Novel plasmidic gene, ways of acquiring this gene, the amylolytic enzyme it encodes and its application

Information

  • Patent Application
  • 20050064574
  • Publication Number
    20050064574
  • Date Filed
    June 26, 2002
    22 years ago
  • Date Published
    March 24, 2005
    19 years ago
Abstract
The object of the invention is a novel plasmidic gene encoding an amylolytic enzyme which after introduction into a microbial strain, favorably bacterial, especially Lactococcus lactis, enables the production of the encoded amylolytic enzyme, the ways of acquiring this gene and the industrial application of the enzyme it encodes.
Description
BACKGROUND OF THE INVENTION

Lactic acid bacteria are capable of utilizing many different sugars as a source of carbon and energy (De Vos W. 1996. Antonie van Leeuwenhoek 70: 223). In a significant majority these sugars are monosaccharides or disaccharides. The ability of lactic acid bacteria to catabolize carbohydrates is widely used in biotechnological processes linked with food production (Libudzisz Z., Walczak P. and Bardowski J. (ed.), 1998. Lactic Acid Bacteria—classification, metabolism, genetics, application. (In polish) Monographies, ódź; Aleksandrzak T., Kowalczyk M., Kok J., Bardowski J. 2000, Food Biotechnol. 17: 61, Elsevier Science B. V., Amsterdam). One of these processes is the production of fermented milk products. The main sugar in milk is lactose, which catabolism is a feature rather commonly present among lactic acid bacteria (Bardowski J. 1995. Przeglad Mleczarski 11: 315; Van Rooijen R. J. 1992. Lactose catabolism in Lactococcus lactis. Ph.D thesis, Wageningen, The Netherlands).


Yet another natural source, besides milk, of food production are plants. These biotechnological processes are frequently conducted with the use of lactic acid bacteria. However, in plant material, differently than in milk, polysaccharides such as cellobiose or starch are present. Thus, in the microbial conversion of plant material these microbials are incorporated which have either cellulolytic or amylolytic abilities. Lactic acid bacteria lack the ability to degrade cellulose.


However, the ability to degrade starch is, in this group of bacteria, a feature limited basically to a few strains of the Lactobacillus genus (cit. after Giraud E., A. Chapailler and M. Raimbault. 1994. Appl. Environ. Microbiol. 60: 4319). Some of these bacteria, belonging to the L. plantarum, L. amylophilus, or L. amylovorus species produce α-amylase (Fitzsimons A. and O'Connell. 1994. FEMS Microbiol. Letts. 116:137; Pompeyo C C., Gomez M S., Gasparian S., J. Morlon-Guyot 1993. Appl. Microbiol. Biotechnol. 40: 266).


It has been determined that besides strains from Lactobacillus genus, some strains of Lactococcus genus, naturally existing in the environment, also demonstrate this since strains which degrade starch were found among Lactococcus strains isolated from natural habitats (Domań M., E. Czerniec, Z. Targoński and J. Bardowski. (2000), Food Biotechnology 17:67, Elsevier Science B.V., Amsterdam).


Unexpectedly, it has been discovered that also other strains, especially from the Lactococcus lactis species, after introducing a specific gene structure according to the invention, are capable of producing a novel amylolytic enzyme which is encoded by this gene and which is secreted into the environment.


SUMMARY OF THE INVENTION

This invention is directed to a novel plasmidic gene encoding an amylolytic enzyme which after introduction into a microbial strain, favorably bacterial, especially Lactococcus lactis, enables the production of the encoded amylolytic enzyme, as well as ways of obtaining this gene and the industrial application of the enzyme it encodes.







DESCRIPTION OF THE PREFERRED EMBODIMENTS

The novel plasmidic gene encoding the novel amylolytic enzyme secreted into the environment, according to the invention has the following nucleotide sequence (top strand: SEQ. ID NO. 1 and bottom strand: SEQ. ID NO. 2):

