Patent Application
20230417775
The invention relates generally to the detection of steroid hormone ligand(s) from a sample. In particular, the present invention provides assays, methods and test kits sufficient to screen a test sample for the presence of a ligand as characterized by its ability to form a complex with a steroid hormone receptor and elicit a steroid hormone specific genomic response, for example, by driving transcription of a reporter construct in vitro.
The detection of ligands capable of eliciting a steroid hormone genomic response is important in many areas of biochemistry, molecular biology and medicine. Such ligands include endogenous steroids, exogenous steroids, non-steroidal and synthetic molecules. For example, the determination of total hormone bioactivity in serum or plasma is important for monitoring human and animal health related conditions including aging, perimenopause, menopause, hypoandrogenism, hyperandrogenism, hormone replacement therapy, endocrine cancers including breast and prostate cancers, other hormone related conditions such as osteoporosis and liver toxicity, irregular menstruation, polycystic ovary syndrome, disorders of sexual development and infertility. Conventional detection methods for androgenic/estrogenic and antiandrogenic/antiestrogenic molecules provide no information about hormone biological activity. Hormone biological activity is an important measurement for understanding underlying mechanisms that are driving health conditions so that appropriate treatments/interventions can be implemented.
The detection of hormonal bioactivity in samples is also important for monitoring illicit human and animal performance enhancement, injury cover-up, supplement and food adulteration, growth promoters in dairy industry and environmental pollutants. Measuring hormonal bioactivity provides information about contaminants and/or adulterants that are likely to modulate endocrine pathways in the body, thereby affecting human and animal health.
Ligands that elicit a steroid hormone genomic response first activate steroid hormone receptor proteins by forming a complex with them in the cytoplasm or nucleus of eukaryote cells to form an activated receptor protein. The ligand displaces coregulators that act to stabilise the inactivated receptor protein, which then exposes DNA binding motifs. The activated receptor protein dimerises with a second activated receptor protein and translocates to the nucleus to interact with DNA by binding to a specific nucleotide sequence called a response element. In normal biological function, the assemblage of ligand-activated steroid hormone receptor proteins bound to a response element regulates gene expression by enhancing or repressing the initiation of RNA polymerase II mediated transcription. In its natural state, the activated receptor may recruit other coregulator proteins to either stabilize its DNA binding and/or to help engage RNA polymerase II. RNA polymerase II is a multi-subunit holoenzyme that assembles to catalyse RNA transcription by polymerising nucleotide triphosphates against a DNA template.
The steroid hormone genomic response is induced by ligands that bind to steroid hormone receptor proteins and receptor-specific response elements for example androgen receptor (AR) and the androgen response element (ARE), estrogen receptor-α (ER-α), estrogen receptor-β (ER-β) and the estrogen response element (ERE), glucocorticoid receptor (GR) and the glucocorticoid response element (GRE), mineralocorticoid receptor (MR) and the mineralocorticoid response element (MRE), progesterone receptor-A (PR-A), progesterone receptor-B (PR-B) and the progesterone response element (PRE).
However, not all ligands that bind to steroid hormone receptor proteins elicit a steroid hormone genomic response. Some ligands elicit a non-genomic response that is characterised by second messenger signalling, such as G-protein activation. Such non-genomic responses occur within seconds to minutes of ligand binding, and are not a classical steroid hormone response.
A common way to detect the presence of a ligand in a sample is to measure it directly in that sample. However, samples are often complex mixtures of molecules and typically require a complicated process of preparation for analysis. Detecting the presence of a ligand(s) in a sample typically relies on processes such as liquid or gas chromatography to separate the molecular species from a complex mixture into fractions of relatively pure composition and then analyse each fraction with a structure-sensitive method such as mass spectrometry. More than 100 ligands can be tested in any one sample using this approach. Automated purification systems, gas or liquid chromatograms, and mass spectrometers are costly and technically complicated laboratory instruments that must be continually calibrated and operated by trained technicians in order to produce reliable results. Another disadvantage is that some ligands may be rendered biologically inactive by interaction with proteins such as sex hormone binding globulin or serum albumin and this methodology does not distinguish between biologically active and inactive fractions of ligands. Also, the process of ionization can lead to disintegration of some steroid molecules such that they cannot be measured using such methodologies. Additionally, this methodology does not provide information about the total biological activity of a sample from multiple ligands when all known ligands cannot be identified or where ligands may be identified it is not known if the activity would be additive, synergistic, or even competitive. Furthermore, prior knowledge of the molecular structure of the ligand(s) and its associated metabolite(s) due to the biological metabolism of the ligand(s) is required to achieve reliable identification of the presence of ligand(s) in the sample.
Another common way to detect the presence of a steroid hormone ligand in a sample is to use biological assays based on immunological techniques, such as radioimmunoassay and enzyme-linked immunosorbent assay. A limitation of immunological techniques is the requirement for antibody molecules to detect the ligands directly or the ligands bound to sex hormone binding globulin. Immunological assays lack reproducibility due to the high degree of variability in the antibody molecules produced by different manufacturers of the assays.
To overcome various limitations associated with detection of ligands in a sample (e.g.) requirement for knowledge of the compound structure and/or to provide complex detection reagents such as antibodies, Applicants have developed various generations of in vitro bioactivity assays involving enzyme- or fluorescence-mediated reporter read-outs. These assays mimic biological systems by assembling, in vitro, essential components of in vivo hormone signalling to facilitate detection of a target ligand from a test sample. The essential assay components include, for example, a steroid hormone receptor, steroid hormone receptor coregulator(s) and a reporter construct which includes a specific DNA binding motif which is only bound/activated in the presence of a ligand of interest. For example, the test kits, assays and methods described in PCT/NZ2020/050045 and PCT/NZ2020/050046.
More recently, Applicants have undertaken further optimization work to establish improvements in the configuration and performance of test kits, assays and methods as previously described. For example, improvements in reporter construct architecture and/or the inclusion of additional coregulators which enhance assay specificity and/or sensitivity.
Further, manufacturing improvements in terms of cell lysate production of steroid hormone receptor sufficient to meet scale-up requirements have been developed. Not only does this approach reduce the total cost of goods required for manufacture of test kits, it also creates flexibility with respect to the recombinant production of variant/designer steroid hormone receptors for wider application of the test kits, assays and methods described herein to steroid hormone biology, and commercial applications therein.
Accordingly, the present invention is concerned with these non-obvious improvements.
The inventions described and claimed herein have many attributes and examples including, but not limited to, those set forth or described or referenced in this Summary of the Invention. It is not intended to be all-inclusive and the inventions described and claimed herein are not limited to or by the features or examples identified in this Summary of the Invention, which is included for purposes of illustration only and not restriction.
In an aspect of the present invention there is provided a test kit for screening a sample for the presence of a ligand capable of eliciting a steroid hormone genomic response, the test kit comprising:
In yet another aspect of the present invention there is provided a test kit for screening a sample for the presence of a ligand capable of eliciting a steroid hormone genomic response, the test kit comprising:
In yet another aspect of the present invention there is provided a test kit for screening a sample for the presence of a ligand capable of eliciting a steroid hormone genomic response, the test kit comprising:
In yet another aspect of the present invention there is provided a test kit for screening a sample for the presence of a ligand capable of eliciting a steroid hormone genomic response, the test kit comprising:
In yet another aspect of the present invention there is provided a test kit for screening a sample for the presence of a ligand capable of eliciting a steroid hormone genomic response, the test kit comprising:
In yet another aspect of the present invention there is provided a test kit for screening a sample for the presence of a ligand capable of eliciting a steroid hormone genomic response, the test kit comprising:
In yet another aspect of the present invention there is provided a test kit for screening a sample for the presence of a ligand capable of eliciting a steroid hormone genomic response, the test kit comprising:
In yet another aspect of the present invention there is provided a test kit for screening a sample for the presence of a ligand capable of eliciting a steroid hormone genomic response, the test kit comprising:
In yet another aspect of the present invention there is provided an assay method for detecting a ligand in a sample which ligand is capable of eliciting a steroid hormone genomic response, the assay method comprising the steps of:
In yet another aspect of the present invention there is provided an assay method for detecting a ligand in a sample which ligand is capable of eliciting a steroid hormone genomic response, the assay method comprising the steps of:
In yet another aspect of the present invention there is provided an assay method for detecting a ligand in a sample which ligand is capable of eliciting a steroid hormone genomic response, the assay method comprising the steps of:
In yet another aspect of the present invention there is provided an assay method for detecting a ligand in a sample which ligand is capable of eliciting a steroid hormone genomic response, the assay method comprising the steps of:
In yet another aspect of the present invention there is provided an assay method for detecting a ligand in a sample which ligand is capable of eliciting a steroid hormone genomic response, the assay method comprising the steps of:
In yet another aspect of the present invention there is provided an assay method for detecting a ligand in a sample which ligand is capable of eliciting a steroid hormone genomic response, the assay method comprising the steps of:
In yet another aspect of the present invention there is provided an assay method for detecting a ligand in a sample which ligand is capable of eliciting a steroid hormone genomic response, the assay method comprising the steps of:
In yet another aspect of the present invention there is provided an assay method for detecting a ligand in a sample which ligand is capable of eliciting a steroid hormone genomic response, the assay method comprising the steps of:
In another aspect of the present invention there is provided a test kit for screening a sample for the side-by-side detection of an androgenic ligand and/or an estrogenic ligand, the test kit comprising:
In other aspects of the present invention there is provided a test kit for screening a sample for the presence of a ligand, which ligand is capable of forming a complex with a steroid hormone receptor and eliciting a genomic response, the test kit comprising:
In another aspect of the present invention there is provided a test kit for screening a sample for the presence of a ligand, which ligand is capable of forming a complex with a steroid hormone receptor and eliciting a genomic response, the test kit comprising:
In another aspect of the present invention there is provided a test kit for screening a sample for the presence of a ligand, which ligand is capable of forming a complex with an estrogen receptor and eliciting a genomic response, the test kit comprising:
In yet another aspect of the present invention there is provided a test kit for the side-by-side detection of an androgenic ligand and/or an estrogenic ligand from a sample, the test kit comprising:
In yet another aspect of the present invention there is provided a test kit to determine the total estrogenic activity of a sample, the test kit comprising:
In an example according to this aspect of the present invention, the RNA polymerase is T7 RNA polymerase, and the RNA polymerase promoter sequence is T7 RNA polymerase promoter sequence defined by SEQ ID NO: 85.
In another example according to these and other aspects of the present invention, the nucleic acid sequence optionally comprises a spacer (e) which is located between the promoter sequence (a) and the response element (b). In a related example, the spacer is between about 2 and about 32 nucleotides in length.
In yet another aspect of the present invention there is provided an assay method for detecting a ligand in a sample which ligand is capable of eliciting a steroid hormone genomic response, the method comprising the steps of:
In a further aspect of the present invention there is provided a method for determining the steroid hormone bioactivity of a sample, the method comprising combining a sample with a test kit as described herein to ascertain if the sample comprises a ligand sufficient to activate a steroid hormone receptor and cause a change in a physical property of the reporter construct, wherein a change in a physical property of the reporter construct provides information about the steroid hormone bioactivity of the sample.
In a further aspect of the present invention there is provided a method for determining the steroid hormone bioactivity of a biological sample, the method comprising combining a biological sample with a test kit as described herein to ascertain if the sample comprises a ligand sufficient to activate a steroid hormone receptor and cause a change in a physical property of the reporter construct, wherein a change in a physical property of the reporter construct provides information about the steroid hormone bioactivity of the biological sample.
In a further aspect of the present invention there is provided a method for determining the steroid hormone bioactivity of a clinical specimen, the method comprising combining a sample obtained from the clinical specimen with a test kit as described herein to ascertain if the sample comprises a ligand sufficient to activate a steroid hormone receptor and cause a change in a physical property of the reporter construct, wherein a change in a physical property of the reporter construct provides information about the steroid hormone bioactivity of the clinical specimen.
In a further aspect of the present invention there is provided a method for determining the steroid hormone bioactivity of a food or a nutritional supplement, the method comprising combining the food or nutritional supplement, or an extract of the food or nutritional supplement, with a test kit as described herein to ascertain if the sample comprises a ligand sufficient to activate a steroid hormone receptor and cause a change in a physical property of the reporter construct, wherein a change in a physical property of the reporter construct provides information about the steroid hormone bioactivity of the food or nutritional supplement.
In a further aspect of the present invention there is provided a method for determining the steroid hormone bioactivity of a sample derived from an environmental source, the method comprising combining a sample obtained from an environmental source with a test kit as described herein to ascertain if the sample comprises a ligand sufficient to activate a steroid hormone receptor and cause a change in a physical property of the reporter construct, wherein a change in a physical property of the reporter construct provides information about the steroid hormone bioactivity of the environmental sample.
In a further aspect of the present invention there is provided a method for determining the doping status of an athlete, the method comprising combining a sample obtained from an athlete with a test kit as described herein to ascertain if the sample comprises a ligand sufficient to activate a steroid hormone receptor and cause a change in a physical property of the reporter construct, wherein a change in a physical property of the reporter construct provides information about the doping status of the athlete.
In a further aspect of the present invention there is provided a method for determining the steroid hormone bioactivity of a sample, the method comprising performing an assay method as described herein on a sample to ascertain if the sample comprises a ligand sufficient to activate a steroid hormone receptor and cause a change in a physical property of the reporter construct, wherein a change in a physical property of the reporter construct provides information about the steroid hormone bioactivity of the sample.
In a further aspect of the present invention there is provided a method for determining the steroid hormone bioactivity of a biological sample, the method comprising performing an assay method as described herein on a sample to ascertain if the sample comprises a ligand sufficient to activate a steroid hormone receptor and cause a change in a physical property of the reporter construct, wherein a change in a physical property of the reporter construct provides information about the steroid hormone bioactivity of the biological sample.
In a further aspect of the present invention there is provided a method for determining the steroid hormone bioactivity of a food or a nutritional supplement, the method comprising performing an assay method as described herein on the food or nutritional supplement, or an extract from the food or nutritional supplement, to ascertain if the food or nutritional supplement comprises a ligand sufficient to activate a steroid hormone receptor and cause a change in a physical property of the reporter construct, wherein a change in a physical property of the reporter construct provides information about the steroid hormone bioactivity of the food or nutritional supplement.
In a further aspect of the present invention there is provided a method for determining the steroid hormone bioactivity of a clinical specimen, the method comprising performing an assay method as described herein on a clinical specimen to ascertain if the sample comprises a ligand sufficient to activate a steroid hormone receptor and cause a change in a physical property of the reporter construct, wherein a change in a physical property of the reporter construct provides information about the steroid hormone bioactivity of the clinical specimen.
In a further aspect of the present invention there is provided a method for determining the steroid hormone bioactivity of a sample derived from an environmental source, the method comprising performing an assay method as described herein on the environmental sample to ascertain if the sample comprises a ligand sufficient to activate a steroid hormone receptor and cause a change in a physical property of the reporter construct, wherein a change in a physical property of the reporter construct provides information about the steroid hormone bioactivity.
In a further aspect of the present invention there is provided a method for determining the doping status of an athlete, the method comprising performing an assay method as described herein on a sample obtained from the athlete to ascertain if the sample comprises a ligand sufficient to activate a steroid hormone receptor and cause a change in a physical property of the reporter construct, wherein a change in a physical property of the reporter construct provides information about the doping status of the athlete.
In a further aspect of the present invention there is provided an article of manufacture for screening a sample for the presence of a ligand, which ligand is capable of eliciting a steroid hormone genomic response, the article of manufacture comprising a test kit as described herein together with instructions for how to detect the presence of a ligand in the sample.
In a further aspect of the present invention there is provided an article of manufacture for screening a biological sample for the presence of a ligand, which ligand is capable of eliciting a steroid hormone genomic response, the article of manufacture comprising a test kit as described herein together with instructions for how to detect the presence of a ligand in the biological sample.
