Nucleic acid based data storage using enzymatic bioencryption

Information

  • Patent Grant
  • 11550939
  • Patent Number
    11,550,939
  • Date Filed
    Thursday, February 22, 2018
    8 years ago
  • Date Issued
    Tuesday, January 10, 2023
    3 years ago
Abstract
Provided herein are compositions, devices, systems and methods for the generation and use of secured biomolecule-based information for storage. Further described herein are compositions, devices, systems and methods for bioencryption or biodecryption of information. Conversion of a digital sequence to a nucleic based sequence includes a step of selection of one or more bioencryption methods.
Description
SEQUENCE LISTING

The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Feb. 20, 2018, is named 44854-738_201_SL.txt and is 8,636 bytes in size.


BACKGROUND

Biomolecule based information storage systems, e.g., DNA-based, have a large storage capacity and stability over time. However, there is a need for scalable, automated, highly accurate and highly efficient systems for biomolecules for information storage. In addition, there is a need for protecting the security of such information.


INCORPORATION BY REFERENCE

All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.


BRIEF SUMMARY

Provided herein are methods for storing information, the method comprising: (a) receiving at least one item of information in a form of at least one digital sequence; (b) receiving instructions for selection of at least one bioencryption format, wherein the bioencryption format is enzymatic, electromagnetic, chemical, or affinity based bioencryption; (c) converting the at least one digital sequence to a plurality of oligonucleotide sequences based on the selected bioencryption format; (d) synthesizing a plurality of oligonucleotides encoding for the oligonucleotide sequences; and (e) storing the plurality of oligonucleotides. Further provided herein are methods for storing information, wherein the enzymatic based bioencryption comprises CRISPR/Cas based bioencryption. Further provided herein are methods for storing information, wherein the enzymatic based bioencryption comprises instructions for synthesis of the oligonucleotides which are sensitive to an enzyme as set out in Table 1. Further provided herein are methods for storing information, wherein the electromagnetic based bioencryption comprises instructions for synthesis of the oligonucleotides which are sensitive to electromagnetic wavelengths of about 0.01 nm to about 400 nm. Further provided herein are methods for storing information, wherein the chemical based bioencryption comprises instructions for synthesis of the oligonucleotides which are sensitive to gaseous ammonia or methylamine administration. Further provided herein are methods for storing information, wherein the affinity based bioencryption comprises instructions for synthesis of the oligonucleotides which are sensitive to a sequence tag or affinity tag. Further provided herein are methods for storing information, wherein the affinity tag is biotin, digoxigenin, Ni-Nitrilotriacetic acid, desthiobiotin, histidine, polyhistidine, myc, hemagglutinin (HA), FLAG, a fluorescence tag, a tandem affinity purification (TAP) tag, glutathione S transferase (GST), a polynucleotide, an aptamer, an antigen, or an antibody. Further provided herein are methods for storing information, wherein 2, 3, 4, or 5 bioencryption formats are used. Further provided herein are methods for storing information, wherein the plurality of oligonucleotides comprises at least 100,000 oligonucleotides. Further provided herein are methods for storing information, wherein the plurality of oligonucleotides comprises at least 10 billion oligonucleotides.


Provided herein are methods for retrieving information, the method comprising: (a) releasing a plurality of oligonucleotides from a surface; (b) applying an enzymatic, electromagnetic, chemical, or affinity based decryption to the plurality of oligonucleotides; (c) enriching the plurality of oligonucleotides; (d) sequencing enriched oligonucleotides from the plurality of oligonucleotides to generate nucleic acid sequences; and (e) converting the nucleic acid sequences to at least one digital sequence, wherein the at least one digital sequence encodes for at least one item of information. Further provided herein are methods for retrieving information, wherein decryption of the plurality of oligonucleotides comprises applying a CRISPR/Cas complex to the plurality of oligonucleotides. Further provided herein are methods for retrieving information, wherein the enzymatic based decryption comprises applying an enzyme as set out in Table 1. Further provided herein are methods for retrieving information, wherein the electromagnetic based decryption comprises applying wavelengths of about 0.01 nm to about 400 nm. Further provided herein are methods for retrieving information, wherein the chemical based decryption comprises applying gaseous ammonia or methylamine administration. Further provided herein are methods for retrieving information, wherein the affinity based decryption comprises applying a sequence tag or affinity tag. Further provided herein are methods for retrieving information, wherein the affinity tag is biotin, digoxigenin, Ni-Nitrilotriacetic acid, desthiobiotin, histidine, polyhistidine, myc, hemagglutinin (HA), FLAG, a fluorescence tag, a tandem affinity purification (TAP) tag, glutathione S transferase (GST), a polynucleotide, an aptamer, an antigen, or an antibody. Further provided herein are methods for retrieving information, wherein 2, 3, 4, or 5 forms of decryption are used.


Provided herein are systems for storing information, the system comprising: (a) a receiving unit for receiving machine instructions for at least one item of information in a form of at least one digital sequence, and machine instructions for selection of at least one bioencryption format, wherein the bioencryption format is enzymatic, electromagnetic, chemical, or affinity based bioencryption; (b) a processor unit for automatically converting the at least one digital sequence to a plurality of oligonucleotide sequences based on the selected bioencryption format; (c) a synthesizer unit for receiving machine instructions from the processor unit for synthesizing a plurality of oligonucleotides encoding for the oligonucleotide sequences; and (d) a storage unit for receiving the plurality of oligonucleotides deposited from the synthesizer unit. Further provided herein are systems for storing information, wherein the enzymatic based bioencryption comprises CRISPR/Cas based bioencryption. Further provided herein are systems for storing information, wherein the enzymatic based bioencryption comprises machine instructions for synthesis of the oligonucleotides which are sensitive to an enzyme as set out in Table 1. Further provided herein are systems for storing information, wherein the electromagnetic based bioencryption comprises machine instructions for synthesis of the oligonucleotides which are sensitive to electromagnetic wavelengths of about 0.01 nm to about 400 nm. Further provided herein are systems for storing information, wherein the chemical based bioencryption comprises machine instructions for synthesis of the oligonucleotides which are sensitive to gaseous ammonia or methylamine administration. Further provided herein are systems for storing information, wherein the affinity based bioencryption comprises instructions for synthesis of the oligonucleotides which are sensitive to a sequence tag or affinity tag. Further provided herein are systems for storing information, wherein the affinity tag is biotin, digoxigenin, Ni-Nitrilotriacetic acid, desthiobiotin, histidine, polyhistidine, myc, hemagglutinin (HA), FLAG, a fluorescence tag, a tandem affinity purification (TAP) tag, glutathione S transferase (GST), a polynucleotide, an aptamer, an antigen, or an antibody. Further provided herein are systems for storing information, wherein the plurality of oligonucleotides comprises at least 100,000 oligonucleotides. Further provided herein are systems for storing information, wherein the plurality of oligonucleotides comprises at least 10 billion oligonucleotides.


Provided herein are systems for retrieving information, the method comprising: (a) a storage unit comprising a plurality of oligonucleotides on a surface; (b) a deposition unit for applying an enzymatic, electromagnetic, chemical, or affinity based bioencryption to the plurality of oligonucleotides; (c) a sequencing unit for sequencing the plurality of oligonucleotides to obtain nucleic acid sequences; and (d) a processor unit for automatically converting the nucleic acid sequences to at least one digital sequence, wherein the at least one digital sequence encodes for at least one item of information. Further provided herein are systems for retrieving information, wherein the deposition unit applies CRISPR/Cas complex to the plurality of oligonucleotides. Further provided herein are systems for retrieving information, wherein the enzymatic based bioencryption comprises applying an enzyme as set out in Table 1. Further provided herein are systems for retrieving information, wherein the electromagnetic based bioencryption comprises applying wavelengths of about 0.01 nm to about 400 nm. Further provided herein are systems for retrieving information, wherein the chemical based bioencryption comprises applying gaseous ammonia or methylamine administration. Further provided herein are systems for retrieving information, wherein the affinity based bioencryption comprises a sequence tag or affinity tag. Further provided herein are systems for retrieving information, wherein the affinity tag is biotin, digoxigenin, Ni-Nitrilotriacetic acid, desthiobiotin, histidine, polyhistidine, myc, hemagglutinin (HA), FLAG, a fluorescence tag, a tandem affinity purification (TAP) tag, glutathione S transferase (GST), a polynucleotide, an aptamer, an antigen, or an antibody.


Provided herein are methods for storing information, the method comprising: (a) receiving at least one item of information in a form of at least one digital sequence; (b) receiving instructions for at least one form of bioencryption; (c) converting the at least one digital sequence to a plurality of bioencrypted oligonucleotide sequences; (d) synthesizing the plurality of bioencrypted oligonucleotide sequences; and (e) storing the plurality of oligonucleotides.


Provided herein are methods for storing information, the method comprising: (a) receiving at least one item of information in a form of at least one digital sequence; (b) receiving instructions for an enzymatic, electromagnetic, chemical, or affinity based bioencryption; (c) converting the at least one digital sequence to a plurality of bioencrypted oligonucleotide sequences; (d) synthesizing the plurality of bioencrypted oligonucleotide sequences; and (e) storing the plurality of oligonucleotides.


Provided herein are methods for storing information, the method comprising: (a) receiving at least one item of information in a form of at least one digital sequence; (b) converting the at least one digital sequence to a plurality of bioencrypted oligonucleotide sequences, wherein each of the bioencrypted oligonucleotide sequences comprise additional sequences encoded for removal by CRISPR/Cas complex; (c) synthesizing the plurality of bioencrypted oligonucleotide sequences; and (d) storing the plurality of oligonucleotides.


Provided herein are methods for retrieving information, the method comprising: (a) releasing a plurality of oligonucleotides from a surface; (b) applying at least one form of biodecryption to the plurality of oligonucleotides; (c) enriching the plurality of oligonucleotides, thereby selecting a plurality of enriched oligonucleotides; (d) sequencing the enriched oligonucleotides to generate nucleic acid sequences; and (e) converting the nucleic acid sequences to at least one digital sequence, wherein the at least one digital sequence encodes for at least one item of information.


Provided herein are methods for retrieving information, the method comprising: (a) releasing a plurality of oligonucleotides from a surface; (b) applying an enzymatic, electromagnetic, chemical, or affinity based decryption to the plurality of oligonucleotides; (c) enriching the plurality of oligonucleotides, thereby selecting a plurality of enriched oligonucleotides; (d) sequencing the enriched oligonucleotides to generate nucleic acid sequences; and (e) converting the nucleic acid sequences to at least one digital sequence, wherein the at least one digital sequence encodes for at least one item of information.


Provided herein are methods for retrieving information, the method comprising: (a) releasing a plurality of oligonucleotides from a surface; (b) applying as CRISPR/Cas complex to the plurality of oligonucleotides; (c) enriching the plurality of oligonucleotides, thereby selecting a plurality of enriched oligonucleotides; (d) sequencing the enriched oligonucleotides to generate nucleic acid sequences; and (e) converting the nucleic acid sequences to at least one digital sequence, wherein the at least one digital sequence encodes for at least one item of information.


Provided herein are systems for storing information, the system comprising: (a) a receiving unit for receiving machine instructions for at least one item of information in a form of at least one digital sequence, and machine instructions for at least one form of bioencryption; (b) a processor unit for converting the at least one digital sequence to a plurality of bioencrypted oligonucleotide sequences; (c) a synthesizer unit for receiving machine instructions from the processor unit for synthesizing the plurality of bioencrypted oligonucleotide sequences; and (d) a storage unit for receiving the plurality of oligonucleotides deposited from the synthesizer unit.


Provided herein are systems for storing information, the system comprising: (a) a receiving unit for receiving machine instructions for at least one item of information in a form of at least one digital sequence, and machine instructions for an enzymatic, electromagnetic, chemical, or affinity based bioencryption; (b) a processor unit for converting the at least one digital sequence to a plurality of bioencrypted oligonucleotide sequences; (c) a synthesizer unit for receiving machine instructions from the processor unit for synthesizing the plurality of bioencrypted oligonucleotide sequences; and (d) a storage unit for receiving the plurality of oligonucleotides deposited from the synthesizer unit.


Provided herein are systems for storing information, the system comprising: (a) a receiving unit for receiving machine instructions for at least one item of information in a form of at least one digital sequence, and machine instructions for bioencryption by CRISPR/Cas complex; (b) processor unit for converting the at least one digital sequence to a plurality of bioencrypted oligonucleotide sequences; (c) a synthesizer unit for receiving machine instructions from the processor unit for synthesizing the plurality of bioencrypted oligonucleotide sequences; and (d) a storage unit for receiving the plurality of oligonucleotides deposited from the synthesizer unit.


Provided herein are systems for retrieving information, the method comprising: (a) a storage unit comprising a plurality of oligonucleotides on a surface; (b) a deposition unit for applying at least one form of biodecryption to the plurality of oligonucleotides; (c) a sequencing unit for sequencing the plurality of oligonucleotides to obtain nucleic acid sequence; and (d) a processor unit for converting the nucleic acid sequences to at least one digital sequence, wherein the at least one digital sequence encodes for at least one item of information.


Provided herein are systems for retrieving information, the method comprising: (a) a storage unit comprising a plurality of oligonucleotides on a surface; (b) a deposition unit for applying at least an enzymatic, electromagnetic, chemical, or affinity based bioencryption to the plurality of oligonucleotides; (c) a sequencing unit for sequencing the plurality of oligonucleotides to obtain nucleic acid sequence; and (d) a processor unit for converting the nucleic acid sequences to at least one digital sequence, wherein the at least one digital sequence encodes for at least one item of information.


Provided herein are systems for retrieving information, the method comprising: (a) a storage unit comprising a plurality of oligonucleotides on a surface; (b) a deposition unit for applying CRISPR/Cas complex to the plurality of oligonucleotides; (c) a sequencing unit for sequencing the plurality of oligonucleotides to obtain nucleic acid sequence; and (d) a processor unit for converting the nucleic acid sequences to at least one digital sequence, wherein the at least one digital sequence encodes for at least one item of information.





BRIEF DESCRIPTION OF THE DRAWINGS

The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:



FIG. 1 illustrates an exemplary workflow for nucleic acid-based data storage.



FIG. 2 illustrates an exemplary workflow for storage for bioencryption.



FIG. 3 illustrates an exemplary workflow for retrieval following bioencryption.



FIGS. 4A-4B depict a bioencryption method using a Cas enzyme.



FIGS. 5A-5C depict various oligonucleotide sequence design schemes.



FIGS. 6A-6C depict various oligonucleotide sequence design schemes.



FIGS. 7A-7B depict a barcode design scheme.



FIG. 8 illustrates a plate configured for oligonucleotide synthesis comprising 24 regions, or sub-fields, each having an array of 256 clusters.



FIG. 9 illustrates a closer view of the sub-field in FIG. 8 having 16×16 of clusters, each cluster having 121 individual loci.



FIG. 10 illustrates a detailed view of the cluster in FIG. 8, where the cluster has 121 loci.



FIG. 11A illustrates a front view of a plate with a plurality of channels.



FIG. 11B illustrates a sectional view of plate with a plurality of channels.



FIGS. 12A-12B depict a continuous loop and reel-to-reel arrangements for flexible structures.



FIGS. 13A-13C depict a zoom in of a flexible structure, having flat features (loci), channels, or wells, respectively.



FIG. 14A illustrates a zoom in of features on a structure described herein.



FIGS. 14B-14C illustrate markings on structures described herein.



FIG. 15 illustrates an oligonucleotide synthesis material deposition device.



FIG. 16 illustrates an oligonucleotide synthesis workflow.



FIG. 17 illustrates an example of a computer system.



FIG. 18 is a block diagram illustrating architecture of a computer system.



FIG. 19 is a diagram demonstrating a network configured to incorporate a plurality of computer systems, a plurality of cell phones and personal data assistants, and Network Attached Storage (NAS).



FIG. 20 is a block diagram of a multiprocessor computer system using a shared virtual address memory space.





DETAILED DESCRIPTION

Definitions


Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which these inventions belong.


Throughout this disclosure, various embodiments are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of any embodiments. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range to the tenth of the unit of the lower limit unless the context clearly dictates otherwise. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual values within that range, for example, 1.1, 2, 2.3, 5, and 5.9. This applies regardless of the breadth of the range. The upper and lower limits of these intervening ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention, unless the context clearly dictates otherwise.


The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of any embodiment. As used herein, the singular forms “a,” “an,” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. It will be further understood that the terms “comprises” and/or “comprising,” when used in this specification, specify the presence of stated features, integers, steps, operations, elements, and/or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and/or groups thereof. As used herein, the term “and/or” includes any and all combinations of one or more of the associated listed items.


Unless specifically stated or obvious from context, as used herein, the term “about” in reference to a number or range of numbers is understood to mean the stated number and numbers +/−10% thereof, or 10% below the lower listed limit and 10% above the higher listed limit for the values listed for a range.


The term “oligonucleotide” as used herein is used interchangeably with “oligonucleic acid.” The terms “oligonucleotide” and “oligonucleic acid” encompass double- or triple-stranded nucleic acids, as well as single-stranded molecules.


Nucleic Acid Based Information Storage


Provided herein are devices, compositions, systems, and methods for nucleic acid-based information (data) storage. An exemplary workflow is provided in FIG. 1. In a first step, a digital sequence encoding an item of information (i.e., digital information in a binary code for processing by a computer) is received 101. An encryption 103 scheme is applied to convert the digital sequence from a binary code to a nucleic acid sequence 105. A surface material for nucleic acid extension, a design for loci for nucleic acid extension (aka, arrangement spots), and reagents for nucleic acid synthesis are selected 107. The surface of a structure is prepared for nucleic acid synthesis 108. De novo oligonucleotide synthesis is performed 109. The synthesized oligonucleotides are stored 111 and available for subsequent release 113, in whole or in part. Once released, the oligonucleotides, in whole or in part, are sequenced 115, and subject to decryption 117 to convert the nucleic sequence back to the digital sequence. The digital sequence is then assembled 119 to obtain an alignment encoding for the original item of information.


Further provided herein are methods and systems for secured DNA-based information storage including receipt of one or more digital sequences encoding for at least one item of information 201, conversion of the one or more digital sequences to a nucleic acid sequence 203, encryption of the nucleic acid sequence 205, and de novo oligonucleotide synthesis of the encrypted nucleic acid sequence 207. See FIG. 2.


Provided herein are devices, compositions, systems, and methods for nucleic acid-based information storage, wherein machine instructions are received for conversion from a digital sequence to a nucleic acid sequence, bioencryption, biodecryption, or a combination of any of these steps. Machine instructions may be received for desired items of information for conversion and for one or more types of bioencryption selected from a list of options, for example, without limitation, enzymatic based (e.g., CRISPR/Cas complex or restriction enzyme digest), electromagnetic radiation based (e.g., photolysis or photodetection), chemical cleavage (e.g, gaseous ammonia or methylamine treatment to cleave Thymidine-succinyl hexamide CED phosphoramidite (CLP-2244 from ChemGenes)), and affinity based (e.g., a sequence tag for hybridization, or incorporation of modified nucleotides with enhanced affinity to a capture reagent) forms of bioencryption. Following receipt of a particular bioencryption selection, a program module performs the step of converting the item of information to nucleic acid sequence and applying design instructions for design of a bioencrypted version of the sequence, before providing synthesis instructions to a material deposition device for de novo synthesis of oligonucleotides. In some instances, machine instructions for selection of one or more species within a category of bioencryption are provided.


Further provided herein are methods and systems for secured DNA-based information retrieval including release of oligonucleotides from a surface 301, enrichment of desired oligonucleotides 303, sequencing of the oligonucleotides 305, decryption of the nucleic acid sequence 307, and assembly of one or more digital sequences encoding for an item of information 309. See FIG. 3.


Machine instructions as described herein may also be provided for biodecryption. Biodecryption may comprise receipt of machine instructions. Such instructions may include one or more formats of biodecryption selected from a list of options, for example, without limitation, enzymatic based (e.g., CRISPR/Cas complex or restriction enzyme digest), electromagnetic radiation based (e.g., photolysis or photodetection), chemical cleavage (e.g, gaseous ammonia or methylamine treatment to cleave Thymidine-succinyl hexamide CED phosphoramidite (CLP-2244 from ChemGenes)), and affinity based (e.g., nucleic acid sequences for hybridization, or incorporation of modified nucleotides with enhanced affinity to a capture reagent) forms of biodecryption of the oligonucleotides. Following receipt of a particular biodecryption selection, a program module performs the step releasing the modulatory agent(s) for enrichment of the oligonucleotides. Following enrichment, the oligonucleotides are sequenced, optionally aligned to a longer nucleic acid sequence, and converted to a digital sequence corresponding to an item of information. In some instances, machine instructions for selection of one or more species within a category of biodecryption are provided.


Items of Information


Optionally, an early step of a DNA data storage process disclosed herein includes obtaining or receiving one or more items of information in the form of an initial code (e.g., digital sequence). Items of information include, without limitation, text, audio and visual information. Exemplary sources for items of information include, without limitation, books, periodicals, electronic databases, medical records, letters, forms, voice recordings, animal recordings, biological profiles, broadcasts, films, short videos, emails, bookkeeping phone logs, internet activity logs, drawings, paintings, prints, photographs, pixelated graphics, and software code. Exemplary biological profile sources for items of information include, without limitation, gene libraries, genomes, gene expression data, and protein activity data. Exemplary formats for items of information include, without limitation, .txt, .PDF, .doc, .docx, .ppt, .pptx, .xls, .xlsx, .rtf, .jpg, .gif, .psd, .bmp, .tiff, .png, and .mpeg. The amount of individual file sizes encoding for an item of information, or a plurality of files encoding for items of information, in digital format include, without limitation, up to 1024 bytes (equal to 1 KB), 1024 KB (equal to 1 MB), 1024 MB (equal to 1 GB), 1024 GB (equal to 1TB), 1024 TB (equal to 1 PB), 1 exabyte, 1 zettabyte, 1 yottabyte, 1 xenottabyte or more. In some instances, an amount of digital information is at least or about 1 gigabyte (GB). In some instances, the amount of digital information is at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more than 1000 gigabytes. In some instances, the amount of digital information is at least or about 1 terabyte (TB). In some instances, the amount of digital information is at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more than 1000 terabytes. In some instances, the amount of digital information is at least or about 1 petabyte (PB). In some instances, the amount of digital information is at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more than 1000 petabytes.


Encryption


Biological Encryption and Decryption


Described herein are devices, compositions, systems, and methods comprising biological encryption (aka “bioencryption”) following receipt of a digital sequence encoding an item of information. In addition to individual forms of bioencryption and biodecryption described herein, also provided herein are processes for incorporating the selection of one or more classes or species of masking a biological sequence into a workflow for information storage and/or retrieval.


Provided herein are devices, compositions, systems, and methods of target enrichment of a nucleic acid sequence of interest from a larger population of nucleic acid sequences comprising biological encryption. In some instances, biological encryption is used to enrich a target signal from noise. In some instances, the target signal is a nucleic acid sequence of interest. In some instances, biological encryption comprises introducing the nucleic acid sequence of interest into a larger population of nucleic acid sequences with known sequences. The known nucleic acid sequences can be referred to as encryption nucleic acid sequences. In some instances, the encryption nucleic acids are decrypted. In some instances, decryption of the known nucleic acid sequences results in an increase in signal-to-noise ratio of the nucleic acid sequence of interest.


Provided herein are devices, compositions, systems, and methods comprising incorporation of biological molecule encryption in an information storage and/or retrieval workflow. Exemplary forms of bioencryption and biodecryption include, without limitation, enzymatic based, electromagnetic radiation based, chemical cleavage, and affinity based bioencryption and biodecryption.


Provided herein are devices, compositions, systems, and methods comprising application of nuclease complex activity based encryption. Exemplary nucleases include, without limitation, a Cas nuclease (CRISPR associated), a Zinc Finger Nuclease (ZFNs), a Transcription Activator-Like Effector Nucleases, an Argonaute nuclease, S1 Nuclease, mung bean nuclease, or a DNAse. Exemplary Cas nucleases include, without limitation, Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx1S, Csf1, Csf2, Cs0, Csf4, Cpf1, c2c1, and c2c3. In some instances, the Cas nuclease is Cas9. In some instances, a CRISPR/Cas complex provides for predetermined removal of one or more nucleic acid sequences. In some instances, enrichment steps described herein comprises depletion of abundant sequences by hybridization (DASH). In some instances, the DASH comprises application of a nuclease. For example, a nuclease such as Cas9, when bound to a CRISPR complex including a guide RNA (“gRNA”) sequence, induces a stranded break such that a longer form of a nucleic acid sequence is no longer intact. In some instances, excised nucleic acids are unavailable for subsequent amplification following enrichment. In some instances, gRNA shepherds the Cas9 enzyme to a specific stretch of nucleic acids. In alternative arrangements, a gRNA has multiple sites for cleavage. A gRNA-based system allows for generation of an encryption code with high specificity and selectivity. For example, since a CRISPR/Cas9 based system uses 20 bp to identify a sequence to cleave, at least about 10{circumflex over ( )}12 different possibilities are available for designing a predetermined gRNA sequence for decryption using a 4 base system. Following removal of extraneous (aka “junk”) DNA, the predetermined oligonucleotides encoding for a target sequence are subject to downstream processing, e.g., amplification and sequencing, resulting in a final sequence without the extra (junk) sequence. In some instances, each oligonucleotide of the plurality of oligonucleotides is designed for modification (e.g., cleavage, base swapping, recombination) at multiple locations. For example, each oligonucleotide of the plurality of oligonucleotides is synthesized with complementary regions for binding to about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more gRNA sequences. In such an arrangement, each of the plurality of oligonucleotides is subject to cleavage, base swapping, recombination subsequent to nuclease (e.g., CRISPR/Cas) complex activity at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more locations.


A first process for target enrichment for data encryption using CRISPR/Cas9 is illustrated in FIG. 4A. A population of DNA sequences 401 comprises DNA information 403 and encrypted DNA 405. The DNA information 403 and encrypted DNA 405 comprise adapter sequences 402 and DNA sequences 404, 406, respectively. Guide RNAs 409 are added 407 to the population of DNA sequences 401. The guide RNAs 409 are used to remove the encrypted DNA 405 by recognizing cleavage sequences encrypted in the encrypted DNA 405. Following addition of the guide RNAs 409, the encrypted DNA 405 is cleaved resulting in a nucleic acid sequence no longer intact. The encrypted DNA 405 are thus removed 411 from the population leaving the DNA information 403, for example, when the encrypted DNA 405 comprising a nucleic acid sequence that is no longer intact is unable to be amplified.


A second process for target enrichment for data encryption using CRISPR/Cas9 is illustrated in FIG. 4B. A population of DNA sequences 421 comprises DNA information 423 and encrypted DNA 425. The DNA information 423 and encrypted DNA 425 comprise adapter sequences 422 and DNA sequences 424, 426, respectively. Guide RNAs 429 and donor DNA 431 are added 427 to the population of DNA sequences 421. The guide RNAs 429 recognize an encrypted cleavage site in the encrypted DNA 425 and generate a cleavage site for insertion of the donor DNA 431. Insertion of the donor DNA 431 results in an insertion or frameshift in the encrypted DNA 425. In some instances, insertion of the donor DNA 431 results in introduction of a sequence tag for hybridization or incorporation of modified nucleotides with enhanced affinity to a capture reagent. For example, the donor DNA 431 is recognized by a fluorescent probe. In some instances, the donor DNA 431 introduces a sequence for electromagnetic radiation based (e.g., photolysis or photodetection) or chemical cleavage based (e.g, gaseous ammonia or methylamine treatment to cleave Thymidine-succinyl hexamide CED phosphoramidite (CLP-2244 from ChemGenes)) bioencryption and/or biodecryption. In some instances, the encrypted DNA 425 is no longer recognized for amplification, and only DNA information 423 is amplified resulting in enrichment of the DNA information 423.


Devices, compositions, systems, and methods comprising application of nuclease complex activity based encryption as described herein may comprise base swapping or sequence swapping. For example, bioencryption and biodecryption using CRISPR/Cas comprises base swapping or sequence swapping. In some instances, bioencryption comprises a CRISPR/dCas9 where a disabled or “dead” Cas9 (“dCas9”) no longer has a splicing function but, with the addition of another enzymatic activity, performs a different target molecule modifying function. For example, tethering a cytidine deaminase to dCas9 converts a C-G DNA base pair into T-A base pair. In an alternative dCas9 process, a different enzyme tethered to the dCas9 results in changing the base C into a T, or a G to an A in a target DNA.