5′ATGAAAAAAACAAAATTAAGAATTTGTCTTTTCCCAATCGTACTGCTTATCAGTTTTACA   1---+---------+---------+---------+---------+---------+------  60TACTTTTTTTGTTTTAATTCTTAAACAGAAAAGGGTTAGCATGACGAATAGTCAAAATGTTTGCTATCCAATGGAACTGGTAAACAGATTGTTTTTGCTACATCTTCATCAGAATATGCT  61---+---------+---------+---------+---------+---------+------ 120AACGATAGGTTACCTTGACCATTTGTCTAACAAAAACGATGTAGAAGTAGTCTTATACGAACACAAGCTCTGTCTGACGAGAAAAATGCCACACAAAACAATGATTTTACATCTTTTGAT 121---+---------+---------+---------+---------+---------+------ 180TGTGTTCGAGACAGACTGCTCTTTTTACGGTGTGTTTTGTTACTAAAATGTAGAAAACTAATAAATGGGCCTATGAAGGGACAGATTTGGGATTTAACTATTCAACAACCAGTACTACT 181---+---------+---------+---------+---------+---------+------ 240TATTTTACCCGGATACTTCCCTGTCTAAACCCTAAATTGATAAGTTGTTGGTCATGATGATTCAAAATCTGGTCACCAACTGCGACGAGCGTGCAGCTGATAAGTTATGGGACGAATACC 241---+---------+---------+---------+---------+---------+------ 300AAGTTTTAGACCAGTGGTTCACGCTGCTCGCACGTCGACTATTCAATACCCTGCTTATGGAATCCGACAGCGGCACAGGTCTCAGCGAAAGCAATGACACGCGGGACATCAGCGACACCA 301---+---------+---------+---------+---------+---------+------ 360TTAGGCTGTCGCCGTGTCCAGAGTCGCTTTCGTTACTGTGCGCCCTGTAGTCGCTGTGGTACTAATCACGCAACCAATACGATTGGGGTGTGGACTTTGACCGTTCCTGGCAATCAAAAT 361---+---------+---------+---------+---------+---------+------ 420TGATTAGTGCGTTGGTTATGCTAACCCCACACCTGAAACTGGCAAGGACCGTTAGTTTTAGGCATGGTTTATGCTTACAAACTAACTTTTGCTGACGGAACCGTTAGTGATTATGCTGGG 421---+---------+---------+---------+---------+---------+------ 480CCGTACCAAATACCAATGTTTGATTGAAAACGACTGCCTTGGCAATCACTAATACGACCCTCAACTTATGGAACACTTTCTACAAGTTCTGTCAGCAATACAACCAATGATCCTTATTCT 481---+---------+---------+---------+---------+---------+------ 540AGTTGAATACCTTGTGAAAGATGTTCAAGACAGTCGTTATGTTGGTTACTAGGAATAAGAATTGCGACGACACAAGGTGGAAATCGTTCAGTTGTCGAATCGTCTGCAAACCTCGCGTCA 541---+---------+---------+---------+---------+---------+------ 600TAACGCTGCTGTGTTCCACCTTTAGCAAGTCAACAGCTTAGCAGACGTTTGGAGCGCAGTAATCTGGCACTTGCGCAAGGCAAATCTGCAACTTGGCGGGTAGCAAGTCCAACACAAGCC 601---+---------+---------+---------+---------+---------+------ 660TTAGACCGTGAACGCGTTCCGTTTAGACGTTGAACCCCCCATCGTTCAGCTTGTGTTCGGATCGTTGACGAACTACATATTCGTGATTTTACAAGCTCATCAACATCTGGTGTTTCGGCT 661---+---------+---------+---------+---------+---------+------ 720TAGCAACTGCTTGATGTATAAGCACTAAAATGTTCGAGTAGTTGTAGACCACAAAGCCGAGGTAATCGTGGTAAGTTTCTCGGAGTGATTCAGTCAGGAACAACTGATCCAAATACAGGT 721---+---------+---------+---------+---------+---------+------ 780CCATTAGCACCATTCAAAGAGCCTCACTAAGTCAGTCCTTGTTGACTAGGTTTATGTCCAACAGCGACTGGACTTGATTATCTGAAAAACGAGGGTTTTAACTACATTCAACTTCATGCC 781---+---------+---------+---------+---------+---------+------ 840TGTCGCTGACCTGAACTAATAGACTTTTTGCTCCCAAAATTGATGTAAGTTGAAGTACGGAGCCAGTCAGTATGCGTCGGTCAACGAAGCCGGAACCGTACTACTGCGCAACCGAATAAC 841---+---------+---------+---------+---------+---------+------ 900TCGGTCAGTCATACGCAGCCAGTTGCTTCGCCCTTGGCATGATGACGCGTTGGCTTATTGTTCAACTGGGGATATGACCCACAAATGAAATGGTACCAGAGCGAATATGCCAGTAATTCT 901---+---------+---------+---------+---------+---------+------ 960AAGTTGACCCCTATACTGGGTGTTTACTTTACCATGGTCTCGCTTATACGGTCATTAAGAGTCAATCCTGTCACACGTATTAATGAAATGAAAGAAATGGTACAAGGCTTGCATACAAAT 961---+---------+---------+---------+---------+---------+------1020CAGTTAGGACAGTGTGCATAATTACTTTACTTTCTTTACCATGTTCCGAACGTATGTTTAGGGATTAGCGTGGTAATGGATATGGTTCTCAATCACGTCTATAGTCAGTCAGCATCCGGT1021---+---------+---------+---------+---------+---------+------1080CCCTAATCGCACCATTACCTATACCAAGAGTTAGTGCAGATATCAGTCAGTCGTAGGCGATTTGAAAAAGCCGAGCCGGGCTATTATTTCCGCAAAAATACGCAATCTGGGTGTGGCAAT1081---+---------+---------+---------+---------+---------+------1140AAACTTTTTCGGCTCGGCCCGATAATAAAGGCGTTTTTATGCGTTAGACCCACACCGTTAGATACGGCGAGCAACCACGAAATGTTTGGTAAATACATTATTGACTCTGTCACTTACTGG1141---+---------+---------+---------+---------+---------+------1200CTATGCCGCTCGTTGGTGCTTTACAAACCATTTATGTAATAACTGAGACAGTGAATGACCGCGAAAAATTATGATATTGACGGCTTCCGTTTTGATGAAATGACACTTTTAGACAGCACG1201---+---------+---------+---------+---------+---------+------1260CGCTTTTTAATACTATAACTGCCGAAGGCAAAACTACTTTACTGTGAAAATCTGTCGTGCACTATGAATAAACTGCGTGCCGCACTGACAGCACTTGACCCACATATTATCATGTATGGC1261---+---------+---------+---------+---------+---------+------1320TGATACTTATTTGACGCACGGCGTGACTGTCGTGAACTGGGTGTATAATAGTACATACCGGAAGGTTGGGGCGATTCTAATGCAAATAATATTCCTGAAACGTCTATCAATAATTACAAA1321---+---------+---------+---------+---------+---------+------1380CTTCCAACCCCGCTAAGATTACGTTTATTATAAGGACTTTGCAGATAGTTATTAATGTTTAATGTTCCTGGTATTGGTTTTTTCAATCCTGGTGAACGTGACGCCATCAGTAATAATGGA1381---+---------+---------+---------+---------+---------+------1440TTACAAGGACCATAACCAAAAAAGTTAGGACCACTTGCACTGCGGTAGTCATTATTACCTGGTTCTGCAGGTGGATTCGCAGCAGGAAATACGGCAAGTACTATAACGGTCGCAGGAGCA1441---+---------+---------+---------+---------+---------+------1500CCAAGACGTCCACCTAAGCGTCGTCCTTTATGCCGTTCATGATATTGCCAGCGTCCTCGTCTTTTGGCTTCTGCAGGTTGGAACGGAAATGGCACAGTGCAAGCTTTTTTGACGCCAAGC1501---+---------+---------+---------+---------+---------+------1560GAAAACCGAAGACCTCCAACCTTGCCTTTACCGTGTCACGTTCGAAAAAACTGCGGTTCGCAGTCTATCAATTATGTTGAATGTCATGATAGCTTCACCTTAAATGACTCACTCTGGTCA1561---+---------+---------+---------+---------+---------+------1620GTCAGATAGTTAATACAACTTACAGTACTATCGAAGTGGAATTTACTGAGTGAGACCAGTGCTGATCCGAATGATTCTGTGGCGACACATCAAGCGCGAGTGACGCTCGCAAATGCCACG1621---+---------+---------+---------+---------+---------+------1680CGACTAGGCTTACTAAGACACCGCTGTGTAGTTCGCGCTCACTGCGAGCGTTTACGGTGCAATATTCTTGCA~ACGGTGTGACATTTATGGAAACAGGACAGGAGTTTGACCAGTCCAAA1681---+---------+---------+---------+---------+---------+------1740TTATAAGAACGTTTGCCACACTGTAAATACCTTTGTCCTGTCCTCAAACTGGTCAGGTTTTTAGTCAATCCGTCAAATCTGACGCCGCTCTCCCCTACACAGACACAGGCTTATCAATCG1741---+---------+---------+---------+---------+---------+------1800AATCAGTTAGGCAGTTTAGACTGCGGCGAGAGGGGATGTGTCTGTGTCCGAATAGTTAGCGGTAGTATGGAAAAACCTGCATGGTATCCTGCGTCATGGGATACTGCCAAAAATTCATAC1801---+---------+---------+---------+---------+---------+------1860CCATCATACCTTTTTGGACGTACCATAGGACGCAGTACCCTATGACGGTTTTTAAGTATGAATGGACTTTTTGGCTTGGCTAGTAATGGTACTTACTATGGCAATTATTGGCCAGGAAGT1861---+---------+---------+---------+---------+---------+------1920TTACCTGAAAAACCGAACCGATCATTACCATGAATGATACCGTTAATAACCGGTCCTTCAAATCTCTACACCCCAGTAGTTGCGGGGGATGTAGTCAATGCCATGAATTGGGATAATGTC1921---+---------+---------+---------+---------+---------+------1980TTAGAGATGTGGGGTCATCAACGCCCCCTACATCAGTTACGGTACTTAACCCTATTACAGAAGGACAATCAAAATGCTGTTAATTTTATTGGAAATTTGATGAAATTTAAAAAATCCAAT1981---+---------+---------+---------+---------+---------+------2040TTCCTGTTAGTTTTACGACAATTAAAATAACCTTTAAACTACTTTAAATTTTTTAGGTTACCGCAATTTTGGCCTGATGATTATAGCAAACTTGCTTGGACTCCTACCAGTATAGGTGTA2041---+---------+---------+---------+---------+---------+------2100GGCGTTAAAACCGGACTACTAATATCGTTTGAACGAACCTGAGGATGGTCATATCCACATGAAAATGTCACAAATGCGTCAAACGGAGTGATCACAGAAGAATTAACATCGGGTGCGACC2101---+---------+---------+---------+---------+---------+------2160CTTTTACAGTGTTTACGCAGTTTGCCTCACTAGTGTCTTCTTAATTGTAGCCCACGCTGGAAATATTTAGTCATATTGAATGCTAGCGGTAATTCGGTCAAAATTGGTCAAGGTGGTCAG2161---+---------+---------+---------+---------+---------+------2220TTTATAAATCAGTATAACTTACGATCGCCATTAAGCCAGTTTTAACCAGTTCCACCAGTCTTTTATGGGGTGTCAAATTTGACAGGTAAAACTGTGATAATTTCTGACGATAGTAGCTTA2221---+---------+---------+---------+---------+---------+------2280AAAATACCCCACAGTTTAAACTGTCCATTTTGACACTATTAAAGACTGCTATCATCGAATACAGCTAATCAAGTTTTGAATAGCTCTGTCACTCTGTCAAATTTGACAGTCACCGTTATC2281---+---------+---------+---------+---------+---------+------2340TGTCGATTAGTTCAAAACTTATCGAGACAGTGAGACAGTTTAAACTGTCAGTGGCAATAGCAACTTTCTAAATAA2341---+---------+- 2355             3′GTTGAAAGATTTATT