In a further aspect of the present invention there is provided an article of manufacture for screening a food or a nutritional supplement for the presence of a ligand, which ligand is capable of eliciting a steroid hormone genomic response, the article of manufacture comprising a test kit as described herein together with instructions for how to detect the presence of a ligand in the food or nutritional supplement.
In yet a further aspect of the present invention there is provided an article of manufacture for determining the steroid hormone bioactivity of a sample, the article of manufacture comprising a test kit as described herein together with instructions for detecting the steroid hormone bioactivity in a sample, wherein the presence of bioactive ligands in the sample is indicative of steroid hormone bioactivity of the sample.
In yet a further aspect of the present invention there is provided an article of manufacture for determining the steroid hormone bioactivity of a clinical specimen, the article of manufacture comprising a test kit as described herein together with instructions for detecting the steroid hormone bioactivity in a clinical specimen, wherein the presence of bioactive ligands in the clinical specimen is indicative of steroid hormone bioactivity of the clinical specimen.
In yet a further aspect of the present invention there is provided an article of manufacture for determining the steroid hormone bioactivity of an environmental sample, the article of manufacture comprising a test kit as described herein together with instructions for detecting the steroid hormone bioactivity in an environmental sample, wherein the presence of bioactive ligands in the environmental sample is indicative of steroid hormone bioactivity of the environmental sample.
In yet a further aspect of the present invention there is provided an article of manufacture for determining doping in an athlete, the article of manufacture comprising a test kit as described herein together with instructions for detecting the presence of a ligand in a sample derived from the athlete, wherein the presence of the ligand in the sample is indicative of doping in the athlete.
In yet a further aspect of the present invention there is provided a nucleic acid molecule comprising or consisting in the T7 RNA polymerase promoter sequence defined by SEQ ID NO: 85
In yet a further aspect of the present invention there is provided a nucleic acid molecule comprising:
In yet a further aspect of the present invention there is provided a nucleic acid molecule comprising:
Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art (for example, in immunology, immunohistochemistry, protein chemistry, molecular genetics, synthetic biology and biochemistry).
It is intended that reference to a range of numbers disclosed herein (e.g. 1 to 10) also incorporates reference to all related numbers within that range (e.g. 1, 1.1, 2, 3, 3.9, 4, 5, 6, 6.5, 7, 8, 9 and 10) and also any range of rational numbers within that range (for example 2 to 8, 1.5 to 5.5 and 3.1 to 4.7) and, therefore, all sub-ranges of all ranges expressly disclosed herein are expressly disclosed. These are only examples of what is specifically intended and all possible combinations of numerical values between the lowest value and the highest value enumerated are to be considered to be expressly stated in this application in a similar manner.
The term “and/or”, e.g., “X and/or Y” shall be understood to mean either “X and Y” or “X or Y” and shall be taken to provide explicit support for both meanings or for either meaning.
The term “a” or “an” refers to one or more than one of the entity specified; for example, “a receptor” or “a nucleic acid molecule” may refer to one or more receptor or nucleic acid molecule, or at least one receptor or nucleic acid molecule. As such, the terms “a” or “an”, “one or more” and “at least one” can be used interchangeably herein.
Throughout this specification the word “comprise”, or variations such as “comprises” or “comprising”, will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.
Throughout this specification, unless specifically stated otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or group of compositions of matter.
For the purposes of the present invention, the following terms shall have the following meanings.
The term “test kit” as used herein refers to an article of manufacture comprising various components to perform the assays and methods according to the inventions described herein.
The term “steroid hormone receptor” or “SHR” as used herein refers to a protein or polypeptide, including recombinant polypeptides that selectively binds to a ligand, which ligand is capable of activating the steroid hormone receptor, and includes, without limitation, an androgen receptor, an estrogen receptor, a progesterone receptor, a mineralocorticoid receptor and a glucocorticoid receptor. Typically, a steroid hormone receptor comprises a ligand binding domain, an activation domain and a deoxyribonucleic acid binding domain. According to this definition, “steroid hormone receptor” may optionally include other corepressors, including (e.g.) heat shock proteins and the like, which help to hold the steroid hormone receptor in a folded and hormone responsive state for activation by a ligand.
The term “steroid hormone receptor coregulator” as used herein includes a “steroid hormone receptor activator” and/or a “steroid hormone receptor repressor”.
A “steroid hormone receptor repressor” according to the present invention includes proteins or molecules that hold the steroid hormone receptor in an inactive state, until displaced by a ligand, at which point the steroid hormone receptor becomes activated. Examples of steroid hormone receptor repressors according to the present invention include, without limitation, heat shock protein 90 (HSP90); a complex of HSP90 and heat shock protein 70 (HSP70); a complex of HSP90, HSP70 and heat shock protein 40 (HSP40); a complex of HSP90, HSP70, HSP40 and p23; a complex of HSP90, HSP70, HSP40, p23 and heat shock protein organizing protein (Hop); a complex of HSP90, HSP70, HSP40, p23, Hop and 48 kD Hip protein (Hip); a complex of HSP90, HSP70, HSP40, p23, Hop, Hip and p60; and a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, p60 and FKBP52.
A “steroid hormone receptor activator” according to the present invention includes a protein or molecule that holds the steroid hormone receptor in an active state and/or enhances the binding interaction between an activated steroid hormone receptor and its complimentary response element. Examples of steroid hormone receptor activators according to the present invention include, without limitation, the erythroblast transformation-specific transcription factor ERG; p160 coactivators inclusive of steroid receptor coactivators, SRC-1, SRC-2, SRC-3; Vav3 a Rho GTPase guanine nucleotide exchange factor; E2F1; ATAD2; CBP/p300; Leupaxin; FHL2; the ARA family of proteins; GRIP1; BRAC1; and Zac1. The skilled person will recognise that certain cell types will express certain subtypes of steroid hormone receptor activators, and that these cells may be genetically altered to increase endogenous expression of coactivators or altered to express different types of coactivators depending on the intended utility. The same is also true for receptor type(s).
The term “ligand” refers generally to any molecule that binds to a receptor, and includes without limitation, a steroid, a polypeptide, a protein, a vitamin, a carbohydrate, a glycoprotein, a therapeutic agent, a drug, a glycosaminoglycan, or any combination thereof. As used herein, “ligand” includes, without limitation, steroid hormones, such as sex hormones including but not limited to estrogens, progestagens, androgens etc, as well as natural and synthetic derivatives and analogs and metabolites thereof, designer steroid hormones, anabolic androgenic steroids, and selective androgen-, progestagen- and estrogen receptor modulators, those that are currently known and those anticipated to be developed or naturally found in biological samples. The term “receptor-ligand complex” and “activated steroid hormone receptor” as used interchangeably herein to refer to a ligand bound steroid hormone receptor, where the steroid hormone receptor undergoes a structural transformation upon binding the ligand and is then said to be in an activated form. A receptor-ligand complex as described herein includes, without limitation, a dimer of a ligand bound hormone receptor (i.e. (HR-L)2.
The term “AAS” as used herein refers to an anabolic androgenic steroid. These compounds are capable of binding to an androgen receptor to form an activated androgen receptor-ligand complex.
The term “SARM” as used herein refers to selective androgen receptor modulator. These compounds are also capable of binding to an androgen receptor to form an activated androgen receptor-ligand complex.
The term “EtOH” as used herein refers to ethanol, and is widely used as a vehicle control in various experiments described herein.
The term “genomic response” as used herein refers to the ability of an activated steroid hormone receptor (or receptor-ligand complex) to selectively bind to its corresponding nucleic acid response element and activate or repress transcription of downstream genes. In the cellular environment, the ligand-bound receptor binds to the nucleic acid response element and switches genes on or off in response to the external stimuli (i.e. presence of a ligand).
The test kits, assays and methods according to the present invention have been developed to identify ligands which, in a cellular environment, would elicit a steroid hormone genomic response by providing reporter based frameworks which mimic aspects of cell based systems.
The term “steroid metabolism machinery” as used herein refers to any enzyme, and includes combinations of enzyme, sufficient to convert a ligand from a physiologically inactive form to a physiologically active form or from a physiologically active form to a more physiologically active form, or from a physiologically active form to a less physiologically active form, or from a physiologically active form to a physiologically inactive form.
The term “detection means” as used herein refers to any apparatus, equipment or configuration adapted to detect the binding interaction between an activated steroid hormone receptor and nucleic acid response element. Examples of detection means include, but are not limited to, optical methods, spectroscopy, visible spectroscopy, Raman spectroscopy, UV spectroscopy, surface plasmon resonance, electrochemical methods, impedance, resistance, capacitance, mechanical sensing by changes in mass, changes in mechanical resonance, electrophoresis, gel electrophoresis, gel retardation, imaging, fluorescence and fluorescence resonance energy transfer, polymerase chain reaction etc.
The term “nucleic acid sequence” as used herein refers to a deoxyribonucleic acid (DNA) sequence, a ribonucleic acid sequence (RNA), messenger ribonucleic acid (mRNA) and complementary DNA (cDNA), and is comprised of a continuous sequence of two or more nucleotides, also referred to as a polynucleotide or oligonucleotide. The nucleic acid sequence may be single-stranded or double-stranded.
The term “reporter construct” as used herein refers to a nucleic acid sequence encoding a reporter molecule that encodes an RNA whose expression may be assayed; such RNA includes, but are not limited to, fluorophore binding aptamers, or synthetic RNA or mRNA, Additionally, reporter genes may encompass any gene of interest whose expression product may be detected by RNA analysis.
The term “promoter” as used herein is a nucleic acid sequence located proximal to the start of transcription at the 5′ end of an operably linked transcribed sequence. The promoter may contain one or more regulatory elements which interact in modulating transcription of an operably linked gene. Examples of promoters according to the present invention include, but are not limited to, T7, T3 and SP6 bacteriophage promoters or initiation sequences. The terms “promoter”, “promoter sequence”, “initiator sequence” or “initiation sequence” may be used interchangeably throughout this specification to mean the same thing.
The term “T7” or “T7 polymerase” as used herein refers to the T7 RNA polymerase enzyme.
The term “operably linked” as used herein describes two macromolecular elements arranged such that modulating the activity of the first element induces an effect on the second element. In this manner, modulation of the activity of a promoter element may be used to alter and/or regulate the expression of an operably-linked reporter construct. For example, the transcription of a reporter construct that is operably-linked to a promoter element is induced by factors that “activate” the promoter's activity; transcription of a reporter construct that is operably-linked to a promoter element is inhibited by factors that “block” the promoter's activity. Thus, a promoter region is operably-linked to the reporter construct if transcription of such a reporter construct is influenced by the activity of the promoter.
The term “expression” as used herein refers to the process by which the information encoded within a gene is expressed. If the gene encodes a protein, expression involves both transcription of the DNA into mRNA, the processing of the mRNA (if necessary) into a mature mRNA product, and translation of the mature mRNA into protein. A nucleic acid molecule, such as a deoxyribonucleic acid (DNA) or gene is said to be “capable of expressing” a polypeptide (or protein) if the molecule contains the coding sequences for the polypeptide and the expression control sequences which, in the appropriate host environment, provide the ability to transcribe, process and translate the genetic information contained in the DNA into a protein product, and if such expression control sequences are operably-linked to the nucleotide sequence that encodes the polypeptide.
The term “sample” as used herein refers to any sample for which it is desired to test for the presence of a ligand. The terms “sample” and “test sample” are used interchangeably in this specification.
The term “relative potency” or “RP” as used herein refers to the multiplier of biological activity exhibited by a test compound relative to a reference compound, where the biological activity is defined by the ability of the compound to bind to and activate a steroid hormone receptor (e.g.) as measured using the assays and test kits described herein. Where Relative Potency is >1, the test compound is more potent in terms of its biological activity as compared to the reference compound; where Relative Potency is <1, the test compound is less potent in terms of its biological activity as compared to the reference compound; and where Relative Potency=1, the test and reference compounds are equally potent in terms of their biological activities.
The term “activation factor” or “AF” as used herein relates to the measure of metabolic conversion of a test compound (e.g.) from a physiologically inactive state to a physiologically active state or from a less physiologically active state to a more physiologically active state. An activation factor >1 means that the test compound has undergone metabolic conversion to a more physiologically active state in the presence of metabolic machinery in the assay.
The term “reference threshold” or “reference standard” may be used interchangeably to means the level of assay activity measured (e.g.) in the absence of a test sample, or in the absence of test sample and steroid hormone receptor. In certain examples according to the inventions described herein, the reference threshold or reference standard is determined using ethanol in place of test sample. The reference threshold is intended to establish any baseline activity or signal of the assay in the absence of target ligand.
The present invention provides test kits, assays and methods useful for screening a sample for the presence of a ligand capable of activating a steroid hormone receptor and eliciting a steroid hormone genomic response.
In certain examples according to the present invention, the test kits, assays and methods described herein are useful for determining the hormone status of a human or animal subject, for example, by measuring the androgenic and/or estrogenic activity of a sample obtained from the subject. This information may then be used to determine, for example, whether the subject has, or is at risk for developing, cancer, or for investigating endocrine issues or for monitoring a changing steroid hormone profile associated with ageing such as, for example, menopause, or for evaluating the efficacy of hormone replacement therapy or hormone inhibitory therapy.
In other examples according to the present invention, the test kits, assays and methods described herein are useful for screening foods and health food supplements for banned additives or for natural activators that could be harmful to health including, but not limited to, phytoestrogens or xenoandrogens or xenoestrogens that could promote hormone sensitive cancers.
The assays according to the present invention, on which the test kits and methods described herein are based, are fundamentally activity based assays which work on the principle of steroid hormone receptor activation through binding of a ligand derived from a sample under interrogation. Activation of a steroid hormone receptor occurs when a ligand binds to the receptor and induces a conformational change in the tertiary structure of the receptor protein, meaning that the receptor-ligand complex (also referred to herein as an ‘activated steroid hormone receptor’) is then able to bind to a nucleic acid response element and influence RNA polymerases and elicit a so-called ‘genomic response’. In other words the ability to up- or down-regulate expression of genes from the genome of the cell which may then lead to a physiological effect. It is this binding interaction between the activated steroid hormone receptor and nucleic acid response element that is measured in a reconstituted in vitro system by the test kits, assays and methods described herein, as a proxy to detect the presence of a ligand having steroid-, or steroid-like activity in a sample under investigation.
Importantly, this means the test kits and assays according to the present invention have the ability to detect steroid hormone bio/activity elicited by ligands of unknown structure such as (e.g.) ‘designer drugs’. Historically, this has not been possible since conventional laboratory testing equipment, such as gas/liquid chromatography and mass spectrometry, requires prior knowledge of the structure of the molecule being investigated.
To address limitations associated with prior art assays as previously described, Applicants have developed various generations of in vitro cellular-free bioactivity assays involving enzyme- or fluorescence-mediated reporter read-outs. These assays mimic biological systems by assembling, in vitro, essential components of in vivo hormone signalling to facilitate detection of a target ligand. The essential assay components include, for example, a steroid hormone receptor, steroid hormone receptor coregulator(s) and a reporter construct which includes a specific DNA binding motif which is only bound/activated in the presence of a target ligand.
For example, PCT/NZ2018/050158 describes enzyme-based transcription and/or translation assays involving RNA polymerase II. However, an inherent limitation associated with these assays is the requirement to provide cell extracts derived from (e.g.) mammalian or yeast origin as a source of both enzyme and coregulator(s) necessary to drive transcription or translation of a reporter gene.
The Applicant's next generation assays described in PCT/NZ2020/050046 removed the requirement for cell-derived extracts by employing single subunit polymerases in the reaction mix. For example, T7 RNA polymerase, which unlike RNA polymerase II could be produced recombinantly. As a consequence, the reduced level of molecular complexity meant assay specificity/sensitivity was significantly enhanced because molecular stoichiometries between essential assay components could be precisely controlled.
Notwithstanding the advantages associated with reduced molecular complexity, a limitation of the assays described in PCT/NZ2020/050046 is the requirement to provide purified steroid hormone receptor.