Provided herein are devices, compositions, systems, and methods for bioencryption and biodecryption comprising application of a restriction enzyme. In some instances, the restriction enzyme targets an enzyme recognition site. In some instances, the enzyme recognition site is a specific nucleotide sequence. In some instances, the restriction enzyme cleaves the phosphate backbone at or near the enzyme recognition site. In some instances, cleavage of the recognition site results in a non-blunt end or a blunt end. In some instances, the restriction enzyme recognizes a nucleotide (e.g., A, T, G, C, U). In some instances, the restriction enzyme recognizes a modification such as, but not limited to, methylation, hydroxylation, or glycosylation. In some instances, the restriction enzyme results in fragmentation. In some instances, fragmentation produces fragments having 5′ overhangs, 3′ overhangs, blunt ends, or a combination thereof. In some instances, the fragments are selected, for example, based on size. In some instances, fragmentation by a restriction enzyme is followed by ligation. For example, fragmentation by a restriction enzyme is used to leave a predictable overhang, followed by ligation with one or more adapter oligonucleotides comprising an overhang complementary to the predictable overhang on a nucleic acid fragment. Exemplary restriction enzymes and their recognition sequences are provided in Table 1.









TABLE 1







Restriction Enzymes


Table 1








Recognition Sequence
Enzyme





AA/CGTT
AclI





A/AGCTT
HindIII HindIII-



HF ®





AAT/ATT
SspI SspI-HF ®





/AATT
MluCI Tsp509I





A/CATGT
PciI





A/CCGGT
AgeI AgeI-HF ®





ACCTGC(4/8)
BspMI BfuAI





A/CCWGGT
SexAI





A/CGCGT
MluI MluI-HF ®





ACGGC(12/14)
BceAI





A/CGT
HpyCH4IV





ACN/GT
HpyCH4III





(10/15)ACNNNNGTAYC(12/7)
BaeI


(SEQ ID NO: 5)






(9/12)ACNNNNNCTCC(10/7)
BsaXI


(SEQ ID NO: 6)






A/CRYGT
AflIII





A/CTAGT
SpeI SpeI-HF ®





ACTGG(1/−1)
BsrI





ACTGGG(5/4)
BmrI





A/GATCT
BglII





AGC/GCT
AfeI





AG/CT
AluI





AGG/CCT
StuI





AGT/ACT
ScaI ScaI-HF ®





AT/CGAT
ClaI BspDI





ATCTATGTCGGGTGCGGAGAAAGAGGTAAT
PI-SceI


(−15/−19) (SEQ ID NO: 7)






ATGCA/T
NsiI NsiI-HF ®





AT/TAAT
AseI





ATTT/AAAT
SwaI





(11/13)CAANNNNNGTGG(12/10)
CspCI


(SEQ ID NO: 8)






C/AATTG
MfeI MfeI-HF ®





CACGAG(−5/−1)
BssSI BssSαI





CACGAG
Nb. BssSI





CACGTC(−3/−3)
BmgBI





CAC/GTG
PmlI





CACNNN/GTG
DraIII DraIII-HF ®





CACNN/NNGTG (SEQ ID NO: 9)
AleI





CAGCAG(25/27)
EcoP15I





CAG/CTG
PvuII PvuII-HF ®





CAGNNN/CTG
AlwNI





CAGTG(2/0)
BtsIMutI





NNCASTGNN/
TspRI





CA/TATG
NdeI





CATG/
NlaIII





C/ATG
CviAII





/CATG
FatI





CAYNN/NNRTG (SEQ ID NO: 10)
MslI


CC(12/16)
FspEI





CCANNNNN/NNNNTGG (SEQ ID NO:
XcmI


11)






CCANNNNN/NTGG (SEQ ID NO: 12)
BstXI





CCANNNN/NTGG (SEQ ID NO: 13)
PflMI





CCATC(4/5)
BccI





C/CATGG
NcoI NcoI-HF ®





CCCAGC(−5/−1)
BseYI





CCCGC(4/6)
FauI





CCC/GGG
SmaI





C/CCGGG
XmaI TspMI





(0/−1)CCD
Nt. CviPII





CCDG(10/14)
LpnPI





CCGC(−3/−1)
AciI





CCGC/GG
SacII





CCGCTC(−3/−3)
BsrBI





C/CGG
MspI HpaII





CC/NGG
ScrFI





/CCNGG
BssKI StyD4I





C/CNNGG
BsaJI





CCNNNNN/NNGG (SEQ ID NO: 14)
BslI





C/CRYGG
BtgI





CC/SGG
NciI





C/CTAGG
AvrII





CCTC(7/6)
MulI





CCTCAGC(−5/−2)
BbvCI





CCTCAGC
Nb. BbvCI





CCTCAGC(−5/−7)
Nt. BbvCI





CCTGCA/GG
SbfI SbfI-HF ®





CCTNAGC(−5/−2)
Bpu10I





CC/TNAGG
Bsu36I





CCTNN/NNNAGG (SEQ ID NO: 15)
EcoNI





CCTTC(6/5)
HpyAV





CC/WGG
BstNI





/CCWGG
PspGI





C/CWWGG
StyI StyI-HF ®





(10/12)CGANNNNNNTGC(12/10)
BcgI


(SEQ ID NO: 16)






CGAT/CG
PvuI PvuI-HF ®





CG/CG
BstUI





C/GGCCG
EagI EagI-HF ®





CG/GWCCG
RsrII





CGRY/CG
BsiEI





C/GTACG
BsiWI BsiWI-HF ®





CGTCTC(1/5)
BsmBI





CGWCG/
Hpy99I





CMG/CKG
MspA1I





CNNR(9/13)
MspJI





CR/CCGGYG
SgrAI





C/TAG
BfaI





CTCAG(9/7)
BspCNI





C/TCGAG
XhoI PaeR7I TliI





CTCTTC(1/4)
Earl





CTGAAG(16/14)
AcuI





CTGCA/G
PstI PstI-HF ®





CTGGAG(16/14)
BpmI





C/TNAG
DdeI





C/TRYAG
SfcI





C/TTAAG
AflII





CTTGAG(16/14)
BpuEI





C/TYRAG
SmlI





C/YCGRG
AvaI BsoBI





GAAGA(8/7)
MboII





GAAGAC(2/6)
BbsI BbsI-HF ®





GAANN/NNTTC (SEQ ID NO: 17)
XmnI





GAATGC(1/−1)
BsmI





GAATGC
Nb. BsmI





G/AATTC
EcoRI EcoRI-HF ®





GACGC(5/10)
HgaI





GACGT/C
AatII





GAC/GTC
ZraI





GACN/NNGTC
Tth111I PflFI





GACNN/NNGTC (SEQ ID NO: 18)
PshAI





GACNNN/NNGTC (SEQ ID NO: 19)
AhdI





GACNNNN/NNGTC (SEQ ID NO: 20)
DrdI





GAG/CTC
Eco53kI





GAGCT/C
SadI SadI-HF ®





GAGGAG(10/8)
BseRI





GAGTC(4/5)
PleI





GAGTC(4/−5)
Nt. BstNBI





GAGTC(5/5)
MlyI





G/ANTC
HinfI





GAT/ATC
EcoRV EcoRV-HF ®





/GATC
MboI Sau3AI DpnII



BfuCI





GA/TC
DpnI





GATNN/NNATC (SEQ ID NO: 21)
BsaBI





G/AWTC
TfiI





GCAATG(2/0)
BsrDI





GCAATG
Nb. BsrDI





GCAGC(8/12)
BbvI





GCAGTG(2/0)
BtsI BtsαI





GCAGTG
Nb. BtsI





GCANNNN/NTGC (SEQ ID NO: 22)
BstAPI





GCATC(5/9)
SfaNI





GCATG/C
SphI SphI-HF ®





GCCC/GGGC
SrfI





GCCGAG(21/19)
NmeAIII





GCC/GGC
NaeI





G/CCGGC
NgoMIV





GCCNNNN/NGGC (SEQ ID NO: 23)
BglI





GCGAT/CGC
AsiSI





GCGATG(10/14)
BtgZI





G/CGC
HinP1I





GCG/C
HhaI





G/CGCGC
BssHII





GC/GGCCGC
NotI NotI-HF ®





GC/NGC
Fnu4HI





GCN/NGC
Cac8I





GCNNNNN/NNGC (SEQ ID NO: 24)
MwoI





G/CTAGC
NheI NheI-HF ®





GCTAG/C
BmtI BmtI-HF ®





GCTCTTC(1/4)
SapI BspQI





GCTCTTC(1/−7)
Nt. BspQI





GC/TNAGC
BlpI





G/CWGC
TseI ApeKI





GDGCH/C
Bsp1286I





GGATC(4/5)
AlwI





GGATC(4/−5)
Nt. AlwI





G/GATCC
BamHI BamHI-HF ®





GGATG(9/13)
FokI





GGATG(2/0)
BtsCI





GG/CC
HaeIII PhoI





GGCCGG/CC
FseI





GGCCNNNN/NGGCC (SEQ ID NO: 25)
SfiI





GG/CGCC
NarI





G/GCGCC
KasI





GGC/GCC
SfoI





GGCGC/C
PluTI





GG/CGCGCC
AscI





GGCGGA(11/9)
EciI





GGGAC(10/14)
BsmFI





GGGCC/C
ApaI





G/GGCCC
PspOMI





G/GNCC
Sau96I





GGN/NCC
NlaIV





GGTAC/C
KpnI KpnI-HF ®





G/GTACC
Acc65I





GGTCTC(1/5)
BsaI BsaI-HF ®





GGTGA(8/7)
HphI





G/GTNACC
BstEII BstEII-HF ®





G/GWCC
AvaII





G/GYRCC
BanI





GKGCM/C
BaeGI





GR/CGYC
BsaHI





GRGCY/C
BanII





GT/AC
RsaI





G/TAC
CviQI





GTA/TAC
BstZ17I





GTATAC
BstZ17I-HF ®





GTATCC(6/5)
BciVI





G/TCGAC
SalI SalI-HF ®





GTCTC(1/−5)
Nt. BsmAI





GTCTC(1/5)
BsmAI BcoDI





G/TGCAC
ApaLI





GTGCAG(16/14)
BsgI





GT/MKAC
AccI





GTN/NAC
Hpy166II





/GTSAC
Tsp45I





GTT/AAC
HpaI





GTTT/AAAC
PmeI





GTY/RAC
HincII





GWGCW/C
BsiHKAI





R/AATTY
ApoI ApoI-HF





RCATG/Y
NspI





R/CCGGY
BsrFI BsrFαI





R/GATCY
BstYI





RGCGC/Y
HaeII





RG/CY
CviKI-1





RG/GNCCY
EcoO109I





RG/GWCCY
PpuMI





TAACTATAACGGTCCTAAGGTAGCGAA
I-CeuI


(−9/−13) (SEQ ID NO: 26)






TAC/GTA
SnaBI





TAGGGATAACAGGGTAAT(−9/−13)
I-SceI


(SEQ ID NO: 27)






T/CATGA
BspHI





T/CCGGA
BspEI





TCCRAC(20/18)
MmeI





T/CGA
TaqαI





TCG/CGA
NruI NruI-HF ®





TCN/GA
Hpy188I





TC/NNGA
Hpy188III





T/CTAGA
XbaI





T/GATCA
BclI





TG/CA
HpyCH4V





TGC/GCA
FspI





TGGCAAACAGCTATTATGGGTATTATGGGT
PI-PspI


(−13/−17) (SEQ ID NO: 28)



TGG/CCA
MscI





T/GTACA
BsrGI BsrGI-HF ®





T/TAA
MseI





TTAAT/TAA
PacI





TTA/TAA
PsiI





TT/CGAA
BstBI





TTT/AAA
DraI





VC/TCGAGB
PspXI





W/CCGGW
BsaWI





YAC/GTR
BsaAI





Y/GGCCR
EaeI









Provided herein are devices, compositions, systems, and methods for bioencryption and biodecryption may comprise application of a repair enzyme. DNA repair enzymes, in some instances, are derived from a particular organism or virus or are non-naturally occurring variants thereof. Exemplary DNA repair enzymes include, but are not limited to, E. coli endonuclease IV, Tth endonuclease IV, human AP endonuclease, glycosylases, such as UDG, E. coli 3-methyladenine DNA glycoylase (AIkA) and human Aag, glycosylase/lyases, such as E. coli endonuclease III, E. coli endonuclease VIII, E. coli Fpg, human OGG1, and T4 PDG, and lyases. Exemplary additional DNA repair enzymes are listed in Table 2.









TABLE 2







DNA Repair Enzymes.











Accession


Gene Name
Activity
Number





UNG
Uracil-DNA glycosylase
NM_080911


SMUG1
Uracil-DNA glycosylase
NM_014311


MBD4
Removes U or T opposite G at CpG
NM_003925



sequences


TDG
Removes U, T or ethenoC opposite G
NM_003211


OGG1
Removes 8-oxoG opposite C
NM_016821


MUTYH (MYH)
Removes A opposite 8-oxoG
NM_012222


NTHL1 (NTH1)
Removes Ring-saturated or
NM_002528



fragmented pyrimidines


MPG
Removes 3-meA, ethenoA,
NM_002434



hypoxanthine


NEIL1
Removes thymine glycol
NM_024608


NEIL2
Removes oxidative products of
NM_145043



pyrimidines


XPC
Binds damaged DNA as complex
NM_004628



with RAD23B, CETN2


RAD23B
Binds damaged DNA as complex
NM_002874


(HR23B)
with XPC, CETN2


CETN2
Binds damaged DNA as complex
NM_004344



with XPC, RAD23B


RAD23A
Substitutes for HR23B
NM_005053


(HR23A)


XPA
Binds damaged DNA in preincision
NM_000380



complex


RPA1
Binds DNA in preincision complex
NM_002945


RPA2
Binds DNA in preincision complex
NM_002946


RPA3
Binds DNA in preincision complex
NM_002947


ERCC5 (XPG)
3′ incision
NM_000123


ERCC1
5′ incision subunit
NM_001983


ERCC4 (XPF)
5′ incision subunit
NM_005236


LIG1
DNA joining
NM_000234


CKN1(CSA)
Cockayne syndrome; Needed for
NM_000082



transcription-coupled NER


ERCC6 (CSB)
Cockayne syndrome; Needed for
NM_000124



transcription-coupled NER


XAB2 (HCNP)
Cockayne syndrome; Needed for
NM_020196



transcription-coupled NER


DDB1
Complex defective in XP group E
NM_001923


DDB2
DDB1, DDB2
NM_000107


MMS19L
Transcription and NER
NM_022362


(MMS19)


FEN1 (DNase IV)
Flap endonuclease
NM_004111


SPO11
endonuclease
NM_012444


FLJ35220
incision 3′ of hypoxanthine and
NM_173627


(ENDOV)
uracil


FANCA
Involved in tolerance or repair of
NM_000135



DNA crosslinks


FANCB
Involved in tolerance or repair of
NM_152633



DNA crosslinks


FANCC
Involved in tolerance or repair of
NM_000136



DNA crosslinks


FANCD2
Involved in tolerance or repair of
NM_033084



DNA crosslinks


FANCE
Involved in tolerance or repair of
NM_021922



DNA crosslinks


FANCF
Involved in tolerance or repair of
NM_022725



DNA crosslinks


FANCG
Involved in tolerance or repair of
NM_004629


(XRCC9)
DNA crosslinks


FANCL
Involved in tolerance or repair of
NM_018062



DNA crosslinks


DCLRE1A
DNA crosslink repair
NM_014881


(SNM1)


DCLRE1B
Related to SNM1
NM_022836


(SNM1B)


NEIL3
Resembles NEIL1 and NEIL2
NM_018248


ATRIP (TREX1)
ATR-interacting protein 5′
NM_130384



alternative ORF of the



TREX1/ATRIP gene


NTH
Removes damaged pyrimidines
NP_416150.1


NEI
Removes damaged pyrimidines
NP_415242.1


NFI
Deoxyinosine 3′ endonuclease
NP_418426.1


MUTM
Formamidopyrimidine DNA
NP_418092.1



glycosylase


UNG
Uracil-DNA glycosylase
NP_417075.1


UVRA
DNA excision repair enzyme
NP_418482.1



complex


UVRB
DNA excision repair enzyme
NP_415300.1



complex


UVRC
DNA excision repair enzyme
NP_416423.3



complex


DENV
Pyrimidine dimer glycosylase
NP_049733.1









Provided herein are devices, compositions, systems, and methods for bioencryption and/or biodecryption comprising nucleic acid modification. In some instances, the nucleic acid modification impacts activity of nucleic acid sequences in a sequencing reaction. For example, the nucleic acid modification prevents the encrypted nucleic acid sequences from being amplified. In some instances, the nucleic acid modification comprises, but is not limited to, methylated bases, PNA (peptide nucleic acid) nucleotides, LNA (locked nucleic acid) nucleotides, and 2′-O-methyl-modified nucleotides. In some instances, the nucleic acid modification comprises a modified nucleobase that is not a cytosine, guanine, adenine or thymine. Non-limiting modified nucleobases include, without limitation, uracil, 3-meA (3-methyladenine), hypoxanthine, 8-oxoG (7,8-dihydro-8-oxoguanine), FapyG, FapyA, Tg (thymine glycol), hoU (hydroxyuracil), hmU (hydroxymethyluracil), fU (formyluracil), hoC (hydroxycytosine), fC (formylcytosine), 5-meC (5-methylcytosine), 6-meG (O6-methylguanine), 7-meG (N7-methylguanine), εC (ethenocytosine), 5-caC (5-carboxylcytosine), 2-hA, εA (ethenoadenine), 5-fU (5-fluorouracil), 3-meG (3-methylguanine), and isodialuric acid.


Provided herein are devices, compositions, systems, and methods for bioencryption comprising use of nucleic acid probe sequences. In some instances, nucleic acid probe sequences that are complementary to a portion of the nucleic acid sequences are then removed by a nuclease. For example, the nuclease is a duplex specific nuclease that recognizes a double stranded nucleic acid molecule formed between the nucleic acid probes and the nucleic acid sequences. In some instances, the nucleic acid probe allows for capturing and isolating nucleic acid sequences. In some instances, the nucleic acid probes comprise at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, or more than 100 nucleotides in length.


In some instances, nucleic acid sequences are identified using nucleic acid probes comprising a label such as, but not limited to, an affinity tag such as biotin, digoxigenin, Ni-Nitrilotriacetic acid, desthiobiotin, histidine, polyhistidine, myc, hemagglutinin (HA), FLAG, a fluorescence tag, a tandem affinity purification (TAP) tag, glutathione S transferase (GST), a polynucleotide, an aptamer, a polypeptide (e.g., an antigen or antibody), or derivatives thereof. In some instances, the label is detected by light absorption, fluorescence, chemiluminescence, electrochemiluminescence, mass, or charge. Non-limiting examples of fluorophores are Alexa-Fluor dyes (e.g., Alexa Fluor® 350, Alexa Fluor® 405, Alexa Fluor® 430, Alexa Fluor® 488, Alexa Fluor® 500, Alexa Fluor® 514, Alexa Fluor® 532, Alexa Fluor® 546, Alexa Fluor® 555, Alexa Fluor® 568, Alexa Fluor® 594, Alexa Fluor® 610, Alexa Fluor® 633, Alexa Fluor® 647, Alexa Fluor® 660, Alexa Fluor® 680, Alexa Fluor® 700, and Alexa Fluor® 750), APC, Cascade Blue, Cascade Yellow and R-phycoerythrin (PE), DyLight 405, DyLight 488, DyLight 550, DyLight 650, DyLight 680, DyLight 755, DyLight 800, FITC, Pacific Blue, PerCP, Rhodamine, Texas Red, Cy5, Cy5.5, and Cy7.


Provided herein are devices, compositions, systems, and methods for bioencryption and/or biodecryption comprising nucleic acid hybridization based binding. Nucleic acid probes comprising an affinity tag may be used. In some instances, the affinity tag allows for the nucleic acid sequences to be pulled down. For example, the affinity tag biotin is conjugated to nucleic acid probes that are complementary to the nucleic acid sequences and is pulled down using streptavidin. In some instances, the affinity tag comprises magnetically susceptible material, e.g., a magnet or magnetically susceptible metal. In some instances, the nucleic acid sequences are pulled down using a solid support such as streptavidin and immobilized on the solid support. In some instances, the nucleic acid sequences are pulled down in solution such as through beads. In some instances, the nucleic acid probes allow for exclusion based on size. For example, the nucleic acid probes result in the nucleic acid sequences having a size different from other nucleic acid sequences so that the nucleic acid sequences are removed by size-based depletion.


Devices, compositions, systems, and methods for bioencryption and/or biodecryption comprising nucleic acid hybridization based binding may comprise controlled amplification. In some instances, the nucleic acid hybridization based binding strategy is directed to controlled amplification, where a plurality of oligonucleotides synthesized have a similar region for a forward primer to bind, but the reverse primer region is not readily identifiable. In such an instance, a predetermined reverse primer would be required. In a first exemplary workflow, a pool of reverse primers with preselected regions to bind to each of the different synthesized oligonucleotides is generated and used in an extension amplification reaction (e.g., with a DNA polymerase) to amplify the oligonucleotides for downstream processing, e.g., further amplification or a DNA sequencing reaction. Optionally, each of the reverse primers comprises an adapter region comprising a common sequence to incorporate a universal reverse primer binding site by an extension amplification reaction (e.g., with a DNA polymerase). In such an arrangement, the downstream processing is simplified as only a single forward or reverse primer is required to amplify or sequence the plurality of oligonucleotides. In a second exemplary workflow, a plurality of oligonucleotides are synthesized, each having one or two regions comprising a hybridization motif that, while varied, has sufficient hybridization ability to a common primer to allow downstream processing of the plurality of oligonucleotides (e.g., amplification or sequencing reactions) utilizing a common primer for one of or both of 5′ and 3′ regions of each of the synthesized oligonucleotides. In some instances, the oligonucleotide population is designed to be hybridized to about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleobases of the common primer.


Provided herein are devices, compositions, systems, and methods for bioencryption and/or biodecryption comprising use of electromagnetic radiation (EMR). In some instances, the electromagnetic radiation provides for cleavage or image capture-based detection of a nucleic acid sequence. In some instances, EMR is applied towards a surface at a wavelength from about 100 nm to about 400 nm, from about 100 nm to about 300 nm, or from about 100 nm to about 200 nm. In some instances, EMR is applied towards a surface at a wavelength from less than 0.01 nm. In some instances, EMR is applied towards a surface at a wavelength from about 10 nm to about 400 nm, about 400 nm to about 700 nm, or about 700 nm to about 100,000 nm. For example, EMR is applied at an ultraviolet (UV) wavelength, or a deep UV wavelength. In some instances, deep UV light is applied to a surface at a wavelength of about 172 nm to cleave a bound agent from the surface. In some instances, EMR is applied with a xenon lamp. Exposure distance is a measurement between the lamp and the surface. In some instances, the exposure distance is about 0.1 to 5 cm. In some instances, the exposure distance is about 0.5 to 2 cm. In some instances, the exposure distance is about 0.5, 1, 2, 3, 4, or 5 cm. In some instances, EMR is applied with a laser. Exemplary lasers and their wavelengths include but are not limited to Ar2 (126 nm), Kr2 (146 nm), F2 (157 nm), Xe2 (172 and 175 nm), ArF (193 nm). In some instances, the nucleic acid sequences comprise nucleobases that are photocleavable at a specific site. In some instances, the nucleic acid sequences comprise a modified nucleobase that is photocleavable. In some instances, the nucleic acid sequences are photocleavable by application of a specific wavelength of light. In some instances, the nucleic acid sequences are photocleavable by application of multiple wavelengths of light.


Provided herein are devices, compositions, systems, and methods for bioencryption and/or biodecryption comprising use of chemical lysis. In some instances, the nucleic acid sequences comprise nucleobases that are chemically cleavable at a specific site. In some instances, the nucleic acid sequences comprise a modified nucleobase that is chemically cleavable. In some instances, the modified nucleobase comprises a modification that is chemically cleavable. In some instances, chemical lysis is performed using an amine reagent. In some instances, the amine reagent is a liquid, a gas, an aqueous reagent, or an anhydrous reagent. Non-limiting examples of amine reagents are ammonium hydroxide, ammonia gas, a C1-C6 alkylamine, or methylamine.


Devices, compositions, systems, and methods for bioencryption as described herein may comprise conversion of the digital sequence to a nucleic acid sequence. In some instances, the nucleic acid sequence is a DNA sequence. In some instances, the DNA sequence is single stranded or double stranded. In some instances, the nucleic acid sequence is a RNA sequence. In some instances, the RNA sequence is single stranded or double stranded. In some instances, the nucleic acid sequence is encrypted in a larger population of nucleic acid sequences. In some instances, the larger population of nucleic acid sequences is a homogenous population or a heterogeneous population. In some instances, the population of nucleic acid sequences comprises DNA sequences. In some instances, the DNA sequences are single stranded or double stranded. In some instances, the population of nucleic acid sequences comprises RNA sequences. In some instances, the RNA sequences are single stranded or double stranded.


A number of nucleic acid sequences may be encrypted. In some instances, the number of nucleic acid sequences that are encrypted are about 10 sequences to about 1 million or more sequences. In some instances, a number of nucleic acid sequences that are encrypted are at least about 10, 50, 100, 200, 500, 1,000, 2,000, 4,000, 8,000, 10,000, 25,000, 30,000, 35,000, 40,000, 45,000, 50,000, 55,000, 60,000, 65,000, 70,000, 80,000, 90,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 1 million, or more than 1 million sequences. In some instances, a number of nucleic acid sequences that are encrypted is greater than 1 trillion.


In some instances, the nucleic acid sequences that are encrypted comprise at least 10, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 300, or more than 300 bases in length. In some instances, the nucleic acid sequences that are encrypted comprises 10 bases to 25 bases, 10 bases to 50 bases, 10 bases to 75 bases, 10 bases to 100 bases, 10 bases to 125 bases, 10 bases to 150 bases, 10 bases to 175 bases, 10 bases to 200 bases, 10 bases to 225 bases, 10 bases to 250 bases, 10 bases to 300 bases, 25 bases to 50 bases, 25 bases to 75 bases, 25 bases to 100 bases, 25 bases to 125 bases, 25 bases to 150 bases, 25 bases to 175 bases, 25 bases to 200 bases, 25 bases to 225 bases, 25 bases to 250 bases, 25 bases to 300 bases, 50 bases to 75 bases, 50 bases to 100 bases, 50 bases to 125 bases, 50 bases to 150 bases, 50 bases to 175 bases, 50 bases to 200 bases, 50 bases to 225 bases, 50 bases to 250 bases, 50 bases to 300 bases, 75 bases to 100 bases, 75 bases to 125 bases, 75 bases to 150 bases, 75 bases to 175 bases, 75 bases to 200 bases, 75 bases to 225 bases, 75 bases to 250 bases, 75 bases to 300 bases, 100 bases to 125 bases, 100 bases to 150 bases, 100 bases to 175 bases, 100 bases to 200 bases, 100 bases to 225 bases, 100 bases to 250 bases, 100 bases to 300 bases, 125 bases to 150 bases, 125 bases to 175 bases, 125 bases to 200 bases, 125 bases to 225 bases, 125 bases to 250 bases, 125 bases to 300 bases, 150 bases to 175 bases, 150 bases to 200 bases, 150 bases to 225 bases, 150 bases to 250 bases, 150 bases to 300 bases, 175 bases to 200 bases, 175 bases to 225 bases, 175 bases to 250 bases, 175 bases to 300 bases, 200 bases to 225 bases, 200 bases to 250 bases, 200 bases to 300 bases, 225 bases to 250 bases, 225 bases to 300 bases, or 250 bases to 300 bases.


In some instances, nucleic acid sequences that are encrypted result in at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more than 95% enrichment of a nucleic acid sequence of interest. In some instances, nucleic acid sequences that are encrypted result in about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more than 95% enrichment of a nucleic acid sequence of interest.


Devices, compositions, systems, and methods for bioencryption and/or biodecryption as described herein may comprise a DNA or RNA based system. Canonical DNA is a base 4 coding system, having four different nucleobases available: A, T, C or G (adenine, thymine, cytosine, and guanine). Thus, these 4 bases allow for a base 3 (using less than all), or a 4 base coding scheme. In addition, use of uracil (U), which is found in RNA, provides a fifth base and allows for a base 5 coding scheme. In addition, a modified nucleobase may be used for a nucleic acid base coding greater than 4. Nucleobases that are not canonical DNA nucleobases or modified nucleobases include, without limitation, uracil, 3-meA (3-methyladenine), hypoxanthine, 8-oxoG (7,8-dihydro-8-oxoguanine), FapyG, FapyA, Tg (thymine glycol), hoU (hydroxyuracil), hmU (hydroxymethyluracil), fU (formyluracil), hoC (hydroxycytosine), fC (formylcytosine), 5-meC (5-methylcytosine), 6-meG (06-methylguanine), 7-meG (N7-methylguanine), εC (ethenocytosine), 5-caC (5-carboxylcytosine), 2-hA, εA (ethenoadenine), 5-fU (5-fluorouracil), 3-meG (3-methylguanine), hmC (hydroxymethylcytosine) and isodialuric acid. Further provided herein are coding schemes where machine instructions provide for conversion of digital information in the form of a binary sequence into an intermediate code prior to ultimately being converted to the final nucleic acid sequence.