The novel gene according to the invention favorably has at its 5′ end an additional nucleotide sequence which together give the following nucleotide structure: (top strand: SEQ. ID NO. 3 and bottom strand: SEQ. ID NO. 4)

TTACGTTAGCTGGAGAATCCACCGTGTGGAGCCTCCGTCTCACGGTTGCTCCGTGTTACG   1---------+---------+---------+---------+---------+---------+  60AATGCAATCGACCTCTTAGGTGGCACACCTCGGAGGCAGAGTGCCAACGAGGCACAATGCGTAATTCCGCTGCTATAAAGTAATAACTAATAACAAATTAAATAGCAGTATAAAATTTTG  61---------+---------+---------+---------+---------+---------+ 120CATTAAGGCGACGATATTTCATTATTGATTATTGTTTAATTTATCGTCATATTTTAAAACATAATTTGAAGATTATTTTAATATTTACCTGAATAACACTTTAGAAAACTGAAATATCTA 121---------+---------+---------+---------+---------+---------+ 180TATTAAACTTCTAATAAAATTATAAATGGACTTATTGTGAAATCTTTTGACTTTATAGATTAACTCCAGATCAATAGTGGAAATACGTACAATTTGATATAAGAGATTTTTGTATCAAAA 181---------+---------+---------+---------+---------+---------+ 240ATTGAGGTCTAGTTATCACCTTTATGCATGTTAAACTATATTCTCTAAAAACATAGTTTTAAAATTTTTTTAAACAAAATGCACTAA.AAGATTTTTTTGTGTTGCTGAGAGGTTGCAAAA 241---------+---------+---------+---------+---------+---------+ 300TTTTAAAAAAATTTGTTTTACGTGATTTTCTAAAAAAACACAACGACTCTCCAACGTTTTTGATACCGCAAGGTATATAATGGTTACGTAATTAGTGCAAGCGCTTGCATTTTTTGTGAA 301---------+---------+---------+---------+---------+---------+ 360ACTATGGCGTTCCATATATTACCAATGCATTAATCACGTTCGCGAACGTAAAAACACTTAAAAGTCCTTTTATTTATTTATCTTATTGCTTTGAAAGATATTGTTAAAAATAAATAAAA 361---------+---------+---------+---------+---------+---------+ 420TTTTCAGGAAAATAAATAAATAGAATAACGAAACTTTCTATAACAATTTTTATTTATTTTTCGTTATAAACTCAATATAATAAGGAGAGCTAAATAATGAAAAAAACAAAATTAAGAATT 421---------+---------+---------+---------+---------+---------+ 480AGCAATATTTGAGTTATATTATTCCTCTCGATTTATTACTTTTTTTGTTTTAATTCTTAATGTCTTTTCCCAATCGTACTGCTTATCAGTTTTACATTGCTATCCAATGGAACTGGTAAA 481---------+---------+---------+---------+---------+---------+ 540ACAGAAAAGGGTTAGCATGACGAATAGTCAAAATGTAACGATAGGTTACCTTGACCATTTCAGATTGTTTTTGCTACATCTTCATCAGAATATGCTACACAAGCTCTGTCTGACGAGAAA 541---------+---------+---------+---------+---------+---------+ 600GTCTAACAAAAACGATGTAGAAGTAGTCTTATACGATGTGTTCGAGACAGACTGCTCTTTAATGCCACACAAAACAATGATTTTACATCTTTTGATATAAAATGGGCCTATGAAGGGACA 601---------+---------+---------+---------+---------+---------+ 660TTACGGTGTGTTTTGTTACTAAAATGTAGAAAACTATATTTTACCCGGATACTTCCCTGTGATTTGGGATTTAACTATTCAACAACCAGTACTACTTTCAAAATCTGGTCACCAACTGCG 661---------+---------+---------+---------+---------+---------+ 720CTAAACCCTAAATTGATAAGTTGTTGGTCATGATGkAAGTTTTAGACCAGTGGTTGACGCACGAGCGTGCAGCTGATAAGTTATGGGACGAATACCAATCCGACAGCGGCACAGGTCTCA 721---------+---------+---------+---------+---------+---------+ 780TGCTCGCACGTCGACTATTCAATACCCTGCTTATGGTTAGGCTGTCGCCGTGTCCAGAGTGCGAAAGCAATGACACGCGGGACATCAGCGACACCAACTAATCACGCAACCAATACGATT 781---------+---------+---------+---------+---------+---------+ 840CGCTTTCGTTACTGTGCGCCCTGTAGTCGCTGTGGTTGATTAGTGCGTTGGTTATGCTAAGGGGTGTGGACTTTGACCGTTCCTGGCAATCAAAATGGCATGGTTTATGCTTACAAACTA 841---------+---------+---------+---------+---------+---------+ 900CCCCACACCTGAAACTGGCAAGGACCGTTAGTTTTACCGTACCAAATACGAATGTTTGATACTTTTGCTGACGGAACCGTTAGTGATTATGCTGGGTCAACTTATGGAACACTTTCTACA 901---------+---------+---------+---------+---------+---------+ 960TGAAAACGACTGCCTTGGCAATCACTAATACGACCCAGTTGAATACCTTGTGAAAGATGTAGTTCTGTCAGCAATACAACCAATGATCCTTATTCTATTGCGACGACACAAGGTGGAAAT 961---------+---------+---------+---------+---------+---------+1020TCAAGACAGTCGTTATGTTGGTTACTAGGAATAAGATAACGCTGCTGTGTTCCACCTTTACGTTCAGTTGTCGAATCGTCTGCAAACCTCGCGTCAAATCTGGCACTTGCGCAAGGCAAA1021---------+---------+---------+---------+---------+---------+1080GCAAGTCAACAGCTTAGCAGACGTTTGGAGCGCAGTTTAGACCGTGAACGCGTTCCGTTTTCTGCAACTTGGCGGGTAGCAAGTCCAACACAAGCCATCGTTGACGAACTACATATTCGT1081---------+---------+---------+---------+---------+---------+1140AGACGTTGAACCGCCCATCGTTCAGGTTGTGTTCGGTAGCAACTGCTTGATGTATAAGCAGATTTTACAAGCTCATCAACATCTGGTGTTTCGGCTGGTAATCGTGGTAAGTTTCTCGGA1141---------+---------+---------+---------+---------+---------+1200CTAAAATGTTCGAGTAGTTGTAGACCACAAAGCCGACCATTAGCACCATTCAAAGAGCCTGTGATTCAGTCAGGAACAACTGATCCAAATACAGGTACAGCGACTGGACTTGATTATCTG1201---------+---------+---------+---------+---------+---------+1260CACTAAGTCAGTCCTTGTTGACTAGGTTTATGTCCATGTCGCTGACCTGAACTAATAGACAAAAACGAGGGTTTTAACTACATTCAACTTCATGCCAGCCAGTCAGTATGCGTCGGTCAA1261---------+---------+---------+---------+---------+---------+1320TTTTTGCTCCCAAAATTGATGTAAGTTGAAGTACGGTCGGTCAGTCATACGCAGCCAGTTCGAAGCGGGAACCGTACTACTGCGCAACCGAATAACTTCAACTGGGGATATGACCCACAA1321---------+---------+---------+---------+---------+---------+1380GCTTCGCCCTTGGCATGATGACGCGTTGGCTTATTGAAGTTGACCCCTATACTGGGTGTTATGAATGGTACCAGAGCGAATATGCCAGTAATTCTGTCAATCCTGTCACACGTATTAAT1381---------+---------+---------+---------+---------+---------+1440TACTTTACCATGGTCTCGCTTATACGGTCATTAAGACAGTTAGGACAGTGTGCATAATTAGAAATGAAAGAAATGGTACAAGGCTTGCATACAAATGGGATTAGCGTGGTAATGGATATG1441---------+---------+---------+---------+---------+---------+1500CTTTACTTTCTTTACCATGTTCCGAACGTATGTTTACCCTAATCGCACCATTACCTATACGTTCTCAATCACGTCTATAGTCAGTCAGCATCCGCTTTTGAAAAAGCCGAGCCGGGCTAT1501---------+---------+---------+---------+---------+---------+1560CAAGAGTTAGTGCAGATATCAGTCAGTCGTAGGCGAAAACTTTTTCGGCTCGGCCCGATATATTTCCGCAAAAATACGCAATCTGGGTGTGGCAATGATACGGCGAGCAACCACGAAATG1561---------+---------+---------+---------+---------+---------+1620ATAAAGGCGTTTTTATGCGTTAGACCCACACCGTTACTATGCCGCTCGTTGGTGCTTTACTTTGGTAAATACATTATTGACTCTGTCACTTACTGGGCGAAAAATTATGATATTGACGGC1621---------+---------+---------+---------+---------+---------+1680AAACCATTTATGTAATAACTGAGACAGTGAATGACCCGCTTTTTAATACTATAACTGCCGTTCCGTTTTGATGAAATGACACTTTTAGACAGCACGACTATGAATAAACTGCGTGCCGCA1681---------+---------+---------+---------+---------+---------+1740AAGGCAAAACTACTTTACTGTGAAAATCTGTCGTGCTGATACTTATTTGACGCACGGCGTCTGACAGCACTTGACCCACATATTATCATGTATGGCGAAGGTTGGGGCGATTCTAATGCA1741---------+---------+---------+---------+---------+---------+1800GACTGTCGTGAACTGGGTGTATAATAGTACATACCGCTTCCAACCCCGCTAAGATTACGTAATAATATTCCTGAAACGTCTATCAATAATTACAAAAATGTTCCTGGTATTGGTTTTTTC1801---------+---------+---------+---------+---------+---------+1860TTATTATAAGGACTTTGCAGATAGTTATTAATGTTTTTACAAGGACCATAACCAAAAAAGAATCCTGGTGAACGTGACGCCATCAGTAATAATGGAGGTTCTGCAGGTGGATTCGCAGCA1861---------+---------+---------+---------+---------+---------+1920TTAGGACCACTTGCACTGCGGTAGTCATTATTACCTCCAAGACGTCCACGTAAGCGTCGTGGAAATACGGCAAGTACTATAACGGTCGCAGGAGCACTTTTGGCTTCTGGAGGTTGGAAC1921---------+---------+---------+---------+---------+---------+1980CCTTTATGCCGTTCATGATATTGCCAGCGTCCTCGTGAAAACCGAAGACCTCCAACCTTGGGAAATGGCACAGTGCAAGCTTTTTTGACGCCAAGCCAGTCTATCAATTATGTTGAATGT1981---------+---------+---------+---------+---------+---------+2040CCTTTACCGTGTCACGTTCGAAAAAACTGCGGTTCGGTCAGATAGTTAATACAACTTACAGATGATAGCTTCACCTTAAATGACTCACTCTGGTCAGCTGATCCGAATGATTCTGTGGCG2041---------+---------+---------+---------+---------+---------+2100GTACTATCGAAGTGGAATTTACTGAGTGAGACCAGTCGACTAGGCTTACTAAGACACCGCACACATCAAGCGCGAGTGACGCTCGCAAATGCCACGAATATTCTTGCAAACGGTGTGACA2101---------+---------+---------+---------+---------+---------+2160TGTGTAGTTCGCGCTCACTGCGAGCGTTTACGGTGCTTATAAGAACGTTTGCCACACTGTTTTATGGAAACAGGACAGGAGTTTGACCAGTCCAAATTAGTCAATCCGTCAAATCTGACG2161---------+---------+---------+---------+---------+---------+2220AAATACCTTTGTCCTGTCCTCAAACTGGTCAGGTTTAATCAGTTAGGCAGTTTAGACTGCCCGCTCTCCCCTACACAGACACAGGCTTATCAATCGGGTAGTATGGAAAAACCTGCATGG2221---------+---------+---------+---------+---------+---------+2280GGCGAGAGGGGATGTGTCTGTGTCCGAATAGTTAGCCCATCATACCTTTTTGGACGTACCTATCCTGCGTCATGGGATACTGCCAAAAATTCATACAATGGACTTTTTGGCTTGGCTAGT2281---------+---------+---------+---------+---------+---------+2340ATAGGACGCAGTACCCTATGACGGTTTTTAAGTATGTTACCTGAAAAACCGAACCGATCAAATGGTACTTACTATGGCAATTATTGGCCAGGAAGTAATCTCTACACCCCAGTAGTTGCG2341---------+---------+---------+---------+---------+---------+2400TTACCATGAATGATACCGTTAATAACCGGTCCTTCATTAGAGATGTGGGGTCATCAACGCGGGGATGTAGTCAATGCCATGAATTGGGATAATGTCAAGGACAATCAAAATGCTGTTAAT2401---------+---------+---------+---------+---------+---------+2460CCCCTACATCAGTTACGGTACTTAACCCTATTACAGTTCCTGTTAGTTTTACGACAATTATTTATTGGAAATTTGATGAAATTTAAAAAATCCAATCCGCAATTTTGGCCTGATGATTAT2461---------+---------+---------+---------+---------+---------+2520AAATAACCTTTAAACTACTTTAAATTTTTTAGGTTAGGCGTTAAAACCGGACTACTAATAAGCAAACTTGCTTGGACTCCTACCAGTATAGGTGTAGAAAATGTCACAAATGCGTCAAAC2521---------+---------+---------+---------+---------+---------+2580TCGTTTGAACGAACCTGAGCATGGTCATATCCACATCTTTTACAGTGTTTACGCAGTTTGGGAGTGATCACAGAAGAATTAACATCGGGTGCGACCAAATATTTAGTCATATTGAATGCT2581---------+---------+---------+---------+---------+---------+2640CCTCACTAGTGTCTTCTTAATTGTAGCCCACGCTGGTTTATAAATCAGTATAACTTACGAAGCGGTAATTCGGTCAAAATTGGTCAAGGTGGTCAGTTTTATGGGCTGTCAAATTTGACA2641---------+---------+---------+---------+---------+---------+2700TCGCCATTAAGCCAGTTTTAACCAGTTCCACCAGTCAAAATACCCCACAGTTTAAACTGTGGTAAAACTGTGATAATTTCTGACGATAGTAGCTTAACAGCTAATCAAGTTTTGAATAGC2701---------+---------+---------+---------+---------+---------+2760CCATTTTGACACTATTAAAGACTGCTATCATCGAATTGTCGATTAGTTCAAAACTTATCGTCTGTCACTCTGTCAAATTTGACAGTCACCGTTATCCAACTTTCTAAATAA2761---------+---------+---------+---------+---------+-2811AGACAGTGAGACAGTTTAAACTGTCAGTGGCAATAGGTTGAAAGATTTATT