Recombinant steroid hormone receptor protein is expensive to produce in quantities required for scale-up production. It is also difficult to handle due to cold temperature storage requirements, and its large size renders it susceptible to degradation. By way of illustration only, androgen receptor (AR) protein is a large protein of ˜110 kDa. Expression by genetically modified yeast, insect, bacteria or mammalian host cells requires complex purification techniques to purify the steroid hormone receptor from other cellular proteins, which is made more difficult so as to ensure full-length and active protein is recovered. More often than not, expression and purification of steroid hormone receptors is performed in the presence of ligand to enhance protein stability during the laborious manipulations. Accordingly, there is substantial cost to the purchase, or production, of recombinant steroid hormone receptor protein and it may be that ligand is present in the steroid hormone receptor added to the reaction which would lead to inflated hormone levels reported, or indeed a false positive (if testing of an athlete sample).
The present invention, in part, seeks to address these limitations by providing test kits, assays and methods involving a cell lysate derived from naturally occurring cell lines which express certain steroid hormone receptor(s) and/or cell-specific coregulator(s) (e.g. LnCaP cells which express androgen receptors; HeLa cells which express estrogen receptor alpha and estrogen receptor beta) or modified cell lines which have been genetically altered to express steroid hormone receptor protein(s) and/or coregulator(s) of interest, depending on the intended utility. The use of steroid hormone receptor lysates markedly decreases the potential cost of the screening assays because there is no need for extensive and expensive purification steps.
By way of illustration only, the prototype assays used in the experiments referred to immediately below involve T7 polymerase, the activity of which is reduced or inhibited, rather than activated, by ligands that bind to an androgen receptor.
In reference to Example 7, read in conjunction with
These data show that each of the AR cell lysates tested adequately suppressed T7 RNA polymerase activity in the presence of testosterone, a ligand widely known to bind to and activate androgen receptor.
To explore inter-variability in batch production, various in-house AR lysates were then produced from human embryonic kidney cells (e.g. HEK293; refer to Example 8) which had been stably transformed with a human AR expression plasmid. These data are also presented in Example 7, read in conjunction with
With reference to Example 10 and
The data presented in
An inherent risk in using a cell lysate as a source of steroid hormone receptor versus a recombinant source of receptor protein is the potential for cross-receptor activation of the hormone response element which is located within the reporter construct. For example, activated glucocorticoid receptor (GR) found within a cell lysate has the potential to bind to and activate an androgen response element within a reporter construct leading to a false positive result for detection of an androgenic ligand. However, the data presented in Example 7, read in conjunction with
Another potential confounder in the androgen screening assay is estradiol (E2). At non-physiological concentrations, E2 can activate androgen receptor, although standard cell culture conditions should not produce levels of E2 or any other estrogen sufficient for cross-activation. Indeed, the data presented in Example 7, also read in conjunction with
Finally, the remaining data presented in Example 7, read in conjunction with
There are numerous advantages to using a cell lysate as a source of steroid hormone receptor protein. In addition to reduced manufacturing costs, the use of cell lysates as a source of steroid hormone receptor protein means a wide variety of host cells may be genetically modified to express different steroid hormone receptor isotypes or variants, depending on the steroid hormone biology under interrogation. For example, by producing cell lysates inclusive of steroid hormone receptor protein which has a superior affinity for its complimentary response element or steroid hormone receptor protein which has superior affinity for its ligand. Accordingly, use of the cell lysates in the test kits and assay methods described could have far reaching clinical application(s) in addition to (e.g.) sports doping utility.
Host cells may also be genetically modified to co-express multiple steroid hormone receptors (e.g. androgen receptor and estrogen receptor) or to co-express desired coregulator proteins which, when present in the cell lysate, advantageously help optimise performance of the test kits and assay methods described herein.
Further, all cell lysates will contain steroid hormone coregulator proteins. In the case of (e.g.) androgen receptor, there are over 30 different coregulator proteins. It has been established in the literature that a subset of these coregulator proteins are ‘core’ and expressed in all cell types. However, another subset of coregulator proteins are specific to cell type. Accordingly, the present invention further contemplates the genetic manipulation of certain cell types to over-express both receptor and coregulator proteins.
While the various experiments referred to above involve validation of a cell lysate approach using an androgen screening assay, the skilled person would appreciate that these principles would apply equally to detection of other steroid hormone ligands, provided a complementary assay framework was established. For example, for the detection of estrogenic ligands, a similar screening assay involving an ER cell lysate (e.g. obtained from a cell transformed with an ER expression plasmid), in combination with a reporter construct comprising an estrogen response element that would only be bound/activated by (e.g.) an E2-estrogen receptor complex.
As evidenced by the data presented in
Another advantage conferred by the cell lysate screening assays is the ability to select variant/designer steroid hormone receptors for recombinant expression by host cells. In turn this allows wider application of the test kits, assays and methods described herein to steroid hormone biology, and commercial applications therein.
The cell lysate can be prepared from transient or stable expression of a steroid hormone receptor expression plasmid, which will allow the use of a particular receptor in the screening assay that has, for example, as stronger binding affinity for a target ligand. Alternatively, (e.g) in the case of androgen receptor, the receptor could be modified such that it represents androgen insensitivity syndrome, or partial androgen insensitivity syndrome, allowing for a genetic screen to be established.
The cell lysate can be prepared from transient or stable expression of a species-specific steroid hormone receptor expression plasmid, which will allow the expression of for e.g. equine androgen receptor expressed in equine cells. Alternatively, canine androgen receptor expressed in canine cells. This could be of particular use for animal diagnostic applications and/or the detection of designer steroids in animal athlete biological samples.
Another advantage conferred by the cell lysate approach is the ability to prepare co-transformed cells that, for e.g., express steroid hormone receptor and one or more steroid hormone receptor coregulators, such as (e.g.) HSP90 and/or ERG. As established herein, these cofactor proteins help modulate steroid hormone receptor behavior in the various screening assays described herein.
Accordingly, in an aspect of the present invention there is provided a test kit for screening a sample for the presence of a ligand capable of eliciting a steroid hormone genomic response, the test kit comprising:
In an example according to this aspect of the present invention, the cell lysate further comprises at least one coregulator protein which includes, by definition, at least one coactivator protein and/or at least one corepressor protein as defined herein.
Applicants also interrogated to what extent the distance between the T7 promoter recognition sequence and the androgen response element influenced assay performance.
Further interrogation of optimal spacer length is presented in Example 11 read in conjunction with
The data presented in
Accordingly, in an example according to these and other aspects of the present invention, the nucleic acid molecule further comprises a spacer (e) located between the polymerase promoter sequence (a) and the response element (b).
While the data referred to above is true in context of the androgen screening assay described herein, it is possible that screening assays involving a binding interaction between an activated steroid hormone receptor-ligand complex and its response element may differ.
Accordingly, Applicants demonstrate that the spacer may comprise a nucleic acid (i.e. DNA) sequence that is between about 2 nucleotides and about 32 nucleotides in length. For any avoidance of doubt the term “between about 2 nucleotides and about 32 nucleotides in length” is intended to mean 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 and 32 nucleotides in length. A person skilled in the art will appreciate the term “about” in the context of “between about 2 nucleotides and about 32 nucleotides in length” does not exclude a spacer length that is (e.g.) 33, 34 or 35 or more nucleotides in length. The data presented in Example 11 teaches the skilled person how to determine the optimal spacer length for any given reporter construct defined herein, without the requirement for undue experimentation or further inventiveness.
In a related example, the spacer is 2 nucleotides in length.
In a further related example, the spacer is 15 nucleotides in length.
In another related example, the spacer is 27 nucleotides in length.
It is important to note that the role of the spacer is a physical barrier between the RNA polymerase promoter sequence and the steroid hormone response element, such that T7 RNA polymerase is impeded at the crucial structural reorganizational step whereby RNA polymerase transitions from the initiation (binding) step to the elongation step. T7 RNA polymerase enters the highly processive elongation step after the nascent RNA is between 8-12 nucleotides in length. It is optimal to have the spacer length such that it is short enough to not allow T7 RNA polymerase to achieve full transitioning to elongation but large enough to allow two large proteins (T7 RNAP and the SHR) to bind to the template DNA and allow the bound SHR to sterically hinder active T7 RNAP or to have the spacer length such that is short enough to not allow T7 RNA polymerase to bind to its promoter sequence. This is achieved by ensuring the reaction mix is made in an ordered way such that the AR/HSP90 and DNA template and sample are added prior to T7 RNA polymerase. This temporal separation of AR to T7 RNA polymerase allows AR to first bind the DNA template and thereby block T7 RNA polymerase access to its binding site.
Further, the sequence composition of the spacer is inconsequential to its function and may contain any natural or non-naturally occurring nucleotides known in the art.
It would be considered routine optimisation, based on the teaching provided herein, for the skilled person to determine the optimal spacer length based on a particular construct/assay architecture (e.g. if the assay was configured to employ a T3 polymerase which binds to a T3 promoter sequence).
In another example according to these and other aspects of the present invention, the test kit further comprises ribonucleotide triphosphates (NTPs).
In yet another example according to these and other aspects of the present invention, the test kit further comprises instructions for how to determine the presence of ligand in the sample which is capable of eliciting a steroid hormone genomic response.
Also contemplated by the present invention is methods for the detection of steroid hormone ligands by measuring a reduction or inhibition in transcription using the test kit framework/s described above.
Accordingly, in yet another aspect of the present invention there is provided an assay method for detecting a ligand in a sample which ligand is capable of eliciting a steroid hormone genomic response, the assay method comprising the steps of:
Again, in an example according to this aspect of the present invention, the cell lysate further comprises at least one coregulator protein which includes, by definition, at least one coactivator protein and/or at least one corepressor protein as defined herein.
The use of a cell lysate as a source of steroid hormone receptor, as opposed to (e.g.) purified/recombinant steroid hormone receptor means that the absolute concentration of receptor in the reaction mix is not known. However, an optimal cell lysate concentration may be empirically derived. For example, with reference to Example 7 read in conjunction with
Accordingly, in a further example according to the test kits, assays and methods described herein, the concentration of steroid hormone receptor is between about 1.0 ng/μL and about 300 ng/μL, in particular between about 5 ng/μL and about 200 ng/μL, in particular between about 6.25 ng/μL and about 150 ng/μL, in particular between about 10 ng/μL and about 100 ng/μL, in particular between about 20 ng/μL and about 80 ng/μL, in particular between about 30 ng/μL and about 70 ng/μL, in particular between about 30 ng/μL and about 60 ng/μL, in particular between about 30 ng/μL and about 50 ng/μL, in particular about 40 ng/μL.
The skilled person would appreciate that the term “between about 10 ng/μL and about 100 ng/μL” includes, without limitation, about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 and about 100 ng/μL, and includes by definition the terms “between about 20 ng/μL and about 80 ng/μL”, “between about 30 ng/μL and about 70 ng/μL”, “between about 30 ng/μL and about 60 ng/μL”, and “between about 30 ng/μL and about 50 ng/μL”.
Accordingly, in yet another example according to the test kits and assay methods described herein:
Notwithstanding the above considerations, care must be taken not to saturate the assay with too much receptor, since this in itself may create thermodynamic or kinetic barriers that prevent optimal binding of a ligand-receptor complex to its complimentary response element. According to the disclosure provided herein, the skilled person could undertake routine experimentation to titrate an optimized concentration/range of cell lysate comprising steroid hormone receptor for performance of the test kits and assay methods described herein (e.g. refer to Example 7 which follows).
As previously mentioned, Applicants have further determined that the steroid hormone receptor retains some capacity to bind to and activate its corresponding nucleic acid response element in the absence of a ligand specific for its steroid hormone receptor. This phenomena is sometimes referred to as auto-activation of the nucleic acid response element. Accordingly, it may be desirable to determine a reference threshold (i.e. baseline signal as a result of auto-activation of the response element) in the absence of ligand to assist with a determination of absolute assay signal/readout in the presence of a sample containing a target ligand.
Accordingly, in another example according to the test kits and assay methods described herein, the reduction or inhibition in transcription of the reporter construct is measured relative to a reference threshold.
In yet another example according to the test kits and assay methods described herein, reduction or inhibition in transcription of the reporter construct is measured relative to a reference threshold as determined by measuring transcription of the reporter construct in the absence of a test sample.
In yet a further example according to the test kits and assay methods described herein, reduction or inhibition in transcription of the reporter construct is measured relative to a reference threshold as determined by measuring transcription of the reporter construct in the absence of a test sample and in the absence of receptor.
In a parallel approach to enhance assay specificity and performance, the test kit and assay methods described herein may be modified to include at least one steroid hormone receptor coregulator protein or molecule. The coregulator protein or molecule may be provided by the cell lysate per se, or it may be included as a separate integer of the kit (e.g.) a protein or molecule that has been produced using recombinant expression and/or purified, and packaged separately within the kit.
The primary purpose of the coregulator protein or molecule is to either (i) hold the steroid hormone receptor in an inactive conformation, thereby preventing it from binding to and activating the hormone response element in the absence of a target ligand (i.e. through activity of at least one steroid hormone receptor corepressor) or (ii) hold the steroid hormone receptor in an active state and/or enhance the binding interaction between an activated steroid hormone receptor and its complimentary response element (i.e. through activity of at least one steroid hormone receptor coactivator).
Accordingly, in an example according to these and other aspects of the present invention, the steroid hormone receptor coregulator comprises a steroid hormone receptor corepressor. In a related example, the steroid hormone receptor corepressor comprises at least one of heat shock protein 90 (HSP90); a complex of HSP90 and heat shock protein 70 (HSP70); a complex of HSP90, HSP70 and heat shock protein 40 (HSP40); a complex of HSP90, HSP70, HSP40 and p23; a complex of HSP90, HSP70, HSP40, p23 and heat shock protein organizing protein (Hop); a complex of HSP90, HSP70, HSP40, p23, Hop and 48 kD Hip protein (Hip); a complex of HSP90, HSP70, HSP40, p23, Hop, Hip and p60; a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, p60 and FKBP52; and any combination thereof.
When the test kit is contacted with a test sample, the presence of a ligand causes displacement of the corepressor and the ligand-bound receptor is then free to form a complex with a second ligand-bound receptor and bind its complementary hormone response element. The latter may be stabilised by activity of the coactivator protein or molecule.
Accordingly, in another example according to these and other aspects of the present invention, the steroid hormone receptor coregulator comprises a steroid hormone receptor activator. In a related example, the steroid hormone receptor activator comprises at least one of erythroblast transformation-specific transcription factor ERG; p160 coactivators inclusive of steroid receptor coactivators, SRC-1, SRC-2, SRC-3; Vav3 a Rho GTPase guanine nucleotide exchange factor; E2F1; ATAD2; CBP/p300; Leupaxin; FHL2; the ARA family of proteins; the prostate-cell specific coactivators including GRIP1, BRAC1 and Zac1.
Indeed, the effect of the erythroblast transformation-specific transcription factor ERG is well documented by the data presented in
In this experiment, a molar ratio of 1:1 ERG:AR was used, or expressed as a ratio of protein concentration: 25 ng AR: 12.5 ng ETS, with 50 ng HSP90.
Applicants then titrated the amount of ERG in the reaction mix, and these data are presented in
In respect of the class II steroid hormone receptors (i.e. including androgen receptor, progesterone A receptor, progesterone B receptor, mineralocorticoid receptor and glucocorticoid receptor), it is thought that the major coactivator protein holding the steroid hormone receptor-ligand complex in an activated state is erythroblast transformation-specific transcription factor ERG.
Conversely, in respect of the class I steroid hormone receptors (i.e. including estrogen receptor alpha and estrogen receptor beta), it is thought that the major coactivator protein holding the steroid hormone receptor-ligand complex in an activated state is the steroid receptor coactivators, including (e.g.) SRC-1, SRC-2 and/or SRC-3.