In some instances, to store data in a sequence of DNA, the information is converted from the 1s and 0s of binary code into the code of A, T, G, and C bases of DNA. In some instances, items of information are first encoded in a digital information form. In some cases, the binary code of digital information is converted into a biomolecule-based (e.g., DNA-based) code while preserving the information that the code represents. This converted code (digital binary code to a biomolecule code) is referred to herein as resulting in a “predetermined” sequence with respect to the deposit of a biomolecule disclosed herein on a surface disclosed herein. The predetermined sequence may encode sequence for a plurality of oligonucleotides.


Binary Code Conversion


Generally, the initial code is digital information, typically in the form of binary code employed by a computer. General purpose computers are electronic devices reading “on” or “off” states, represented by the numbers “0” and “1”. This binary code is application for computers to read multiple types of items of information. In binary arithmetic, the number two is written as the number 10. For example, “10” indicates “one time the number, two and no more”. The number “3,” is written as “11” to mean “one times two and one more.” The number “4” is written as “100,” the number “5” as “101,” “six” as “110,” etc. An example of American Standard Code II (ASCII) for binary code is provided for the alphabet in lower and upper case in Table 3.









TABLE 3







American Standard Code II (ASCII) for Binary Code
















ASCII


ASCII


ASCII



Letter
Code
Binary
Letter
Code
Binary
No.
Code
Binary


















a
97
1100001
A
65
1000001
0
chr (0)
00000000


b
98
1100010
B
66
1000010
1
chr (1)
00000001


c
99
1100011
C
67
1000011
2
chr (2)
00000010


d
100
1100100
D
68
1000100
3
chr (3)
00000011


e
101
1100101
E
69
1000101
4
chr (4)
00000100


f
102
1100110
F
70
1000110
5
chr (5)
00000101


g
103
1100111
G
71
1000111
6
chr (6)
00000110


h
104
1101000
H
72
1001000
7
chr (7)
00000111


i
105
1101001
I
73
1001001
8
chr (8)
00001000


j
106
1101010
J
74
1001010
9
chr (9)
00001001


k
107
1101011
K
75
1001011
10
chr (10)
00001010


l
108
1101100
L
76
1001100
11
chr (11)
00001011


m
109
1101101
M
77
1001101
12
chr (12)
00001100


n
110
1101110
N
78
1001110
13
chr (13)
00001101


o
111
1101111
O
79
1001111
14
chr (14)
00001110


p
112
1110000
P
80
1010000
15
chr (15)
00001111


q
113
1110001
Q
81
1010001
16
chr (16)
00010000


r
114
1110010
R
82
1010010
17
chr (17)
00010001


s
115
1110011
S
83
1010011
18
chr (18)
00010010


t
116
1110100
T
84
1010100
19
chr (19)
00010011


u
117
1110101
U
85
1010101
20
chr (20)
00010100


v
118
1110110
V
86
1010110
21
chr (21)
00010101


w
119
1110111
W
87
1010111
22
chr (22)
00010110


x
120
1111000
X
88
1011000
23
chr (23)
00010111


y
121
1111001
Y
89
1011001
24
chr (24)
00011000


z
122
1111010
Z
90
1011010
25
chr (25)
00011001








26
chr (26)
00011010








27
chr (27)
00011011








28
chr (28)
00011100








29
chr (29)
00011101








30
chr (30)
00011110









Provided herein are methods for converting information in the form of a first code, e.g., a binary sequence to a nucleic acid sequence. The process may involve direct conversion from a base 2 code (i.e., binary) to a base code that is higher. Exemplary base codes include 2, 3, 4, 5, 6, 7, 8, 9, 10 or more. Table 4 illustrates an exemplary alignment between various base numbering schemes. A computer receiving machine instructions for conversion, can automatically convert sequence information from one code to another.









TABLE 4





Alignment of Base Numbering Schemes

























Decimal
0
1
2
3
4
5
6
7
8
9


Qua-
0
1
2
3
10
11
12
13
20
21


ternary


Octal
0
1
2
3
4
5
6
7
10
11


Ternary
0
1
2
10
11
12
20
21
22
100


Binary
0
1
10
11
100
101
110
111
1000
1001









Nucleic Acid Sequence


Provided herein are methods for designing a sequence for an oligonucleotide described herein such that the nucleic acid sequence encodes for at least part of an item of information. In some instances, each oligonucleotide sequence has design features to facilitate with sequence alignment during subsequent assembly steps and also to provide a means for error correction. In some arrangements, oligonucleotide sequences are designed such that overlap exits between each oligonucleotide sequence with another in the population. In some instances, each oligonucleotide sequence overlaps with a portion of just one other oligonucleotide sequence, FIG. 5A. In an alternative arrangement, each oligonucleotide sequence region overlaps with two sequences such that 2 copies are generated for each sequence within a single oligonucleotide, FIG. 5B. In yet another arrangement, each oligonucleotide sequence region overlaps with more than two sequences such that 3 copies are generated for each sequence within a single oligonucleotide, FIG. 5C. Sequences for oligonucleotides described herein may encode for 10-2000, 10-500, 30-300, 50-250, or 75-200 bases in length. In some instances, each of the oligonucleotide sequence is at least 10, 15, 20, 25, 30, 50, 100, 150, 200, 500 or more bases in length.


Provided herein are methods, systems and compositions wherein each oligonucleotide sequence described herein is designed to comprise a plurality of coding regions and a plurality of non-coding regions, FIG. 6A. In such an arrangement, each coding region (e.g., 601, 603, 605) encodes for at least a portion of an item of information. Optionally, each coding region in the same oligonucleotide encodes for a sequence from the same item of information, and an overlapping scheme is optionally employed as described herein, FIG. 6B. In further instances, each coding region in the same oligonucleotide encodes for the same sequence, FIG. 6C. Sequences for oligonucleotides described herein may encode for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more coding regions. Sequences for oligonucleotides described herein may encode for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more of the same coding region. In some instances, each of the multiple coding regions is 10-1000, 20-500, 30-300, 50-250, or 75-200 bases in length. In some instances, each of the multiple coding regions is at least 10, 15, 20, 25, 30, 50, 100, 150, 200 or more bases in length. In some instances, each oligonucleotide comprises a tether region 611 linking the molecule to the surface 602 of a structure.


In arrangements where multiple coding sequences are present in the same oligonucleotide, a cleavage region 607 is optionally present in between each coding region. The cleavage region 607 may be present at the junction between each coding region, or may be present within an adaptor region having a string of sequence between each coding region. A cleavage region 607 may encode for a sequence feature, once synthesized, which will break from the strand subsequent to application of a cleavage signal. The cleavage region 607 may encode for a restriction enzyme recognition site, a modified nucleic acid that is light sensitive and will break under application of electromagnetic radiation (e.g., oligodeoxynucleotide heteropolymers carrying base-sensitive S-pivaloylthioethyl (t-Bu-SATE) phosphotriester linkages sensitive to light wavelengths of >300 nm), or a modified nucleic acid that is sensitive to application of a certain chemical, e.g., Thymidine-succinyl hexamide CED phosphoramidite (CLP-2244 from ChemGenes) which breaks subsequent to application of ammonia gas. Because the design of a sequence to have a particular cleavage scheme may not be readily apparent from sequencing synthesized oligonucleotides, the cleavage scheme provides a means for adding a level of security to sequences encoded by the synthesized nucleic acid library. Sequences for oligonucleotides described herein may encode for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more cleavage regions. In some instances, each of the cleavage region encodes for 1-100, 1-50, 1-20, 1-10, 5-25, or 5-30 bases in length. In some instances, each of the cleavage region encodes for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50 100 or more bases. In some arrangements, for each oligonucleotide, each coding region is identical and each cleavage region between each coding region is different. For example, a first cleavage region 607 is different from a second cleavage region 609. In some arrangements, the cleavage region 607 closest to the surface 602 is identical to the next distal cleavage region 607.


Barcodes are typically known nucleic acid sequences that allow some feature of a polynucleotide with which the barcode is associated to be identified. FIGS. 7A-7B provide an illustrative barcode arrangement. In FIG. 7A, each coding region for a first oligonucleotide 701, a second oligonucleotide 703, and a third oligonucleotide 705, has the following features (from surface 702 outward): a tether region 702, a cleavage region 707, a first primer binding region 701, a barcode region 703, a coding region 701, 703, 705, and a second primer binding region 704. The oligonucleotides may be amplified with the use of primers that recognize the first and/or second primer binding regions. Amplification may occur to oligonucleotides attached to the surface or released from the surface (i.e., via cleavage at the cleavage region 707). After sequencing, the barcode region 703, provides an indicator for identifying a characteristic associated with the coding region. In some instances, a barcode comprises a nucleic acid sequence that when joined to a target polynucleotide serves as an identifier of the sample from which the target polynucleotide was derived. Barcodes can be designed at suitable lengths to allow sufficient degree of identification, e.g., at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 , 36 , 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, or more bases in length. Multiple barcodes, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, or more barcodes, may be used on the same molecule, optionally separated by non-barcode sequences. In some instances, barcodes are shorter than 10, 9, 8, 7, 6, 5, or 4 bases in length. In some instances, barcodes associated with some polynucleotides are of different lengths than barcodes associated with other polynucleotides. In general, barcodes are of sufficient length and comprise sequences that are sufficiently different to allow the identification of samples based on barcodes with which they are associated. In some arrangements, a barcode, and the sample source with which it is associated, can be identified accurately after the mutation, insertion, or deletion of one or more bases in the barcode sequence, such as the mutation, insertion, or deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more bases. In some instances, each barcode in a plurality of barcodes differ from every other barcode in the plurality by at least three base positions, such as at least 3, 4, 5, 6, 7, 8, 9, 10, or more positions. Arrangements provided herein may include a barcode sequence that indicates the nucleic acid sequence encoding for a sequence in a particular region of a digital sequence. For example, a barcode sequence may indicate where in a large file a particular oligonucleotide sequence encodes. In some instances, a barcode sequence may indicate which file a particular oligonucleotide sequence is associated with. In some instances, a barcode sequence includes information associated with the conversion scheme for a particular sequence, providing an added layer of security.


Provided herein are oligonucleotide sequence design schemes where each oligonucleotide sequence in a population of oligonucleotide sequences is designed to have at least one region in common amongst oligonucleotide sequences in that population. For example, all oligonucleotides in the same population may comprise one or more primer regions. The design of sequence-specific primer regions allows for the selection of oligonucleotides to be amplified in selected batches from a large library of multiple oligonucleotides. Each oligonucleotide sequence may comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more primer binding sequences. A population of oligonucleotide sequences may comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 25, 50, 100, 200, 500, 1000, 5000, 10000, 50000, 100000 or more non-identical binding sequences. Primer binding sequences may comprise 5-100, 10-75, 7-60, 8-60, 10-50, or 10-40 bases in length.


Structures for Oligonucleotide Synthesis


Provided herein are rigid or flexibles structures for oligonucleotide synthesis for use with devices, compositions, systems, and methods for bioencryption and/or biodecryption as described herein. In the case of rigid structures, provided herein are devices having structures (e.g., a plate) for the generation of a library of oligonucleotides. An exemplary structure 800 is illustrated in FIG. 8, wherein the structure 800 has about the same size dimensions as a standard 96 well plate: 140 mm by 90 mm. The structure 800 comprises clusters grouped in 24 regions or sub-fields 805, each sub-field 805 comprising an array of 256 clusters 810. An expanded view of an exemplary sub-field 805 is shown in FIG. 9. The structure as seen in FIG. 8 and FIG. 9 may be substantially planar. In the expanded view of four clusters (FIG. 9), a single cluster 910, has a Y axis cluster pitch (distance from center to center of adjacent clusters) of 1079.210 um or 1142.694 um, and an X axis cluster pitch of 1125 um. An illustrative cluster 1010 is depicted in FIG. 10, where the Y axis loci pitch (distance from center to center of adjacent loci) is 63.483 um, and an X axis loci pitch is 75 um. The locus width at the longest part, e.g., diameter for a circular locus, is 50 um and the distance between loci is 24 um. The number of loci 1005 in the exemplary cluster in FIG. 10 is 121. The loci (also referred to as “features”), may be flat, wells, or channels. An exemplary channel arrangement is illustrated in FIGS. 11A-11B where a plate 1105 is illustrated comprising a main channel 1110 and a plurality of channels 1115 connected to the main channel 1110. The connection between the main channel 1110 and the plurality of channels 1115 provides for a fluid communication for flow paths from the main channel 1110 to the each of the plurality of channels 1115. A plate 1105 described herein can comprise multiple main channels 1110. The plurality of channels 1115 collectively forms a cluster within the main channel 1110.


In the case of flexible structures, provided herein are devices wherein the flexible structure comprises a continuous loop 1201 wrapped around one or more fixed structures, e.g., a pair of rollers 1203 or a non-continuous flexible structure 1207 wrapped around separate fixed structures, e.g., a pair reels 1205. See FIGS. 12A-12B. Provided herein are flexible structures having a surface with a plurality of features (loci) for oligonucleotide extension. Each feature in a portion of the flexible structure 1301 may be a substantially planar feature 1303 (e.g., flat), a channel 1305, or a well 1307. See FIGS. 13A-13C. In one exemplary arrangement, each feature of the structure has a width of about 10 um and a distance between the center of each structure of about 21 um. See FIG. 14A. Features may comprise, without limitation, circular, rectangular, tapered, or rounded shapes.


Structures for oligonucleotide synthesis for use with devices, compositions, systems, and methods for bioencryption and/or biodecryption as described herein may comprise a channel. In some instances, a channel described herein has a width to depth (or height) ratio of 1 to 0.01, wherein the width is a measurement of the width at the narrowest segment of the microchannel. In some instances, a channel described herein has a width to depth (or height) ratio of 0.5 to 0.01, wherein the width is a measurement of the width at the narrowest segment of the microchannel. In some instances, a channel described herein has a width to depth (or height) ratio of about 0.01, 0.05, 0.1, 0.15, 0.16, 0.2, 0.5, or 1.


Provided herein are structures for polynucleotide synthesis comprising a plurality of discrete loci, channels, wells or protrusions for polynucleotide synthesis. Structures described herein may comprise a plurality of clusters, each cluster comprising a plurality of wells, loci or channels. Alternatively, described herein are structures that may comprise a homogenous arrangement of wells, loci or channels. In some instances, a structure described herein is provided comprising a plurality of channels corresponding to a plurality of features (loci) within a cluster, wherein the height or depth of the channel is from about 5 um to about 500 um, from about 5 um to about 400 um, from about 5 um to about 300 um, from about 5 um to about 200 um, from about 5 um to about 100 um, from about 5 um to about 50 um, or from about 10 um to about 50 um. In some cases, the height or depth of a channel is less than 100 um, less than 80 um, less than 60 um, less than 40 um or less than 20 um. In some cases, channel height or depth is about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500 um or more. In some instances, the height or depth is at least 10, 25, 50, 75, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or more than 1000 nm. In some instances, the height or depth is in a range of about 10 nm to about 1000 nm, about 25 nm to about 900 nm, about 50 nm to about 800 nm, about 75 nm to about 700 nm, about 100 nm to about 600 nm, or about 200 nm to about 500. In some instances, the height or depth is in a range of about 50 nm to about 1 um.


Structures for oligonucleotide synthesis for use with devices, compositions, systems, and methods for bioencryption and/or biodecryption as described herein may comprise a feature. In some instances, the width of a feature (e.g., substantially planar feature, well, channel, locus, or protrusion) is from about 0.1 um to about 500 um, from about 0.5 um to about 500 um, from about 1 um to about 200 um, from about 1 um to about 100 um, from about 5 um to about 100 um, or from about 0.1 um to about 100 um, for example, about 90 um, 80 um, 70 um, 60 um, 50 um, 40 um, 30 um, 20 um, 10 um, 5 um, 1 um or 0.5 um. In some instances, the width of a feature (e.g., microchannel) is less than about 100 um, 90 um, 80 um, 70 um, 60 um, 50 um, 40 um, 30 um, 20 um or 10 um. In some instances, the width of a feature is at least 10, 25, 50, 75, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or more than 1000 nm. In some instances, the width of a feature is in a range of about 10 nm to about 1000 nm, about 25 nm to about 900 nm, about 50 nm to about 800 nm, about 75 nm to about 700 nm, about 100 nm to about 600 nm, or about 200 nm to about 500. In some instances, the width of a feature is in a range of about 50 nm to about 1000 nm. In some instances, the distance between the center of two adjacent features is from about 0.1 um to about 500 um, 0.5 um to about 500 um, from about 1 um to about 200 um, from about 1 um to about 100 um, from about 5 um to about 200 um, from about 5 um to about 100 um, from about 5 um to about 50 um, or from about 5 um to about 30 um, for example, about 20 um. In some instances, the total width of a feature is about Sum, 10 um, 20 um, 30 um, 40 um, 50 um, 60 um, 70 um, 80 um, 90 um, or 100 um. In some instances, the total width of a feature is about 1 um to 100 um, 30 um to 100 um, or 50 um to 70 um. In some instances, the distance between the center of two adjacent features is from about 0.5 um to about 2 um, from about 0.5 um to about 2 um, from about 0.75 um to about 2 um, from about 1 um to about 2 um, from about 0.2 um to about 1 um, from about 0.5 um to about 1.5 um, from about 0.5 um to about 0.8 um, or from about 0.5 um to about 1 um, for example, about 1 um. In some instances, the total width of a features is about 50 nm, 0.1 um, 0.2 um, 0.3 um, 0.4 um, 0.5 um, 0.6 um, 0.7 um, 0.8 um, 0.9 um, 1 um, 1.1 um, 1.2 um, 1.3 um, 1.4 um, or 1.5 um. In some instances, the total width of a feature is about 0.5 um to 2 um, 0.75 um to 1 um, or 0.9 um to 2 um.


In some instances, each feature supports the synthesis of a population of oligonucleotides having a different sequence than a population of oligonucleotides grown on another feature. Provided herein are surfaces which comprise at least 10, 100, 256, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, 20000, 30000, 40000, 50000 or more clusters. Provided herein are surfaces which comprise more than 2,000; 5,000; 10,000; 20,000; 30,000; 50,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 5,000,000; or 10,000,000 or more distinct features. In some cases, each cluster includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 130, 150, 200, 500 or more features. In some cases, each cluster includes 50 to 500, 50 to 200, 50 to 150, or 100 to 150 features. In some cases, each cluster includes 100 to 150 features. In exemplary arrangements, each cluster includes 109, 121, 130 or 137 features.


Provided herein are features having a width at the longest segment of 5 to 100 um. In some cases, the features have a width at the longest segment of about 30, 35, 40, 45, 50, 55 or 60 um. In some cases, the features are channels having multiple segments, wherein each segment has a center to center distance apart of 5 to 50 um. In some cases, the center to center distance apart for each segment is about 5, 10, 15, 20 or 25 um.


In some instances, the number of distinct oligonucleotides synthesized on the surface of a structure described herein is dependent on the number of distinct features available in the substrate. In some instances, the density of features within a cluster of a substrate is at least or about 1 feature per mm2, 10 features per mm2, 25 features per mm2, 50 features per mm2, 65 features per mm2, 75 features per mm2, 100 features per mm2, 130 features per mm2, 150 features per mm2, 175 features per mm2, 200 features per mm2, 300 features per mm2, 400 features per mm2, 500 features per mm2, 1,000 features per mm2 or more. In some cases, a substrate comprises from about 10 features per mm2 to about 500 mm2, from about 25 features per mm2 to about 400 mm2, from about 50 features per mm2 to about 500 mm2, from about 100 features per mm2 to about 500 mm2, from about 150 features per mm2 to about 500 mm2, from about 10 features per mm2 to about 250 mm2, from about 50 features per mm2 to about 250 mm2, from about 10 features per mm2 to about 200 mm2, or from about 50 features per mm2 to about 200 mm2. In some instances, the distance between the centers of two adjacent features within a cluster is from about 10 um to about 500 um, from about 10 um to about 200 um, or from about 10 um to about 100 um. In some cases, the distance between two centers of adjacent features is greater than about 10 um, 20 um, 30 um, 40 um, 50 um, 60 um, 70 um, 80 um, 90 um or 100 um. In some cases, the distance between the centers of two adjacent features is less than about 200 um, 150 um, 100 um, 80 um, 70 um, 60 um, 50 um, 40 um, 30 um, 20 um or 10 um. In some cases, the distance between the centers of two adjacent features is less than about 10000 nm, 8000 nm, 6000 nm, 4000 nm, 2000 nm 1000 nm, 800 nm, 600 nm, 400 nm, 200 nm, 150 nm, 100 nm, 80 um, 70 nm, 60 nm, 50 nm, 40 nm, 30 nm, 20 nm or 10 nm. In some instances, each square meter of a structure described herein allows for at least about 107, 108, 109, 1010, 1011 features, where each feature supports one oligonucleotide. In some instances, 109 oligonucleotides are supported on less than about 6, 5, 4, 3, 2 or 1 m2 of a structure described herein.


Structures for oligonucleotide synthesis for use with devices, compositions, systems, and methods for bioencryption and/or biodecryption as described herein supports synthesis of a number of oligonucleotides. In some instances, a structure described herein provides support for the synthesis of more than 2,000; 5,000; 10,000; 20,000; 30,000; 50,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; 10,000,000 or more non-identical oligonucleotides. In some cases, the structure provides support for the synthesis of more than 2,000; 5,000; 10,000; 20,000; 50,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; 10,000,000 or more oligonucleotides encoding for distinct sequences. In some instances, at least a portion of the oligonucleotides have an identical sequence or are configured to be synthesized with an identical sequence. In some instances, the structure provides a surface environment for the growth of oligonucleotides having at least about 50, 60, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 bases or more.


In some instances, oligonucleotides are synthesized on distinct features of a structure, wherein each feature supports the synthesis of a population of oligonucleotides. In some cases, each feature supports the synthesis of a population of oligonucleotides having a different sequence than a population of oligonucleotides grown on another locus. In some instances, the features of a structure are located within a plurality of clusters. In some instances, a structure comprises at least 10, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, 20000, 30000, 40000, 50000 or more clusters. In some instances, a structure comprises more than 2,000; 5,000; 10,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,100,000; 1,200,000; 1,300,000; 1,400,000; 1,500,000; 1,600,000; 1,700,000; 1,800,000; 1,900,000; 2,000,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; or 10,000,000 or more distinct features. In some cases, each cluster includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 130, 150 or more features (loci). In some instances, each cluster includes 50 to 500, 100 to 150, or 100 to 200 features. In some instances, each cluster includes 109, 121, 130 or 137 features. In some instances, each cluster includes 5, 6, 7, 8, 9, 10, 11 or 12 features. In some instances, oligonucleotides from distinct features within one cluster have sequences that, when assembled, encode for a contiguous longer oligonucleotide of a predetermined sequence.


Structure Size


Structures for oligonucleotide synthesis for use with devices, compositions, systems, and methods for bioencryption and/or biodecryption as described herein comprise a variety of sizes. In some instances, a structure described herein is about the size of a standard 96 well plate, for example between about 100 and 200 mm by between about 50 and 150 mm. In some instances, a structure described herein has a diameter less than or equal to about 1000 mm, 500 mm, 450 mm, 400 mm, 300 mm, 250 nm, 200 mm, 150 mm, 100 mm or 50 mm. In some instances, the diameter of a substrate is between about 25 mm and 1000 mm, between about 25 mm and about 800 mm, between about 25 mm and about 600 mm, between about 25 mm and about 500 mm, between about 25 mm and about 400 mm, between about 25 mm and about 300 mm, or between about 25 mm and about 200. Non-limiting examples of substrate size include about 300 mm, 200 mm, 150 mm, 130 mm, 100 mm, 76 mm, 51 mm and 25 mm. In some instances, a substrate has a planar surface area of at least about 100 mm2; 200 mm2; 500 mm2; 1,000 mm2; 2,000 mm2; 5,000 mm2; 10,000 mm2; 12,000 mm2; 15,000 mm2; 20,000 mm2; 30,000 mm2; 40,000 mm2; 50,000 mm2 or more. In some instances, the thickness of the substrate is between about 50 mm and about 2000 mm, between about 50 mm and about 1000 mm, between about 100 mm and about 1000 mm, between about 200 mm and about 1000 mm, or between about 250 mm and about 1000 mm. Non-limiting examples of substrate thickness include 275 mm, 375 mm, 525 mm, 625 mm, 675 mm, 725 mm, 775 mm and 925 mm. In some cases, the thickness of the substrate varies with diameter and depends on the composition of the substrate. For example, a structure comprising materials other than silicon may have a different thickness than a silicon structure of the same diameter. Structure thickness may be determined by the mechanical strength of the material used and the structure must be thick enough to support its own weight without cracking during handling. In some instances, a structure is more than about 1, 2, 3, 4, 5, 10, 15, 30, 40, 50 feet in any one dimension.


Materials


Structures for oligonucleotide synthesis for use with devices, compositions, systems, and methods for bioencryption and/or biodecryption as described herein may be fabricated from a variety of materials. In certain instances, the materials from which the substrates/solid supports of the disclosure are fabricated exhibit a low level of oligonucleotide binding. In some situations, material(s) that is (are) transparent to visible and/or UV light can be employed. Materials that are sufficiently conductive, e.g. those that can form uniform electric fields across all or a portion of the substrates/solids support described herein, can be utilized. In some instances, such materials may be connected to an electric ground. In some cases, the substrate or solid support can be heat conductive or insulated. The materials can be chemical resistant and heat resistant to support chemical or biochemical reactions such as a series of oligonucleotide synthesis reactions. For flexible materials, materials of interest can include: nylon, both modified and unmodified, nitrocellulose, polypropylene, and the like.


For rigid materials, specific materials of interest include: glass; fuse silica; silicon, plastics (for example polytetraflouroethylene, polypropylene, polystyrene, polycarbonate, and blends thereof, and the like); and metals (for example, gold, platinum, and the like). The structure can be fabricated from a material selected from the group consisting of silicon, polystyrene, agarose, dextran, cellulosic polymers, polyacrylamides, polydimethylsiloxane (PDMS), and glass. The substrates/solid supports or the microstructures, reactors therein may be manufactured with a combination of materials listed herein or any other suitable material known in the art.


The term “flexible” is used herein to refer to a structure that is capable of being bent, folded or similarly manipulated without breakage. In some cases, a flexible structure is bent at least 30 degrees around a roller. In some cases, a flexible structure is bent at least 180 degrees around a roller. In some cases, a flexible structure is bent at least 270 degrees around a roller. In some instances, a flexible structure is bent about 360 degrees around a roller. In some cases, the roller is less than about 10 cm, 5 cm, 3 cm, 2 cm or 1 cm in radius. In some instances, the flexible structure is bent and straightened repeatedly in either direction at least 100 times without failure (for example, cracking) or deformation at 20° C. In some instances, a flexible structure described herein has a thickness that is amenable to rolling. In some cases, the thickness of the flexible structure described herein is less than about 50 mm, 10 mm, 1 mm, or 0.5 mm.


Exemplary flexible materials for structure described herein include, without limitation, nylon (unmodified nylon, modified nylon, clear nylon), nitrocellulose, polypropylene, polycarbonate, polyethylene, polyurethane, polystyrene, acetal, acrylic, acrylonitrile, butadiene styrene (ABS), polyester films such as polyethylene terephthalate, polymethyl methacrylate or other acrylics, polyvinyl chloride or other vinyl resin, transparent PVC foil, transparent foil for printers, poly(methyl methacrylate) (PMMA), methacrylate copolymers, styrenic polymers, high refractive index polymers, fluorine-containing polymers, polyethersulfone, polyimides containing an alicyclic structure, rubber, fabric, metal foils, and any combination thereof. Various plasticizers and modifiers may be used with polymeric substrate materials to achieve selected flexibility characteristics.


Flexible structures described herein may comprise a plastic material. In some instances, the flexible structure comprises a thermoplastic material. Non-limiting examples of thermoplastic materials include acrylic, acrylonitrile butadiene styrene, nylon, polylactic acid, polybenzimidazole, polycarbonate, polyether sulfone, polyetherether ketone, polyetherimide, polyethylene, polyphenylene oxide, polyphenylene sulfide, polypropylene, polystyrene, polyvinyl chloride, and polytetrafluoroethylene. In some instances, the substrate comprises a thermoplastic material in the polyaryletherketone (PEAK) family. Non-limiting examples of PEAK thermoplastics include polyetherketone (PEK), polyetherketoneketone (PEKK), poly(ether ether ketone ketone) (PEEKK), polyether ether ketone (PEEK), and polyetherketoneetherketoneketone (PEKEKK). In some instances, the flexible structure comprises a thermoplastic material compatible with toluene. In some instances, the flexibility of the plastic material is increased by the addition of a plasticizer. An example of a plasticizer is an ester-based plasticizer, such as phthalate. Phthalate plasticizers include bis(2-ethylhexyl) phthalate (DEHP), diisononly phthalate (DINP), di-n-butyl phthalate (DnBP, DBP), butyl benzyl phthalate (BBzP), diisodecyl phthalate (DIDP), dioctyl phthalate (DOP, DnOP), diisooctyl phthalate (DIOP), diethyl phthalate (DEP), diisobutyl phthalate (DIBP), and di-n-hexyl phthalate. In some instances, modification of the thermoplastic polymer through copolymerization or through the addition of non-reactive side chains to monomers before polymerization also increases flexibility.