Ways of producing the novel plasmidic gene encoding the novel amylolytic enzyme which is secreted into the environment, according to the invention, are as follows: the plasmid DNA, previously isolated from the bacterial strain, favorably belonging to Lactococcus genus, encoding the amylolytic enzyme, is digested with restriction enzymes, favorably EcoRI, SacII, SalI, SmaI, SpeI, XhoI or XbaI. Subsequently, the excised fragment, favorably of size not smaller than 3.0 kb is ligated with a plasmid capable of replicating in bacterial cells, favorably those of Lactococcus genus, especially pIL253, pGKV210 or pIL252 also digested previously with restriction enzymes, favorably with EcoRI, SalI, or SmaI, after which the two DNA fragments are recombined together and introduced by means of electroporation into bacterial cells, which are grown in a known manner, and from the cultivated population, cells possessing the novel gene encoding the novel amylolytic enzyme are isolated in a known way.


In the method according to the invention bacterial strains into which the recombined DNA is introduced are favorably used Lactococcus lactis MG1363, Lactococcus lactis IL1403 or Lactococcus lactis IBB140.


In the method according to the invention colonies producing the amylolytic enzyme and carrying the novel gene are positively separated by inoculation into fresh liquid medium with antibiotic and starch if necessary.


The novel enzyme secreted into the environment, encoded by the novel plasmidic gene according to the invention, has the following amino acid structure (SEQ. ID NO. 5):

  1MKKTKLRICL FPIVLLISFT LLSNGTGKQI VFATSSSEYA TQALSDEKNA 51TQNNDFTSFD IKWAYEGTDL GFNYSTTSTT FKIWSPTATS VQLISYGTNT101NPTAAQVSAK AMTRGTSATP TNHATNTIGV WTLTVPGNQN GMVYAYKLTF151ADGTVSDYAG STYGTLSTSS VSNTTNDPYS IATTQGGNRS VVESSANLAS201NLALAQGKSA TWRVASPTQA IVDELHIRDF TSSSTSGVSA GNRGKFLGVI251QSGTTDPNTG TATGLDYLKN EGFNYIQLHA SQSVCVGQRS GNRTTAQPNN301FNWGYDPQMK WYQSEYASNS VNPVTRINEM KEMVQGLHTN GISVVMDMVL351NHVYSQSASA FEKAEPGYYF RKNTQSGCGN DTASNHEMFG KYIIDSVTYW401AKNYDIDGFR FDEMTLLDST TMNKLRAALT ALDPHIIMYG EGWGDSNANN451IPETSINNYK NVPGIGFFNP GERDAISNNG GSAGGFAAGN TASTITVAGA501LLASGGWNGN GTVQAFLTPS QSINYVECHD SFTLNDSLWS ADPNDSVATH551QARVTLANAT NILANGVTFM ETGQEFDQSK LVNPSNLTPL SPTQTQAYQS601GSMEKPAWYP ASWDTAKNSY NGLFGLASNG TYYGNYWPGS NLYTPVVAGD651VVNAMNWDNV KDNQNAVNFI GNLMKFKKSN PQFWPDDYSK LAWTPTSIGV701ENVTNASNGV ITEELTSGAT KYLVILNASG NSVKIGQGGQ FYGVSNLTGK751TVIISDDSSL TANQVLNSSV TLSNLTVTVI QLSK


This enzyme exhibits a unique set of profitable features, especially showing activity in a wide range of acid pH from 3.5 to 5.5 as shown on graph (FIG. 1) while its optimum is at a pH 4.4. At the same time the optimal temperature of the enzyme's activity is in a range from 350-45° C. as shown on graph (FIG. 2), and is thermally inactivated at temperatures higher than 50° C. as shown on graph (FIG. 3).


Application of the amylolytic enzyme encoded by the novel gene according to the invention, in fermentation of plant material, favorably starch, pullulan, amylose, amylopectin, feed production, obtaining glucose, lactic acid and production of probiotic specimens, probiotic-containing food, feed and fodder, according to the invention is based on the fact that its gene is introduced into the structure of the bacterial strain, favorably the strains of Lactococcus lactis IBB500, IBB501, IBB502, IBB140 and subsequently of applying the strains obtained in fermentations of plant material or milk or in biomass production.


The gene according to the invention has been sequenced and the sequence obtained indicates that it belongs to the family of pullulanase encoding genes. The analysis of the gene's promoter region as well as functional studies suggest that the expression of this gene undergoes catabolic repression.


General Characteristics of the Amylolytic Enzyme


From the comparison of features of pullulanases from studied L. lactis IBB500 and IBB502 strains it can be concluded that we are dealing with an enzyme produced in two organisms. Pullulanase deriving from both of the strains had the optimum pH of 4.4 and reached the optimal temperature at 45° C. (FIGS. 1, 2).