It follows that the specificity of the test kits and assays described herein may be enhanced by including at least one steroid hormone receptor corepressor and at least one steroid hormone receptor coactivator. In a related example, the test kits and assays described herein comprise at least one of (i) heat shock protein 90 (HSP90); a complex of HSP90 and heat shock protein 70 (HSP70); a complex of HSP90, HSP70 and heat shock protein 40 (HSP40); a complex of HSP90, HSP70, HSP40 and p23; a complex of HSP90, HSP70, HSP40, p23 and heat shock protein organizing protein (Hop); a complex of HSP90, HSP70, HSP40, p23, Hop and 48 kD Hip protein (Hip); a complex of HSP90, HSP70, HSP40, p23, Hop, Hip and p60; a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, p60 and FKBP52; and any combination thereof, in combination with (ii) at least one of erythroblast transformation-specific transcription factor ERG or at least one steroid receptor coactivator, including but not limited to SRC-1, SRC-2 and/or SRC-3.
It will, however, be appreciated by a person skilled in the art that the presence of at least one steroid hormone regulator protein or molecule is not an essential feature of the test kits, assays and methods described herein. This is because an assay result may still be achieved in the absence of one or both of a corepressor protein or molecule or a coactivator protein or molecule. Hence use of the term “optionally” to define the test kits and assay methods described and claimed herein.
As such, in another aspect of the present invention there is provided a test kit for screening a sample for the presence of a ligand capable of eliciting a steroid hormone genomic response, the test kit comprising:
A person skilled in the art will appreciate that RNA polymerase, including a T7 RNA polymerase, is optionally present in the test kits described herein because it is entirely possible for the enzyme to be sourced externally (e.g. from a laboratory freezer stock).
In an example according to these and other aspects of the present invention, the test kits further comprise nucleotide triphosphates (NTPs).
Also contemplated by the present invention is methods for the detection of steroid hormone ligands by measuring a reduction or inhibition in transcription using the frameworks described above and defined elsewhere in this specification.
It will, however, be appreciated by a person skilled in the art that the presence of at least one steroid hormone receptor coregulator (e.g. a coactivator and/or a corepressor) is not an essential feature of the test kits, assays and methods described herein. This is because an assay result may still be achieved in the absence of coregulator. For example, the data presented in Example 1/
Indeed, there are further approaches in which to minimise the amount of signal generated by auto-activation of the hormone response element by non-liganded receptor, for example, by modifying the temperature at which an assay method is performed.
Applicants have observed a differential in the binding affinty/kinetics between ligand bound and non-ligand bound steroid hormone receptor for its nucleic acid response element. Accordingly, the test kits, assays and methods described herein may be performed at a temperature, or in a temperature range, that preferentially measures activation of a hormone response element by ligand-bound receptor over non-ligand bound receptor, thereby minimising any background signal generated by non-ligand bound receptor.
Accordingly, in yet another example according to this aspect of the present invention, performance of the test kit or assay method is carried out in a temperature range from about 25° C. to about 60° C., and preferably from about 35° C. to about 37° C.
The term “a temperature range from about 25° C. to about 60° C.” is intended to include any temperature from 25° C. to 42° C. and without limitation includes 25° C., 26° C., 27° C., 28° C., 29° C., 30° C., 31° C., 32° C., 33° C., 34° C., 35° C., 36° C., 37° C., 38° C., 39° C., 40° C., 41° C., 42° C., 43° C., 44° C., 45° C., 46° C., 47° C., 48° C., 49° C., 50° C., 51° C., 52° C., 53° C., 54° C., 55° C., 56° C., 57° C., 58° C., 59° C. and 60° C. The skilled person would recognise that temperatures in the decimal point range may also be used. To further illustrate this point, “in a temperature range from about 35° C. to about 37° C.” includes, without limitation, 35.0° C., 35.1° C., 35.2° C., 35.3° C., 35.4° C., 35.5° C., 35.6° C., 35.7° C., 35.8° C., 35.9° C., 36.0° C., 36.1° C., 36.2° C., 36.3° C., 36.4° C., 36.5° C., 36.6° C., 36.7° C., 36.8° C., 36.9° C. and 37.0° C.
The Applicants further discovered that the stoichiometric relationship between the coregulator and steroid hormone receptor may be manipulated to further enhance assay sensitivity. For example, according to the Androgen Assay Prototype 2 described in Example 2, it was determined by the Applicants that AR is most effective at being activated by an AR-specific ligand and binding to ARE when the HSP90:AR ratio is between 1.22 and 4.88.
As previously discussed, in the cell lysate assays described herein, the absolute concentration of receptor remains unknown. However, according to the data presented in Example 7, an optimal HSP90:AR ratio of ˜2:1 was empirically derived based on a AR cell lysate concentration of >30 ng/μL. Refer to
Accordingly, in a further example according to the test kits and assay methods described herein, the ratio of HSP90 to steroid hormone receptor is defined as between about 1:1 to about 5:1. This includes, without limitation, a ratio of HSP90 to steroid hormone receptor that is defined as 1.0:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5;1, 1.6:1, 1.7:1, 1.8:1, 1.9:1, 2.0:1, 2.1:1, 2.2:1, 2.3:1, 2.4:1, 2.5;1, 2.6:1, 2.7:1, 2.8:1, 2.9:1, 3.0:1, 3.1:1, 3.2:1, 3.3:1, 3.4:1, 3.5;1, 3.6:1, 3.7:1, 3.8:1, 3.9:1, 4.0:1, 4.1:1, 4.2:1, 4.3:1, 4.4:1, 4.5;1, 4.6:1, 4.7:1, 4.8:1, 4.9:1 or 5.0:1.
The skilled person would, however, appreciate that the molecular stoichiometry between the at least one steroid hormone receptor coregulator and steroid hormone receptor may vary depending on the composition of the test kit/assay. For example, the test kit/assay may be configured to detect ligands which bind to an estrogen receptor, including estrogen receptor alpha or estrogen receptor beta, and the ratio between the estrogen receptor coregulator and estrogen receptor may be (e.g.) between about 1:1 and about 20:1.
Accordingly, in yet another example according to the test kits and assay methods described herein:
The information in Table 9 of Example 4 summarises key considerations related to the molecular stoichiometry argument when considering the composition of the test kits and assay methods described herein, which is supported by the data accompanying Examples 1-3, in particular.
An assay reaction mix according to the present invention will typically contain between 10 μL and 50 μL total volume. According to the information summarised in Table 9, this means:
A further consideration is the concentration/amount of enzyme, where optimal assay results were achieved when −50-100 enzyme units (U) were employed in the reaction mixes assuming an absolute baseline threshold activity of about 200,000 U (when RNA aptamer Mango II is the readout by example). Refer to
In yet another example according to the test kits and assay methods described herein, the reduction or inhibition in transcription is a reduction or inhibition in transcription mediated by a single polypeptide polymerase selected from a bacteriophage RNA polymerase, a virus RNA polymerase, a bacterial RNA polymerase, and a eukaryotic virus RNA polymerase.
In a related example, the polymerase is a bacteriophage RNA polymerase. In a further related example, the promoter sequence is a bacteriophage RNA polymerase initiation sequence.
In yet another example according to the test kits and assay methods described herein, the polymerase is a bacteriophage polymerase selected from the group consisting of DNA-dependent RNA polymerases including T7 RNA polymerase, T3 RNA polymerase and SP6 RNA polymerase.
In another example according to the test kits and assay methods described herein, the bacteriophage polymerase is T7 RNA polymerase.
In an example according to this aspect of the present invention, the test kit further comprises nucleotide triphosphates (NTPs).
In another example according to the test kits and assay methods described herein, the promoter sequence is a T7 RNA polymerase initiation sequence.
In a related example, the T7 RNA polymerase initiation sequence comprises a sequence defined by 5′-TAATACGACTCACTATAG-3′ (SEQ ID NO: 82).
Applicants next investigated the T7 promoter architecture in an attempt to further optimize the sensitivity of the steroid hormone screnning assays.
The literature describes various T7 promoter (or initiation) sequences wherein alterations in the nucleotide composition yield increased T7 activity. For example the wild-type T7 promoter sequence defined by 5′-TAATACGACTCACTATAGGGAGA-3′ (SEQ ID NO: 83) has been modified at its 3′ end to yield 5′-TAATACGACTCACAATCGCGGAG-3′ (SEQ ID NO: 84). This variant promoter reportedly facilitates a ˜2-fold increase in T7 activity. Indeed, this was confirmed by the T7 screening assay experiments described in Example 9 and read in conjunction with
Accordingly, in a related example, the T7 RNA polymerase initiation sequence comprises a sequence defined by 5′-TAATACGACTCACAATCGCGGAG-3′ (SEQ ID NO: 84).
However, Applicants discovered that a modified form of the T7 promoter, containing both 3′ and 5′ modifications and having a sequence defined by 5′-GGAGGCCGGAGAATTGTAATACGACTCACTATAGGGAGACGCGTGT-3′ (SEQ ID NO: 85) yielded superior performance in terms of enhanced sensitivity of the T7 screening assay for detection of androgenic ligands. Refer to Example 9, read in conjunction with
As such, in a related example, the T7 RNA polymerase initiation sequence comprises a sequence defined by 5′-GGAGGCCGGAGAATTGTAATACGACTCACTATAGGGAGACGCGTGT-3′ (SEQ ID NO: 85).
The data presented in
Importantly, the T7 promoter/initiation sequence defined by SEQ ID NO: 85 did not affect performance of the screening assay in terms of cross-activation by E2 or dexamethasone. This observation held true whether a recombinant form of androgen receptor was used (i.e.
Accordingly, in another aspect of the present invention there is provided a test kit for screening a sample for the presence of a ligand capable of eliciting a steroid hormone genomic response, the test kit comprising:
In an example according to this aspect of the present invention, the test kit further comprises nucleotide triphosphates (NTPs).
Also contemplated by the present invention is methods for the detection of steroid hormone ligands by measuring a reduction or inhibition in transcription using the framework described above.
Accordingly, in yet another aspect of the present invention there is provided an assay method for detecting a ligand in a sample which ligand is capable of eliciting a steroid hormone genomic response, the assay method comprising the steps of:
While not an essential feature of the screening assays described herein, the inclusion of the steroid hormone coregulators as defined herein is further contemplated for these and other aspects of the present invention.
Accordingly, in yet another aspect of the present invention there is provided a test kit for screening a sample for the presence of a ligand capable of eliciting a steroid hormone genomic response, the test kit comprising:
In an example according to this aspect of the present invention, the test kit further comprises nucleotide triphosphates (NTPs).
Also contemplated by the present invention is methods for the detection of steroid hormone ligands by measuring a reduction or inhibition in transcription using the framework described above and defined elsewhere in this specification.
In a further example according to the test kits and assay methods described herein, the bacteriophage polymerase is T3 RNA polymerase and the promoter sequence is a T3 RNA polymerase initiation sequence.
In a related example, the T3 RNA polymerase initiation sequence comprises a sequence defined by 5′-AATTAACCCTCACTAAAG-3′ (SEQ ID NO: 2).
In yet a further example according to the test kits and assay methods described herein, the bacteriophage polymerase is SP6 RNA polymerase and the promoter sequence is a SP6 RNA polymerase initiation sequence.
In a related example, the SP6 RNA polymerase initiation sequence comprises a sequence defined by 5′-ATTTAGGTGACACTATAG-3′ (SEQ ID NO: 3).
In yet another example according to the test kits and assay methods described herein, the reporter construct comprises a sequence encoding an RNA aptamer that when transcribed to form an RNA aptamer is capable of binding to a fluorophore thereby generating a fluorescence signal.
In a related example, the RNA aptamer is further supported by an RNA scaffold which promotes secondary structure formation of the RNA aptamer, thereby optimizing the binding interaction with its fluorophore(s). In a further related example, the RNA scaffold includes, but is not limited to, F30.
In another example, the RNA aptamer is Mango including, but not limited to, Mango I, Mango II, Mango III and Mango IV. In a related example, the fluorophore which binds to the Mango RNA aptamer thereby generating a fluorescent signal is a derivative of thiazole orange (TO).
In another example, the RNA aptamer is selected from Spinach, iSpinach, baby Spinach and Broccoli. In a related example, the fluorophore which binds to the iSpinach, Spinach or Broccoli RNA aptamer thereby generating a fluorescent signal is 3,5-difluoro-4-hydroxybenzylidene imidazolinone (DFHBI).
In another example, the RNA aptamer is Malachite Green. In a related example, the fluorophore which binds to the Malachite Green RNA aptamer thereby generating a fluorescent signal is malachite green.
In a further example according to the test kits and assay methods described herein, the reporter construct comprises a single sequence copy of the RNA aptamer, or multiple sequence copies of the RNA aptamer. The term “multiple sequence copies” is intended to mean, without limitation, two, three, four, five, six, seven, eight, nine, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or more copies of the sequence encoding the RNA aptamer. A person skilled in the art will recognize that the copy number of RNA aptamer sequences will be governed by the optimal signal to noise ratio, as determined by routine assay optimization.
In other examples according to the test kits and assay methods described herein, the reporter construct is selected from the group consisting of a gene that does or does not encode a protein or polypeptide that can be detected by RNA analysis.
As such, the test kits and assay methods described herein may be configured to detect transcript levels of a reporter construct by investigating, for example, messenger ribonucleic acid (mRNA) or complementary deoxyribose nucleic acid (cDNA) levels when a test sample is combined with the assay, as a means to screen the sample for the presence of a ligand having steroid hormone receptor activity.
In yet a further example according to the test kits and assay methods described herein, a reduction or inhibition in transcription of a reporter construct may be measured using polymerase chain reaction (PCR) quantitative PCR (also known as real-time PCR, qPCR), digital PCR (dPCR), reverse transcription PCR (RT-PCR), reverse transcription qPCR (RTqPCR), reverse transcription digital PCR (RTdPCR), RNA seq or insitu hybridisation.
In other examples according to the test kits and assay methods described herein, reporter gene transcript levels comprising (e.g.) mRNA or cDNA may be semi-/quantified using established techniques such as quantitative polymerase chain reaction (qPCR, including RealTime qPCR and Reverse Transcription-qPCR), or using other techniques such as fluorescence based on detection of intercalating dyes or on direct addition of fluorescent nucleotides. For example, the use of fluorophores that bind to RNA aptamers to form RNA-fluorophore complexes, as described herein. These and other techniques would be known to a person skilled in the art.
The test kits and assay methods described herein are configured for detection of various ligands of both known and unknown structure which will bind to a steroid hormone receptor including androgen receptor (AR), estrogen receptor alpha (ER-α), estrogen receptor beta (ER-β), progesterone receptor A (PRA), progesterone receptor B (PRB), mineralocorticoid receptor (MR) and glucocorticoid receptor (GR).
Examples of ligands known to bind androgen receptor include, without limitation, Testosterone, Dihydrotestosterone; Androgenic Anabolic Steroids (AAS) including but not limited to TRENA, 17α-Trenbolone, 17β-Trenbolone, Trendione, Nandrolone, Boldenone, Selective Adrogen Receptor Modulators (SARMs) including but not limited to 93746, BMS-546929, LGD4033, ACP105, YK-11, Andarine, Ligandrol, Ostarine. Androgenic progestagens including but not limited to Altrenogest.
Examples of ligands known to bind estrogen receptor alpha include, without limitation, Estradiol, Estrone, Estriol; Selective Estrogen Receptor Modulators including Raloxifene, Tamoxifen, Toremifene, Ospemifene, Lasofoxifene, Cyclofenil, Clomifene, Broparestrol, Basedoxifene, Anordrin; Phytoestrogens including but not limited to, dietary estrogens such as Polyphenols (Resveratrol), Flavanones (Eriodictyol, Hesperetin, Homoeriodictyol, Naringenin), Flavones (Apigenin, Luteolin, Tangeritin), Flavonols (Fisetin, Kaempferol, Myricetin, Pachypodol, Quercetin, Rhamnazin), Catechins (Proanthocyanides), Isoflavonoids (Isoflavones Biochanin A, Clycitein, Daidzein, Formononetin, Genistein), Isoflavans (Equol), Coumestans (Coumestrol); Estrogen-like Endocrine Disruptive Chemicals (EEDC) including, but not limited to, Dichlorodiphenyltrichloroethane (DDT), Dioxin, Polychlorinated Biphenyls (PCBs), Bisphenol A (BPA), Polybrominated Biphenyls (PBB), Phthalate Esters, Endosulfan, Atrazine, Zeranol; designer compounds such as Hydrazide Derivatives.