Provided herein are flexible structures which may further comprise a fluoroelastomer. Materials having about 80% fluoroelastomers are designated as FKMs. Fluoroelastomers include perfluoro-elastomers (FFKMs) and tetrafluoroethylene/propylene rubbers (FEPM). Fluoroelastomers have five known types. Type 1 FKMs are composed of vinylidene fluoride (VDF) and hexafluoropropylene (HFP) and their fluorine content typically is around 66% by weight. Type 2 FKMs are composed of VDF, HFP, and tetrafluoroethylene (TFE) and typically have between about 68% and 69% fluorine. Type 3 FKMs are composed of VDF, TFE, and perfluoromethylvinylether (PMVE) and typically have between about 62% and 68% fluorine. Type 4 FKMs are composed of propylene, TFE, and VDF and typically have about 67% fluorine. Type 5 FKMs are composed of VDF, HFP, TFE, PMVE, and ethylene.


In some instances, a substrate disclosed herein comprises a computer readable material. Computer readable materials include, without limitation, magnetic media, reel-to-reel tape, cartridge tape, cassette tape, flexible disk, paper media, film, microfiche, continuous tape (e.g., a belt) and any media suitable for storing electronic instructions. In some cases, the substrate comprises magnetic reel-to-reel tape or a magnetic belt. In some instances, the substrate comprises a flexible printed circuit board.


Structures described herein may be transparent to visible and/or UV light. In some instances, structures described herein are sufficiently conductive to form uniform electric fields across all or a portion of a structure. In some instances, structures described herein are heat conductive or insulated. In some instances, the structures are chemical resistant and heat resistant to support a chemical reaction such as an oligonucleotide synthesis reaction. In some instances, the structure is magnetic. In some instances, the structures comprise a metal or a metal alloy.


Structures for oligonucleotide synthesis may be over 1, 2, 5, 10, 30, 50 or more feet long in any dimension. In the case of a flexible structure, the flexible structure is optionally stored in a wound state, e.g., in a reel. In the case of a large rigid structure, e.g., greater than 1 foot in length, the rigid structure can be stored vertically or horizontally.


Encryption Key Markings on the Structure's Surface


Structures for oligonucleotide synthesis for use with devices, compositions, systems, and methods for bioencryption and/or biodecryption as described herein may comprise encryption markings. Provided herein are structures having markings 1401 wherein the markings provide information relating to the source item of information associated with a nearby population of oligonucleotides, an encryption scheme for decrypting the sequence of the nearby population of oligonucleotides, the copy number for the nearby population of oligonucleotides, or any combination thereof. See, e.g., FIGS. 14B-14C. The markings may be visible to the naked eye, or visible under a magnified view using a microscope. In some instances, the markings on the surface are only visible after a treatment condition to expose the marking, such as a heat, chemical or light treatment (e.g., UV or IR light to illuminate the marking). An example ink developed by heat includes, without limitation, cobalt chloride, (which turns blue when heated). Example inks developed by chemical reaction include, without limitation, phenolphthalein, copper sulfate, lead(II) nitrate, cobalt(II) chloride, and cerium oxalate developed by manganese sulfate and hydrogen peroxide.


Surface Preparation


Structures for oligonucleotide synthesis for use with devices, compositions, systems, and methods for bioencryption and/or biodecryption as described herein may comprise a surface for oligonucleotide synthesis. Provided herein are methods to support the immobilization of a biomolecule on a substrate, where a surface of a structure described herein comprises a material and/or is coated with a material that facilitates a coupling reaction with the biomolecule for attachment. To prepare a structure for biomolecule immobilization, surface modifications may be employed that chemically and/or physically alter the substrate surface by an additive or subtractive process to change one or more chemical and/or physical properties of a substrate surface or a selected site or region of the surface. For example, surface modification involves (1) changing the wetting properties of a surface, (2) functionalizing a surface, i.e. providing, modifying or substituting surface functional groups, (3) defunctionalizing a surface, i.e. removing surface functional groups, (4) otherwise altering the chemical composition of a surface, e.g., through etching, (5) increasing or decreasing surface roughness, (6) providing a coating on a surface, e.g., a coating that exhibits wetting properties that are different from the wetting properties of the surface, and/or (7) depositing particulates on a surface. In some instances, the surface of a structure is selectively functionalized to produce two or more distinct areas on a structure, wherein at least one area has a different surface or chemical property that another area of the same structure. Such properties include, without limitation, surface energy, chemical termination, surface concentration of a chemical moiety, and the like.


In some instances, a surface of a structure disclosed herein is modified to comprise one or more actively functionalized surfaces configured to bind to both the surface of the substrate and a biomolecule, thereby supporting a coupling reaction to the surface. In some instances, the surface is also functionalized with a passive material that does not efficiently bind the biomolecule, thereby preventing biomolecule attachment at sites where the passive functionalization agent is bound. In some cases, the surface comprises an active layer only defining distinct features for biomolecule support.


In some instances, the surface is contacted with a mixture of functionalization groups which are in any different ratio. In some instances, a mixture comprises at least 2, 3, 4, 5 or more different types of functionalization agents. In some cases, the ratio of the at least two types of surface functionalization agents in a mixture is about 1:1, 1:2, 1:5, 1:10, 2:10, 3:10, 4:10, 5:10, 6:10, 7:10, 8:10, 9:10, or any other ratio to achieve a desired surface representation of two groups. In some instances, desired surface tensions, wettabilities, water contact angles, and/or contact angles for other suitable solvents are achieved by providing a substrate surface with a suitable ratio of functionalization agents. In some cases, the agents in a mixture are chosen from suitable reactive and inert moieties, thus diluting the surface density of reactive groups to a desired level for downstream reactions. In some instances, the mixture of functionalization reagents comprises one or more reagents that bind to a biomolecule and one or more reagents that do not bind to a biomolecule. Therefore, modulation of the reagents allows for the control of the amount of biomolecule binding that occurs at a distinct area of functionalization.


In some instances, a method for substrate functionalization comprises deposition of a silane molecule onto a surface of a substrate. The silane molecule may be deposited on a high energy surface of the substrate. In some instances the high surface energy region includes a passive functionalization reagent. Methods described herein provide for a silane group to bind the surface, while the rest of the molecule provides a distance from the surface and a free hydroxyl group at the end to which a biomolecule attaches. In some instances, the silane is an organofunctional alkoxysilane molecule. Non-limiting examples of organofunctional alkoxysilane molecules include dimethylchloro-octodecyl-silane, methyldichloro-octodecyl-silane, trichloro-octodecyl-silane, and trimethyl-octodecyl-silane, triethyl-octodecyl-silane. In some instances, the silane is an amino silane. Examples of amino silanes include, without limitation, 11-acetoxyundecyltriethoxysilane, n-decyltriethoxysilane, (3-aminopropyl)trimethoxysilane, (3-aminopropyl)triethoxysilane, glycidyloxypropyl/trimethoxysilane and N-(3-triethoxysilylpropyl)-4-hydroxybutyramide. In some instances, the silane comprises 11-acetoxyundecyltriethoxysilane, n-decyltriethoxysilane, (3-aminopropyl)trimethoxysilane, (3-aminopropyl)triethoxysilane, glycidyloxypropyl/trimethoxysilane, N-(3-triethoxysilylpropyl)-4-hydroxybutyramide, or any combination thereof. In some instances, an active functionalization agent comprises 11-acetoxyundecyltriethoxysilane. In some instances, an active functionalization agent comprises n-decyltriethoxysilane. In some cases, an active functionalization agent comprises glycidyloxypropyltriethoxysilane (GOPS). In some instances, the silane is a fluorosilane. In some instances, the silane is a hydrocarbon silane. In some cases, the silane is 3-iodo-propyltrimethoxysilane. In some cases, the silane is octylchlorosilane.


In some instances, silanization is performed on a surface through self-assembly with organofunctional alkoxysilane molecules. The organofunctional alkoxysilanes are classified according to their organic functions. Non-limiting examples of siloxane functionalizing reagents include hydroxyalkyl siloxanes (silylate surface, functionalizing with diborane and oxidizing the alcohol by hydrogen peroxide), diol (dihydroxyalkyl) siloxanes (silylate surface, and hydrolyzing to diol), aminoalkyl siloxanes (amines require no intermediate functionalizing step), glycidoxysilanes (3-glycidoxypropyl-dimethyl-ethoxysilane, glycidoxy-trimethoxysilane), mercaptosilanes (3-mercaptopropyl-trimethoxysilane, 3-4 epoxycyclohexyl-ethyltrimethoxysilane or 3-mercaptopropyl-methyl-dimethoxysilane), bicyclohepthenyl-trichlorosilane, butyl-aldehydr-trimethoxysilane, or dimeric secondary aminoalkyl siloxanes. Exemplary hydroxyalkyl siloxanes include allyl trichlorochlorosilane turning into 3-hydroxypropyl, or 7-oct-1-enyl trichlorochlorosilane turning into 8-hydroxyoctyl. The diol (dihydroxyalkyl) siloxanes include glycidyl trimethoxysilane-derived (2,3-dihydroxypropyloxy)propyl (GOPS). The aminoalkyl siloxanes include 3-aminopropyl trimethoxysilane turning into 3-aminopropyl (3-aminopropyl-triethoxysilane, 3-aminopropyl-diethoxy-methylsilane, 3-aminopropyl-dimethyl-ethoxysilane, or 3-aminopropyl-trimethoxysilane). In some cases, the dimeric secondary aminoalkyl siloxanes is bis (3-trimethoxysilylpropyl) amine turning into bis(silyloxylpropyl)amine.


Active functionalization areas may comprise one or more different species of silanes, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more silanes. In some cases, one of the one or more silanes is present in the functionalization composition in an amount greater than another silane. For example, a mixed silane solution having two silanes comprises a 99:1, 98:2, 97:3, 96:4, 95:5, 94:6, 93:7, 92:8, 91:9, 90:10, 89:11, 88:12, 87:13, 86:14, 85:15, 84:16, 83:17, 82:18, 81:19, 80:20, 75:25, 70:30, 65:35, 60:40, 55:45 ratio of one silane to another silane. In some instances, an active functionalization agent comprises 11-acetoxyundecyltriethoxysilane and n-decyltriethoxysilane. In some instances, an active functionalization agent comprises 11-acetoxyundecyltriethoxysilane and n-decyltriethoxysilane in a ratio from about 20:80 to about 1:99, or about 10:90 to about 2:98, or about 5:95.


In some instances, functionalization comprises deposition of a functionalization agent to a structure by any deposition technique, including, but not limiting to, chemical vapor deposition (CVD), atomic layer deposition (ALD), plasma enhanced CVD (PECVD), plasma enhanced ALD (PEALD), metal organic CVD (MOCVD), hot wire CVD (HWCVD), initiated CVD (iCVD), modified CVD (MCVD), vapor axial deposition (VAD), outside vapor deposition (OVD), physical vapor deposition (e.g., sputter deposition, evaporative deposition), and molecular layer deposition (MLD).


Any step or component in the following functionalization process be omitted or changed in accordance with properties desired of the final functionalized substrate. In some cases, additional components and/or process steps are added to the process workflows embodied herein. In some instances, a substrate is first cleaned, for example, using a piranha solution. An example of a cleaning process includes soaking a substrate in a piranha solution (e.g., 90% H2SO4, 10% H2O2) at an elevated temperature (e.g., 120° C.) and washing (e.g., water) and drying the substrate (e.g., nitrogen gas). The process optionally includes a post piranha treatment comprising soaking the piranha treated substrate in a basic solution (e.g., NH4OH) followed by an aqueous wash (e.g., water). In some instances, a surface of a structure is plasma cleaned, optionally following the piranha soak and optional post piranha treatment. An example of a plasma cleaning process comprises an oxygen plasma etch. In some instances, the surface is deposited with an active functionalization agent following by vaporization. In some instances, the substrate is actively functionalized prior to cleaning, for example, by piranha treatment and/or plasma cleaning.


The process for surface functionalization optionally comprises a resist coat and a resist strip. In some instances, following active surface functionalization, the substrate is spin coated with a resist, for example, SPR™ 3612 positive photoresist. The process for surface functionalization, in various instances, comprises lithography with patterned functionalization. In some instances, photolithography is performed following resist coating. In some instances, after lithography, the surface is visually inspected for lithography defects. The process for surface functionalization, in some instances, comprises a cleaning step, whereby residues of the substrate are removed, for example, by plasma cleaning or etching. In some instances, the plasma cleaning step is performed at some step after the lithography step.


In some instances, a surface coated with a resist is treated to remove the resist, for example, after functionalization and/or after lithography. In some cases, the resist is removed with a solvent, for example, with a stripping solution comprising N-methyl-2-pyrrolidone. In some cases, resist stripping comprises sonication or ultrasonication. In some instances, a resist is coated and stripped, followed by active functionalization of the exposed areas to create a desired differential functionalization pattern.


In some instances, the methods and compositions described herein relate to the application of photoresist for the generation of modified surface properties in selective areas, wherein the application of the photoresist relies on the fluidic properties of the surface defining the spatial distribution of the photoresist. Without being bound by theory, surface tension effects related to the applied fluid may define the flow of the photoresist. For example, surface tension and/or capillary action effects may facilitate drawing of the photoresist into small structures in a controlled fashion before the resist solvents evaporate. In some instances, resist contact points are pinned by sharp edges, thereby controlling the advance of the fluid. The underlying structures may be designed based on the desired flow patterns that are used to apply photoresist during the manufacturing and functionalization processes. A solid organic layer left behind after solvents evaporate may be used to pursue the subsequent steps of the manufacturing process. Structures may be designed to control the flow of fluids by facilitating or inhibiting wicking effects into neighboring fluidic paths. For example, a structure is designed to avoid overlap between top and bottom edges, which facilitates the keeping of the fluid in top structures allowing for a particular disposition of the resist. In an alternative example, the top and bottom edges overlap, leading to the wicking of the applied fluid into bottom structures. Appropriate designs may be selected accordingly, depending on the desired application of the resist.


In some instances, a structure described herein has a surface that comprises a material having a thickness of at least or at least about 0.1 nm, 0.5 nm, 1 nm, 2 nm, 5 nm, 10 nm or 25 nm that comprises a reactive group capable of binding nucleosides. Exemplary surfaces include, without limitation, glass and silicon, such as silicon dioxide and silicon nitride. In some cases, exemplary surfaces include nylon and PMMA.


In some instances, electromagnetic radiation in the form of UV light is used for surface patterning. In some instances, a lamp is used for surface patterning, and a mask mediates exposure locations of the UV light to the surface. In some instances, a laser is used for surface patterning, and a shutter opened/closed state controls exposure of the UV light to the surface. The laser arrangement may be used in combination with a flexible structure that is capable of moving. In such an arrangement, the coordination of laser exposure and flexible structure movement is used to create patterns of one or more agents having differing nucleoside coupling capabilities.


Material Deposition Systems


Provided herein are systems and devices for the deposition and storage of biomolecules on a structure described herein. In some instances, the biomolecules are oligonucleotides that store encoded information in their sequences. In some instances, the system comprises a surface of a structure to support biomolecule attachment and/or a device for application of a biomolecule to the surface of the substrate. In an example, the device for biomolecule application is an oligonucleotide synthesizer. In some instances, the system comprises a device for treating the substrate with a fluid, for example, a flow cell. In some instances, the system comprises a device for moving the substrate between the application device and the treatment device. For instances where the substrate is a reel-to-reel tape, the system may comprise two or more reels that allow for access of different portions of the substrate to the application and optional treatment device at different times.


A first example of an oligonucleotide material deposition system for oligonucleotide synthesis is shown in FIG. 15. The system includes a material deposition device that moves in the X-Y direction to align with the location of the substrate. The material deposition device can also move in the Z direction to seal with the substrate, forming a resolved reactor. A resolved reactor is configured to allow for the transfer of fluid, including oligonucleotides and/or reagents, from the substrate to a capping element and/or vice versa. As shown in FIG. 15, fluid may pass through either or both the substrate and the capping element and includes, without limitation, coupling reagents, capping reagents, oxidizers, de-blocking agents, acetonitrile and nitrogen gas. Examples of devices that are capable of high resolution droplet deposition include the printhead of inkjet printers and laser printers. The devices useful in the systems and methods described herein achieve a resolution from about 100 dots per inch (DPI) to about 50,000 DPI; from about 100 DPI to about 20,000 DPI; from about 100 DPI to about 10,000 DPI; from about 100 DPI to about 5,000 DPI; from about 1,000 DPI to about 20,000 DPI; or from about 1,000 DPI to about 10,000 DPI. In some instances, the devices have a resolution at least about 1,000; 2,000; 3,000; 4,000; 5,000; 10,000; 12,000 DPI, or 20,000 DPI. The high resolution deposition performed by the device is related to the number and density of each nozzle that corresponds to a feature of the substrate.


An exemplary process workflow for de novo synthesis of an oligonucleotide on a substrate using an oligonucleotide synthesizer is shown in FIG. 16. Droplets comprising oligonucleotide synthesis reagents are released from the material deposition device to the substrate in a stepwise manner, wherein the material deposition device has a piezo ceramic material and electrodes to convert electrical signals into a mechanical signal for releasing the droplets. The droplets are released to specific locations on the surface of the substrate one nucleobase at a time to generate a plurality of synthesized oligonucleotides having predetermined sequences that encode data. In some cases, the synthesized oligonucleotides are stored on the substrate. Nucleic acid reagents may be deposited on the substrate surface in a non-continuous, or drop-on-demand method. Examples of such methods include the electromechanical transfer method, electric thermal transfer method, and electrostatic attraction method. In the electromechanical transfer method, piezoelectric elements deformed by electrical pulses cause the droplets to be ejected. In the electric thermal transfer method, bubbles are generated in a chamber of the device, and the expansive force of the bubbles causes the droplets to be ejected. In the electrostatic attraction method, electrostatic force of attraction is used to eject the droplets onto the substrate. In some cases, the drop frequency is from about 5 KHz to about 500 KHz; from about 5 KHz to about 100 KHz; from about 10 KHz to about 500 KHz; from about 10 KHz to about 100 KHz; or from about 50 KHz to about 500 KHz. In some cases, the frequency is less than about 500 KHz, 200 KHz, 100 KHz, or 50 KHz.


The size of the droplets dispensed correlates to the resolution of the device. In some instances, the devices deposit droplets of reagents at sizes from about 0.01 pl to about 20 pl, from about 0.01 pl to about 10 pl, from about 0.01 pl to about 1 pl, from about 0.01 pl to about 0.5 pl, from about 0.01 pl to about 0.01 pl, or from about 0.05 pl to about 1 pl. In some instances, the droplet size is less than about 1 pl, 0.5 pl, 0.2 pl, 0.1 pl, or 0.05 pl. The size of droplets dispensed by the device is correlated to the diameters of deposition nozzles, wherein each nozzle is capable of depositing a reagent onto a feature of the substrate. In some instances, a deposition device of an oligonucleotide synthesizer comprises from about 100 to about 10,000 nozzles; from about 100 to about 5,000 nozzles; from about 100 to about 3,000 nozzles; from about 500 to about 10,000 nozzles; or from about 100 to about 5,000 nozzles. In some cases, the deposition device comprises greater than 1,000; 2,000; 3,000; 4,000; 5,000; or 10,000 nozzles. In some instances, each material deposition device comprises a plurality of nozzles, where each nozzle is optionally configured to correspond to a feature on a substrate. Each nozzle may deposit a reagent component that is different from another nozzle. In some instances, each nozzle deposits a droplet that covers one or more features of the substrate. In some instances, one or more nozzles are angled. In some instances, multiple deposition devices are stacked side by side to achieve a fold increase in throughput. In some cases, the gain is 2×, 4×, 8× or more. An example of a deposition device is Samba Printhead (Fujifilm). A Samba Printhead may be used with the Samba Web Administration Tool (SWAT).


The number of deposition sites may be increased by using and rotating the same deposition device by a certain degree or saber angle. By rotating the deposition device, each nozzle is jetted with a certain amount of delay time corresponding to the saber angle. This unsynchronized jetting creates a cross talk among the nozzles. Therefore, when the droplets are jetting at a certain saber angle different from 0 degrees, the droplet volume from the nozzle could be different.


In some arrangements, the configuration of an oligonucleotide synthesis system allows for a continuous oligonucleotide synthesis process that exploits the flexibility of a substrate for traveling in a reel-to-reel type process. This synthesis process operates in a continuous production line manner with the substrate travelling through various stages of oligonucleotide synthesis using one or more reels to rotate the position of the substrate. In an exemplary embodiment, an oligonucleotide synthesis reaction comprises rolling a substrate: through a solvent bath, beneath a deposition device for phosphoramidite deposition, through a bath of oxidizing agent, through an acetonitrile wash bath, and through a deblock bath. Optionally, the tape is also traversed through a capping bath. A reel-to-reel type process allows for the finished product of a substrate comprising synthesized oligonucleotides to be easily gathered on a take-up reel, where it can be transported for further processing or storage.


In some arrangements, oligonucleotide synthesis proceeds in a continuous process as a continuous flexible tape is conveyed along a conveyor belt system Similar to the reel-to-reel type process, oligonucleotide synthesis on a continuous tape operates in a production line manner, with the substrate travelling through various stages of oligonucleotide synthesis during conveyance. However, in a conveyor belt process, the continuous tape revisits an oligonucleotide synthesis step without rolling and unrolling of the tape, as in a reel-to-reel process. In some arrangements, oligonucleotide synthesis steps are partitioned into zones and a continuous tape is conveyed through each zone one or more times in a cycle. For example, an oligonucleotide synthesis reaction may comprise (1) conveying a substrate through a solvent bath, beneath a deposition device for phosphoramidite deposition, through a bath of oxidizing agent, through an acetonitrile wash bath, and through a block bath in a cycle; and then (2) repeating the cycles to achieve synthesized oligonucleotides of a predetermined length. After oligonucleotide synthesis, the flexible substrate is removed from the conveyor belt system and, optionally, rolled for storage. Rolling may be around a reel, for storage.


In an exemplary arrangement, a flexible substrate comprising thermoplastic material is coated with nucleoside coupling reagent. The coating is patterned into features such that each feature has diameter of about 10 um, with a center-to-center distance between two adjacent features of about 21 um. In this instance, the feature size is sufficient to accommodate a sessile drop volume of 0.2 pl during an oligonucleotide synthesis deposition step. In some cases, the feature density is about 2.2 billion features per m2 (1 feature/441×10−12 m2). In some cases, a 4.5 m2 substrate comprise about 10 billion features, each with a 10 um diameter.


A material deposition device described herein may comprise about 2,048 nozzles that each deposit about 100,000 droplets per second at 1 nucleobase per droplet. For each deposition device, at least about 1.75×1013 nucleobases are deposited on the substrate per day. In some instances, 100 to 500 nucleobase oligonucleotides are synthesized. In some cases, 200 nucleobase oligonucleotides are synthesized. Optionally, over 3 days, at a rate of about 1.75×1013 bases per day, at least about 262.5×109 oligonucleotides are synthesized.


In some arrangements, a device for application of one or more reagents to a substrate during a synthesis reaction is configured to deposit reagents and /or nucleotide monomers for nucleoside phosphoramidite based synthesis. Reagents for oligonucleotide synthesis include reagents for oligonucleotide extension and wash buffers. As non-limiting examples, the device deposits cleaning reagents, coupling reagents, capping reagents, oxidizers, de-blocking agents, acetonitrile, gases such as nitrogen gas, and any combination thereof. In addition, the device optionally deposits reagents for the preparation and/or maintenance of substrate integrity. In some instances, the oligonucleotide synthesizer deposits a drop having a diameter less than about 200 um, 100 um, or 50 um in a volume less than about 1000, 500, 100, 50, or 20 pl. In some cases, the oligonucleotide synthesizer deposits between about 1 and 10000, 1 and 5000, 100 and 5000, or 1000 and 5000 droplets per second.


In some arrangements, during oligonucleotide synthesis, the substrate is positioned within and/or sealed within a flow cell. The flow cell may provide continuous or discontinuous flow of liquids such as those comprising reagents necessary for reactions within the substrate, for example, oxidizers and/or solvents. The flow cell may provide continuous or discontinuous flow of a gas, such as nitrogen, for drying the substrate typically through enhanced evaporation of a volatile substrate. A variety of auxiliary devices are useful to improve drying and reduce residual moisture on the surface of the substrate. Examples of such auxiliary drying devices include, without limitation, a vacuum source, depressurizing pump and a vacuum tank. In some cases, an oligonucleotide synthesis system comprises one or more flow cells, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, or 20 and one or more substrates, such as 2, 3, 4, 5, 6, 7, 8, 9, 10 or 20. In some cases, a flow cell is configured to hold and provide reagents to the substrate during one or more steps in a synthesis reaction. In some instances, a flowcell comprises a lid that slides over the top of a substrate and can be clamped into place to form a pressure tight seal around the edge of the substrate. An adequate seal includes, without limitation, a seal that allows for about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 atmospheres of pressure. In some cases, the lid of the flow cell is opened to allow for access to an application device such as an oligonucleotide synthesizer. In some cases, one or more steps of an oligonucleotide synthesis method are performed on a substrate within a flow cell, without the transport of the substrate.


In some arrangements, a device for treating a substrate with a fluid comprises a spray bar. Nucleotide monomers may be applied onto a substrate surface then a spray bar sprays the substrate surface with one or more treatment reagents using spray nozzles of the spray bar. In some arrangements, the spray nozzles are sequentially ordered to correlate with different treatment steps during oligonucleotide synthesis. The chemicals used in different process steps may be changed in the spray bar to readily accommodate changes in a synthesis method or between steps of a synthesis method. In some instances, the spray bar continuously sprays a given chemistry on a surface of a substrate as the substrate moves past the spray bar. In some cases, the spray bar deposits over a wide area of a substrate, much like the spray bars used in lawn sprinklers. In some instances, the spray bar nozzles are positioned to provide a uniform coat of treatment material to a given area of a substrate.


In some instances, an oligonucleotide synthesis system comprises one or more elements useful for downstream processing of synthesized oligonucleotides. As an example, the system comprises a temperature control element such as a thermal cycling device. In some instances, the temperature control element is used with a plurality of resolved reactors to perform nucleic acid assembly such as PCA and/or nucleic acid amplification such as PCR.


De Novo Oligonucleotide Synthesis


Provided herein are systems and methods for oligonucleotide synthesis of a high density of oligonucleotides on a substrate in a short amount of time for use with devices, compositions, systems, and methods for bioencryption and/or biodecryption as described herein. In some instances, the substrate is a flexible substrate. In some instances, at least about 1010, 1011, 1012, 1013, 1014, or 1015 bases are synthesized in one day. In some instances, at least about 10×108, 10×109, 10×1010, 10×1011, or 10×1012 oligonucleotides are synthesized in one day. In some cases, each oligonucleotide synthesized comprises at least about 20, 50, 100, 200, 300, 400 or 500 nucleobases. In some cases, these bases are synthesized with a total average error rate of less than about 1 in 100; 200; 300; 400; 500; 1000; 2000; 5000; 10000; 15000; 20000 bases. In some instances, these error rates are for at least 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, 99.5%, or more of the oligonucleotides synthesized. In some instances, these at least 90%, 95%, 98%, 99%, 99.5%, or more of the oligonucleotides synthesized do not differ from a predetermined sequence for which they encode. In some instances, the error rate for synthesized oligonucleotides on a substrate using the methods and systems described herein is less than about 1 in 200. In some instances, the error rate for synthesized oligonucleotides on a substrate using the methods and systems described herein is less than about 1 in 1,000. In some instances, the error rate for synthesized oligonucleotides on a substrate using the methods and systems described herein is less than about 1 in 2,000. In some instances, the error rate for synthesized oligonucleotides on a substrate using the methods and systems described herein is less than about 1 in 3,000. In some instances, the error rate for synthesized oligonucleotides on a substrate using the methods and systems described herein is less than about 1 in 5,000. Individual types of error rates include mismatches, deletions, insertions, and/or substitutions for the oligonucleotides synthesized on the substrate. The term “error rate” refers to a comparison of the collective amount of synthesized oligonucleotide to an aggregate of predetermined oligonucleotide sequences. In some instances, synthesized oligonucleotides disclosed herein comprise a tether of 12 to 25 bases. In some instances, the tether comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more bases.