One should note the rather narrow pH range of the enzyme's activity between pH 3.5-5.5 as well as the fact that it is significantly lower than for pullulanases deriving from other bacteria (Ara K., Igarashi K., Saeki K., Kawai S., and S., Ito. 1992. Biosci. Biotech. Biochem. 56:62; Kim Ch., Nashiru O., J., Ko. 1996. FEMS Microbiology Letters 138:147; Takasaki Y. 1987. Agric. Biol. Chem., 51:9).


The enzyme obtained with the help of the novel gene according to the invention, shows homology to amylolytic enzymes of the pullulanase group and the highest homology was found to pullulanase from Termotoga maritima. In the amino acid sequence of pullulanase from L. lactis IBB500 four conserved motives, characteristic for many amylolytic enzymes were identified. The nucleotide sequence of pul gene was preceded by a RBS typical for Lactococcus in front of which a long 500-nucleotide non-coding region was identified.


The thorough analysis of the non-coding region upstream of the pul gene showed the presence of several putative promoter sequences. Due to the earlier observations of the effect of glucose on pullulanase production, from which was concluded that the expression of the pul gene may be regulated by catabolic repression, the promoter region was analyzed for the presence of the cre motive,. characteristic for this mechanism of regulation (Weickert M. J. and S. Adhya. 1992. J. Biol. Chem. 267: 15869). It was determined that the sequence homologous to the 14-nucleotide cre sequence is present in the analyzed promoter region. This observation strongly supported the earlier hypothesis. Another argument for the validity of this hypothesis was acquired during experiments on the influence of glucose as well as starch and its derivates on the pullulanase production in the IBB500 strain. In the process it was determined that starch and its derivatives induce pullulanase production although at different levels, while in the presence of glucose the repression of production of this enzyme is observed (Domań M., E. Czerniec, Z. Targoński and J. Bardowski. 2000. Food Biotechnology 17:67, Elsevier Science B.V., Amsterdam).


HERE BELOW THE EXAMPLES OF REALIZATION ARE PRESENTED

Materials and Methods


Bacterial Strains, Growth Conditions and Plasmids Used.


Bacterial strains and plasmids used in these studies are shown in Table 1. Lactococcus lactis strains were grown in BHI medium (Oxoid, England) or M17 (Difco, USA), at the temperature of 28° C., Escherichia coli in Luria-Bertani medium (LB), at the temperature of 37° C. Where necessary for selection, the following antibiotics were used: erythromycin—5 μg/ml for L. lactis and ampicyline—100 μg/ml for E. coli.


Example I

Plasmid DNA was isolated from Lactococcus lactis IBB500 bacterial strain encoding the amylolytic enzyme. Subsequently, it was digested with EcoRI restriction enzyme, then the excised fragment not smaller that 8.0 kb was ligated with a plasmid capable of replicating in Lactococcus bacterial cells—pIL253, digested previously also with EcoRI restriction enzyme. Both DNAs were recombined with each other and introduced by the method of electroporation into Lactococcus lactis cells which were grown and from the cultivated population cells carrying the novel gene of the structure according to the invention were isolated by inoculation into fresh liquid medium with antibiotic and starch.



L. lactis cells were transformed by method of electroporation (Holo H. and I. F. Nes. 1989. Appl. Environ. Microbiol. 55: 3119).


The remaining molecular biology techniques used in the example were carried out according to the standard methodology (Sambrook J., E. F. Fritsch and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd edition. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.).


Example II

Plasmid DNA was isolated from Lactococcus lactis IBB500 bacterial strain encoding the amylolytic enzyme. Subsequently, it was digested with XhoI restriction enzyme, the excised fragment of size not smaller than 5.0 kb was ligated with a plasmid capable of replicating in Lactococcus bacterial cells—pIL253, digested previously also with XhoI. Both DNAs were then recombined with each other and introduced by method of electroporation into Lactococcus lactis cells which were grown and from the cultivated population cells carrying the novel gene of the structure according to the invention was selected by inoculation into fresh liquid medium with antibiotic and starch.



L. lactis cells were transformed by method of electroporation (Holo H. and I. F. Nes. 1989. Appl. Environ. Microbiol. 55: 3119).


The remaining molecular biology techniques used in the example were carried out according to the standard methodology (Sambrook J., E. F. Fritsch and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd edition. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.).


Example III

The structure of the nucleotide sequence of the novel gene and the amino acid sequence of the amylolytic enzyme encoded by this gene according to the invention was determined by sequencing a Pstl 1.5 kb fragment of the pIBB502 plasmid, carrying a part of the novel gene, which was previously cloned in pBluescript plasmid (Stratagene), what generated the pIBB504 plasmid. This plasmid was used to sequence the cloned fragment from both sides. Transformation of E. coli cells was carried out according to the standard method with the use of CaCl2 (Sambrook J., E. F. Fritsch and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd edition. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.).


The complete nucleotide sequence of the fragment and of the lacking part of the novel gene encoding the amylolytic enzyme were obtained by using the sequencing method named “primer walking”. For DNA sequencing BigDye Terminator set (Promega, USA), PCR machine model 2400 (Perkin-Elmer) and sequencer ABI377 (Applied Biosystem, USA) were used. The nucleotide and amino acid sequences obtained were analyzed using the GCG programs (Genetics Computer Group. 1991. Program manual for the GCG package, version 7, April 1991. Genetic Computer Group, Madison, Wis., USA) and BLAST (Altschul S. F., W. Gish, W. Miller, E. W. Myers and D. J. Lipman. (1990), J. Mol. Biol. 215: 403).


Example IV

For determining the amylolytic activity two tests—quantitative and qualitative were applied.


Qualitative Test on Plates


Bacterial strains were plated on BHI with 0.5% starch and incubated in 28° C. for two days. Subsequently, the grown colonies were overlayed with Lugol reagent, which colors the non-degraded starch dark blue. A clear zone of non-colored medium surrounded colonies that secrete the amylolytic enzyme into the environment.


