiquitin-conjugating enzyme

WD40
WD domain, G-beta repeat

WH2
WH2 motif

WW
WW domain

Xlink
Extracellular link domain

zf-BED
BED zinc finger

zf-C2H2
Zinc finger, C2H2 type

ZU5
ZU5 domain

(5) Expression Site

Expressions in the tissue and the sites of the brain were examined by RT-PCR ELISA. Table 6 lists the sites showing the strongest expression.

(6) Chromosome Position

Using the DNA nucleotide sequences of the clones as queries, an analysis program BLASTN 2.0.14 (the above-mentioned “Gapped BLAST and PSI-BLAST: a new generation of protein database search programs”) was run on human genome sequences corresponding to the library of known sequences, Genbank release 119. The description of the chromosome number from which the clone had been derived was extracted from the definitions for the matched clones as listed in Table 6.

TABLE 6Expression site of each gene and chromosomeposition of homologous geneChromosomeExpression sitepositionSEQ ID NO:TissueBrainPosition1BrainCaudate nucleus—2OvaryCerebellum—3Brain——4BrainNucleus of hypothalamus—5BrainCaudate nucleus 26KidneyCaudate nucleus—7OvarySpinal cord208BrainSubstantia nigra 79OvaryAmygdaloid body—10BrainCaudate nucleus2011OvaryThalamus 712BrainAmygdaloid body—13OvarySubstantia nigra 914BrainCaudate nucleus2215BrainThalamus1916KidneySpinal cord 717Skeletal muscleCaudate nucleus1918BrainSpinal cord 719HeartAmygdaloid body 920———21BrainHippocampus1722BrainSpinal cord—23OrchisCorpus callosum—24KidneyThalamus 725—Nucleus of hypothalamus2226—— 327BrainThalamus2228BrainCerebellum 229BrainSpinal cord1630BrainCaudate nucleus 831OvaryNucleus of hypothalamus 132HeartAmygdaloid body1833BrainCaudate nucleus 334OvaryCaudate nucleus 235OvaryThalamus 736OvarySpinal cord1137BrainCerebellum1438BrainCerebellum—39OvarySpinal cord1740OvaryCorpus callosum1641OvaryCerebellum—42KidneySpinal cord—43BrainThalamus1944BrainCorpus callosum—45KidneyCerebellumX46BrainSpinal cord2247BrainAmygdaloid body 348OvarySpinal cord1749Skeletal muscleAmygdaloid body2250Skeletal muscleThalamus 351Skeletal muscleSpinal cord—52OvaryHippocampus—53BrainCerebellum 254—— 355BrainThalamus—56KidneySpinal cord 557BrainCaudate nucleus1158——1659KidneySpinal cord 360—— 561BrainSubstantia nigra1062OvaryCaudate nucleus1163——1764Skeletal muscleSpinal cord1465BrainSubstantia nigra1966BrainCaudate nucleus 367BrainHippocampus 568——1669——1970BrainCaudate nucleus19

According to the above information on homology, homologous genes, each domain, expression sites, chromosome positions and the like, a person skilled in the art can predict based on the grounds shown in Table 1 that the DNAs or the genes of the present invention respectively have each function described in Table 1.

INDUSTRIAL APPLICABILITY

A single nucleotide polymorphism, SNP, which is a change in one base (nucleotide) among individuals in the DNA or the gene of the present invention, can be found by performing PCR using synthetic DNA primers prepared based on the nucleotide sequence of the DNA or the gene of the present invention or a part thereof, and using chromosome DNA extracted from human blood or tissue so as to determine the nucleotide sequence of the product. Therefore, individual constitution or the like can be predicted, which enables the development of a pharmaceutical preparation suitable for each individual.

Further, when ortholog (homolog, counterpart) genes for the DNA or the gene of the present invention in model organisms, such as mice, are isolated with cross hybridization, for example, these genes are knocked out to produce human disease model animals, so that the causative genes which cause human diseases can be searched and identified.

DNA chip, polypeptide chip and antibody chip can be respectively prepared by arraying the DNAs and the polypeptides of the present invention, and antibodies for the polypeptides of the present invention. Specifically, novel DNAs or genes obtained by the present invention are assembled on a so-called DNA chip, and then probes prepared using blood or tissue derived from patients with diseases that relate to the brain, such as mental disease, or as a control using blood or tissue from healthy individuals are hybridized to the chip, so that the chip can be applied to diagnosis and treatment for the diseases. Moreover, antibody chip, on which the antibodies against the polypeptides of the present invention are thoroughly prepared and arrayed, can be applied to diagnosis, treatment of diseases and the like through proteome analysis, such as detection of a difference in expression amount of a protein between a patient and a healthy individual.

The present application asserts priority based on the three specifications of Japanese Patent Application Nos. 2000-389742, 2001-95524 and 2001-127066, and includes by reference all of the contents as disclosed in these specifications.

Novel gene and protein encoded by the gene

Information

Publication Number

Date Filed

Date Published

Inventors

CPC

US Classifications

International Classifications

Abstract

Description

Claims

Priority Claims (1)

PCT Information