Examples of ligands known to bind estrogen receptor beta include, without limitation, all ligands which bind to estrogen receptor alpha, as well as, Diarylpropionitrile (DPN) and Wyeth-derived Benzoxazoles such as Way-659, Way-818 and Way-200070.
Examples of ligands known to bind progesterone receptor A and progesterone receptor B include, without limitation, Progesterone, Norethisterone, Levonorgestrel, Medroxyprogesterone Acetate, Megestrol Acetate, Dydrogesterone, Drospirenone, Altrenogest; Selective Progesterone Receptor Modulators including Ulipristal Acetate, Telapristone Acetate, Vilaprisan, Asoprisnil, Asoprisnil Ecamate; Anti-Progestins including Mifepristone, Onapristone, Lilopritone and Gestrinone.
Examples of ligands known to bind mineralocorticoid receptor include, without limitation, Aldosterone; synthetic mineralocorticoids such as Fludrocortisone; antimineralocorticoids such as Spironolactone and Eplerenone; glucocorticoid receptor ligands such as those described below.
Examples of ligands known to bind glucocorticoid receptor include, without limitation dexamethasone, hydrocortisone, cortisone, prednisolone, methylprednisolone, prednisone, amcinonide, budesonide, desonide, fluocinonide, halcinonide, beclometasone, betamethasone, fluocortolone, halometasone, mometasone, or as antagonists mifepristone, and ketoconazole.
Steroid hormone receptors activated by a ligand present in a sample will dimerize (i.e. forming a receptor-ligand complex as defined) and bind to its complimentary hormone response element. In the test kits and assays described herein, hormone response elements are linked to a reporter construct, and a change in a physical property of the reporter construct may be used to reflect the presence of a ligand in a sample under investigation. Exemplary hormone response elements according to the present invention include: androgen response element (ARE), estrogen response element (ERE), progesterone response element (PRE), mineralocorticoid response element (MRE) and glucocorticoid response element (GRE).
As previously stated, the various hormone response elements incorporate binding motifs configured to selectively bind activated ligand-receptor complexes. For example, each of the androgen, estrogen, progesterone, mineralocorticoid and glucocorticoid response elements comprise imperfect dihexameric palindrome sequences which in their secondary structure orientations facilitate binding of a dimerized ligand receptor complex (i.e. (HR-L)2) via zinc finger binding motifs.
In an example according to the test kits and assay methods described herein, the androgen response element comprises a DNA binding motif that binds to an activated androgen receptor. In a related example, the DNA binding motif binds to a dimer of the ligand bound androgen receptor (i.e. (AR-L)2; where “AR” is an androgen receptor and “L” is a ligand). In a related example, the DNA binding motif comprises imperfect dihexameric palindrome sequences which create binding specificity between the activated androgen receptor and an androgen response element. In a further related example, the androgen response element comprising a DNA binding motif is a double stranded deoxyribonucleic acid.
In an example according to the test kits and assay methods described herein, the estrogen response element comprises a DNA binding motif that binds to an activated estrogen receptor. In a related example, the DNA binding motif binds to a dimer of the ligand bound estrogen receptor (i.e. (ER-L)2; where “ER” is an estrogen receptor selected from ER-α or ER-β). In a further related example, the DNA binding motif comprises imperfect dihexameric palindrome sequences which create binding specificity between the activated estrogen receptor and an estrogen response element. In a further related example, the estrogen response element comprising a DNA binding motif is a double stranded deoxyribonucleic acid.
In an example according to the test kits and assay methods described herein, the progesterone response element comprises a DNA binding motif that binds to an activated progesterone receptor. In a related example, the DNA binding motif binds to a dimer of the ligand bound progesterone receptor (i.e. (PR-L)2; where “PR” is a progesterone receptor selected from PRA or PRB). In a further related example, the DNA binding motif comprises imperfect dihexameric palindrome sequences which create binding specificity between the activated progesterone receptor and a progesterone response element. In a further related example, the progesterone response element comprising a DNA binding motif is a double stranded deoxyribonucleic acid.
In an example according to the test kits and assay methods described herein, the mineralocorticoid response element comprises a DNA binding motif that selectively binds to an activated mineralocorticoid receptor. In a related example, the DNA binding motif binds to a dimer of the ligand bound mineralocorticoid receptor (i.e. (MR-L)2; where “MR” is a mineralocorticoid receptor). In a further related example, the DNA binding motif comprises imperfect dihexameric palindrome sequences which create binding specificity between the activated mineralocorticoid receptor and a mineralocorticoid response element. In a further related example, the mineralocorticoid response element comprising a DNA binding motif is a double stranded deoxyribonucleic acid.
In an example according to the test kits and assay methods described herein, the glucocorticoid response element comprises a DNA binding motif that selectively binds to an activated glucocorticoid receptor. In a related example, the DNA binding motif binds to a dimer of the ligand bound glucocorticoid receptor (i.e. (GR-L)2; where “GR” is a glucocorticoid receptor). In a further related example, the DNA binding motif comprises imperfect dihexameric palindrome sequences which create binding specificity between the activated glucocorticoid receptor and a glucocorticoid response element. In a further related example, the glucocorticoid response element comprising a DNA binding motif is a double stranded deoxyribonucleic acid.
Detection of a ligand that binds to and activates an androgen receptor, such as Testosterone, Dihydrotestosterone, androgenic anabolic steroids and selective androgen receptor modulators (i.e SARMs) and phyto- or xenoandrogens, requires test kits/assays comprising an androgen receptor together with an androgen response element capable of binding to an activated androgen-receptor complex.
In an example according to the test kits and assay methods described herein, the androgen response element comprises or consist in the sequence 5′-AGAACAnnnTGTTCT-3′ (SEQ ID NO: 4), where n is any nucleic acid base selected from G, C, T or A. Its complimentary antisense sequence is defined as 5′-AGAACAnnnTGTTCT-3′ (SEQ ID NO: 5), where n represents the base that is complementary to SEQ ID NO: 4 based on a sequence alignment between SEQ ID NOs: 4 and 5 (i.e. A=T; T=A; G=C; C=G).
In another example according to the test kits and assay methods described herein, the androgen response element comprises or consist in the sequence 5′-GGTACAnnnTGTTCT-3′ (SEQ ID NO: 6), where n is any nucleic acid base selected from G, C, T or A. Its complimentary antisense sequence is defined as 5′-AGAACAnnnTGTACC-3′ (SEQ ID NO: 7), where n represents the base that is complementary to SEQ ID NO: 6 based on a sequence alignment between SEQ ID NOs: 6 and 7 (i.e. A=T; T=A; G=C; C=G).
Detection of a ligand that binds to and activates an estrogen receptor, such as Estradiol, Estrone, other estrogen-like steroid hormones including phyto- and xenoestrogens and selective estrogen receptor modulators (SERMs), requires test kits/assays comprising either an estrogen receptor alpha (ER-α) or estrogen receptor beta (ER-β) together with an estrogen response element capable of binding to an activated estrogen-receptor complex.
In an example according to the test kits and assay methods described herein, the estrogen response element comprises or consist in the sequence 5′-AGGTCAnnnTGACCT-3′ (SEQ ID NO: 8), where n is any nucleic acid base selected from G, C, T or A. Its complimentary antisense sequence is defined as 5′-AGGTCAnnnTGACCT-3′ (SEQ ID NO: 9), where n represents the base that is complementary to SEQ ID NO: 8 based on a sequence alignment between SEQ ID NOs: 8 and 9 (i.e. A=T; T=A; G=C; C=G).
Detection of a ligand that binds to and activates a progesterone receptor, such as Progesterone, Norethisterone, Levonorgestrel, other progesterone-like steroid hormones and selective progesterone receptor modulators (SPRMs), requires test kits/assays comprising either an progesterone receptor A (PRA) or progesterone receptor B (PRB) together with an progesterone response element capable of binding to an activated progesterone-receptor complex.
In an example according to the test kits and assay methods described herein, the progesterone response element comprises or consist in the sequence 5′-GGTACAAACTGTTCT-3′ (SEQ ID NO: 10). Its complimentary antisense sequence is defined as 5′-AGAACAGTTTGTACC-3′ (SEQ ID NO: 11).
Detection of a ligand that binds to and activates a mineralocorticoid receptor, such as Aldosterone, synthetic mineralocorticoids such as Fludrocortisone and antimineralocorticoids such as Spironolactone and Eplerenone, requires test kits/assays comprising a mineralocorticoid receptor together with an mineralocorticoid response element capable of binding to an activated mineralocorticoid-receptor complex.
In an example according to the test kits and assay methods described herein, the mineralocorticoid response element comprises or consist in the sequence 5′-AGAACAnAATGTTCT-3′ (SEQ ID NO: 12), where n is any nucleic acid base selected from G, C, T or A. Its complimentary antisense sequence is defined as 5′-AGAACATTnTGTTCT-3′ (SEQ ID NO: 13), where n represents the base that is complementary to SEQ ID NO: 12 based on a sequence alignment between SEQ ID NOs: 12 and 13 (i.e. A=T; T=A; G=C; C=G).
Detection of a ligand that binds to and activates a glucocorticoid receptor, such as, Cortisol, Dexamethasone and 11-Dihydrocorticosterone requires test kits/assays comprising a glucocorticoid receptor together with an glucocorticoid response element capable of binding to an activated glucocorticoid-receptor complex.
In an example according to the test kits and assay methods described herein, the glucocorticoid response element comprises or consist in the sequence 5′-AGAACAnAATGTTCT-3′ (SEQ ID NO: 12), where n is any nucleic acid base selected from G, C, T or A. Its complimentary antisense sequence is defined as 5′-AGAACATTnTGTTCT-3′ (SEQ ID NO: 13), where n represents the base that is complementary to SEQ ID NO: 12 based on a sequence alignment between SEQ ID NOs: 12 and 13 (i.e. A=T; T=A; G=C; C=G).
Exemplary nucleic acid sequences according to the test kits and assay methods described here include, without limitation:
In a related example, the T7i promoter/initiation sequence is defined by 5′-TAATACGACTCACTATAG-3′ (SEQ ID NO: 1).
In another related example, the T7 RNA polymerase initiation sequence comprises a sequence defined by 5′-TAATACGACTCACTATAGGGAGA-3′ (SEQ ID NO: 83).
In another related example, the T7 RNA polymerase initiation sequence comprises a sequence defined by 5′-TAATACGACTCACAATCGCGGAG-3′ (SEQ ID NO: 84).
In another related example, the T7 RNA polymerase initiation sequence comprises a sequence defined by 5′-GGAGGCCGGAGAATTGTAATACGACTCACTATAGGGAGACGCGTGT-3′ (SEQ ID NO: 85).
Alternate exemplary nucleic acid sequences according to the test kits and assay methods described here include, without limitation:
In a related example, the T3i promoter/initiation sequence is defined by 5′-AATTAACCCTCACTAAAG-3′ (SEQ ID NO: 2).
Alternate exemplary nucleic acid sequences according to the test kits and assay methods described here include, without limitation:
In a related example, the SP6i promoter/initiation sequence is defined by 5′-ATTTAGGTGACACTATAG-3′ (SEQ ID NO: 3).
In another example according to the present invention, the test kits and/or assay methods are configured to detect ligands that bind to an androgen receptor, and the nucleic acid sequence comprised of a T7 RNA polymerase initiation sequence, an androgen response element and a reporter construct encoding F30 scaffold and Mango II RNA aptamer comprises the sequence set forth in SEQ ID NO: 14 as follows:
In yet another example according to the present invention, the test kits and/or assay methods are configured to detect ligands that bind to an estrogen receptor alpha or estrogen receptor beta, and the nucleic acid sequence comprised of a T7 RNA polymerase initiation sequence, an estrogen response element and a reporter construct encoding F30 scaffold and Mango II RNA aptamer comprises the sequence set forth in SEQ ID NO: 15 as follows:
In yet a further another example according to the present invention, the test kits and/or assay methods are configured to detect ligands that bind to a progesterone receptor A or a progesterone receptor B, and the nucleic acid sequence comprised of a T7 RNA polymerase initiation sequence, an progesterone response element and a reporter construct encoding F30 scaffold and Mango II RNA aptamer comprises the sequence set forth in SEQ ID NO: 16 as follows:
In another example according to the present invention, the test kits and/or assay methods are configured to detect ligands that bind to a mineralocorticoid receptor, and the nucleic acid sequence comprised of a T7 RNA polymerase initiation sequence, an mineralocorticoid response element and a reporter construct encoding F30 scaffold and Mango II RNA aptamer comprises the sequence set forth in SEQ ID NO: 17 as follows:
In another example according to the present invention, the test kits and/or assay methods are configured to detect ligands that bind to a glucocorticoid receptor, and the nucleic acid sequence comprised of a T7 RNA polymerase initiation sequence, an glucocorticoid response element and a reporter construct encoding F30 scaffold and Mango II RNA aptamer comprises the sequence set forth in SEQ ID NO: 18 as follows:
Other nucleic acids/constructs for use in the test kits and assay methods according to the present invention are summarised in Table 1, below.
The present invention further contemplates multiplexed assays configured to detect two or more steroid hormone genomic responses from the same test sample.
To further illustrate the relevance of multiplexed systems, in certain circumstances it would be useful for a clinician investigating, for example, the hormonal status of a subject to know both the androgenic and estrogenic levels/activity in the subject.
The side-by-side detection of androgenic and estrogenic ligands from the same test sample is possible because a ligand which binds to an androgen receptor will not bind to and activate an estrogen receptor present in the same assay; conversely a ligand which binds to an estrogen receptor which will not bind to and activate an androgen receptor also present in the same assay. This is because androgen and estrogen receptors belong to different steroid hormone receptor classes, and so there is no ‘cross-talk’ in terms of receptor activation. And so, multiplexed assays have been developed to detect both androgenic and estrogenic ligands from the same sample.
Accordingly, in another aspect of the present invention there is provided a test kit for screening a sample for the side-by-side detection of an androgenic ligand and/or an estrogenic ligand, the test kit comprising:
According to certain examples of the inventions described herein, assay components (i) and (iii) in the aspect referred to immediately above could be provided by the same cell lysate.
According to these and other aspects of the present invention, the test kits may be modified to include least one steroid hormone receptor corepressor and at least one steroid hormone receptor coactivator.
In an example according to this aspect of the present invention, the first and second nucleic acid molecules are discrete molecules.
In another example according to this aspect of the present invention, the first and second nucleic acid molecules are operably linked.
In yet another example according to this aspect of the present invention, the first nucleic acid molecule comprises a sequence defined by SEQ ID NO: 14.
In a further example according to this aspect of the present invention, the second nucleic acid molecule comprises a sequence defined by SEQ ID NO: 15.
In yet a further example according to this aspect of the present invention the first and second nucleic acid molecules are operably linked and comprise a sequence defined by SEQ ID NO: 100.
CTATAGGGAGACGCGTGTACTCTGGAGGAACAGGTCAGCATGACCTGTT
Advantageously, the assays and test kits described herein are particularly suited for configuration in multiplexed systems because the simplicity of the assay systems described herein means that an existing assay or test kit may be routinely modified to include a second or subsequent receptor/report construct combination specific to detection of a second ligand; by leveraging the same in vitro transcription machinary (e.g. bacteriophage polymerase+nucleoside triphosphates), discrete signals generated by each reporter may be conveniently detected. To further illustrate this point, a multiplexed assay system according to the present invention may comprise, for example, an androgen specific reporter construct which, in the presence of androgen or an androgen-like ligand, would generate a reporter read-out that may be measured independently of the read-out generated by a reporter construct that is specific for the detection of an estrogen or an estrogen-like ligand in the same sample.