Quantitative Determination of Enzyme Activity


In this test a modified method was used to determine the activity of extracellular amylase (Nicholson W. and P. Setlow. 1990. Sporulation, germination and outgrowth, p 433. W C. R. Harwood and S. M. Cutting (ed.), Molecular Biology for Bacillus. John Wiley and Sons Ltd., Chichester, United Kingdom).


In this method the enzymatic activity was determined in the supernatant of the culture: to 200 μof this supernatant 800 μl of the substrate (0.025% starch in 10 mM Tris-HCl-3 mM potassium acetate-25 mM CaCl2, pH 4.4) was added and incubated for 30 min. at 37° C. The reaction was stopped by adding 400 μof Lugol reagent and the absorption was measured at wavelength of 620 nm [A620]. As a control non-inoculated medium was used.


One unit of amylolytic activity (1 U) was established as the amount of enzyme, which in the conditions of the test, generated the decrease of the substrate's absorption A620 by 0.1 compared to the control.

TABLE 1Strains and plasmids.Strains and plasmidsGenotypeSourceLactococcus lactisIBB 500amy+ wild type strainIBB PAN collectionisolated from plant materialIBB 501amy+ MG 1363 withthis workpIBB501IBB 502amy+ derivative of MGthis work1363 with pIBB502IBB 140amy+ IBB140 withthis workpIBB502IL 1403amy, plamid-freeA. Chopin, FranceMG 1363amy, plamid-freeM. Gasson, EnglandEschercia coliTG1supE thi Δ(lac-proAB) hsd(Gibson, 1984)(F′+ traD proAB laclqZ M15)IBB 504amy derivative of TG1this workwith pIBB504PlasmidspIBB50030-kb, wild type plasmidthis workwith amy+ genepIBB50120-kb fragment of pIBB500this workwith amy+ gene cloned inpIL253pIBB50213-kb derivative ofthis workpIBB501 with amy+ genepIBB5041.5-kb Pstl fragment fromthis workpIBB502 in pSKII+pBluescript SKII+AmpR, vector for cloningStratagene, USAand DNA sequencingpIL253EryR, vector for geneA. Chopin, Francecloning


Claims
  • 1-7. (Canceled).
  • 8. An isolated polynucleotide comprising the nucleotide sequence of SEQ ID No. 1.
  • 9. The polynucleotide according to claim 8, further comprising the nucleotide sequence of SEQ ID No. 3.
  • 10. A plasmid comprising the polynucleotide according to claim 8.
  • 11. The polynucleotide according to claim 8, which encodes a enzyme possessing amylolytic activity.
  • 12. A method of producing a polypeptide having amylolytic activity, said method comprising ligating the polynucleotide according to claim 8 into a plasmid, introducing said plasmid into a bacterial cell, expressing said plasmid to produce said polypeptide, and isolating said polypeptide.
  • 13. The method according to claim 12, wherein the plasmid is introduced into the bacterial cell by electroporation.
  • 14. The method according to claim 12, wherein the polynucleotide is derived from a bacterial strain.
  • 15. The method according to claim 14, wherein the bacterial strain is Lactococcus.
  • 16. The method according to claim 12, wherein the bacterial cell is from a Lactococcus genus.
  • 17. The method according to claim 16, wherein the bacterial cell from Lactococcus genus is pIL253, pGKV210 or pIL252.
  • 18. The method according to claim 14, wherein the polynucleotide is derived from a bacterial strain by digesting its DNA comprising the polynucleotide with a restriction enzyme.
  • 19. The method according to claim 18, wherein the restriction enzyme is selected from the group consisting of EcoRI, SacI, SalI, SmaI, SpeI, XhoI and XbaI.
  • 20. The method according to claim 12, wherein the plasmid comprises one or more restriction enzyme sites.
  • 21. The method according to claim 20, wherein the restriction enzyme site is selected from the group consisting of EcoRI, SacI, SalI, SmaI, SpeI, XhoI and XbaI.
  • 22. The method according to claim 12, wherein the bacterial cell is derived from a bacterial strain selected from the group consisting of Lactococcus lactis MG1363, Lactococcus lactis IL 1403 and Lactococcus lactis IBB 140.
  • 23. The method according to claim 12, wherein the bacterial cell comprising said plasmid is isolated by inoculation in fresh liquid medium supplemented with antibiotic
  • 24. The method according to claim 23, wherein the fresh liquid medium is further supplemented with starch.
  • 25. A polypeptide comprising the amino acid sequence of SEQ ID No. 5.
  • 26. The polypeptide according to claim 25, which exhibits enzymatic activity at a range of pH from 3.5 to 5.5.
  • 27. The polypeptide according to claim 26, which exhibits optimum enzymatic activity at a pH of 4.4
  • 28. The polypeptide according to claim 25, which exhibits enzymatic activity at a temperature range of 35°-45° C. and is thermally inactivated at a temperature higher than 50° C.
  • 29. The polypeptide according to claim 25, which is encoded by the nucleotide sequence of SEQ ID No. 1.
  • 30. A method of fermentation comprising applying the polypeptide according to claim 25 to a material to be fermented.
  • 31. The method according to claim 30, wherein the material is starch, pullulan, amylose, amylopectin, and lactose.
  • 32. A method of fermentation comprising transforming a bacterial strain with a polynucleotide comprising the nucleotide sequence of SEQ ID No. 1, and applying the transformed bacterial strain in plant material or milk.
  • 33. The method according to claim 32, wherein the bacterial strain is selected from the group consisting of Lactococcus lactis IBB500, Lactococcus lactis IBB501, Lactococcus lactis IBB502, and Lactococcus lactis IBB140.
Priority Claims (1)
Number Date Country Kind
P-348789 Jul 2001 PL national
PCT Information
Filing Document Filing Date Country Kind
PCT/PL02/00041 6/26/2002 WO