A suitable method for oligonucleotide synthesis on a substrate of this disclosure is a phosphoramidite method comprising the controlled addition of a phosphoramidite building block, i.e. nucleoside phosphoramidite, to a growing oligonucleotide chain in a coupling step that forms a phosphite triester linkage between the phosphoramidite building block and a nucleoside bound to the substrate. In some instances, the nucleoside phosphoramidite is provided to the substrate activated. In some instances, the nucleoside phosphoramidite is provided to the substrate with an activator. In some instances, nucleoside phosphoramidites are provided to the substrate in a 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100-fold excess or more over the substrate-bound nucleosides. In some instances, the addition of nucleoside phosphoramidite is performed in an anhydrous environment, for example, in anhydrous acetonitrile. Following addition and linkage of a nucleoside phosphoramidite in the coupling step, the substrate is optionally washed. In some instances, the coupling step is repeated one or more additional times, optionally with a wash step between nucleoside phosphoramidite additions to the substrate. In some instances, an oligonucleotide synthesis method used herein comprises 1, 2, 3 or more sequential coupling steps. Prior to coupling, in many cases, the nucleoside bound to the substrate is de-protected by removal of a protecting group, where the protecting group functions to prevent polymerization. A common protecting group is 4,4′-dimethoxytrityl (DMT).


Following coupling, phosphoramidite oligonucleotide synthesis methods optionally comprise a capping step. In a capping step, the growing oligonucleotide is treated with a capping agent. A capping step generally serves to block unreacted substrate-bound 5′-OH groups after coupling from further chain elongation, preventing the formation of oligonucleotides with internal base deletions. Further, phosphoramidites activated with 1H-tetrazole often react, to a small extent, with the O6 position of guanosine. Without being bound by theory, upon oxidation with I2/water, this side product, possibly via O6-N7 migration, undergoes depurination. The apurinic sites can end up being cleaved in the course of the final deprotection of the oligonucleotide thus reducing the yield of the full-length product. The O6 modifications may be removed by treatment with the capping reagent prior to oxidation with I2/water. In some instances, inclusion of a capping step during oligonucleotide synthesis decreases the error rate as compared to synthesis without capping. As an example, the capping step comprises treating the substrate-bound oligonucleotide with a mixture of acetic anhydride and 1-methylimidazole. Following a capping step, the substrate is optionally washed.


Following addition of a nucleoside phosphoramidite, and optionally after capping and one or more wash steps, the substrate bound growing nucleic acid may be oxidized. The oxidation step comprises oxidizing the phosphite triester into a tetracoordinated phosphate triester, a protected precursor of the naturally occurring phosphate diester internucleoside linkage. In some instances, oxidation of the growing oligonucleotide is achieved by treatment with iodine and water, optionally in the presence of a weak base such as a pyridine, lutidine, or collidine. Oxidation is sometimes carried out under anhydrous conditions using tert-Butyl hydroperoxide or (1S)-(+)-(10-camphorsulfonyl)-oxaziridine (CSO). In some methods, a capping step is performed following oxidation. A second capping step allows for substrate drying, as residual water from oxidation that may persist can inhibit subsequent coupling. Following oxidation, the substrate and growing oligonucleotide is optionally washed. In some instances, the step of oxidation is substituted with a sulfurization step to obtain oligonucleotide phosphorothioates, wherein any capping steps can be performed after the sulfurization. Many reagents are capable of the efficient sulfur transfer, including, but not limited to, 3-(Dimethylaminomethylidene)amino)-3H-1,2,4-dithiazole-3-thione, DDTT, 3H-1,2-benzodithiol-3-one 1,1-dioxide, also known as Beaucage reagent, and N,N,N′N′-Tetraethylthiuram disulfide (TETD).


In order for a subsequent cycle of nucleoside incorporation to occur through coupling, a protected 5′ end of the substrate bound growing oligonucleotide must be removed so that the primary hydroxyl group can react with a next nucleoside phosphoramidite. In some instances, the protecting group is DMT and deblocking occurs with trichloroacetic acid in dichloromethane. Conducting detritylation for an extended time or with stronger than recommended solutions of acids may lead to increased depurination of solid support-bound oligonucleotide and thus reduce the yield of the desired full-length product. Methods and compositions described herein provide for controlled deblocking conditions limiting undesired depurination reactions. In some instances, the substrate bound oligonucleotide is washed after deblocking. In some cases, efficient washing after deblocking contributes to synthesized oligonucleotides having a low error rate.


Methods for the synthesis of oligonucleotides on the substrates described herein typically involve an iterating sequence of the following steps: application of a protected monomer to a surface of a substrate feature to link with either the surface, a linker or with a previously deprotected monomer; deprotection of the applied monomer so that it can react with a subsequently applied protected monomer; and application of another protected monomer for linking. One or more intermediate steps include oxidation and/or sulfurization. In some instances, one or more wash steps precede or follow one or all of the steps.


In some instances, oligonucleotides are synthesized with photolabile protecting groups, where the hydroxyl groups generated on the surface are blocked by photolabile-protecting groups. When the surface is exposed to UV light, such as through a photolithographic mask, a pattern of free hydroxyl groups on the surface may be generated. These hydroxyl groups can react with photoprotected nucleoside phosphoramidites, according to phosphoramidite chemistry. A second photolithographic mask can be applied and the surface can be exposed to UV light to generate second pattern of hydroxyl groups, followed by coupling with 5′-photoprotected nucleoside phosphoramidite. Likewise, patterns can be generated and oligomer chains can be extended. Without being bound by theory, the lability of a photocleavable group depends on the wavelength and polarity of a solvent employed and the rate of photocleavage may be affected by the duration of exposure and the intensity of light. This method can leverage a number of factors such as accuracy in alignment of the masks, efficiency of removal of photo-protecting groups, and the yields of the phosphoramidite coupling step. Further, unintended leakage of light into neighboring sites can be minimized. The density of synthesized oligomer per spot can be monitored by adjusting loading of the leader nucleoside on the surface of synthesis.


The surface of the substrate that provides support for oligonucleotide synthesis may be chemically modified to allow for the synthesized oligonucleotide chain to be cleaved from the surface. In some instances, the oligonucleotide chain is cleaved at the same time as the oligonucleotide is deprotected. In some cases, the oligonucleotide chain is cleaved after the oligonucleotide is deprotected. In an exemplary scheme, a trialkoxysilyl amine such as (CH3CH2O)3Si—(CH2)2-NH2 is reacted with surface SiOH groups of a substrate, followed by reaction with succinic anhydride with the amine to create an amide linkage and a free OH on which the nucleic acid chain growth is supported. Cleavage includes gas cleavage with ammonia or methylamine. In some instances, once released from the surface, oligonucleotides are assembled into larger nucleic acids that are sequenced and decoded to extract stored information.


Oligonucleotides may be designed to collectively span a large region of a predetermined sequence that encodes for information. In some instances, larger oligonucleotides are generated through ligation reactions to join the synthesized oligonucleotides. One example of a ligation reaction is polymerase chain assembly (PCA). In some instances, at least a portion of the oligonucleotides are designed to include an appended region that is a substrate for universal primer binding. For PCA reactions, the presynthesized oligonucleotides include overlaps with each other (e.g., 4, 20, 40 or more bases with overlapping sequence). During the polymerase cycles, the oligonucleotides anneal to complementary fragments and then are filled in by polymerase. Each cycle thus increases the length of various fragments randomly depending on which oligonucleotides find each other. Complementarity amongst the fragments allows for forming a complete large span of double-stranded DNA. In some cases, after the PCA reaction is complete, an error correction step is conducted using mismatch repair detecting enzymes to remove mismatches in the sequence. Once larger fragments of a target sequence are generated, they can be amplified. For example, in some cases, a target sequence comprising 5′ and 3′ terminal adapter sequences is amplified in a polymerase chain reaction (PCR) which includes modified primers that hybridize to the adapter sequences. In some cases, the modified primers comprise one or more uracil bases. The use of modified primers allows for removal of the primers through enzymatic reactions centered on targeting the modified base and/or gaps left by enzymes which cleave the modified base pair from the fragment. What remains is a double-stranded amplification product that lacks remnants of adapter sequence. In this way, multiple amplification products can be generated in parallel with the same set of primers to generate different fragments of double-stranded DNA.


Error correction may be performed on synthesized oligonucleotides and/or assembled products. An example strategy for error correction involves site-directed mutagenesis by overlap extension PCR to correct errors, which is optionally coupled with two or more rounds of cloning and sequencing. In certain instances, double-stranded nucleic acids with mismatches, bulges and small loops, chemically altered bases and/or other heteroduplexes are selectively removed from populations of correctly synthesized nucleic acids. In some instances, error correction is performed using proteins/enzymes that recognize and bind to or next to mismatched or unpaired bases within double-stranded nucleic acids to create a single or double-strand break or to initiate a strand transfer transposition event. Non-limiting examples of proteins/enzymes for error correction include endonucleases (T7 Endonuclease I, E. coli Endonuclease V, T4 Endonuclease VII, mung bean nuclease, Cell, E. coli Endonuclease IV, UVDE), restriction enzymes, glycosylases, ribonucleases, mismatch repair enzymes, resolvases, helicases, ligases, antibodies specific for mismatches, and their variants. Examples of specific error correction enzymes include T4 endonuclease 7, T7 endonuclease 1, S1, mung bean endonuclease, MutY, MutS, MutH, MutL, cleavase, CELI, and HINF1. In some cases, DNA mismatch-binding protein MutS (Thermus aquaticus) is used to remove failure products from a population of synthesized products. In some instances, error correction is performed using the enzyme Correctase. In some cases, error correction is performed using SURVEYOR endonuclease (Transgenomic), a mismatch-specific DNA endonuclease that scans for known and unknown mutations and polymorphisms for heteroduplex DNA.


Release, Extraction and Assembly


Provided herein are method and devices for replicable information storage. In some instances, multiple copies of the same coding region, the oligonucleotide, the same cluster, the same portion of a structure comprising oligonucleotides, or the entire structure comprising oligonucleotides are synthesized. Where multiple copies of the same oligonucleotide are synthesized, each of the oligonucleotides may be attached to distinct regions of the surface. The distinct regions may be separated by breaking or cutting. Alternatively, each of the oligonucleotides may be present at a feature in the form of a spot, well or channel and individually accessible. For example, contacting the feature with a cleavage reagent and then water would free one copy of the oligonucleotide while leaving the other copies intact. Similarly, cleavage of oligonucleotides in an entire region or over an entire plate allows for accessing a fraction of a replicate population. Replicate populations may exist in separated reels, plates, belts, and the like. In the case of a flexible material, such as a tape, a replicate region may be cut and the remaining regions of the tape may be spliced back together. Alternatively, nucleic acid information of the synthesized and stored oligonucleotides may be obtained by performing amplification of oligonucleotides attached to the surface of the structure using primers and a DNA polymerase.


In some instances, an aqueous or gaseous transfer media is deposited onto one or a plurality of channels in a structure to transfer the oligonucleotides from the structure to a receiving unit. For example, a transfer media may pass through a channel in the structure to adhere to, collect and transfer an oligonucleotide from a channel in the structure to a receiving unit. In some instances, a charge conducting feature and an applied voltage are employed to attract or repel a transfer media to or through a channel in the structure. In some instances, a slip is employed to direct a transfer media into a channel in the structure. In some cases a pressure release is employed to direct a transfer media into or through a channel in the structure. In some cases a nozzle is employed to form a localized area of high pressure which forces a transfer media into or through a channel in the structure. In some instances, a pin is employed to transfer an oligonucleotide from a channel in the structure to a container to a receiving unit. In such instances, the pin may comprise agents to facilitate transfer media adhesion. In some cases a charge conducting feature is employed to attract or repel a transfer media to or through a channel in a structure, by forming a voltage potential between the conducting feature and the structure. In some cases, a pipette tip, or other capillary flow inducing structure, is used to transfer the fluid and oligonucleotides via capillary flow. In some instances, a container comprises one or more compartments that each receives a portion of the transfer media, and the one or more oligonucleotides therein, emitted from a single respective channel. In some instances, the container comprises a single compartment that receives one or more portions of the transfer media, each containing one or more oligonucleotides therein, emitted from a one or more structure channels.


Sequencing


After extraction and/or amplification of oligonucleotides from the surface of the structure, suitable sequencing technology may be employed to sequence the oligonucleotides. In some cases, the DNA sequence is read on the substrate or within a feature of a structure. In some cases, the oligonucleotides stored on the substrate are extracted, optionally assembled into longer nucleic acids and then sequenced.


Oligonucleotides synthesized and stored on the structures described herein encode data that can be interpreted by reading the sequence of the synthesized oligonucleotides and converting the sequence into binary code readable by a computer. In some cases the sequences require assembly, and the assembly step may need to be at the nucleic acid sequence stage or at the digital sequence stage.


Provided herein are detection systems comprising a device capable of sequencing stored oligonucleotides, either directly on the structure and/or after removal from the main structure. In cases where the structure is a reel-to-reel tape of flexible material, the detection system comprises a device for holding and advancing the structure through a detection location and a detector disposed proximate the detection location for detecting a signal originated from a section of the tape when the section is at the detection location. In some instances, the signal is indicative of a presence of an oligonucleotide. In some instances, the signal is indicative of a sequence of an oligonucleotide (e.g., a fluorescent signal). In some instances, information encoded within oligonucleotides on a continuous tape is read by a computer as the tape is conveyed continuously through a detector operably connected to the computer. In some instances, a detection system comprises a computer system comprising an oligonucleotide sequencing device, a database for storage and retrieval of data relating to oligonucleotide sequence, software for converting DNA code of an oligonucleotide sequence to binary code, a computer for reading the binary code, or any combination thereof.


Computer Systems


In various aspects, any of the systems described herein are operably linked to a computer and are optionally automated through a computer either locally or remotely. In various instances, the methods and systems of the disclsoure further comprise software programs on computer systems and use thereof. Accordingly, computerized control for the synchronization of the dispense/vacuum/refill functions such as orchestrating and synchronizing the material deposition device movement, dispense action and vacuum actuation are within the bounds of the disclosure. In some instances, the computer systems are programmed to interface between the user specified base sequence and the position of a material deposition device to deliver the correct reagents to specified regions of the substrate.


The computer system 1700 illustrated in FIG. 17 may be understood as a logical apparatus that can read instructions from media 1711 and/or a network port 1705, which can optionally be connected to server 1709 having fixed media 1712. The system, such as shown in FIG. 17 can include a CPU 1701, disk drives 1703, optional input devices such as keyboard 1715 and/or mouse 1716 and optional monitor 1707. Data communication can be achieved through the indicated communication medium to a server at a local or a remote location. The communication medium can include any means of transmitting and/or receiving data. For example, the communication medium can be a network connection, a wireless connection or an internet connection. Such a connection can provide for communication over the World Wide Web. It is envisioned that data relating to the present disclosure can be transmitted over such networks or connections for reception and/or review by a party 1722.



FIG. 18 is a block diagram illustrating a first example architecture of a computer system 1800 that can be used in connection with example embodiments of the present disclosure. As depicted in FIG. 18, the example computer system can include a processor 1802 for processing instructions. Non-limiting examples of processors include: Intel Xeon™ processor, AMD Opteron™ processor, Samsung 32-bit RISC ARM 1176JZ(F)-S v1.0™ processor, ARM Cortex-A8 Samsung S5PC100™ processor, ARM Cortex-A8 Apple A4™ processor, Marvell PXA 930™ processor, or a functionally-equivalent processor. Multiple threads of execution can be used for parallel processing. In some instances, multiple processors or processors with multiple cores can also be used, whether in a single computer system, in a cluster, or distributed across systems over a network comprising a plurality of computers, cell phones, and/or personal data assistant devices.


As illustrated in FIG. 18, a high speed cache 1804 can be connected to, or incorporated in, the processor 1802 to provide a high speed memory for instructions or data that have been recently, or are frequently, used by processor 1802. The processor 1802 is connected to a north bridge 1806 by a processor bus 1808. The north bridge 1806 is connected to random access memory (RAM) 1810 by a memory bus 1812 and manages access to the RAM 1810 by the processor 1802. The north bridge 1806 is also connected to a south bridge 1814 by a chipset bus 1816. The south bridge 1814 is, in turn, connected to a peripheral bus 1818. The peripheral bus can be, for example, PCI, PCI-X, PCI Express, or other peripheral bus. The north bridge and south bridge are often referred to as a processor chipset and manage data transfer between the processor, RAM, and peripheral components on the peripheral bus 1818. In some alternative architectures, the functionality of the north bridge can be incorporated into the processor instead of using a separate north bridge chip.


In some instances, system 1800 can include an accelerator card 1822 attached to the peripheral bus 1818. The accelerator can include field programmable gate arrays (FPGAs) or other hardware for accelerating certain processing. For example, an accelerator can be used for adaptive data restructuring or to evaluate algebraic expressions used in extended set processing.


Software and data are stored in external storage 1824 and can be loaded into RAM 1810 and/or cache 1804 for use by the processor. The system 1800 includes an operating system for managing system resources; non-limiting examples of operating systems include: Linux, Windows™, MACOS™, iOS™, and other functionally-equivalent operating systems, as well as application software running on top of the operating system for managing data storage and optimization in accordance with example embodiments of the present disclosure.


In this example, system 1800 also includes network interface cards (NICs) 1820 and 1821 connected to the peripheral bus for providing network interfaces to external storage, such as Network Attached Storage (NAS) and other computer systems that can be used for distributed parallel processing.



FIG. 19 is a diagram showing a network 1900 with a plurality of computer systems 1902a, and 1902b, a plurality of cell phones and personal data assistants 1902c, and Network Attached Storage (NAS) 1904a, and 1904b. In example embodiments, systems 1902a, 1902b, and 1902c can manage data storage and optimize data access for data stored in Network Attached Storage (NAS) 1904a and 1904b. A mathematical model can be used for the data and be evaluated using distributed parallel processing across computer systems 1902a, and 1902b, and cell phone and personal data assistant systems 1902c. Computer systems 1902a, and 1902b, and cell phone and personal data assistant systems 1902c can also provide parallel processing for adaptive data restructuring of the data stored in Network Attached Storage (NAS) 1904a and 1904b. FIG. 19 illustrates an example only, and a wide variety of other computer architectures and systems can be used in conjunction with the various embodiments of the present disclosure. For example, a blade server can be used to provide parallel processing. Processor blades can be connected through a back plane to provide parallel processing. Storage can also be connected to the back plane or as Network Attached Storage (NAS) through a separate network interface.


In some example embodiments, processors can maintain separate memory spaces and transmit data through network interfaces, back plane or other connectors for parallel processing by other processors. In other instances, some or all of the processors can use a shared virtual address memory space.



FIG. 20 is a block diagram of a multiprocessor computer system 2000 using a shared virtual address memory space in accordance with an example embodiment. The system includes a plurality of processors 2002a-f that can access a shared memory subsystem 2004. The system incorporates a plurality of programmable hardware memory algorithm processors (MAPs) 2006a-f in the memory subsystem 2004. Each MAP 2006a-f can comprise a memory 2008a-f and one or more field programmable gate arrays (FPGAs) 2010a-f. The MAP provides a configurable functional unit and particular algorithms or portions of algorithms can be provided to the FPGAs 2010a-f for processing in close coordination with a respective processor. For example, the MAPs can be used to evaluate algebraic expressions regarding the data model and to perform adaptive data restructuring in example embodiments. In this example, each MAP is globally accessible by all of the processors for these purposes. In one configuration, each MAP can use Direct Memory Access (DMA) to access an associated memory 2008a-f, allowing it to execute tasks independently of, and asynchronously from, the respective microprocessor 2002a-f. In this configuration, a MAP can feed results directly to another MAP for pipelining and parallel execution of algorithms.


The above computer architectures and systems are examples only, and a wide variety of other computer, cell phone, and personal data assistant architectures and systems can be used in connection with example embodiments, including systems using any combination of general processors, co-processors, FPGAs and other programmable logic devices, system on chips (SOCs), application specific integrated circuits (ASICs), and other processing and logic elements. In some instances, all or part of the computer system can be implemented in software or hardware. Any variety of data storage media can be used in connection with example instances, including random access memory, hard drives, flash memory, tape drives, disk arrays, Network Attached Storage (NAS) and other local or distributed data storage devices and systems.


In example embodiments, the computer system can be implemented using software modules executing on any of the above or other computer architectures and systems. In other instances, the functions of the system can be implemented partially or completely in firmware, programmable logic devices such as field programmable gate arrays (FPGAs), system on chips (SOCs), application specific integrated circuits (ASICs), or other processing and logic elements. For example, the Set Processor and Optimizer can be implemented with hardware acceleration through the use of a hardware accelerator card, such as an accelerator card.


Provided herein are methods for storing information, comprising: converting an item of information in the form of at least one digital sequence to at least one nucleic acid sequence; providing a flexible structure having a surface; synthesizing a plurality of oligonucleotides having predetermined sequences collectively encoding for the at least one nucleic acid sequence, wherein the plurality of oligonucleotides comprises at least about 100,000 oligonucleotides, and wherein the plurality of oligonucleotides extends from the surface of the flexible structure; and storing the plurality of oligonucleotides. Further provided herein are methods wherein synthesizing comprises: depositing nucleosides on the surface at predetermined locations; and moving at least a portion of the flexible structure through a bath or emissions from a spray bar. Further provided herein are methods wherein the bath or emissions from a spray bar expose the surface of the structure to an oxidizing reagent or a deblocking reagent. Further provided herein are methods wherein synthesizing further comprises capping the nucleosides deposited on the surface. Further provided herein are methods wherein the nucleosides comprise a nucleoside phosphoramidite. Further provided herein are methods wherein the flexible structure comprises a reel-to-reel tape or a continuous tape. Further provided herein are methods wherein the flexible structure comprises a thermoplastic material. Further provided herein are methods wherein the thermoplastic material comprises a polyaryletherketone. Further provided herein are methods wherein the polyaryletherketone is polyetherketone, polyetherketoneketone, poly(ether ether ketone ketone), polyether ether ketone or polyetherketoneetherketoneketone. Further provided herein are methods wherein the flexible structure comprises nylon, nitrocellulose, polypropylene, polycarbonate, polyethylene, polyurethane, polystyrene, acetal, acrylic, acrylonitrile, butadiene styrene, polyethylene terephthalate, polymethyl methacrylate, polyvinyl chloride, transparent PVC foil, Poly(methyl methacrylate), styrenic polymer, fluorine-containing polymers, polyethersulfone or polyimide. Further provided herein are methods wherein each oligonucleotide of the plurality of oligonucleotides comprises from 50 to 500 bases in length. Further provided herein are methods wherein the plurality of oligonucleotides comprises at least about 10 billion oligonucleotides. Further provided herein are methods wherein at least about 1.75×1013 nucleobases are synthesized within 24 hours. Further provided herein are methods wherein at least about 262.5×109 oligonucleotides are synthesized within 72 hours. Further provided herein are methods wherein the item of information is text information, audio information or visual information. Further provided herein are methods wherein the nucleosides comprise nucleoside phosphoramidite.


Provided herein are methods for storing information, comprising: converting an item of information in the form of at least one digital sequence to at least one nucleic acid sequence; providing a structure having a surface; synthesizing a plurality of oligonucleotides having predetermined sequences collectively encoding for the at least one nucleic acid sequence, wherein the plurality of oligonucleotides comprises at least about 100,000 oligonucleotides, wherein the plurality of oligonucleotides extends from the surface of the structure, and wherein synthesizing comprises: cleaning a surface of the structure; depositing nucleosides on the surface at predetermined locations; oxidizing, deblocking, and optionally capping the nucleosides deposited on the surface; wherein the cleaning, oxidizing, deblocking, and capping comprises moving at least a portion of the flexible structure through a bath or emissions from a spray bar; and storing the plurality of oligonucleotides. Further provided herein are methods wherein the nucleosides comprise nucleoside phosphoramidite.


The following examples are set forth to illustrate more clearly the principle and practice of embodiments disclosed herein to those skilled in the art and are not to be construed as limiting the scope of any claimed embodiments. Unless otherwise stated, all parts and percentages are on a weight basis.


EXAMPLES
Example 1
Functionalization of a Device Surface

A device was functionalized to support the attachment and synthesis of a library of oligonucleotides. The device surface was first wet cleaned using a piranha solution comprising 90% H2SO4 and 10% H2O2 for 20 minutes. The device was rinsed in several beakers with DI water, held under a DI water gooseneck faucet for 5 min, and dried with N2. The device was subsequently soaked in NH4OH (1:100; 3 mL:300 mL) for 5 min, rinsed with DI water using a handgun, soaked in three successive beakers with DI water for 1 min each, and then rinsed again with DI water using the handgun. The device was then plasma cleaned by exposing the device surface to O2. A SAMCO PC-300 instrument was used to plasma etch O2 at 250 watts for 1 min in downstream mode.


The cleaned device surface was actively functionalized with a solution comprising N-(3-triethoxysilylpropyl)-4-hydroxybutyramide using a YES-1224P vapor deposition oven system with the following parameters: 0.5 to 1 torr, 60 min, 70° C., 135° C. vaporizer. The device surface was resist coated using a Brewer Science 200× spin coater. SPR™ 3612 photoresist was spin coated on the device at 2500 rpm for 40 sec. The device was pre-baked for 30 min at 90° C. on a Brewer hot plate. The device was subjected to photolithography using a Karl Suss MA6 mask aligner instrument. The device was exposed for 2.2 sec and developed for 1 min in MSF 26A. Remaining developer was rinsed with the handgun and the device soaked in water for 5 min. The device was baked for 30 min at 100° C. in the oven, followed by visual inspection for lithography defects using a Nikon L200. A descum process was used to remove residual resist using the SAMCO PC-300 instrument to O2 plasma etch at 250 watts for 1 min.


The device surface was passively functionalized with a 100 μL solution of perfluorooctyltrichlorosilane mixed with 10 μL light mineral oil. The device was placed in a chamber, pumped for 10 min, and then the valve was closed to the pump and left to stand for 10 min. The chamber was vented to air. The device was resist stripped by performing two soaks for 5 min in 500 mL NMP at 70° C. with ultrasonication at maximum power (9 on Crest system). The device was then soaked for 5 min in 500 mL isopropanol at room temperature with ultrasonication at maximum power. The device was dipped in 300 mL of 200 proof ethanol and blown dry with N2. The functionalized surface was activated to serve as a support for oligonucleotide synthesis.


Example 2
Synthesis of a 50-mer Sequence on an Oligonucleotide Synthesis Device

A two dimensional oligonucleotide synthesis device was assembled into a flowcell, which was connected to a flowcell (Applied Biosystems (ABI394 DNA Synthesizer”). The two-dimensional oligonucleotide synthesis device was uniformly functionalized with N-(3-TRIETHOXYSILYLPROPYL)-4-HYDROXYBUTYRAMIDE (Gelest) and used to synthesize an exemplary oligonucleotide of 50 bp (“50-mer oligonucleotide”) using oligonucleotide synthesis methods described herein.


The sequence of the 50-mer was as described in SEQ ID NO.: 1. 5′AGACAATCAACCATTTGGGGTGGACAGCCTTGACCTCTAGACTTCGGCAT##TTTTT TTTTT3′ (SEQ ID NO.: 1), where # denotes Thymidine-succinyl hexamide CED phosphoramidite (CLP-2244 from ChemGenes), which is a cleavable linker enabling the release of oligonucleotides from the surface during deprotection.


The synthesis was done using standard DNA synthesis chemistry (coupling, capping, oxidation, and deblocking) according to the protocol in Table 5 and an ABI synthesizer.









TABLE 5







Synthesis Protocol








General DNA Synthesis
Table 5









Process Name
Process Step
Time (sec)












WASH (Acetonitrile Wash
Acetonitrile System Flush
4


Flow)
Acetonitrile to Flowcell
23



N2 System Flush
4



Acetonitrile System Flush
4


DNA BASE ADDITION
Activator Manifold Flush
2


(Phosphoramidite +
Activator to Flowcell
6


Activator Flow)
Activator +
6



Phosphoramidite to



Flowcell



Activator to Flowcell
0.5



Activator +
5



Phosphoramidite to



Flowcell



Activator to Flowcell
0.5



Activator +
5



Phosphoramidite to



Flowcell



Activator to Flowcell
0.5



Activator +
5



Phosphoramidite to



Flowcell



Incubate for 25 sec
25


WASH (Acetonitrile Wash
Acetonitrile System Flush
4


Flow)
Acetonitrile to Flowcell
15



N2 System Flush
4



Acetonitrile System Flush
4


DNA BASE ADDITION
Activator Manifold Flush
2


(Phosphoramidite +
Activator to Flowcell
5


Activator Flow)
Activator +
18



Phosphoramidite to



Flowcell



Incubate for 25 sec
25


WASH (Acetonitrile Wash
Acetonitrile System Flush
4


Flow)
Acetonitrile to Flowcell
15



N2 System Flush
4



Acetonitrile System Flush
4


CAPPING (CapA + B, 1:1,
CapA + B to Flowcell
15


Flow)


WASH (Acetonitrile Wash
Acetonitrile System Flush
4


Flow)
Acetonitrile to Flowcell
15



Acetonitrile System Flush
4


OXIDATION (Oxidizer
Oxidizer to Flowcell
18


Flow)


WASH (Acetonitrile Wash
Acetonitrile System Flush
4


Flow)
N2 System Flush
4



Acetonitrile System Flush
4



Acetonitrile to Flowcell
15



Acetonitrile System Flush
4



Acetonitrile to Flowcell
15



N2 System Flush
4



Acetonitrile System Flush
4



Acetonitrile to Flowcell
23



N2 System Flush
4



Acetonitrile System Flush
4


DEBLOCKING (Deblock
Deblock to Flowcell
36


Flow)


WASH (Acetonitrile Wash
Acetonitrile System Flush
4


Flow)
N2 System Flush
4



Acetonitrile System Flush
4



Acetonitrile to Flowcell
18



N2 System Flush
4.13



Acetonitrile System Flush
4.13



Acetonitrile to Flowcell
15









The phosphoramidite/activator combination was delivered similar to the delivery of bulk reagents through the flowcell. No drying steps were performed as the environment stays “wet” with reagent the entire time.