The skilled person would appreciate the advantages conferred by a lack of molecular complexity associated with the multiplexed systems of the present invention, and would recognise that detection of multiple discrete steroid hormone genomic responses (e.g. two, three, four, or more) from the same test sample is possible.
Accordingly, the test kits according to the present invention comprise at least one steroid hormone receptor and at least one nucleic acid molecule comprising at least one reporter construct.
Accordingly, the term “a steroid hormone receptor” according to the test kits and methods described herein is intended to mean “at least one steroid hormone receptor” in the sense that two or more different types of steroid hormone receptors may be present (e.g. and by way of illustration only, a steroid hormone receptor that binds testosterone and a steroid hormone receptor that binds estradiol).
Similarly, the term “a nucleic acid molecule [comprising a response element]” is intended to mean “at least one nucleic acid” in the sense that two or more discrete nucleic acid molecules may be present, each comprising a different response element and optionally a different reporter molecule.
In an example according to this aspect of the present invention, the test kit comprises (i) an estrogen receptor and nucleic acid molecule comprising an estrogen response element, and (ii) an androgen receptor and nucleic acid molecule comprising an androgen response element.
In a related example, the nucleic acid molecule comprising an estrogen response element further comprises a first RNA aptamer that is capable of binding to a first fluorophore.
In another related example, the nucleic acid molecule comprising the androgen response element further comprises a second RNA aptamer that is capable of binding to a second fluorophore.
In a related example, the first and second RNA aptamers include, but are not limited to Mango I, Mango II, Mango III and Mango IV, Spinach, iSpinach, baby Spinach, Broccoli and Malachite Green, provided the first RNA aptamer is not identical to the second RNA aptamer.
In a further related example, the first RNA aptamer is Mango II and the second RNA aptamer is Malachite Green.
In a further related example, the first RNA aptamer is Mango II and the second RNA aptamer is iSpinach.
The present invention further contemplates a utility for the test kits and assay methods described herein for various clinical applications.
For example, it may desirable to know the total estrogenic activity of a test (e.g. biological) sample. As described elsewhere in this specification, there are two estrogen receptor subtypes, namely estrogen receptor alpha and estrogen receptor beta. Accordingly, the present invention contemplates a multiplexed assay format involving the two estrogen receptor subtypes, based on the assay principles described herein, to measure the total estrogenic activity of a sample.
Accordingly, in yet another aspect of the present invention there is provided a test kit to determine the total estrogenic activity of a test sample, the test kit comprising:
In an example according to this aspect of the present invention, the RNA polymerase is T7 RNA polymerase, and the RNA polymerase promoter sequence is T7 RNA polymerase promoter sequence defined by SEQ ID NO: 85.
In another example according to this aspect of the present invention, the nucleic acid sequence comprises a spacer (e) which is located between the promoter sequence (a) and the response element (b). In a related example, the spacer (e) is between about 2 and about 32 nucleotides in length.
Advantageously, the present invention provides activity based test kits, assays and methods that work fundamentally on the principle of steroid hormone receptor activation. By detecting steroid hormone receptor activation (with consequent binding to its hormone response element) by a target ligand present within a sample to be tested, the present invention provides cell-free test kits, assays and methods that do not rely on structural knowledge of the ligand(s) being interrogated, can readily distinguish between the presence of biologically active and inactive ligands, and provide cost-effective, reliable and reproducible systems that do not require complex laboratory equipment or particular expertise to perform.
Accordingly, in another aspect of the present invention there is provided a method for determining the doping status of an athlete, the method comprising combining a sample obtained from the athlete with a test kit as described herein and determining the doping status of an athlete.
In an example according to this aspect of the present invention, the sample obtained obtained from the athlete is a serum sample, a plasma sample or a urine sample.
In another example, the athlete is a human athlete or a non-human athlete selected from a horse, a camel or a dog.
In a further aspect of the present invention there is provided an article of manufacture for screening a test sample for the presence of a ligand, which ligand is capable of activating a steroid hormone receptor and eliciting a genomic response in a cell, the article of manufacture comprising a test kit as described herein together with instructions for how to detect the presence of a ligand in the sample.
In yet a further aspect of the present invention there is provided an article of manufacture for determining doping in an athlete, the article of manufacture comprising a test kit as described herein together with instructions for detecting the presence of a ligand in a sample derived from the athlete, wherein the presence of the ligand in the sample is indicative of doping in the athlete.
The various test kits and assays described herein each provide (i) a steroid hormone receptor inclusive of a ligand binding domain for binding a ligand that may be present in a sample to be tested and (ii) a nucleic acid response element comprising a protein binding domain which is bound by an activated steroid hormone receptor (or ligand-receptor complex; HR-L). The term “activated steroid hormone receptor” refers to a receptor-ligand complex, and may include various permutations of the HR-L structure (e.g. monomer, dimer, trimer etc). Importantly, the hormone response element contains binding motifs specific for the receptor-ligand complex. Accordingly, by combining the test kits and assays of the present invention with a sample of interest, detection of a ligand, which possesses the potential to bind to a steroid hormone receptor and elicit a steroid hormone genomic response, is possible.
The terms “receptor binding domain”, “activated receptor binding domain”, “hormone receptor binding domain”, “activated hormone receptor binding domain”, “receptor-ligand binding domain” and “hormone receptor-ligand binding domain” are used interchangeably to refer to the protein binding domain of the hormone response element that is bound by an activated hormone receptor or ligand-receptor complex, as defined herein.
In other examples, the inventions described herein find utility in the detection of performance enhancing pro/drugs (e.g. anabolic steroids) used in human as well as non-human athletes including race horses, camels and dogs. In other examples, the inventions described herein have utility in screening foods and health food supplements for additives that may bind to a steroid hormone receptor and elicit a genomic response in a cell or do so following metabolic processing (i.e. in the case of so-called ‘prodrugs’).
The present invention further contemplates detection of one or more physiologically inactivate ligands from a test sample, which ligands are ultimately capable of activating steroid hormone receptors when converted to a physiologically active form. As such, the test kits, assays and methods as described herein further comprise steroid metabolism machinery that is capable of processing the ligand in such a way that it will activate its corresponding steroid hormone receptor. In this way, detection of physiologically inactive ligands (e.g. prohormones) from samples such as nutritional supplements is possible.
As such, the test kits, assays and methods described herein may further comprise steroid metabolism machinery sufficient to convert a ligand from a physiologically inactive form to a physiologically active form, or from a physiologically active form to a more physiologically active form or from a physiologically active form to a less physiologically active form, or from a physiologically active form to a physiologically inactive form. Only when the ligand is in a physiologically active form does it possess the ability to activate a steroid hormone receptor and elicit a genomic response. Accordingly, inclusion of steroid metabolism machinery in the test kits, assays and methods according to the present invention helps facilitate detection of physiologically inactive ligands from a test sample of interest, (e.g.) which ligands exist as pro-drugs (e.g. pro-hormones) and might otherwise evade detection using established methodologies. Furthermore, inclusion of steroid metabolism machinery in the test kits, assays and methods according to the present invention helps determine biological activity/potency of ligands necessary to show effect.
The data presented in
The test kits, assays and methods described herein may further comprise a detection means for detecting binding between the receptor-ligand complex and the response element contained within the nucleic acid, as defined.
The test kits and assays according to the present invention are cell-free. This is particularly important since the molecular complexity of the assay systems are significantly reduced. For example, the absence of (i) a cell membrane structure which has the potential to create a thermodynamic sink for steroid hormone molecules and (ii) endogenous steroid hormone metabolism observed with cell based systems, provides for an assay system with enhanced sensitivity and selectivity. Further, and advantageously, according to the test kits, assays and methods described herein, the relative amounts of essential structural elements (e.g. steroid hormone receptor and nucleic acid response element inclusive of one or more activated receptor binding domains) may be precisely controlled to provide enhanced assay functionality and increased sensitivity.
According to the methods described herein, the test result may be compared to a reference threshold in order to determine the absolute level of signal generated by a ligand present in a test sample. Indeed, Applicants observed non-specific binding and/or activation of the response element by non-ligand bound receptor. Accordingly, where it is desirable to perform a semi-quantitative analysis for any given test sample, the assays and methods described herein may be performed in the absence of test sample to first establish a reference threshold (e.g. in presence of ethanol acting as a negative control). Assay results obtained from a test sample may then be compared to the reference threshold, to determine the absolute activity attributable to the ligand(s) present in a sample using a simple subtraction methodology.
The present invention further contemplates the use of the assays and test kits described herein to determine the potency of a test compound relative to a reference compound. According to the present invention, the term ‘relative potency’ is defined as the multiplier of biological activity of a test compound relative to a reference compound, as determined by normalizing the biological activity of the test compound to the reference compound.
The biological activity of the test and reference compounds may be determined using EC50 or the concentration of compound that gives half the maximal response from a dose response curve for that particular compound. The dose response curve is generated by serially diluting the compound and measuring its steroid hormone receptor binding/activation profile. A plot of the measured activity (e.g. as measured by fluorescence) vs concentration of the compound (i.e. serial dilution of the compound generates a concentration range that is best presented on a log scale) is then made.
A person skilled in the art will recognize that a measure of relative potency of a test compound is relative to the reference compound used. In other words, the relative potency of a test compound is likely to differ depending on the reference compound to which its biological activity is normalized.
Where the relative potency is >1, the test compound invokes a higher measured biological activity in the assays compared to the reference compound. Where the relative potency is <1, the test compound invokes a lower measured biological activity in the assays compared to the reference compound. Where the relative potency=1, the test compound and the reference compound invoke equal biological activity in the assays.
Relative potency can also be used to determine the activation factor of a test compound in question. As used herein, activation factor relates the relative potency of a test compound determined in a yeast cell or using a yeast cell-free extract (i.e. which contains no metabolic machinery) to the relative potency of the same test compound determined in a mammalian cell or using a mammalian cell-free extract (i.e. which includes metabolic machinery) as a measure of relative activation between the two states of the test compound. An activation factor >1 means that the test compound has undergone metabolic conversion to a more physiologically active state in the presence of metabolic machinery in the assay.
Yet another advantage conferred by the test kits and assays according to the present invention is the relative ease of performance. In other words, performance of the test kits, assays and methods described herein does not require complex cell culture techniques, experienced laboratory technicians or convoluted laboratory testing equipment and analysis. This is particularly advantageous, because the test kits, assays and methods according to the present invention may be practiced by untrained personnel in the field following relatively simple testing procedures. Further, performance of the test kits, assays and methods may provide real time information (e.g.) when testing for performance enhancing substances in a sample taken from an athlete immediately prior to, or following, competition.
In other aspects of the present invention there is provided a test kit for screening a sample for the presence of a ligand, which ligand is capable of forming a complex with a steroid hormone receptor and eliciting a genomic response when in a cell, the test kit comprising:
In other aspects of the present invention there is provided a test kit for screening a sample for the presence of a ligand, which ligand is capable of forming a complex with a steroid hormone receptor and eliciting a genomic response when in a cell, the test kit comprising:
In yet further aspects of the present invention there is provided a test kit for screening a test sample for the presence of a ligand capable of eliciting a steroid hormone genomic response, the test kit comprising:
In yet further aspects of the present invention there is provided a test kit for screening a test sample for the presence of a ligand capable of eliciting a steroid hormone genomic response, the test kit comprising:
In certain examples according to the assays, methods and test kits of the present invention, the nucleic acid molecules include one or more copies of various components of the nucleic acid, including the response element or reporter construct. For example, the reporter constructs or the nucleic acid molecules may include a single copy or multiple copies of the nucleic acid response elements including, but not limited to, duplicate copies, triplicate copies, quadruple copies etc.
In another example of the present invention, the steroid hormone receptor is purified from a cell, or is derived from a cell-based hormone receptor through recombinant cloning, expression and purification. In a further example, the steroid hormone receptor is synthetic, and its sequence modeled on, or evolved from, endogenous steroid hormone receptor sequences known in the art.
A person skilled in the art would also recognize that any steroid hormone receptor may be employed in the test kits, assays and methods of the present invention, provided that it retains the ability to bind to, and be activated by, a ligand of interest for detection. This includes, steroid hormone receptors, based on endogenous cellular forms, as well as recombinant or synthetic forms.
As such, the test kits, assays and methods according to the present invention may be configured to screen/detect any ligand that elicits a steroid hormone genomic response. However, a person skilled in the art will recognise that, according to the various assays concepts described herein, detection of different hormone classes (i.e. ligands) requires the format of the test kits, assays and methods to be properly configured and optimized. For example, detection of a ligand that binds to and activates an androgen receptor, such as testosterone as well as other testosterone-like hormones, requires test kits/assays comprising androgen receptor together with an androgen response element capable of binding to an activated androgen-receptor complex etc.
Designer steroids and non-steroidal anabolic drugs pose a significant and growing challenge for anti-doping laboratories. First identified in the early 2000s with the detection of tetrahydrogestrinone and madol, the threat posed by designer anabolic drugs has rapidly increased to include numerous potential agents. These synthetically-derived anabolic drugs are designed to evade detection or legal controls with respect to both manufacture and supply, and many are widely available on the internet where they are sold as so-called “supplements”.
Mass spectrometry remains the primary technology for the identification of known illicit steroid hormones and non-steroid anabolic drugs in biological samples and/or supplements. Despite its sensitivity and specificity, mass spectrometry remains limited by requiring prior knowledge of the steroid and non-steroid anabolic drug's chemical structures for detection. Moreover, mass spectrometry fails to provide information about the biological activity of the anabolic drugs detected, and is unable to differentiate between bioactive and inactive molecules. This is information that is required for legal prosecution of athletes, coaches, trainers, managers and manufacturers.
In recent years, yeast and mammalian cell-based in vitro androgen bioassays have been used to detect the presence of novel synthetic androgens, the androgenic potential of progestins as well as androgens, pro-androgens, designer androgens and designer non-steroid anabolic drugs in supplements. However, these assays suffer limitations associated with molecular complexity, as described elsewhere herein, and require technical skills that are both molecular and cellular in nature, are time consuming, labour intensive and expensive. As such, it is not feasible to consider the assays in their present form for inclusion in routine screening. In other words, yeast and mammalian cell-based assays suffer significant limitations because they are not high throughput or cost effective.
Advantageously, the present invention provides activity based test kits, assays and methods that work fundamentally on the principle of steroid hormone receptor activation. By detecting steroid hormone receptor activation by a ligand present within a sample to be tested, the present invention provides cell-free test kits, assays and methods that do not rely on structural knowledge of the ligand(s) being interrogated, can readily distinguish between the presence of biologically active and inactive ligands, and provide cost-effective, reliable and reproducible systems that do not require complex laboratory equipment or particular expertise to perform.
Accordingly, in an example according to the test kits, assays and methods described herein, the ligand is a performance enhancing designer drug and/or steroid.
In another example according to the test kits, assays and methods described herein, the ligand is of an unknown chemical structure.
In a further example according to the test kits, assays and methods described herein, the ligand is of a previously unknown chemical structure.
The present invention further contemplates use of the test kits, assays and methods as described herein for detecting antagonists of a target ligand by screening a sample of interest for a compound that will prevent binding of the ligand to its steroid hormone receptor such that it no longer activates the receptor and elicits a genomic response.
This is particularly useful when there is a need to screen for antagonists that block steroid hormone receptor activation (e.g.) as potential therapeutics for the treatment of endocrine and non-endocrine cancers. For example, the activity based test kits, methods and assays comprising one or more estrogen receptors according to the present invention can be used to screen compound libraries for the presence of antagonists or to monitor the loss of estrogen receptor activation in breast cancer tissue or blood in patients on cancer therapy.
In yet a further example according to all aspects of the test kits, assays and methods described herein, the biological sample is derived from an animal selected from the group consisting of equine, canine, camelid, bovine, porcine, ovine, caprine, avian, simian, murine, leporine, cervine, piscine, salmonid, primate, and human.