The flow restrictor was removed from the ABI 394 synthesizer to enable faster flow. Without flow restrictor, flow rates for amidites (0.1M in ACN), Activator, (0.25M Benzoylthiotetrazole (“BTT”; 30-3070-xx from GlenResearch) in ACN), and Ox (0.02M I2 in 20% pyridine, 10% water, and 70% THF) were roughly ˜100 uL/sec, for acetonitrile (“ACN”) and capping reagents (1:1 mix of CapA and CapB, wherein CapA is acetic anhydride in THF/Pyridine and CapB is 16% 1-methylimidizole in THF), roughly ˜200 uL/sec, and for Deblock (3% dichloroacetic acid in toluene), roughly ˜300 uL/sec (compared to ˜50 uL/sec for all reagents with flow restrictor). The time to completely push out Oxidizer was observed, the timing for chemical flow times was adjusted accordingly and an extra ACN wash was introduced between different chemicals. After oligonucleotide synthesis, the chip was deprotected in gaseous ammonia overnight at 75 psi. Five drops of water were applied to the surface to assemble oligonucleotides. The assembled oligonucleotides were then analyzed on a BioAnalyzer small RNA chip (data not shown).


Example 3
Synthesis of a 100-mer Sequence on an Oligonucleotide Synthesis Device

The same process as described in Example 2 for the synthesis of the 50-mer sequence was used for the synthesis of a 100-mer oligonucleotide (“100-mer oligonucleotide”; 5′ CGGGATCCTTATCGTCATCGTCGTACAGATCCCGACCCATTTGCTGTCCACCAGTCAT GCTAGCCATACCATGATGATGATGATGATGAGAACCCCGCAT##TTTTTTTTTT3′, where # denotes Thymidine-succinyl hexamide CED phosphoramidite (CLP-2244 from ChemGenes); SEQ ID NO.: 2) on two different silicon chips, the first one uniformly functionalized with N-(3-TRIETHOXYSILYLPROPYL)-4-HYDROXYBUTYRAMIDE and the second one functionalized with 5/95 mix of 11-acetoxyundecyltriethoxysilane and n-decyltriethoxysilane, and the oligonucleotides extracted from the surface were analyzed on a BioAnalyzer instrument (data not shown).


All ten samples from the two chips were further PCR amplified using a forward (5′ATGCGGGGTTCTCATCATC3′; SEQ ID NO.: 3) and a reverse (5′CGGGATCCTTATCGTCATCG3′; SEQ ID NO.: 4) primer in a 50 uL PCR mix (25 uL NEB Q5 mastermix, 2.5 uL 10 uM Forward primer, 2.5 uL 10 uM Reverse primer, 1 uL oligonucleotide extracted from the surface, and water up to 50 uL) using the following thermalcycling program:


98° C., 30 sec


98° C., 10 sec; 63° C., 10 sec; 72° C., 10 sec; repeat 12 cycles 72° C., 2 min


The PCR products were also run on a BioAnalyzer (data not shown), demonstrating sharp peaks at the 100-mer position. Next, the PCR amplified samples were cloned, and Sanger sequenced. Table 6 summarizes the results from the Sanger sequencing for samples taken from spots 1-5 from chip 1 and for samples taken from spots 6-10 from chip 2.









TABLE 6







Sequencing Results









Spot
Error rate
Cycle efficiency













1
1/763
bp
99.87%


2
1/824
bp
99.88%


3
1/780
bp
99.87%


4
1/429
bp
99.77%


5
1/1525
bp
99.93%


6
1/1615
bp
99.94%


7
1/531
bp
99.81%


8
1/1769
bp
99.94%


9
1/854
bp
99.88%


10
1/1451
bp
99.93%









Thus, the high quality and uniformity of the synthesized oligonucleotides were repeated on two chips with different surface chemistries. Overall, 89%, corresponding to 233 out of 262 of the 100-mers that were sequenced were perfect sequences with no errors.


Table 7 summarizes error characteristics for the sequences obtained from the oligonucleotides samples from spots 1-10.









TABLE 7





Error Characteristics

















Sample ID/Spot no.













OSA_0046/







1
OSA_0047/2
OSA_0048/3
OSA_0049/4
OSA_0050/5





Total
32
32
32
32
32


Sequences


Sequencing
25 of
27 of
26 of
21 of
25 of


Quality
28
27
30
23
26


Oligo
23 of
25 of
22 of
18 of
24 of


Quality
25
27
26
21
25


ROI Match
2500
2698
2561
2122
2499


Count


ROI
2
2
1
3
1


Mutation


ROI Multi
0
0
0
0
0


Base


Deletion


ROI Small
1
0
0
0
0


Insertion


ROI Single
0
0
0
0
0


Base


Deletion


Large
0
0
1
0
0


Deletion


Count


Mutation:
2
2
1
2
1


G > A


Mutation:
0
0
0
1
0


T > C


ROI Error
3
2
2
3
1


Count


ROI Error
Err:
Err: ~1
Err: ~1
Err: ~1
Err: ~1


Rate
~1 in
in 1350
in 1282
in 708
in 2500



834


ROI Minus
MP
MP
MP
MP
MP


Primer
Err:
Err: ~1
Err: ~1
Err: ~1
Err: ~1


Error Rate
~1 in
in 824
in 780
in 429
in 1525



763












Sample ID/Spot no.

















OSA_0055/



OSA_0051/6
OSA_0052/7
OSA_0053/8
OSA_0054/9
10





Total
32
32
32
32
32


Sequences


Sequencing
29 of
27 of
29 of
28 of
25 of 28


Quality
30
31
31
29


Oligo
25 of
22 of
28 of
26 of
20 of 25


Quality
29
27
29
28


ROI Match
2666
2625
2899
2798
2348


Count


ROI
0
2
1
2
1


Mutation


ROI Multi
0
0
0
0
0


Base


Deletion


ROI Small
0
0
0
0
0


Insertion


ROI Single
0
0
0
0
0


Base


Deletion


Large
1
1
0
0
0


Deletion


Count


Mutation:
0
2
1
2
1


G > A


Mutation:
0
0
0
0
0


T > C


ROI Error
1
3
1
2
1


Count


ROI Error
Err: ~1
Err: ~1
Err: ~1
Err: ~1
Err: ~1


Rate
in 2667
in 876
in 2900
in 1400
in 2349


ROI Minus
MP
MP
MP
MP
MP Err:


Primer
Err: ~1
Err: ~1
Err: ~1
Err: ~1
~1 in


Error Rate
in 1615
in 531
in 1769
in 854
1451









Example 4
Highly Accurate DNA-based Information Storage and Assembly

Digital information was selected in the form of binary data totaling about 0.2 GB included content for the Universal Declaration of Human Rights in more than 100 languages, the top 100 books of Project Guttenberg and a seed database. The digital information was encrypted into a nucleic acid-based sequence and divided into strings. Over 10 million non-identical oligonucleotides, each corresponding to a string, were synthesized on a rigid silicon surface in a manner similar to that described in Example 2. Each non-identical oligonucleotide was under equal or less than 200 bases in length. The synthesized oligonucleotides were collected and sequenced and decoded back to digital code, with 100% accuracy for the source digital information, compared to the initial at least one digital sequence.


Example 5
Conversion of Digital Information to Nucleic Acid Sequence

A computer txt file includes text information. A general purpose computer uses a software program having machine instructions for conversion of the sequence to base 3, 4, or 5 sequence, depending on instructions received. Each number in base 3 is assigned a nucleic acid (e.g., A=0, T=1, C=2). Each number in base 4 is assigned a nucleic acid (e.g., A=0, T=1, C=2, G=3). Alternatively, a base 5 quinary sequence is used, where each number in base 5 is assigned a nucleic acid (e.g., A=0, T=1, C=2, G=3, U=4). A sequence is generated as depicted in Table 8. Machine instructions are then provided for de novo synthesis of oligonucleotides encoding the nucleic acid sequence.









TABLE 8







Sequence Conversion








Text
Jack went up the hill.





Binary
010010100110000101100011011010110010000001110111011001010110111


sequence
001110100001000000111010101110000001000000111010001101000011001



010010000001101000011010010110110001101100001011100000110100001



0100000110100001010


Ternary
101010201100022101010021102012221200101112202210002122002210200


sequence
011112212102011201021112122200101110001002001022002222221100222



22112


Quaternary
102212011203122302001313121112321310020013111300020013101220121


sequence
10200122012211230123002320031002200310022


Quinary
332214330133012303013123001030244433343300431224103020320210201


sequence
12342341100431241100334213









Example 6
Flexible Surface Having a High Density of Features

A flexible structure comprising thermoplastic material is coated with a nucleoside coupling reagent. The coating agent is patterned for a high density of features. A portion of the flexible surface is illustrated in FIG. 14A. Each feature has a diameter of 10 um, with a center-to-center distance between two adjacent features of 21 um. The feature size is sufficient to accommodate a sessile drop volume of 0.2 pl during an oligonucleotide synthesis deposition step. The small feature dimensions allow for a high density of oligonucleotides to be synthesized on the surface of the substrate. The feature density is 2.2 billion features /m2 (1 feature/441×10−12 m2). A 4.5 m2 substrate is manufactured having 10 billion features, each with a 10 um diameter. The flexible structure is optionally placed in a continuous loop system, FIG. 12A, or a reel-to-reel system, FIG. 12B, for oligonucleotide synthesis.


Example 7
Oligonucleotide Synthesis on a Flexible Structure

A flexible structure is prepared comprising a plurality of features on a thermoplastic flexible material. The structure serves as a support for the synthesis of oligonucleotides using an oligonucleotide synthesis device comprising a deposition device. The flexible structure is in the form of a flexible media much like a magnetic reel-to-reel tape.


De novo synthesis operates in a continuous production line manner with the structure travelling through a solvent bath and then beneath a stack of printheads where the phosphoramidites are printed on to a surface of the structure. The flexible structure with the sessile drops deposited on to the surface is rolled into a bath of oxidizing agent, then the tape emerges from the oxidizing bath and is immersed in an acetonitrile wash bath then submerged in a deblock bath. Optionally, the tape is traversed through a capping bath. In an alternative workflow, the flexible structure emerges from the oxidizing bath and is sprayed with acetonitrile in a wash step.


Alternatively, a spray bar is used instead of a liquid bath. In this process, the nucleotides are still deposited on the surface with an inkjet device but the flood steps are now done in a chamber with spray nozzles. For example, the deposition device has 2,048 nozzles that each deposits 100,000 droplets per second at 1 nucleobase per droplet. There is a sequential ordering of spray nozzles to mimic the ordering of the flood steps in standard phosphoramidite chemistry. This technique provides for easily changing the chemicals loaded in the spray bar to accommodate different process steps. Oligonucleotides are deprotected or cleaved in the same manner as described in Example 2.


For each deposition device, more than 1.75×1013 nucleobases are deposited on the structure per day. A plurality of 200 nucleobase oligonucleotides is synthesized. In 3 days, at a rate of 1.75×1013 bases per day, 262.5×109 oligonucleotides are synthesized.


Example 8
Selection Bioencryption

Machine instructions are received for desired items of information for conversion and for one or more categories of bioencryption selected from enzymatic based (e.g., CRISPR/Cas complex and restriction enzyme digest), electromagnetic radiation based (e.g., photolysis and photodetection), chemical cleavage (e.g, gaseous ammonia or methylamine treatment to cleave Thymidine-succinyl hexamide CED phosphoramidite (CLP-2244 from ChemGenes)), and affinity based (e.g., a sequence tag for hybridization, or incorporation of modified nucleotides with enhanced affinity to a capture reagent) forms of bioencryption. Following receipt of a particular bioencryption selection, a program module performs the step of converting the items of information to nucleic acid sequences and applying design instructions for design of a bioencrypted version of the sequence. A specific encryption subtype within the bioencryption category is selected. Synthesis instructions are then provided to a material deposition device for de novo synthesis of oligonucleotides.


Example 9
Selected Biodecryrption

Machine instructions are provided for application of one or more categories of biodecryption selected from enzymatic based (e.g., CRISPR/Cas complex or restriction enzyme digest), electromagnetic radiation based (e.g., photolysis or photodetection), chemical cleavage based (e.g, gaseous ammonia or methylamine treatment to cleave Thymidine-succinyl hexamide CED phosphoramidite (CLP-2244 from ChemGenes)), and affinity based (e.g., a sequence tag for hybridization, or incorporation of modified nucleotides with enhanced affinity to a capture reagent) biodecryption. Following receipt of a particular biodecryption selection, a program module performs the step of releasing the modulatory agent(s) for enrichment of the oligonucleotides. Following enrichment, the oligonucleotides are sequenced, optionally aligned to a longer nucleic acid sequence, and converted to a digital sequence corresponding to an item of information.


Example 10
Biological Encryption and Decryption of a DNA Ssequence with CRISPR/Cas9

A digital sequence encoding for an item of information is received. The digital sequence is then converted to a nucleic acid sequence. The nucleic acid sequence is encrypted in a larger population of nucleic acid sequences. The encryption process involves adding “junk” regions for detection and removal by a CRISPR/Cas9 complex. Nucleic acid sequences are synthesized as in Examples 2-3.


The population of nucleic acid sequences comprising the encrypted nucleic acid sequences are mixed with Cas9 and gRNAs in Cas9 buffer and incubated at 37° C. for 2 hours. Cas9 is then inactivated and removed by purification. The purified sample is then analyzed by next generation sequencing.


Example 11
Biological Encryption and Decryption of a DNA Sequence with CRISPR/Cas9 Comprising Sequence Swapping

A digital sequence encoding for an item of information is received, the digital sequence is converted to nucleic acid sequences. The nucleic acid sequences are encrypted by addition of a specific sequence using CRISPR/Cas9 system and guide RNA sequence. Nucleic acid sequences are synthesized as in Examples 2-3.


The nucleic acid sequences are then mixed with fluorescent-tagged probes that are complementary to the swapped sequences. Nucleic acid sequences identified by the fluorescent-tagged probes are removed from the population.


Example 12
Biological Encryption and Decryption of a DNA Sequence Using Restriction Enzyme Digest

A digital sequence encoding for an item of information is received, and the digital sequence is converted to nucleic acid sequences. A population of nucleic acid sequences is encrypted by addition of a specific sequence that is recognized by the restriction enzyme EcoRI. Nucleic acid sequences are synthesized, as in Examples 2-3, and stored.


The nucleic acid sequences are incubated with EcoRI. Encrypted nucleic acid sequences comprising the EcoRI recognition site are cleaved. Following cleavage of the encrypted nucleic acid sequences, sequences with complementary overhangs are hybridized and ligated to the released DNA. The ligated complex is then isolated and the purified sample is sequenced and the original digital information is assembled.


Example 13
Biological Encryption and Decryption of a DNA Sequence Using Photolysis

A digital sequence encoding for an item of information is received, and the digital sequence is converted to nucleic acid sequences. A population of nucleic acid sequences is designed to include nucleobases that are photocleavable. Nucleic acid sequences are synthesized as in Examples 2-3, and stored.


UV-B irradiation of 280 nm is applied to the nucleic acid sequences. Encrypted nucleic acid sequences comprising the photocleavable site are cleaved and removed. The nucleic acid sequences are then collected sequenced. Alternatively, nucleic acid sequences are released from the surface of a structure, such as by ammonia gas cleavage, and then exposed to electromagnetic radiation to provide for breaks in the nucleotide sequences. Portions of the population are enriched, such as by pull down assay using beads having complementary capture probes bound thereto, PCR using primers selected to only amplify target sequence, or size exclusion chromatography. Enriched nucleic acids are then sequenced, converted to digital sequence, and an item of information is received.


Example 14
Biological Encryption and Decryption of a DNA Sequence Using Chemical Enrichment

A digital sequence encoding for an item of information is received, and the digital sequence is converted to nucleic acid sequences. A population of nucleic acid sequences is encrypted by addition of a specific sequence (e.g., Thymidine-succinyl hexamide CED phosphoramidite (CLP-2244 from ChemGenes)) that is chemically cleavable by ammonia gas. Nucleic acid sequences are synthesized as in Examples 2-3.


Ammonia gas is applied to the nucleic acid sequences. Encrypted nucleic acid sequences comprising the chemically cleavable sequence are released and enriched from the population using enrichment methods described herein. Enriched nucleic acids are then sequenced, converted to digital sequence, and an item of information is received.


Example 15
Biological Encryption and Decryption of a DNA Sequence Using Nucleic Acid Probes Comprising Biotin

A digital sequence encoding for an item of information is received, and the digital sequence is converted to nucleic acid sequences. A population of nucleic acid sequences is encrypted by design of predetermined residues to comprise biotin containing nucleobases. Nucleic acid sequences are synthesized as in Examples 2-3.


The nucleic acid sequences are cleaved from a structure, and mixed with streptavidin containing beads. The nucleic acid sequences are then incubated with streptavidin magnetic beads. Nucleic acid sequences comprising biotin are pulled down by the magnetic beads. Enriched nucleic acids are then sequenced, converted to digital sequence, and an item of information is received.


Example 16
Biological Encryption and Decryption of a DNA Sequence Using Photodetection

A digital sequence encoding for an item of information is received, and the digital sequence is converted to nucleic acid sequences. A population of nucleic acid sequences is encrypted by design to include specific sequence that is recognized by Alexa488-tagged nucleic acid probes. Nucleic acid sequences are synthesized as in Examples 2-3.


The nucleic acid sequences are released from a structure and mixed with Alexa488-tagged nucleic acid probes. The nucleic acid sequences are then sorted by fluorescence intensity. Nucleic acid sequences that are tagged with Alexa488-tagged nucleic acid probes are further analyzed. Probe bound nucleic acids are then sequenced, converted to digital sequence, and an item of information is received.


Example 17
Biological Encryption and Decryption of a DNA Sequence Using Modified Nucleotides

A digital sequence encoding for an item of information is received, the digital sequence is converted to nucleic acid sequences. A population of nucleic acid sequences is encrypted by designing for the addition of predetermined nucleobases comprising peptide nucleic acid (PNA) at predetermined locations and for the design of restriction enzyme recognitions sizes to excise PNA containing sections. Nucleic acid sequences are synthesized as in Examples 2-3.


The nucleic acid sequences are released, subject to restriction enzyme digestion, and then amplified by PCR. Nucleic acid sequences comprising PNAs are unable to be amplified. Enriched, amplified nucleic acids are then sequenced, converted to digital sequence, and the item of information is received.


Example 18
Biological Encryption and Decryption of a DNA Sequence Using CRISPR/Cas9 and Chemical Cleavage

A digital sequence encoding for an item of information is received, the digital sequence is converted to nucleic acid sequences. A population of nucleic acid sequences is encrypted by addition of a specific sequence using CRISPR/Cas9 and guide RNA sequence. The CRISPR/Cas9 system introduces a chemically cleavable site in the nucleic acid sequences at preselected locations. Nucleic acid sequences are synthesized as in Examples 2-3.


Ammonia gas is applied to the nucleic acid sequences. Encrypted nucleic acid sequences comprising the chemically cleavable site are cleaved and removed by size exclusion purification and analyzed by next generation sequencing.


While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.

Claims
  • 1. A method for storing information, the method comprising: a) receiving, by a computing system, at least one item of information in a form of at least one digital sequence;b) receiving, by the computing system, instructions for enzymatic bioencryption;c) converting, by the computing system, the at least one digital sequence to digital sequences of a plurality of oligonucleotides based on the instructions, wherein the digital sequences of the plurality of oligonucleotides are configured for decryption by exposure of the plurality of oligonucleotides to a nuclease complex;d) synthesizing the plurality of oligonucleotides in a synthesizer; ande) storing the plurality of oligonucleotides.
  • 2. The method of claim 1, wherein the enzymatic bioencryption comprises CRISPR/Cas-based bioencryption.
  • 3. The method of claim 1, wherein the nuclease complex comprises an enzyme as set out in Table 1:
  • 4. The method of claim 1, wherein the plurality of oligonucleotides comprises at least 100,000 oligonucleotides.
  • 5. The method of claim 1, wherein the plurality of oligonucleotides comprises at least 10 billion oligonucleotides.
  • 6. A platform for storing information, the platform comprising: a) a computing system comprising at least one processor and instructions executable by the at least one processor to perform operations comprising: i) receiving at least one item of information in a form of at least one digital sequence;ii) receiving instructions for enzymatic bioencryption; andiii) converting the at least one digital sequence to digital sequences of a plurality of oligonucleotides based on the instructions, wherein the digital sequences of the plurality of oligonucleotides are configured for decryption by exposure of the plurality of oligonucleotides to a nuclease complex; andb) a material deposition system for deposition and storage of oligonucleotides comprising: i) a synthesizer for receiving instructions from the computing system for synthesizing the plurality of oligonucleotides,wherein the synthesizer comprises a substrate for storing the plurality of oligonucleotides.
  • 7. The method of claim 1, wherein the decryption comprises contacting the plurality of oligonucleotides with Cas nuclease (CRISPR-associated nuclease), a Zinc Finger Nuclease (ZFN), a Transcription Activator-Like Effector Nuclease, an Argonaute nuclease, Si Nuclease, a mung bean nuclease, or a DNAse.
  • 8. The method of claim 1, wherein the method further comprises sequencing the plurality of oligonucleotides.
  • 9. The method of claim 1, wherein the plurality of oligonucleotides is stored ex-vivo.
  • 10. The method of claim 1, wherein synthesizing the plurality of oligonucleotides comprises phosphoramidite chemical synthesis.
  • 11. The method of claim 1, wherein the at least one digital sequence comprises at least 1 MB.
  • 12. The platform of claim 6, wherein the decryption comprises contacting the plurality of oligonucleotides with Cas nuclease (CRISPR associated), a Zinc Finger Nuclease (ZFN), a Transcription Activator-Like Effector Nuclease, an Argonaute nuclease, Si Nuclease, a mung bean nuclease, or a DNAse.
  • 13. The platform of claim 6, wherein the computing system comprises a distributed computing system.
CROSS-REFERENCE

This application claims the benefit of U.S. Provisional Application No. 62/462,284 filed on Feb. 22, 2017, which is incorporated herein by reference in its entirety.

US Referenced Citations (1050)
Number Name Date Kind
3549368 Robert et al. Dec 1970 A
3920714 Streck Nov 1975 A
4123661 Wolf et al. Oct 1978 A
4415732 Caruthers et al. Nov 1983 A
4613398 Chiong et al. Sep 1986 A
4726877 Fryd et al. Feb 1988 A
4808511 Holmes Feb 1989 A
4837401 Hirose et al. Jun 1989 A
4863557 Kokaku et al. Sep 1989 A
4981797 Jessee et al. Jan 1991 A
4988617 Landegren et al. Jan 1991 A
5102797 Tucker et al. Apr 1992 A
5118605 Urdea Jun 1992 A
5137814 Rashtchian et al. Aug 1992 A
5143854 Pirrung et al. Sep 1992 A
5242794 Whiteley et al. Sep 1993 A
5242974 Holmes Sep 1993 A
5288514 Ellman Feb 1994 A
5299491 Kawada Apr 1994 A
5368823 McGraw et al. Nov 1994 A
5384261 Winkler et al. Jan 1995 A
5387541 Hodge et al. Feb 1995 A
5395753 Prakash Mar 1995 A
5431720 Nagai et al. Jul 1995 A
5445934 Fodor et al. Aug 1995 A
5449754 Nishioka Sep 1995 A
5459039 Modrich et al. Oct 1995 A
5474796 Brennan Dec 1995 A
5476930 Letsinger et al. Dec 1995 A
5487993 Herrnstadt et al. Jan 1996 A
5494810 Barany et al. Feb 1996 A
5501893 Laermer et al. Mar 1996 A
5508169 Deugau et al. Apr 1996 A
5510270 Fodor et al. Apr 1996 A
5514789 Kempe May 1996 A
5527681 Holmes Jun 1996 A
5530516 Sheets Jun 1996 A
5534507 Cama et al. Jul 1996 A
5556750 Modrich et al. Sep 1996 A
5586211 Dumitrou et al. Dec 1996 A
5641658 Adams et al. Jun 1997 A
5677195 Winkler et al. Oct 1997 A
5679522 Modrich et al. Oct 1997 A
5683879 Laney et al. Nov 1997 A
5688642 Chrisey et al. Nov 1997 A
5700637 Southern Dec 1997 A
5700642 Monforte et al. Dec 1997 A
5702894 Modrich et al. Dec 1997 A
5707806 Shuber Jan 1998 A
5712124 Walker Jan 1998 A
5712126 Weissman et al. Jan 1998 A
5739386 Holmes Apr 1998 A
5750672 Kempe May 1998 A
5780613 Letsinger et al. Jul 1998 A
5830643 Yamamoto et al. Nov 1998 A
5830655 Monforte et al. Nov 1998 A
5830662 Soares et al. Nov 1998 A
5834252 Stemmer et al. Nov 1998 A
5843669 Kaiser et al. Dec 1998 A
5843767 Beattie Dec 1998 A
5846717 Brow et al. Dec 1998 A
5854033 Lizardi Dec 1998 A
5858754 Modrich et al. Jan 1999 A
5861482 Modrich et al. Jan 1999 A
5863801 Southgate et al. Jan 1999 A
5869245 Yeung Feb 1999 A
5877280 Wetmur Mar 1999 A
5882496 Northrup et al. Mar 1999 A
5922539 Modrich et al. Jul 1999 A
5922593 Livingston Jul 1999 A
5928907 Woudenberg et al. Jul 1999 A
5962272 Chenchik et al. Oct 1999 A
5976842 Wurst Nov 1999 A
5976846 Passmore et al. Nov 1999 A
5989872 Luo et al. Nov 1999 A
5994069 Hall et al. Nov 1999 A
6001567 Brow et al. Dec 1999 A
6008031 Modrich et al. Dec 1999 A
6013440 Lipshutz et al. Jan 2000 A
6015674 Woudenberg et al. Jan 2000 A
6017434 Simpson et al. Jan 2000 A
6020481 Benson et al. Feb 2000 A
6027898 Gjerde et al. Feb 2000 A
6028189 Blanchard Feb 2000 A
6028198 Liu et al. Feb 2000 A
6040138 Lockhart et al. Mar 2000 A
6077674 Schleifer et al. Jun 2000 A
6087482 Teng et al. Jul 2000 A
6090543 Prudent et al. Jul 2000 A
6090606 Kaiser et al. Jul 2000 A
6103474 Dellinger et al. Aug 2000 A
6107038 Choudhary et al. Aug 2000 A
6110682 Dellinger et al. Aug 2000 A
6114115 Wagner, Jr. Sep 2000 A
6130045 Wurst et al. Oct 2000 A
6132997 Shannon Oct 2000 A
6136568 Hiatt et al. Oct 2000 A
6171797 Perbost Jan 2001 B1
6180351 Cattell Jan 2001 B1
6201112 Ach Mar 2001 B1
6218118 Sampson et al. Apr 2001 B1
6221653 Caren et al. Apr 2001 B1
6222030 Dellinger et al. Apr 2001 B1
6232072 Fisher May 2001 B1
6235483 Wolber et al. May 2001 B1
6242266 Schleifer et al. Jun 2001 B1
6251588 Shannon et al. Jun 2001 B1
6251595 Gordon et al. Jun 2001 B1
6251685 Dorsel et al. Jun 2001 B1
6258454 Lefkowitz et al. Jul 2001 B1
6262490 Hsu et al. Jul 2001 B1
6274725 Sanghvi et al. Aug 2001 B1
6284465 Wolber Sep 2001 B1
6287776 Hefti Sep 2001 B1
6287824 Lizardi Sep 2001 B1
6297017 Schmidt et al. Oct 2001 B1
6300137 Earhart et al. Oct 2001 B1
6306599 Perbost Oct 2001 B1
6309822 Fodor et al. Oct 2001 B1
6309828 Schleifer et al. Oct 2001 B1
6312911 Bancroft et al. Nov 2001 B1
6319674 Fulcrand et al. Nov 2001 B1
6323043 Caren et al. Nov 2001 B1
6329210 Schleifer Dec 2001 B1
6346423 Schembri Feb 2002 B1
6365355 McCutchen-Maloney Apr 2002 B1
6372483 Schleifer et al. Apr 2002 B2
6375903 Cerrina et al. Apr 2002 B1
6376285 Joyner et al. Apr 2002 B1
6384210 Blanchard May 2002 B1
6387636 Perbost et al. May 2002 B1
6399394 Dahm et al. Jun 2002 B1
6399516 Ayon Jun 2002 B1
6403314 Lange et al. Jun 2002 B1
6406849 Dorsel et al. Jun 2002 B1
6406851 Bass Jun 2002 B1
6408308 Maslyn et al. Jun 2002 B1
6419883 Blanchard Jul 2002 B1
6428957 Delenstarr Aug 2002 B1
6440669 Bass et al. Aug 2002 B1
6444268 Lefkowitz et al. Sep 2002 B2
6446642 Caren et al. Sep 2002 B1
6446682 Viken Sep 2002 B1
6451998 Perbost Sep 2002 B1
6458526 Schembri et al. Oct 2002 B1
6458535 Hall et al. Oct 2002 B1
6458583 Bruhn et al. Oct 2002 B1
6461812 Barth et al. Oct 2002 B2
6461816 Wolber et al. Oct 2002 B1
6469156 Schafer et al. Oct 2002 B1
6472147 Janda et al. Oct 2002 B1
6492107 Kauffman et al. Dec 2002 B1
6518056 Schembri et al. Feb 2003 B2
6521427 Evans Feb 2003 B1
6521453 Crameri et al. Feb 2003 B1
6555357 Kaiser et al. Apr 2003 B1
6558908 Wolber et al. May 2003 B2
6562611 Kaiser et al. May 2003 B1
6566495 Fodor et al. May 2003 B1
6582908 Fodor et al. Jun 2003 B2
6582938 Su et al. Jun 2003 B1
6586211 Staehler et al. Jul 2003 B1
6587579 Bass Jul 2003 B1
6589739 Fisher Jul 2003 B2
6599693 Webb Jul 2003 B1
6602472 Zimmermann et al. Aug 2003 B1
6610978 Yin et al. Aug 2003 B2
6613513 Parce et al. Sep 2003 B1
6613523 Fischer Sep 2003 B2
6613560 Tso et al. Sep 2003 B1
6613893 Webb Sep 2003 B1
6621076 Van De Goor et al. Sep 2003 B1
6630581 Dellinger et al. Oct 2003 B2
6632641 Brennan et al. Oct 2003 B1
6635226 Tso et al. Oct 2003 B1
6642373 Manoharan et al. Nov 2003 B2
6649348 Bass et al. Nov 2003 B2
6660338 Hargreaves Dec 2003 B1
6664112 Mulligan et al. Dec 2003 B2
6670127 Evans Dec 2003 B2
6670461 Nielsen et al. Dec 2003 B1
6673552 Frey Jan 2004 B2
6682702 Barth et al. Jan 2004 B2
6689319 Fisher et al. Feb 2004 B1
6692917 Neri et al. Feb 2004 B2
6702256 Killeen et al. Mar 2004 B2
6706471 Brow et al. Mar 2004 B1
6706875 Goldberg et al. Mar 2004 B1
6709841 Short Mar 2004 B2
6709852 Bloom et al. Mar 2004 B1
6709854 Donahue et al. Mar 2004 B2
6713262 Gellibolian et al. Mar 2004 B2
6716629 Hess et al. Apr 2004 B2
6716634 Myerson Apr 2004 B1
6723509 Ach Apr 2004 B2
6728129 Lindsey et al. Apr 2004 B2
6743585 Dellinger et al. Jun 2004 B2
6753145 Holcomb et al. Jun 2004 B2
6768005 Mellor et al. Jul 2004 B2
6770748 Imanishi et al. Aug 2004 B2
6770892 Corson et al. Aug 2004 B2
6773676 Schembri Aug 2004 B2
6773888 Li et al. Aug 2004 B2
6780982 Lyamichev et al. Aug 2004 B2
6787308 Balasubramanian et al. Sep 2004 B2
6789965 Barth et al. Sep 2004 B2
6790620 Bass et al. Sep 2004 B2
6794499 Wengel et al. Sep 2004 B2
6796634 Caren et al. Sep 2004 B2
6800439 McGall et al. Oct 2004 B1
6814846 Berndt Nov 2004 B1
6815218 Jacobson et al. Nov 2004 B1
6824866 Glazer et al. Nov 2004 B1
6830890 Lockhart et al. Dec 2004 B2
6833246 Balasubramanian Dec 2004 B2
6833450 McGall et al. Dec 2004 B1
6835938 Ghosh et al. Dec 2004 B2
6838888 Peck Jan 2005 B2
6841131 Zimmermann et al. Jan 2005 B2
6845968 Killeen et al. Jan 2005 B2
6846454 Peck Jan 2005 B2
6846922 Manoharan et al. Jan 2005 B1
6852850 Myerson et al. Feb 2005 B2
6858720 Myerson et al. Feb 2005 B2
6879915 Cattell Apr 2005 B2
6880576 Karp et al. Apr 2005 B2
6884580 Caren et al. Apr 2005 B2
6887715 Schembri May 2005 B2
6890723 Perbost et al. May 2005 B2
6890760 Webb May 2005 B1
6893816 Beattie May 2005 B1
6897023 Fu et al. May 2005 B2
6900047 Bass May 2005 B2
6900048 Perbost May 2005 B2
6911611 Wong et al. Jun 2005 B2
6914229 Corson et al. Jul 2005 B2
6916113 Van De Goor et al. Jul 2005 B2
6916633 Shannon Jul 2005 B1
6919181 Hargreaves Jul 2005 B2
6927029 Lefkowitz et al. Aug 2005 B2
6929951 Corson et al. Aug 2005 B2
6936472 Earhart et al. Aug 2005 B2
6938476 Chesk Sep 2005 B2
6939673 Bass et al. Sep 2005 B2
6943036 Bass Sep 2005 B2
6946285 Bass Sep 2005 B2
6950756 Kincaid Sep 2005 B2
6951719 Dupret et al. Oct 2005 B1
6958119 Yin et al. Oct 2005 B2
6960464 Jessee et al. Nov 2005 B2
6969449 Maher et al. Nov 2005 B2
6969488 Bridgham et al. Nov 2005 B2
6976384 Hobbs et al. Dec 2005 B2
6977223 George et al. Dec 2005 B2
6987263 Hobbs et al. Jan 2006 B2
6989267 Kim et al. Jan 2006 B2
6991922 Dupret et al. Jan 2006 B2
7008037 Caren et al. Mar 2006 B2
7025324 Slocum et al. Apr 2006 B1
7026124 Barth et al. Apr 2006 B2
7027930 Cattell Apr 2006 B2
7028536 Karp et al. Apr 2006 B2
7029854 Collins et al. Apr 2006 B2
7034290 Lu et al. Apr 2006 B2
7041445 Chenchik et al. May 2006 B2
7045289 Allawi et al. May 2006 B2
7051574 Peck May 2006 B2
7052841 Delenstarr May 2006 B2
7062385 White et al. Jun 2006 B2
7064197 Rabbani et al. Jun 2006 B1
7070932 Leproust et al. Jul 2006 B2
7075161 Barth Jul 2006 B2
7078167 Delenstarr et al. Jul 2006 B2
7078505 Bass et al. Jul 2006 B2
7094537 Leproust et al. Aug 2006 B2
7097974 Staehler et al. Aug 2006 B1
7101508 Thompson et al. Sep 2006 B2
7101986 Dellinger et al. Sep 2006 B2
7105295 Bass et al. Sep 2006 B2
7115423 Mitchell Oct 2006 B1
7122303 Delenstarr et al. Oct 2006 B2
7122364 Lyamichev et al. Oct 2006 B1
7125488 Li Oct 2006 B2
7125523 Sillman Oct 2006 B2
7128876 Yin et al. Oct 2006 B2
7129075 Gerard et al. Oct 2006 B2
7135565 Dellinger et al. Nov 2006 B2
7138062 Yin et al. Nov 2006 B2
7141368 Fisher et al. Nov 2006 B2
7141807 Joyce et al. Nov 2006 B2
7147362 Caren et al. Dec 2006 B2
7150982 Allawi et al. Dec 2006 B2
7153689 Tolosko et al. Dec 2006 B2
7163660 Lehmann Jan 2007 B2
7166258 Bass et al. Jan 2007 B2
7179659 Stolowitz et al. Feb 2007 B2
7183406 Belshaw et al. Feb 2007 B2
7192710 Gellibolian et al. Mar 2007 B2
7193077 Dellinger et al. Mar 2007 B2
7195872 Agrawal et al. Mar 2007 B2
7198939 Dorsel et al. Apr 2007 B2
7202264 Ravikumar et al. Apr 2007 B2
7202358 Hargreaves Apr 2007 B2
7205128 Ilsley et al. Apr 2007 B2
7205399 Vargeese et al. Apr 2007 B1
7205400 Webb Apr 2007 B2
7206439 Zhou et al. Apr 2007 B2
7208322 Stolowitz et al. Apr 2007 B2
7217522 Brenner May 2007 B2
7220573 Shea et al. May 2007 B2
7221785 Curry et al. May 2007 B2
7226862 Staehler et al. Jun 2007 B2
7227017 Mellor et al. Jun 2007 B2
7229497 Stott et al. Jun 2007 B2
7247337 Leproust et al. Jul 2007 B1
7247497 Dahm et al. Jul 2007 B2
7252938 Leproust et al. Aug 2007 B2
7269518 Corson Sep 2007 B2
7271258 Dellinger et al. Sep 2007 B2
7276336 Webb et al. Oct 2007 B1
7276378 Myerson Oct 2007 B2
7276599 Moore et al. Oct 2007 B2
7282183 Peck Oct 2007 B2
7282332 Caren et al. Oct 2007 B2
7282705 Brennen Oct 2007 B2
7291471 Sampson et al. Nov 2007 B2
7302348 Ghosh et al. Nov 2007 B2
7306917 Prudent et al. Dec 2007 B2
7314599 Roitman et al. Jan 2008 B2
7323320 Oleinikov Jan 2008 B2
7344831 Wolber et al. Mar 2008 B2
7348144 Minor Mar 2008 B2
7351379 Schleifer Apr 2008 B2
7353116 Webb et al. Apr 2008 B2
7361906 Ghosh et al. Apr 2008 B2
7364896 Schembri Apr 2008 B2
7368550 Dellinger et al. May 2008 B2
7371348 Schleifer et al. May 2008 B2
7371519 Wolber et al. May 2008 B2
7371580 Yakhini et al. May 2008 B2
7372982 Le Cocq May 2008 B2
7384746 Lyamichev et al. Jun 2008 B2
7385050 Dellinger et al. Jun 2008 B2
7390457 Schembri Jun 2008 B2
7393665 Brenner Jul 2008 B2
7396676 Robotti et al. Jul 2008 B2
7399844 Sampson et al. Jul 2008 B2
7402279 Schembri Jul 2008 B2
7411061 Myerson et al. Aug 2008 B2
7413709 Roitman et al. Aug 2008 B2
7417139 Dellinger et al. Aug 2008 B2
7422911 Schembri Sep 2008 B2
7427679 Dellinger et al. Sep 2008 B2
7432048 Neri et al. Oct 2008 B2
7435810 Myerson et al. Oct 2008 B2
7439272 Xu Oct 2008 B2
7476709 Moody et al. Jan 2009 B2
7482118 Allawi et al. Jan 2009 B2
7488607 Tom-Moy et al. Feb 2009 B2
7504213 Sana et al. Mar 2009 B2
7514369 Li et al. Apr 2009 B2
7517979 Wolber Apr 2009 B2
7524942 Wang et al. Apr 2009 B2
7524950 Dellinger Apr 2009 B2
7527928 Neri et al. May 2009 B2
7531303 Dorsel et al. May 2009 B2
7534561 Sana et al. May 2009 B2
7534563 Hargreaves May 2009 B2
7537936 Dahm et al. May 2009 B2
7541145 Prudent et al. Jun 2009 B2
7544473 Brenner Jun 2009 B2
7556919 Chenchik et al. Jul 2009 B2
7563600 Oleinikov Jul 2009 B2
7572585 Wang Aug 2009 B2
7572907 Dellinger et al. Aug 2009 B2
7572908 Dellinger et al. Aug 2009 B2
7585970 Dellinger et al. Sep 2009 B2
7588889 Wolber et al. Sep 2009 B2
7595350 Xu Sep 2009 B2
7604941 Jacobson Oct 2009 B2
7604996 Stuelpnagel et al. Oct 2009 B1
7608396 Delenstarr Oct 2009 B2
7618777 Myerson et al. Nov 2009 B2
7629120 Bennett et al. Dec 2009 B2
7635772 McCormac Dec 2009 B2
7648832 Jessee et al. Jan 2010 B2
7651762 Xu et al. Jan 2010 B2
7659069 Belyaev et al. Feb 2010 B2
7678542 Lyamichev et al. Mar 2010 B2
7682809 Sampson Mar 2010 B2
7709197 Drmanac May 2010 B2
7718365 Wang May 2010 B2
7718786 Dupret et al. May 2010 B2
7723077 Young et al. May 2010 B2
7737088 Staehler et al. Jun 2010 B1
7737089 Guimil et al. Jun 2010 B2
7741463 Gormley et al. Jun 2010 B2
7749701 Leproust et al. Jul 2010 B2
7759471 Dellinger et al. Jul 2010 B2
7776021 Borenstein et al. Aug 2010 B2
7776532 Gibson et al. Aug 2010 B2
7790369 Stahler et al. Sep 2010 B2
7790387 Dellinger et al. Sep 2010 B2
7807356 Sampson et al. Oct 2010 B2
7807806 Allawi et al. Oct 2010 B2
7811753 Eshoo Oct 2010 B2
7816079 Fischer Oct 2010 B2
7820387 Neri et al. Oct 2010 B2
7829314 Prudent et al. Nov 2010 B2
7855281 Dellinger et al. Dec 2010 B2
7862999 Zheng et al. Jan 2011 B2
7867782 Barth Jan 2011 B2
7875463 Adaskin et al. Jan 2011 B2
7879541 Kincaid Feb 2011 B2
7879580 Carr et al. Feb 2011 B2
7894998 Kincaid Feb 2011 B2
7919239 Wang Apr 2011 B2
7919308 Schleifer Apr 2011 B2
7927797 Nobile et al. Apr 2011 B2
7927838 Shannon Apr 2011 B2
7932025 Carr et al. Apr 2011 B2
7932070 Hogrefe et al. Apr 2011 B2
7935800 Allawi et al. May 2011 B2
7939645 Borns May 2011 B2
7943046 Martosella et al. May 2011 B2
7943358 Hogrefe et al. May 2011 B2
7960157 Borns Jun 2011 B2
7977119 Kronick et al. Jul 2011 B2
7979215 Sampas Jul 2011 B2
7998437 Berndt et al. Aug 2011 B2
7999087 Dellinger et al. Aug 2011 B2
8021842 Brenner Sep 2011 B2
8021844 Wang Sep 2011 B2
8034917 Yamada Oct 2011 B2
8036835 Sampas et al. Oct 2011 B2
8048664 Guan et al. Nov 2011 B2
8053191 Blake Nov 2011 B2
8058001 Crameri et al. Nov 2011 B2
8058004 Oleinikov Nov 2011 B2
8058055 Barrett et al. Nov 2011 B2
8063184 Allawi et al. Nov 2011 B2
8067556 Hogrefe et al. Nov 2011 B2
8073626 Troup et al. Dec 2011 B2
8076064 Wang Dec 2011 B2
8076152 Robotti Dec 2011 B2
8097711 Timar et al. Jan 2012 B2
8137936 MacEvicz Mar 2012 B2
8148068 Brenner Apr 2012 B2
8154729 Baldo et al. Apr 2012 B2
8168385 Brenner May 2012 B2
8168388 Gormley et al. May 2012 B2
8173368 Staehler et al. May 2012 B2
8182991 Kaiser et al. May 2012 B1
8194244 Wang et al. Jun 2012 B2
8198071 Goshoo et al. Jun 2012 B2
8202983 Dellinger et al. Jun 2012 B2
8202985 Dellinger et al. Jun 2012 B2
8206952 Carr et al. Jun 2012 B2
8213015 Kraiczek et al. Jul 2012 B2
8242258 Dellinger et al. Aug 2012 B2
8247221 Fawcett Aug 2012 B2
8263335 Carr et al. Sep 2012 B2
8268605 Sorge et al. Sep 2012 B2
8283148 Sorge et al. Oct 2012 B2
8288093 Hall et al. Oct 2012 B2
8298767 Brenner et al. Oct 2012 B2
8304273 Stellacci et al. Nov 2012 B2
8309307 Barrett et al. Nov 2012 B2
8309706 Dellinger et al. Nov 2012 B2
8309710 Sierzchala et al. Nov 2012 B2
8314220 Mullinax et al. Nov 2012 B2
8318433 Brenner Nov 2012 B2
8318479 Domansky et al. Nov 2012 B2
8357489 Chua et al. Jan 2013 B2
8357490 Froehlich et al. Jan 2013 B2
8367016 Quan et al. Feb 2013 B2
8367335 Staehler et al. Feb 2013 B2
8380441 Webb et al. Feb 2013 B2
8383338 Kitzman et al. Feb 2013 B2
8415138 Leproust Apr 2013 B2
8435736 Gibson et al. May 2013 B2
8445205 Brenner May 2013 B2
8445206 Bergmann et al. May 2013 B2
8470996 Brenner Jun 2013 B2
8476018 Brenner Jul 2013 B2
8476598 Pralle et al. Jul 2013 B1
8481292 Casbon et al. Jul 2013 B2
8481309 Zhang et al. Jul 2013 B2
8491561 Borenstein et al. Jul 2013 B2
8497069 Hutchison, III et al. Jul 2013 B2
8500979 Elibol et al. Aug 2013 B2
8501454 Liu et al. Aug 2013 B2
8507226 Carr et al. Aug 2013 B2
8507239 Lubys et al. Aug 2013 B2
8507272 Zhang et al. Aug 2013 B2
8530197 Li et al. Sep 2013 B2
8552174 Dellinger et al. Oct 2013 B2
8563478 Gormley et al. Oct 2013 B2
8569046 Love et al. Oct 2013 B2
8577621 Troup et al. Nov 2013 B2
8586310 Mitra et al. Nov 2013 B2
8614092 Zhang et al. Dec 2013 B2
8642755 Sierzchala et al. Feb 2014 B2
8664164 Ericsson et al. Mar 2014 B2
8669053 Stuelpnagel et al. Mar 2014 B2
8679756 Brenner et al. Mar 2014 B1
8685642 Sampas Apr 2014 B2
8685676 Hogrefe et al. Apr 2014 B2
8685678 Casbon et al. Apr 2014 B2
8715933 Oliver May 2014 B2
8715967 Casbon et al. May 2014 B2
8716467 Jacobson May 2014 B2
8722368 Casbon et al. May 2014 B2
8722585 Wang May 2014 B2
8728766 Casbon et al. May 2014 B2
8741606 Casbon et al. Jun 2014 B2
8808896 Choo et al. Aug 2014 B2
8808986 Jacobson et al. Aug 2014 B2
8815600 Liu et al. Aug 2014 B2
8889851 Leproust et al. Nov 2014 B2
8932994 Gormley et al. Jan 2015 B2
8962532 Shapiro et al. Feb 2015 B2
8968999 Gibson et al. Mar 2015 B2
8980563 Zheng et al. Mar 2015 B2
9018365 Brenner Apr 2015 B2
9023601 Oleinikov May 2015 B2
9051666 Oleinikov Jun 2015 B2
9073962 Fracchia et al. Jul 2015 B2
9074204 Anderson et al. Jul 2015 B2
9085797 Gebeyehu et al. Jul 2015 B2
9102731 Boone et al. Aug 2015 B2
9133510 Andersen et al. Sep 2015 B2
9139874 Myers et al. Sep 2015 B2
9150853 Hudson et al. Oct 2015 B2
9187777 Jacobson et al. Nov 2015 B2
9194001 Brenner Nov 2015 B2
9216414 Chu Dec 2015 B2
9217144 Jacobson et al. Dec 2015 B2
9279149 Efcavitch et al. Mar 2016 B2
9286439 Shapiro et al. Mar 2016 B2
9295965 Jacobson et al. Mar 2016 B2
9315861 Hendricks et al. Apr 2016 B2
9328378 Earnshaw et al. May 2016 B2
9347091 Bergmann et al. May 2016 B2
9375748 Harumoto et al. Jun 2016 B2
9376677 Mir Jun 2016 B2
9376678 Gormley et al. Jun 2016 B2
9384320 Church Jul 2016 B2
9384920 Bakulich Jul 2016 B1
9388407 Jacobson Jul 2016 B2
9394333 Wada et al. Jul 2016 B2
9403141 Banyai et al. Aug 2016 B2
9409139 Banyai et al. Aug 2016 B2
9410149 Brenner et al. Aug 2016 B2
9410173 Betts et al. Aug 2016 B2
9416411 Stuelpnagel et al. Aug 2016 B2
9422600 Ramu et al. Aug 2016 B2
9487824 Kutyavin et al. Nov 2016 B2
9499848 Carr et al. Nov 2016 B2
9523122 Zheng et al. Dec 2016 B2
9528148 Zheng et al. Dec 2016 B2
9534251 Young et al. Jan 2017 B2
9555388 Banyai et al. Jan 2017 B2
9568839 Stahler et al. Feb 2017 B2
9580746 Leproust et al. Feb 2017 B2
9670529 Osborne et al. Jun 2017 B2
9670536 Casbon et al. Jun 2017 B2
9677067 Toro et al. Jun 2017 B2
9695211 Wada et al. Jul 2017 B2
9718060 Venter et al. Aug 2017 B2
9745573 Stuelpnagel et al. Aug 2017 B2
9745619 Rabbani et al. Aug 2017 B2
9765387 Rabbani et al. Sep 2017 B2
9771576 Gibson et al. Sep 2017 B2
9833761 Banyai et al. Dec 2017 B2
9834774 Carstens Dec 2017 B2
9839894 Banyai et al. Dec 2017 B2
9879283 Ravinder et al. Jan 2018 B2
9889423 Banyai et al. Feb 2018 B2
9895673 Peck et al. Feb 2018 B2
9925510 Jacobson et al. Mar 2018 B2
9932576 Raymond et al. Apr 2018 B2
9981239 Banyai et al. May 2018 B2
10053688 Cox Aug 2018 B2
10272410 Banyai Apr 2019 B2
10384188 Banyai et al. Aug 2019 B2
10583415 Banyai et al. Mar 2020 B2
10618024 Banyai et al. Apr 2020 B2
10632445 Banyai et al. Apr 2020 B2
10669304 Indermuhle et al. Jun 2020 B2
10754994 Peck Aug 2020 B2
10773232 Banyai et al. Sep 2020 B2
10844373 Cox et al. Nov 2020 B2
10936953 Bramlett et al. Mar 2021 B2
10963953 Sweeder et al. Mar 2021 B2
10975372 Cox et al. Apr 2021 B2
11214798 Brown Jan 2022 B2
11236393 Dubinsky et al. Feb 2022 B2
11268149 Targan et al. Mar 2022 B2
20010018512 Blanchard Aug 2001 A1
20010039014 Bass et al. Nov 2001 A1
20010055761 Kanemoto et al. Dec 2001 A1
20020012930 Rothberg et al. Jan 2002 A1
20020025561 Hodgson Feb 2002 A1
20020058802 Dellinger et al. May 2002 A1
20020076716 Sabanayagam et al. Jun 2002 A1
20020081582 Gao et al. Jun 2002 A1
20020094533 Hess et al. Jul 2002 A1
20020095073 Jacobs et al. Jul 2002 A1
20020119459 Griffiths et al. Aug 2002 A1
20020132308 Liu et al. Sep 2002 A1
20020155439 Rodriguez et al. Oct 2002 A1
20020160536 Regnier et al. Oct 2002 A1
20020164824 Xiao et al. Nov 2002 A1
20030008411 Van Dam et al. Jan 2003 A1
20030022207 Balasubramanian et al. Jan 2003 A1
20030022240 Luo et al. Jan 2003 A1
20030022317 Jack et al. Jan 2003 A1
20030044781 Korlach et al. Mar 2003 A1
20030058629 Hirai et al. Mar 2003 A1
20030064398 Barnes Apr 2003 A1
20030068633 Belshaw et al. Apr 2003 A1
20030082719 Schumacher et al. May 2003 A1
20030100102 Rothberg et al. May 2003 A1
20030108903 Wang et al. Jun 2003 A1
20030120035 Gao et al. Jun 2003 A1
20030130827 Bentzien et al. Jul 2003 A1
20030138782 Evans Jul 2003 A1
20030143605 Lok et al. Jul 2003 A1
20030148291 Robotti Aug 2003 A1
20030148344 Rothberg et al. Aug 2003 A1
20030171325 Gascoyne et al. Sep 2003 A1
20030186226 Brennan et al. Oct 2003 A1
20030228602 Parker et al. Dec 2003 A1
20030228620 Du Breuil Lastrucci Dec 2003 A1
20040009498 Short Jan 2004 A1
20040043509 Stahler et al. Mar 2004 A1
20040053362 De Luca et al. Mar 2004 A1
20040086892 Crothers et al. May 2004 A1
20040087008 Schembri May 2004 A1
20040106130 Besemer et al. Jun 2004 A1
20040106728 McGall et al. Jun 2004 A1
20040110133 Xu et al. Aug 2004 A1
20040175710 Haushalter Sep 2004 A1
20040175734 Stahler et al. Sep 2004 A1
20040191810 Yamamoto Sep 2004 A1
20040213795 Collins et al. Oct 2004 A1
20040219663 Page Nov 2004 A1
20040236027 Maeji et al. Nov 2004 A1
20040248161 Rothberg et al. Dec 2004 A1
20040253242 Bowdish et al. Dec 2004 A1