In yet a further example according to all aspects of the test kits, assays and methods described herein, the test sample is derived from biological material selected from the group consisting of urine, saliva, stool, hair, tissues including, but not limited to, blood (plasma and serum), muscle, tumors, semen, etc.
In yet a further example according to all aspects of the test kits, assays and methods described herein, the test sample is derived from a food selected from the group consisting of vegetable, meat, beverage including but not limited to sports drink and milk, supplements including, but not limited to, food supplements and sports supplements, nutritional supplements, herbal extracts, etc.
In yet a further example according to all aspects of the test kits, assays and methods described herein, the test sample is derived from a medication selected from the group consisting of drug, tonic, syrup, pill, lozenge, cream, spray and gel.
In yet a further example according to all aspects of the test kits, assays and methods described herein, the sample is derived from the environment selected from the group consisting of liquid, water, soil, textile including, but not limited to, plastics and mineral.
The information presented in Example 6 read in conjunction with
Accordingly, in another example, the sample is a biological sample. In a related example, the biological sample is a body fluid sample, including but not limited to, blood, plasma, serum, saliva, interstitial fluid, semen and urine.
In another example, the sample derived from a plant, including but not limited to, leaf, flower, stem, bark, root, bud, pod, pollen and seed.
In another example, the sample is derived from an animal including, but not limited to, an equine animal, a canine animal, a dromedary animal, a bovine animal, a porcine animal, an ovine animal, a caprine animal, an avian animal, a simian animal, a murine animal, a leporine animal, a cervine animal, a piscine animal, a salmonid animal, a primate animal, and a human animal.
In another example, the test sample is a non-biological sample. In a related example, the non-biological sample includes, but is not limited to, a liquid sample including water, a soil sample, a textile sample including but not limited to plastics, a mineral sample, a food sample and a medication.
Examples of a food sample includes, but is not limited to, vegetables, meats, beverages, supplements and herbal extracts.
Examples of a medication includes, but is not limited to, drugs, tonics, syrups, pills, lozenges, creams, sprays and gels.
The invention is further described with reference to the following examples. It will be appreciated that the invention as claimed is not intended to be limited in any way by these examples.
The information and data which follows demonstrates various prototype assays with respect to the detection of ligands that bind to and activate androgen receptors including (e.g.) Testosterone and Dihydrotestosterone, or ligands that bind to and activate estrogen receptors including (e.g.) Estradiol. These Examples are used to illustrate the activity assay platform described and claimed herein, where the assay concepts and principles exemplified by the detection of ligands that bind to androgen receptors or ligands that bind to estrogen receptors (i.e. ER-α and ER-β) would apply equally to the detection of other receptor ligands of interest including, without limitation, ligands that bind to progesterone receptor including but not limited to progesterone, ligands that bind to mineralocorticoid receptor including but not limited to aldosterone, and ligands that bind to the glucocorticoid receptor including but not limited to cortisol.
Applicants initially developed an in vitro transcription platform include a DNA construct that encodes a T7 RNA consensus promoter sequence upstream of a tandem array of 3× androgen response elements (ARE) upstream of an RNA aptamer sequence for Mango II, combined with recombinant androgen receptor (AR), recombinant heat shock protein 90 (HSP90), T7 RNA polymerase, nucleoside triphosphates and a transcription buffer. The T7 promoter will drive a high level of RNA aptamer expression that will be detected by binding to fluorophore, Thiazole Orange 1—biotin (TO1). Inhibition of T7-driven aptamer expression will occur when ARE is bound by ligand-activated AR.
Natural androgen signaling starts with the diffusion of an androgenic molecule into the cell where it binds to the AR being held in an inactive state in the cytoplasm, bound to heat shock protein 90 (HSP90). Upon binding the androgenic molecule (or ligand), AR undergoes a conformational change that releases HSP90, and exposes nuclear localization and dimerization sites. The ligand-AR complex is targeted for translocation to the nucleus where AR binds to ARE sites in the DNA and RNA polymerase II holoenzyme assembles and initiates transcription of AR-regulated genes. Transcription of a gene by RNA polymerase II produces an mRNA transcript that, in turn, acts as the template for the ribosome machinery to make a protein.
Exploiting this natural biology, the experiments described now show testosterone (a natural androgen)—activated AR decreases T7-mediated transcription, as ARE has been placed downstream of the T7 promoter (and transcription initiation site) so when testosterone-liganded AR binds to the ARE, there is a reduction/inhibition in T7-mediated transcription.
In the presence of ligand, such as the natural androgen, testosterone, AR binds to ARE and inhibits transcription by T7 polymerase. In this state, less RNA Mango II aptamer is formed.
In the absence of ligand, AR is not activated to bind to ARE, and therefore the DNA is free from an obstructive protein. T7 proceeds along the DNA construct to generate RNA Mango II aptamer, which is subsequently detected by TO1-B binding and fluorescence.
In reference to the result presented in
In reference to
The concept of the Androgen Assay Prototype 2 is that a single protein RNA polymerase, such as T7 RNA polymerase, binds to its promoter sequence on a DNA template. The DNA template encodes the RNA aptamer Mango II sequence downstream of the promoter. A hormone response element (HRE) is located between the T7 promoter and the Mango II sequence. When a steroid hormone receptor (SHR) is added to the T7 in vitro transcription (IVT) reaction mix and activated by a receptor-specific ligand, the SHR binds to the HRE on the DNA template and in this bound position physically inhibits T7 RNA polymerase from transcribing the DNA into the RNA, and therefore no Mango II aptamer is formed. The formation of Mango II is detected by adding a specific fluorophore, such as TO1-biotin, to the reaction mix which binds to the Mango II aptamer. Upon binding to the Mango II aptamer, TO1 emits an excitation wavelength at 535 nm wavelength when excited by 510 nm wavelength. Fluorescence is measured using a standard fluorimeter.
The following experiments use AR or ERc as the example SHR and the ARE or ERE as the example HRE.
The key step that underpins T7-mediated in vitro transcription is for the recognition of its promoter sequence in the DNA template. To then measure that T7 transcription has occurred the DNA sequence can encode a reporter enzyme (protein) or a reporter RNA (e.g. aptamer). In the following examples, the DNA sequence encoded a reporter RNA (Mango II).
Commercial DNA fragment synthesis was used to generate a series of DNA templates that encoded the (1) T7 initiator sequence, (2) ARE, (3) Mango II RNA aptamer with F30 scaffold. These DNA fragments were cloned into a plasmid and amplified using transformed E. coli. Subsequent plasmid extraction, purification and linearization provided the final DNA template for Prototype Assay. Other examples where transcription factors have blocked T7 activity show that ˜10-32 bp between the T7 initiator sequence and the transcription factor site is optimal for blocking T7 progress. Therefore, a 12 bp filler sequence was included in the DNA fragment.
The SHR-HRE-RNA aptamer reaction to detect a SHR ligand hinges on the blockade of T7 transcription by an SHR bound to a hormone response element. In the following examples, AR and ARE were used to represent SHR and HRE.
The reactions were assembled and initiated with the addition of T7 RNA polymerase and incubated for 150 mins at 37° C. During this time, RNA Mango II aptamer was generated. The detection of Mango II was by the addition of fluorophore, thiazole orange (TO1) and measuring output with fluorimeter, excitation 510 nm and emission 535 nm.
As above, AR was used as the example steroid hormone receptor in the following experiments.
In the above experiment, and as shown in Table 3, the initial AR concentration was based on previous cell-free assays established in the inventors' laboratory. The reduction in T7-mediated Mango II generation is dependent on there being sufficient AR to block all the T7 enzyme molecules currently engaged with, and active on, the DNA templates. This means that both the ratios of AR to T7 and AR to DNA template are important. The level of AR, however, needs to be considered in the context of an optimal level of T7 and/or DNA template that supports sufficient Mango II generation required for detecting changes in fluorescence.
In the next series of experiments, the concentration of AR per reaction was altered to show the effects on Δ[Mango II].
Using the 50 ng AR reaction as the “standard” reaction, the number of molecules of AR is 2.737e11 (454.55 fmol or 22.72 nM) to the number of DNA molecules at 3.798e10 (63.06 fmol, or 3.15 nM) resulting in an excess ratio of AR:DNA of 7.2:1. Doubling the AR concentration to 100 ng, doubles the ratio to 14.4:1. Halving the AR concentration to 25 ng, halves the ratio to 3.6:1, and further again for the 14.2 ng AR to 1.8:1.
The data in
When considering SHR activation by steroid hormones, it is also necessary to examine the ratio of HSP90 to SHR, as an excess of HSP90 will block activation of the SHR, especially at low concentrations of ligand, while insufficient HSP90 will allow autoactivation of the SHR. Again, using AR as the representative SHR, in the next set of experiments, the ratio of HSP90 to AR was altered to scrutinize effects on T7-generation of Mango II by testosterone.
Importantly, the data from
AR is most effective at binding to an ARE and blocking T7 progress when the AR:DNA ratio is ≥7.2:1. AR is most effective at being activated by ligand and binding to an ARE when the HSP90:AR ratio is between 1.22:1 and 4.88:1.
The data so far has used a 3×ARE sequence commonly used in cell-based AR bioassays (see Table 2). However, the primary ARE that has been identified is of the sequence AGAACAgccTGTTCT. Considering the functioning of this assay whereby T7 enzyme is physically blocked by AR, it may not be necessary for the presence of 3×ARE sequences. In the following test, a single, but primary in sequence, ARE was cloned into the T7 DNA template.
The DNA template is a critical component of the assay and needs to be at a concentration that supports T7 transcription while also not being in excess so that the number of AR molecules present can sterically hinder transcription of the reporter construct by T7 enzyme.
In the next series of experiments, the DNA template was titrated holding AR and T7 constant. This provided insight into the number of DNA molecules required to support transcription and to maintain AR blockade.
Data from
The final component of the Androgen Assay Prototype 2 that needs to be considered to allow a fully defined stoichiometric reaction that can mimic steroid hormone receptor biology is the T7 enzyme itself. T7 RNA polymerase is used in this reaction to generate the reporter, which in these examples is the RNA aptamer, Mango II.
The amount of T7 enzyme is critical to maintain the fluorescent readout within a spectrum that will allow an optimal dynamic range. T7 is an enzyme so it is not just concentration that is an important factor, but also activity. The next series of experiments showed the effect of altering T7 activity on ΔMango II.
In
To further demonstrate the effect of minimal fluorescence level, T7 (50U) or T7 (100U) was used to generate Mango II RNA aptamer, in a reaction blocked with testosterone-induced AR, or as control ethanol. The data in
In the above examples, AR/ARE was used as the example SHR/HRE. The following series of experiments used the defined reaction stoichiometry established for AR/ARE to show the applicability of the test to other SHRs, in this case ERα. The results presented below demonstrate that estradiol-activated ERα is able to suppress T7-mediated expression of RNA aptamer, Mango II.
The standard AR/ARE conditions that proved to be a successful detection test for testosterone were used, however AR was replaced with ERα and a DNA template encoding a single ERE replaced the ARE DNA template (Table 6).
The importance of the ERα:ERE reactions for detection of an estrogen is two-fold. Firstly, it shows the simplicity in switching out the essential test components from AR/ARE DNA template to an ER/ERE DNA template. Secondly, it shows the defined stoichiometric reaction established for AR/ARE that mimics androgen biology by ligand binding to an androgen receptor, becoming displaced from HSP90, and binding to an ARE is translatable to a second steroid hormone receptor/steroid response element combination.
The data shows that the test is able to recapitulate steroid hormone biology in a cell-free manner and in such a way that every component can be defined—a truly in situ test. This is unlike the situation in vitro when using cell-based bioassays or cell-free bioassays based on nuclear extracts providing the holoenzyme RNA polymerase II. In the case of cell-based bioassays, the levels of SHR, HSP90, DNA template, and RNA polymerase II cannot be defined at all because they are influenced by the expression pattern of the cell. Cell-free bioassays based on nuclear extracts can, in part, define the stoichiometry of a reaction by describing SHR, HSP90 and HRE levels, however are unable to define the RNA polymerase level. RNA polymerase II is a holoenzyme, made up of several subunits or proteins, and therefore can only be supplied in the form of a nuclear extract. The nuclear extract is undefined in what other proteins are present. In this single polypeptide RNA polymerase form of the assay, the stoichiometry of the reaction can be fully defined and the data shows that such reactions can by synthetically manipulated to mimic the natural biology of steroid hormone receptors.
The data presented in Examples 2 and 3 has revealed defined stoichiometry that mimics steroid hormone receptor biology with ligand binding to a specific receptor thereby the receptor displaces from HSP90 and binds to a steroid response element—the classical steroid hormone genomic response. In nature, the SHR will activate or repress the expression of the target gene. In the Prototype Assays described herein, binding of the liganded-SHR represses expression of the reporter molecule.
9.459e9-3.798e10
Androgenic molecules are primarily steroid hormones. Testosterone and dihydrotestosterone are the most abundant endogenous androgens. Based on their structures, synthetic androgenic anabolic steroids (AAS) have been designed and marketed. AAS are the most commonly abused performance enhancing drug in athletes, human and animal alike. Another class of androgenic molecules that have been synthetically derived are the selective androgen receptor modulators or SARMs. Like AAS, SARMs are abused by athletes. Both AAS and SARMs differ in their structures, with a great variety of different side groups and backbones. This next series of experiments tested whether the AR/HSP90-ARE Prototype Assay was able to detect different AAS and SARMs.
Androgen Assay Prototype 2 was next tested for its ability to detect testosterone when present in a biological matrix, such as serum or plasma. First, it was necessary to demonstrate that T7 RNA polymerase continued to operate in the presence of serum, that is serum per se did not suppress T7 efficacy in generating Mango II aptamer.
There was no evidence that serum inadvertently suppressed T7 activity. Next, it was tested whether in the presence of serum, AR remained responsive to testosterone as the example ligand. Reactions were established as described above, except this time water component was replaced with serum into which testosterone (or ethanol as vehicle) had been spiked.
In the next phase of testing, the Androgen Assay Prototype 2 was tested for its ability to detect endogenous androgens deconjugated and extracted from equine urine samples. Racehorse urine samples were collected on race day and steroids deconjugated and extracted using routine processes. The extracted steroids were resuspended in ethanol and subjected to the assay.
Data from
The main components of the androgen screening assay are the steroid hormone response element (HRE) and the steroid hormone receptor (SHR), that is held in an inactive state by a coregulatory protein in the absence of ligand. In the presence of ligand, the regulator protein is released from the SHR, and the liganded-SHR binds to the HRE that is encoded on a double-stranded DNA reporter construct.
In this Example, the DNA reporter construct encodes an RNA polymerase promoter site, an HRE, and an RNA aptamer, although the skilled person would recognize that fluorophore bound RNA aptamer could be replaced by any other reporter construct, including the other examples described herein.
In this Example, the RNA polymerase is the T7 enzyme, a recombinant single protein RNA polymerase. The DNA reporter construct then encodes downstream from the T7 site, a series, or a single, HRE, with an RNA aptamer reporter located further downstream. When T7 is active, it will bind to its promoter and transcribe this DNA fragment producing an RNA aptamer. This RNA aptamer acts as the reporter. When this T7 reaction is performed in the presence of a steroid hormone, the steroid hormone will bind to its SHR, dislodge the coregulatory protein, and the steroid hormone-SHR will bind to the HRE. In this position, the SHR will physically inhibit T7 RNA polymerase from transcribing the RNA aptamer. Therefore, the fluorescence readout is reduced in the presence of a steroid hormone ligand.
The key components of the assay include the T7 RNA polymerase and the recombinant SHR protein. For purposes of producing an assay that is cost-effective, rapid and reproducible, the activity of both the RNA polymerase and the SHR protein were interrogated, with the example of SHR being the androgen receptor (AR). However, a person skilled in the art would appreciate that androgen receptor could be switched for any steroid hormone receptor, including estrogen hormone receptor to achieve the same or similar outputs to those outlined below
The reaction mix used in the experiments which follow is reflected in Table 11.
Recombinant AR protein is costly to produce in the quantities needed for scale-up production. Recombinant AR is also difficult to handle as it requires cold temperature storage and its large size renders it susceptible to degradation. Recombinant AR protein is expressed in genetically modified cells where the host cells maybe yeast, insect, bacteria, or mammalian. Once expressed within the cell, a lengthy process is performed to purify recombinant AR from all other cellular proteins. As the AR protein is a large protein of 110 kDa, the purification process is made even more difficult to ensure full-length and active protein. Understandably, there is substantial cost to the purchase, or production, of this protein.
In the cell, inactive AR is located in the cytoplasm or in its ligand-activated state, AR is found in the nucleus. In over-expression cell systems whereby, the plasmid encodes a highly active constitutive promoter, AR is expressed at much higher levels than normal, even in the absence of androgens leading to large amounts of inactive AR.
One of the first steps when purifying recombinant AR protein is to produce a cell lysate. This cell lysate contains all cellular material including the proteins. The over-expressed AR will be in this pool of proteins.
To override the need to use purified recombinant AR protein in the androgen screening assay, Applicants tested whether a whole cell lysate from HEK293 cells could act as the source of AR. A commercially available transient overexpression lysate of AR (transcript variant 1, NM_000044, OriGene, LY400012) where the expression host was HEK293T cells (human embryonic kidney cells) was used. As the AR concentration is not known, the experiments initially used the lysate at a protein concentration of 25 ng/μl.
The absolute concentration of AR is not known in the AR cell lysate. The AR lysate concentration that was most effective in the reaction was next empirically determined. The AR lysate was titrated from 150 ng/μl to 6.25 ng/μl. The results show that the slope of the line was highest for 40 ng/μl of lysate, with a range of 30-50 ng/μl being the strongest (
Previously, it has been determined that a HSP90:AR ratio of 2:1 is optimal, however a range 8:1 is tolerated with probable redundancy. Using an AR lysate it is not possible to determine absolute AR concentration and subsequently, determine a 2:1 HSP90:AR ratio. Instead, the ratio was empirically derived with the ratio based on the total protein concentration of the cell lysate and a HSP90:AR lysate of 2:1 based on ng/μl was maintained (
Together, these data show that the AR lysate concentration used in the assay can vary from, at least, 6.25 ng/μl to 150 ng/μl. The wide range in lysate concentration tolerated is encouraging for probable batch-to-batch variation. It is expected that different batches of AR lysate will vary in AR content. To test the effect of AR lysate variation on the reliability of the androgen screening assay, two commercially sourced OriGene AR lysates (#OA741, #O11311) were compared. These data are presented in
To further explore inter-variability amongst batches, the androgen screening assay was performed with in-house prepared AR lysate preparations (refer to Example 8, below). HEK293 cells stably transformed with a human AR expression plasmid were cultured and from these cells, a cell lysate, a cytoplasm- and a nuclear extract were prepared. The cytoplasm- and nuclear extracts were prepared as AR is sequestered in the cytoplasm and nucleus so it was hypothesized that concentrated AR in these extracts would perform better than total cell lysate.
Given that the in-house HEK293 cell lysate was functional in the androgen screening assay, the next series of experiments returned to the question of inter-variability. Six independent in-house HEK293 cell lysates were prepared, and tested alongside the recombinant AR protein, in the androgen screening assay. All six batches of HEK293 lysate functioned in the assay (
An important consideration with the use of the cell lysate is that it may contain a number of endogenous SHRs, including glucocorticoid receptor (GR). GR can cross-react with AR at AREs because GR and AR both recognize similar response elements. However, GR should not be activated by testosterone in the androgen screening assay, although it is possible that during the culture of the HEK293 cells endogenous ligands could have activated GR. If ligand-activated GR is present this could produce a false positive result for the androgen screening assay.
To test if ligand-activated GR was present in the HEK293 AR lysates, the androgen screening assay was activated with a common glucocorticoid, dexamethasone.
Another potential confounder of the androgen screening assay is estradiol (E2). E2 at extremely high, non-physiological, concentrations can activate AR. Standard cell culture conditions should not produce high levels of E2, or any other estrogen. However, to determine the responsiveness of the androgen screening assay to high concentrations of E2, reactions were performed with AR lysate and activated by 1 nM E2.
The major endogenous androgen is testosterone. The AR lysate-based androgen screening assay responds well to testosterone. There are synthetic steroids, called anabolic androgenic steroids (AAS) and synthetic androgenic molecules, called selective androgen receptor modulators (SARMs). The androgen screening assay with the cell lysate as source of AR was tested for its ability to detect the synthetic steroid, 11keto-testosterone, and the SARM, andarine. The results presented in
The androgen screening assay has been designed to detect not only purified compounds but also the relative androgen bioactivity of biological samples. To show that the AR lysate-based androgen screening assay could differentiate relative androgen bioactivity, two equine plasma samples of known high and low values were tested. The androgen screening assay was established with AR lysate at 50 ng/reaction and 15% (v/v) plasma. The results show that the AR lysate-androgen screening assay could detect a difference between the two equine plasma samples and was, at least, equal to the recombinant AR (n=1,
In humans, circulating androgens are higher in males than females by an average of 10-20-fold. A commercially available human male serum (single donor) was compared to a commercially available human female serum (single donor). The androgen screening assay was used with AR lysate at 50 ng/reaction. The assay was performed using 15% v/v serum samples. The results show that male serum more strongly suppressed T7 activity relative to the female serum (
In summary, the AR lysate is able to mimic recombinant AR in the androgen screening assay. The AR lysate is responsive to both purified androgen compounds such as designer androgens and SARMs as well as endogenous androgens present in the biological matrices such as plasma and serum. The use of AR lysate markedly decreases the potential cost of the androgen screening assay because there is no need for extensive and expensive purification steps.
There are additional advantages to using AR lysate:
Production of Androgen Receptor Cell Lysate in Hek Cell Lines HEK293 cells stably transformed with a human AR cDNA expression plasmid were cultured to 90% confluence in DMEM media supplemented with 10% fetal bovine serum, 1% penicillin/streptomycin and 5.5 μg/mL puromycin. Cells were harvested by washing 1×PBS and then scraping cells with a 1.7 ml Eppendorf tube. Cells are centrifuged at 4° C. at 800×g for 5 mins to pellet the cells. Wash cells with 500 ul PBS by resuspension followed by centrifugation at 500×g for 2-3 mins at 4° C. The cytoplasmic and nuclear extract protocol was then as described by the ThermoFisher Scientific NE-PER Nuclear and Cytoplasmic Extraction Reagents kit (ThermoFisher Scientific #78835). For the total cell extract, the cell pellet was resuspended in ice-cold RIPA buffer (50 mM Tris-HCl pH7.4, 150 mM NaCl, 0.1% SDS, 1% Triton X-100, 1 mM EDTA). Every 5 ml RIPA buffer was supplemented with the inhibitors, 200 ul cOmplete (cOmplete Protease Inhibitor Cocktail, Sigma-Aldrich, 25×), 500 μl PhosSTOP (PhosSTOP Phosphatase Inhibitor Cocktail, Sigma-Aldrich, 10×) and 50 μuL phenylmethylsulfonylfluoride (Sigma-Aldrich, 100 mM). The cells were incubated in RIPA lysis buffer for 30 mins, vortexed then centrifuged at 14,000×g for 10 mins at 4° C. The cell lysate was aliquoted into 1.5 ml Eppendorf tubes for storage at −20° C. the cell lysate is diluted in Protein Stabilizing Cocktail for assays.
The next series of experiments tested promoter variations of T7 RNA polymerase. T7 RNA polymerase initiates RNA transcription by binding to a consensus, specific DNA binding site. The binding site, or promoter, can be just 18 bp (SEQ ID NO: 82). For example, this 18 bp sequence is routinely added to a DNA template by PCR, when the DNA template is to be used to PCR to produce RNA.
The wild-type T7 binding site is 23 bp, with the extra base pairs included at the 3′ end (SEQ ID NO: 83).
In the literature, variant promoters have been described whereby an altered DNA sequence leads to increased T7 activity. For example, the wild-type 23 bp 3′ sequence has been modified and such modification reportedly increases T7 promoter activity by ˜ 2-fold (SEQ ID NO: 84). In another example, a substantially longer promoter sequence with modifications to both the 5′ and 3′ sequence reportedly increased T7 promoter activity by up to 23-fold (SEQ ID NO: 84) (Moll et al. (2004) Anal Biochem 334:164-174).
In summary, SEQ ID NO: 85 has been shown to be a stronger T7 promoter for use in the androgen screening assay.
The specificity of SEQ ID NO: 85-based androgen screening assay was tested by evaluating the response to estradiol and dexamethasone.
Given that SEQ ID NO: 85-based reactions produced more fluorescence output, the reactions were next interrogated at the molecular level. The initial rate of reaction to produce MangoII (fluorescence output) is founded on the key event of T7 to DNA binding. The binding of the polymerase triggers subsequent initiation/elongation steps. This entire event is highly dependent on the T7 promoter sequence, the amount of T7 and the DNA concentration. It follows that if T7 binds the DNA sequence rapidly and efficiently, the transcription of the RNA will be higher.
Ideally, the optimal reaction would have every DNA template bound by a T7 RNA polymerase. However, AR levels also need to be considered in the androgen screening assay because if AR levels are too low, and T7 exceeds AR, then there will be excess DNA template bound by T7 RNA polymerase, that will allow T7 transcription to occur unhindered. A subsequent high baseline could mask limited AR suppression of T7.
To optimize the androgen screening assay, an AR:T7/DNA ratio of >1 is desirable, with the T7:DNA ratio being as ≥1.
In the reaction described for
In summary, T7SEQ ID NO: 85-androgen screening assay allows for a faster, reproducible test. The reaction time has reduced from 150 mins to 40 mins, with greater change from vehicle controls.
To explore the use of alternate host cells, the androgen screening assay was performed with in-house (inventor's laboratory) AR lysate preparations from AR-expressing Pc-3 cells. Pc-3 cells were originally isolated from bone metastasis of grade IV prostatic adenocarcinoma and reportedly express a range of AR coregulator proteins, including GRIP1, BRCA1, and Zac1 (PMID: 15264248). From Pc-3 cells, cell extracts were prepared and utilized as the source of AR in the cell-free reactions.
For a cell-free reaction, a master mix was prepared with components added in this order: NTP buffer (NEB2052AVIAL component of E2050S), 50 ng DNA template (Seq. ID NO:85), Pc-3 lysate (40 ng), HSP90 (80 ng), testosterone, andarine or ethanol as vehicle control), and T7 RNA polymerase mix. The master mix was gently mixed by pipetting up and down and incubated at 37° C. for 40 minutes. The detection buffer was then added consisting of TO1B (100 nM final concentration) in a 200 mM KCl, 10 mM, Na2HPO4, 0.05% Tween 20 and pH 7.2 solution. The fluorescence was measured using a Spectramax i3× (Molecular Devices) plate reader with excitation 510 nm and emission 535 nm (bandwidth 15 nm).
These data indicate that cell lysate from AR-expressing cells functions efficiently in the cell-free reactions and can be used to substitute recombinant AR.
To test the sensitivity of Pc-3 AR lysate-driven androgen detection, the reactions used above were performed with decreasing concentrations of testosterone, with the exception that the reactions were established with 25 ng Pc-3 AR lysate.
To test that the ligand-dependent induction of the AR lysate-driven reactions was not just specific to testosterone, a number of anabolic androgenic steroids or alternate testosterone preparations that are commonly detected as used by athletes were substituted for testosterone as the activator of AR.
To test different androgens, a master mix was prepared with components added in this order: NTP buffer (NEB2052AVIAL component of E2050S), 50 ng DNA template (SEQ ID NO: 85), Pc-3 lysate (40 ng), HSP90 (80 ng), and T7 RNA polymerase mix. The master mix was gently mixed by pipetting up and down and aliquoted into individual wells. The steroids being tested were then added to a final concentration of 100 μM and incubated at 37° C. for 40 minutes. The detection buffer was then added consisting of TO1B (100 nM final concentration) in a 200 mM KCl, 10 mM, Na2HPO4, 0.05% Tween 20 and pH 7.2 solution. The fluorescence was measured using a Spectramax i3× (Molecular Devices) plate reader with excitation 510 nm and emission 535 nm (bandwidth 15 nm).
Finally,
Applicants previously demonstrated that a spacer length of 15 bp (SEQ ID NO: 86) was better able to support testosterone-activated AR blockade of T7 RNA polymerase activity (
To test the different DNA templates, a master mix was prepared with components added in this order: in-house reaction buffer, NTP mix (1 mM), DNA template (50 ng), Pc-3 lysate (50 ng), HSP90 (100 ng), testosterone (250 μM) or ethanol (5%). The master mix was gently mixed by pipetting up and down and aliquoted into individual wells and NEB Hi-T7 T7 RNA polymerase (50U) was added and reactions incubated at 50° C. for 40 minutes. The detection buffer was then added consisting of Y03 (100 nM final concentration) in a 200 mM KCl, 10 mM Na2HPO4, 0.05% Tween 20 and pH 7.2 solution. The fluorescence was measured using a Spectramax i3× (Molecular Devices) plate reader with excitation 595 nm and emission 620 nm (bandwidth 15 nm).
Irrespective, each of the different spacers used in these experiments were able to detect testosterone, adding further support to the feature of a spacer length defined by between about 2 and about 32 nucleotides.
The signals that influence the level of transcriptional output include the sequence composition of cis-regulatory elements, including the steroid hormone response elements. For AR, the sequence of the DNA binding motif modulates the receptor's activity. The ARE comprises two inverted repeats of two half-sites of 6 bp separated by a 3 bp spacer. This 15 bp standard ARE is of the consensus sequence AGAACAGCCTGTTCT (SEQ ID NO: 93). The AGAACA (SEQ ID NO: 98) and TGTTCT (SEQ ID NO: 99) sequences represent where the AR dimer binds to the double stranded DNA, however the immediate flanking base pairs can influence activity of steroid hormone receptors, as can the make-up of the 3 bp spacer.
In our exemplary sequence of T7-ARE-MangoII, the ARE (solid underline) is flanked by a G/C combination. To understand whether altering the flanking base pairs to A/T rather than G/C improves the efficacy of the androgen screening assay, SEQ ID Nos: 94 and 95 were tested (Table 15).
In addition to the flanking sequences, the 3 bp spacer sequence can alter steroid hormone receptor activity. To determine if altering the G to T or C to A influences the efficacy of the androgen screening assay, SEQ ID Nos: 96 and 97 were tested (Table 15).
A
AGAACAGCCTGTTCT
A
T
AGAACAGCCTGTTCT
T
Although the invention has been described by way of example, it should be appreciated that variations and modifications may be made without departing from the scope of the invention as defined in the claims. Furthermore, where known equivalents exist to specific features, such equivalents are incorporated as if specifically referred in this specification.
All patents, publications, scientific articles, web sites, and other documents and materials referenced or mentioned herein are indicative of the levels of skill of those skilled in the art to which the invention pertains, and each such referenced document and material is hereby incorporated by reference to the same extent as if it had been incorporated by reference in its entirety individually or set forth herein in its entirety. Applicants reserve the right to physically incorporate into this specification any and all materials and information from any such patents, publications, scientific articles, web sites, electronically available information, and other referenced materials or documents.
The terms and expressions that have been employed are used as terms of description and not of limitation, and there is no intent in the use of such terms and expressions to exclude any equivalent of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention as claimed. Thus, it will be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts disclosed herein may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as described herein, and as defined by the appended claims.
The invention has been described broadly and generically herein. Each of the narrower species and sub-generic groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.
Other examples are within the following claims. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/NZ2021/050201 | 11/12/2021 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63112924 | Nov 2020 | US |