20040259146 Friend et al. Dec 2004 A1
20050022895 Barth et al. Feb 2005 A1
20050049402 Babcook et al. Mar 2005 A1
20050049796 Webb et al. Mar 2005 A1
20050053968 Bharadwaj et al. Mar 2005 A1
20050079510 Berka et al. Apr 2005 A1
20050100932 Lapidus et al. May 2005 A1
20050112608 Grossman et al. May 2005 A1
20050112636 Hurt et al. May 2005 A1
20050112679 Myerson et al. May 2005 A1
20050118706 Pirrung et al. Jun 2005 A1
20050124022 Srinivasan et al. Jun 2005 A1
20050137805 Lewin Jun 2005 A1
20050208513 Agbo et al. Sep 2005 A1
20050214778 Peck et al. Sep 2005 A1
20050214779 Peck et al. Sep 2005 A1
20050227235 Carr et al. Oct 2005 A1
20050255477 Carr et al. Nov 2005 A1
20050266045 Canham et al. Dec 2005 A1
20050277125 Benn et al. Dec 2005 A1
20050282158 Landegren Dec 2005 A1
20050287585 Oleinikov Dec 2005 A1
20060003381 Gilmore et al. Jan 2006 A1
20060003958 Melville et al. Jan 2006 A1
20060012784 Ulmer Jan 2006 A1
20060012793 Harris Jan 2006 A1
20060019084 Pearson Jan 2006 A1
20060024678 Buzby Feb 2006 A1
20060024711 Lapidus et al. Feb 2006 A1
20060024721 Pedersen Feb 2006 A1
20060076482 Hobbs et al. Apr 2006 A1
20060078909 Srinivasan et al. Apr 2006 A1
20060078927 Peck et al. Apr 2006 A1
20060078937 Korlach et al. Apr 2006 A1
20060127920 Church et al. May 2006 A1
20060134638 Mulligan et al. Jun 2006 A1
20060160138 Church Jul 2006 A1
20060171855 Yin et al. Aug 2006 A1
20060202330 Reinhardt et al. Sep 2006 A1
20060203236 Ji et al. Sep 2006 A1
20060203237 Ji et al. Sep 2006 A1
20060207923 Li Sep 2006 A1
20060219637 Killeen et al. Oct 2006 A1
20070031857 Makarov et al. Feb 2007 A1
20070031877 Stahler et al. Feb 2007 A1
20070043516 Gustafsson Feb 2007 A1
20070054127 Hergenrother et al. Mar 2007 A1
20070059692 Gao et al. Mar 2007 A1
20070087349 Staehler et al. Apr 2007 A1
20070099196 Kauppinen et al. May 2007 A1
20070099208 Drmanac et al. May 2007 A1
20070122817 Church et al. May 2007 A1
20070128635 Macevicz Jun 2007 A1
20070141557 Raab et al. Jun 2007 A1
20070196834 Cerrina et al. Aug 2007 A1
20070196854 Stahler et al. Aug 2007 A1
20070207482 Church et al. Sep 2007 A1
20070207487 Emig et al. Sep 2007 A1
20070231800 Roberts et al. Oct 2007 A1
20070238104 Barrett et al. Oct 2007 A1
20070238106 Barrett et al. Oct 2007 A1
20070238108 Barrett et al. Oct 2007 A1
20070259344 Leproust et al. Nov 2007 A1
20070259345 Sampas Nov 2007 A1
20070259346 Gordon et al. Nov 2007 A1
20070259347 Gordon et al. Nov 2007 A1
20070269870 Church et al. Nov 2007 A1
20080085511 Peck et al. Apr 2008 A1
20080085514 Peck et al. Apr 2008 A1
20080087545 Jensen et al. Apr 2008 A1
20080161200 Yu et al. Jul 2008 A1
20080182296 Chanda et al. Jul 2008 A1
20080214412 Stahler et al. Sep 2008 A1
20080227160 Kool Sep 2008 A1
20080233616 Liss Sep 2008 A1
20080287320 Baynes et al. Nov 2008 A1
20080300842 Govindarajan et al. Dec 2008 A1
20080308884 Kalvesten Dec 2008 A1
20080311628 Shoemaker Dec 2008 A1
20090036664 Peter Feb 2009 A1
20090053704 Novoradovskaya et al. Feb 2009 A1
20090062129 McKernan et al. Mar 2009 A1
20090074771 Koenig et al. Mar 2009 A1
20090087840 Baynes et al. Apr 2009 A1
20090088679 Wood et al. Apr 2009 A1
20090105094 Heiner et al. Apr 2009 A1
20090170802 Stahler et al. Jul 2009 A1
20090176280 Hutchison, III et al. Jul 2009 A1
20090181861 Li et al. Jul 2009 A1
20090194483 Robotti et al. Aug 2009 A1
20090230044 Bek Sep 2009 A1
20090238722 Mora-Fillat et al. Sep 2009 A1
20090239759 Balch Sep 2009 A1
20090246788 Albert et al. Oct 2009 A1
20090263802 Drmanac Oct 2009 A1
20090285825 Kini et al. Nov 2009 A1
20090324546 Notka et al. Dec 2009 A1
20100004143 Shibahara Jan 2010 A1
20100008851 Nicolaides et al. Jan 2010 A1
20100009872 Eid et al. Jan 2010 A1
20100047805 Wang Feb 2010 A1
20100051967 Bradley et al. Mar 2010 A1
20100069250 White, III et al. Mar 2010 A1
20100090341 Wan et al. Apr 2010 A1
20100099103 Hsieh et al. Apr 2010 A1
20100111768 Banerjee et al. May 2010 A1
20100160463 Wang et al. Jun 2010 A1
20100167950 Juang et al. Jul 2010 A1
20100173364 Evans, Jr. et al. Jul 2010 A1
20100216648 Staehler et al. Aug 2010 A1
20100256017 Larman et al. Oct 2010 A1
20100258487 Zelechonok et al. Oct 2010 A1
20100272711 Feldman et al. Oct 2010 A1
20100286290 Lohmann et al. Nov 2010 A1
20100292102 Nouri Nov 2010 A1
20100300882 Zhang Dec 2010 A1
20100311960 Dellinger Dec 2010 A1
20100323404 Lathrop Dec 2010 A1
20110009607 Komiyama et al. Jan 2011 A1
20110082055 Fox et al. Apr 2011 A1
20110114244 Yoo et al. May 2011 A1
20110114549 Yin et al. May 2011 A1
20110124049 Li et al. May 2011 A1
20110124055 Carr et al. May 2011 A1
20110126929 Velasquez-Garcia et al. Jun 2011 A1
20110171651 Richmond Jul 2011 A1
20110172127 Jacobson et al. Jul 2011 A1
20110201057 Carr et al. Aug 2011 A1
20110201528 Baek et al. Aug 2011 A1
20110217738 Jacobson Sep 2011 A1
20110229975 Matthiesen et al. Sep 2011 A1
20110230653 Novoradovskaya et al. Sep 2011 A1
20110254107 Bulovic et al. Oct 2011 A1
20110287435 Grunenwald et al. Nov 2011 A1
20120003713 Hansen et al. Jan 2012 A1
20120021932 Mershin et al. Jan 2012 A1
20120027786 Gupta et al. Feb 2012 A1
20120028843 Ramu et al. Feb 2012 A1
20120032366 Ivniski et al. Feb 2012 A1
20120046175 Rodesch et al. Feb 2012 A1
20120050411 Mabritto et al. Mar 2012 A1
20120094847 Warthmann et al. Apr 2012 A1
20120128548 West et al. May 2012 A1
20120129704 Gunderson et al. May 2012 A1
20120149602 Friend et al. Jun 2012 A1
20120164127 Short et al. Jun 2012 A1
20120164633 Laffler Jun 2012 A1
20120164691 Eshoo et al. Jun 2012 A1
20120184724 Sierzchala et al. Jul 2012 A1
20120220497 Jacobson et al. Aug 2012 A1
20120231968 Bruhn et al. Sep 2012 A1
20120238737 Dellinger et al. Sep 2012 A1
20120258487 Chang et al. Oct 2012 A1
20120264653 Carr et al. Oct 2012 A1
20120270750 Oleinikov Oct 2012 A1
20120270754 Blake Oct 2012 A1
20120283140 Chu Nov 2012 A1
20120288476 Hartmann et al. Nov 2012 A1
20120289691 Dellinger et al. Nov 2012 A1
20120315670 Jacobson et al. Dec 2012 A1
20120322681 Kung et al. Dec 2012 A1
20130005585 Anderson et al. Jan 2013 A1
20130005612 Carr et al. Jan 2013 A1
20130017642 Milgrew et al. Jan 2013 A1
20130017977 Oleinikov Jan 2013 A1
20130017978 Kavanagh et al. Jan 2013 A1
20130035261 Sierzchala et al. Feb 2013 A1
20130040836 Himmler et al. Feb 2013 A1
20130045483 Treusch et al. Feb 2013 A1
20130053252 Xie et al. Feb 2013 A1
20130059296 Jacobson et al. Mar 2013 A1
20130065017 Sieber Mar 2013 A1
20130109595 Routenberg May 2013 A1
20130109596 Peterson et al. May 2013 A1
20130123129 Zeiner et al. May 2013 A1
20130130321 Staehler et al. May 2013 A1
20130137161 Zhang et al. May 2013 A1
20130137173 Zhang et al. May 2013 A1
20130137174 Zhang et al. May 2013 A1
20130137861 Leproust et al. May 2013 A1
20130164308 Foletti et al. Jun 2013 A1
20130165328 Previte et al. Jun 2013 A1
20130196864 Govindarajan et al. Aug 2013 A1
20130225421 Li et al. Aug 2013 A1
20130244884 Jacobson et al. Sep 2013 A1
20130252849 Hudson et al. Sep 2013 A1
20130261027 Li et al. Oct 2013 A1
20130281308 Kung et al. Oct 2013 A1
20130289246 Crowe et al. Oct 2013 A1
20130296192 Jacobson et al. Nov 2013 A1
20130296194 Jacobson et al. Nov 2013 A1
20130298265 Cunnac et al. Nov 2013 A1
20130309725 Jacobson et al. Nov 2013 A1
20130323725 Peter et al. Dec 2013 A1
20130330778 Zeiner et al. Dec 2013 A1
20140011226 Bernick et al. Jan 2014 A1
20140018441 Fracchia et al. Jan 2014 A1
20140031240 Behlke et al. Jan 2014 A1
20140038240 Temme et al. Feb 2014 A1
20140106394 Ko et al. Apr 2014 A1
20140141982 Jacobson et al. May 2014 A1
20140170665 Hiddessen et al. Jun 2014 A1
20140178992 Nakashima et al. Jun 2014 A1
20140221250 Vasquez et al. Aug 2014 A1
20140274729 Kurn et al. Sep 2014 A1
20140274741 Hunter et al. Sep 2014 A1
20140303000 Armour et al. Oct 2014 A1
20140309119 Jacobson et al. Oct 2014 A1
20140309142 Tian Oct 2014 A1
20150010953 Lindstrom et al. Jan 2015 A1
20150012723 Park et al. Jan 2015 A1
20150031089 Lindstrom Jan 2015 A1
20150038373 Banyai et al. Feb 2015 A1
20150056609 Daum et al. Feb 2015 A1
20150057625 Coulthard Feb 2015 A1
20150065357 Fox Mar 2015 A1
20150065393 Jacobson Mar 2015 A1
20150099870 Bennett et al. Apr 2015 A1
20150119293 Short Apr 2015 A1
20150120265 Amirav-Drory et al. Apr 2015 A1
20150159152 Allen et al. Jun 2015 A1
20150183853 Sharma et al. Jul 2015 A1
20150191524 Smith et al. Jul 2015 A1
20150191624 Scheibel et al. Jul 2015 A1
20150191719 Hudson et al. Jul 2015 A1
20150196917 Kay et al. Jul 2015 A1
20150203839 Jacobson et al. Jul 2015 A1
20150211047 Borns Jul 2015 A1
20150225782 Walder et al. Aug 2015 A1
20150240232 Zamore et al. Aug 2015 A1
20150240280 Gibson et al. Aug 2015 A1
20150261664 Goldman et al. Sep 2015 A1
20150269313 Church Sep 2015 A1
20150293102 Shim Oct 2015 A1
20150307875 Happe et al. Oct 2015 A1
20150321191 Kendall et al. Nov 2015 A1
20150322504 Lao et al. Nov 2015 A1
20150344927 Sampson et al. Dec 2015 A1
20150353921 Tian Dec 2015 A9
20150353994 Myers et al. Dec 2015 A1
20150361420 Hudson et al. Dec 2015 A1
20150361422 Sampson et al. Dec 2015 A1
20150361423 Sampson et al. Dec 2015 A1
20150368687 Saaem et al. Dec 2015 A1
20150376602 Jacobson et al. Dec 2015 A1
20160001247 Oleinikov Jan 2016 A1
20160002621 Nelson et al. Jan 2016 A1
20160002622 Nelson et al. Jan 2016 A1
20160010045 Cohen et al. Jan 2016 A1
20160017394 Liang et al. Jan 2016 A1
20160017425 Ruvolo et al. Jan 2016 A1
20160019341 Harris et al. Jan 2016 A1
20160024138 Gebeyehu et al. Jan 2016 A1
20160024576 Chee et al. Jan 2016 A1
20160026753 Krishnaswami et al. Jan 2016 A1
20160026758 Jabara et al. Jan 2016 A1
20160032396 Diehn et al. Feb 2016 A1
20160046973 Efcavitch et al. Feb 2016 A1
20160046974 Efcavitch et al. Feb 2016 A1
20160082472 Perego et al. Mar 2016 A1
20160089651 Banyai Mar 2016 A1
20160090422 Reif et al. Mar 2016 A1
20160090592 Banyai et al. Mar 2016 A1
20160096160 Banyai et al. Apr 2016 A1
20160097051 Jacobson et al. Apr 2016 A1
20160102322 Ravinder et al. Apr 2016 A1
20160108466 Nazarenko et al. Apr 2016 A1
20160122755 Hall et al. May 2016 A1
20160122800 Bernick et al. May 2016 A1
20160152972 Stapleton et al. Jun 2016 A1
20160168611 Efcavitch et al. Jun 2016 A1
20160184788 Hall et al. Jun 2016 A1
20160200759 Srivastava et al. Jul 2016 A1
20160215283 Braman et al. Jul 2016 A1
20160229884 Indermuhle et al. Aug 2016 A1
20160230175 Carstens Aug 2016 A1
20160230221 Bergmann et al. Aug 2016 A1
20160251651 Banyai et al. Sep 2016 A1
20160256846 Smith et al. Sep 2016 A1
20160264958 Toro et al. Sep 2016 A1
20160289758 Akeson et al. Oct 2016 A1
20160289839 Harumoto et al. Oct 2016 A1
20160303535 Banyai et al. Oct 2016 A1
20160304862 Igawa et al. Oct 2016 A1
20160304946 Betts et al. Oct 2016 A1
20160310426 Wu Oct 2016 A1
20160310927 Banyai et al. Oct 2016 A1
20160318016 Hou et al. Nov 2016 A1
20160333340 Wu Nov 2016 A1
20160339409 Banyai et al. Nov 2016 A1
20160340672 Banyai et al. Nov 2016 A1
20160348098 Stuelpnagel et al. Dec 2016 A1
20160354752 Banyai et al. Dec 2016 A1
20160355880 Gormley et al. Dec 2016 A1
20170017436 Church Jan 2017 A1
20170066844 Glanville Mar 2017 A1
20170067047 Link et al. Mar 2017 A1
20170067099 Zheng et al. Mar 2017 A1
20170073664 McCafferty et al. Mar 2017 A1
20170073731 Zheng et al. Mar 2017 A1
20170081660 Cox et al. Mar 2017 A1
20170081716 Peck Mar 2017 A1
20170088887 Makarov et al. Mar 2017 A1
20170095785 Banyai et al. Apr 2017 A1
20170096706 Behlke et al. Apr 2017 A1
20170114404 Behlke et al. Apr 2017 A1
20170141793 Strauss et al. May 2017 A1
20170147748 Staehler et al. May 2017 A1
20170151546 Peck et al. Jun 2017 A1
20170159044 Toro et al. Jun 2017 A1
20170175110 Jacobson et al. Jun 2017 A1
20170218537 Olivares Aug 2017 A1
20170233764 Young et al. Aug 2017 A1
20170247473 Short Aug 2017 A1
20170249345 Malik et al. Aug 2017 A1
20170253644 Steyaert et al. Sep 2017 A1
20170298432 Holt Oct 2017 A1
20170320061 Venter et al. Nov 2017 A1
20170327819 Banyai et al. Nov 2017 A1
20170355984 Evans et al. Dec 2017 A1
20170357752 Diggans Dec 2017 A1
20170362589 Banyai et al. Dec 2017 A1
20180029001 Banyai et al. Feb 2018 A1
20180051278 Cox et al. Feb 2018 A1
20180051280 Gibson et al. Feb 2018 A1
20180068060 Ceze et al. Mar 2018 A1
20180101487 Peck Apr 2018 A1
20180104664 Fernandez Apr 2018 A1
20180126355 Peck et al. May 2018 A1
20180142289 Zeitoun et al. May 2018 A1
20180171509 Cox et al. Jun 2018 A1
20180236425 Banyai et al. Aug 2018 A1
20180264428 Banyai et al. Sep 2018 A1
20180273936 Cox et al. Sep 2018 A1
20180282721 Cox et al. Oct 2018 A1
20180291445 Betts et al. Oct 2018 A1
20180312834 Cox et al. Nov 2018 A1
20180326388 Banyai et al. Nov 2018 A1
20180334712 Singer et al. Nov 2018 A1
20180346585 Zhang et al. Dec 2018 A1
20180355351 Nugent et al. Dec 2018 A1
20190060345 Harrison et al. Feb 2019 A1
20190083596 Orentas et al. Mar 2019 A1
20190118154 Marsh et al. Apr 2019 A1
20190135926 Glanville May 2019 A1
20190224711 Demeris, Jr. Jul 2019 A1
20190240636 Peck et al. Aug 2019 A1
20190314783 Banyai et al. Oct 2019 A1
20190352635 Toro et al. Nov 2019 A1
20190366293 Banyai et al. Dec 2019 A1
20190366294 Banyai et al. Dec 2019 A1
20200017907 Zeitoun et al. Jan 2020 A1
20200056229 Mir Feb 2020 A1
20200102611 Zeitoun et al. Apr 2020 A1
20200156037 Banyai et al. May 2020 A1
20200181667 Wu et al. Jun 2020 A1
20200222875 Peck et al. Jul 2020 A1
20200283760 Nugent et al. Sep 2020 A1
20200299322 Indermuhle et al. Sep 2020 A1
20200299684 Toro et al. Sep 2020 A1
20200308575 Sato Oct 2020 A1
20200325235 Tabibiazar et al. Oct 2020 A1
20200342143 Peck Oct 2020 A1
20210002710 Gantt et al. Jan 2021 A1
20210040476 Cox et al. Feb 2021 A1
20210071168 Nugent et al. Mar 2021 A1
20210102192 Tabibiazar et al. Apr 2021 A1
20210102195 Sato et al. Apr 2021 A1
20210102198 Cox et al. Apr 2021 A1
20210115594 Cox et al. Apr 2021 A1
20210129108 Marsh et al. May 2021 A1
20210142182 Bramlett et al. May 2021 A1
20210147830 Liss May 2021 A1
20210170356 Peck et al. Jun 2021 A1
20210179724 Sato et al. Jun 2021 A1
20210207197 Gantt et al. Jul 2021 A1
20210332078 Wu Oct 2021 A1
20210348220 Zeitoun et al. Nov 2021 A1
20210355194 Sato et al. Nov 2021 A1
20210395344 Sato et al. Dec 2021 A1
20220032256 Lackey et al. Feb 2022 A1
20220064206 Fernandez et al. Mar 2022 A1
20220064313 Sato et al. Mar 2022 A1
20220064628 Toro et al. Mar 2022 A1
20220106586 Nugent et al. Apr 2022 A1
20220106590 Arbiza et al. Apr 2022 A1
20220135690 Sato et al. May 2022 A1
20220135965 Gantt et al. May 2022 A1
20220138354 Peck May 2022 A1
20220145289 Lackey et al. May 2022 A1
20220206001 Sato Jun 2022 A1
20220243195 Nugent et al. Aug 2022 A1
20220246236 Amirav-Drory Aug 2022 A1
20220259319 Sato et al. Aug 2022 A1
20220259638 Brown Aug 2022 A1
20220277808 Arbiza et al. Sep 2022 A1
20220281989 Glanville Sep 2022 A1
20220307010 Sato et al. Sep 2022 A1
20220315971 Wu et al. Oct 2022 A1
Foreign Referenced Citations (247)
Number Date Country
3157000 Sep 2000 AU
2362939 Aug 2000 CA
1771336 May 2006 CN
10127758 Oct 2008 CN
102159726 Aug 2011 CN
103003431 Mar 2013 CN
103907117 Jul 2014 CN
104520864 Apr 2015 CN
104562213 Apr 2015 CN
104734848 Jun 2015 CN
104974929 Oct 2015 CN
204714802 Oct 2015 CN
105637097 Jun 2016 CN
10260805 Jul 2004 DE
WO-03066212 Aug 2003 DO
201890763 Aug 2018 EA
0090789 Oct 1983 EP
0126621 Aug 1990 EP
0753057 Jan 1997 EP
1153127 Nov 2001 EP
1314783 May 2003 EP
1363125 Nov 2003 EP
1546387 Jun 2005 EP
1153127 Jul 2006 EP
1728860 Dec 2006 EP
1072010 Apr 2010 EP
2175021 Apr 2010 EP
2330216 Jun 2011 EP
1343802 May 2012 EP
2504449 Oct 2012 EP
2751729 Jul 2014 EP
2872629 May 2015 EP
2928500 Oct 2015 EP
2971034 Jan 2016 EP
3030682 Jun 2016 EP
3044228 Apr 2017 EP
2994509 Jun 2017 EP
3204518 Aug 2017 EP
H07505530 Jun 1995 JP
2001518086 Oct 2001 JP
2002511276 Apr 2002 JP
2002536977 Nov 2002 JP
2002538790 Nov 2002 JP
2003522119 Jul 2003 JP
2004521628 Jul 2004 JP
2006503586 Feb 2006 JP
2006238724 Sep 2006 JP
2008505642 Feb 2008 JP
2008097189 Apr 2008 JP
2008523786 Jul 2008 JP
2008214343 Sep 2008 JP
2009294195 Dec 2009 JP
2016527313 Sep 2016 JP
WO-9015070 Dec 1990 WO
WO-9210092 Jun 1992 WO
WO-9210588 Jun 1992 WO
WO-9309668 May 1993 WO
WO-9320242 Oct 1993 WO
WO-9525116 Sep 1995 WO
WO-9526397 Oct 1995 WO
WO-9615861 May 1996 WO
WO-9710365 Mar 1997 WO
WO-9822541 May 1998 WO
WO-9841531 Sep 1998 WO
WO-9942813 Aug 1999 WO
WO-9953101 Oct 1999 WO
WO-0013017 Mar 2000 WO
WO-0018957 Apr 2000 WO
WO-0042559 Jul 2000 WO
WO-0042560 Jul 2000 WO
WO-0042561 Jul 2000 WO
WO-0049142 Aug 2000 WO
WO-0053617 Sep 2000 WO
WO-0156216 Aug 2001 WO
WO-0210443 Feb 2002 WO
WO-0156216 Mar 2002 WO
WO-0220537 Mar 2002 WO
WO-0224597 Mar 2002 WO
WO-0227638 Apr 2002 WO
WO-0233669 Apr 2002 WO
WO-02072791 Sep 2002 WO
WO-02072864 Sep 2002 WO
WO-03040410 May 2003 WO
WO-03046223 Jun 2003 WO
WO-03054232 Jul 2003 WO
WO-03060084 Jul 2003 WO
WO-03064026 Aug 2003 WO
WO-03064027 Aug 2003 WO
WO-03064699 Aug 2003 WO
WO-03065038 Aug 2003 WO
WO-03089605 Oct 2003 WO
WO-03093504 Nov 2003 WO
WO-03100012 Dec 2003 WO
WO-2004024886 Mar 2004 WO
WO-2004029220 Apr 2004 WO
WO-2004029586 Apr 2004 WO
WO-2004031351 Apr 2004 WO
WO-2004031399 Apr 2004 WO
WO-2004059556 Jul 2004 WO
WO-03060084 Aug 2004 WO
WO-2005014850 Feb 2005 WO
WO 2005051970 Jun 2005 WO
WO-2005059096 Jun 2005 WO
WO-2005059097 Jun 2005 WO
WO-2005093092 Oct 2005 WO
WO-2006023144 Mar 2006 WO
WO-2006044956 Apr 2006 WO
WO-2006076679 Jul 2006 WO
WO-2006116476 Nov 2006 WO
WO-2007073171 Jun 2007 WO
WO-2007109221 Sep 2007 WO
WO-2007118214 Oct 2007 WO
WO-2007120627 Oct 2007 WO
WO-2007137242 Nov 2007 WO
WO-2008003116 Jan 2008 WO
WO-2008006078 Jan 2008 WO
WO-2008027558 Mar 2008 WO
WO-2008045380 Apr 2008 WO
WO-2008054543 May 2008 WO
WO-2008063134 May 2008 WO
WO-2008063135 May 2008 WO
WO-2008068280 Jun 2008 WO
WO-2008103474 Aug 2008 WO
WO-2008109176 Sep 2008 WO
WO-2009132876 Nov 2009 WO
WO-2010001251 Jan 2010 WO
WO-2010025310 Mar 2010 WO
WO-2010025566 Mar 2010 WO
WO-2010027512 Mar 2010 WO
WO-2010089412 Aug 2010 WO
WO-2010141249 Dec 2010 WO
WO-2010141433 Dec 2010 WO
WO-2011020529 Feb 2011 WO
WO-2010141433 Apr 2011 WO
WO-2011053957 May 2011 WO
WO-2011056644 May 2011 WO
WO-2011056872 May 2011 WO
WO-2011066185 Jun 2011 WO
WO-2011068186 Jun 2011 WO
WO-2011085075 Jul 2011 WO
WO-2011103468 Aug 2011 WO
WO-2011109031 Sep 2011 WO
WO-2011143556 Nov 2011 WO
WO-2011150168 Dec 2011 WO
WO-2011161413 Dec 2011 WO
WO-2012013913 Feb 2012 WO
WO-2012061832 May 2012 WO
WO-2012078312 Jun 2012 WO
WO-2012149171 Nov 2012 WO
WO-2012154201 Nov 2012 WO
WO-2013010062 Jan 2013 WO
WO-2013030827 Mar 2013 WO
WO-2013032850 Mar 2013 WO
WO-2013036668 Mar 2013 WO
WO-2013049227 Apr 2013 WO
WO-2013101896 Jul 2013 WO
WO-2013134881 Sep 2013 WO
WO-2013154770 Oct 2013 WO
WO-2013170168 Nov 2013 WO
WO-2013177220 Nov 2013 WO
WO-2014004393 Jan 2014 WO
WO-2014008447 Jan 2014 WO
WO-2014021938 Feb 2014 WO
WO-2014035693 Mar 2014 WO
WO-2014088693 Jun 2014 WO
WO-2014089160 Jun 2014 WO
WO-2014093330 Jun 2014 WO
WO-2014093694 Jun 2014 WO
WO-2014151117 Sep 2014 WO
WO-2014151696 Sep 2014 WO
WO-2014160004 Oct 2014 WO
WO-2014160059 Oct 2014 WO
WO-2014206304 Dec 2014 WO
WO-2015017527 Feb 2015 WO
WO-2015021080 Feb 2015 WO
WO-2015021280 Feb 2015 WO
WO-2015031689 Mar 2015 WO
WO-2015040075 Mar 2015 WO
WO-2015054292 Apr 2015 WO
WO-2015066174 May 2015 WO
WO-2015081114 Jun 2015 WO
WO-2015081142 Jun 2015 WO
WO-2015081440 Jun 2015 WO
WO-2015090879 Jun 2015 WO
WO-2015095404 Jun 2015 WO
WO-2015120403 Aug 2015 WO
WO-2015136072 Sep 2015 WO
WO-2016162127 Sep 2015 WO
WO-2015160004 Oct 2015 WO
WO-2015175832 Nov 2015 WO
WO-2016007604 Jan 2016 WO
WO-2016011080 Jan 2016 WO
WO-2016022557 Feb 2016 WO
WO-2016053883 Apr 2016 WO
WO-2016055956 Apr 2016 WO
WO-2016065056 Apr 2016 WO
WO-2016126882 Aug 2016 WO
WO-2016126987 Aug 2016 WO
WO-2016130868 Aug 2016 WO
WO-2016161244 Oct 2016 WO
WO-2016164779 Oct 2016 WO
WO-2016172377 Oct 2016 WO
WO-2016173719 Nov 2016 WO
WO-2016183100 Nov 2016 WO
WO-2017049231 Mar 2017 WO
WO-2017053450 Mar 2017 WO
WO-2017059399 Apr 2017 WO
WO-2017095958 Jun 2017 WO
WO-2017100441 Jun 2017 WO
WO-2017118761 Jul 2017 WO
WO-2017158103 Sep 2017 WO
WO-2017214574 Dec 2017 WO
WO-2018026920 Feb 2018 WO
WO-2018038772 Mar 2018 WO
WO-2018057526 Mar 2018 WO
WO-2018094263 May 2018 WO
WO-2018112426 Jun 2018 WO
WO-2018119246 Jun 2018 WO
WO-2018156792 Aug 2018 WO
WO-2018170164 Sep 2018 WO
WO-2018170169 Sep 2018 WO
WO-2018170559 Sep 2018 WO
WO-2018200380 Nov 2018 WO
WO-2018231872 Dec 2018 WO
WO-2019014781 Jan 2019 WO
WO-2019051501 Mar 2019 WO
WO-2019079769 Apr 2019 WO
WO-2019084500 May 2019 WO
WO-2019136175 Jul 2019 WO
WO-2019222706 Nov 2019 WO
WO-2020139871 Jul 2020 WO
WO-2020176362 Sep 2020 WO
WO-2020176678 Sep 2020 WO
WO-2020176680 Sep 2020 WO
WO-2020257612 Dec 2020 WO
WO-2021046655 Mar 2021 WO
WO-2021119193 Jun 2021 WO
WO-2022010934 Jan 2022 WO
WO-2022046797 Mar 2022 WO
WO-2022046944 Mar 2022 WO
WO-2022047076 Mar 2022 WO
WO-2022076326 Apr 2022 WO
WO-2022086866 Apr 2022 WO
WO-2022087293 Apr 2022 WO
WO-2022098662 May 2022 WO
WO-2022159620 Jul 2022 WO
WO-2022178137 Aug 2022 WO
Non-Patent Literature Citations (621)
Entry
Wikipedia, “Central dogma of molecular biology,” URL: https://en.wikipedia.org/wiki/Central_dogma_of_molecular_biology, 9 pages, downloaded Dec. 4, 2021.
Hood, Leroy, and David Galas. “The digital code of DNA.” Nature 421.6921 (2003): 444-448.
Alberts et al.: Molecular Biology ofthe Cell. 4th edition. New York: Garland Science; 2002. The Generation of Antibody Diversity. https://www.ncbi.nlm.nih.gov/books/NBK26860/.
Almagro et al.: Progress and Challenges in the Design and Clinical Development of Antibodies for Cancer Therapy. Frontiers in immunology; 8, 1751 (2018) doi:10.3389/fimmu.2017.01751 https://www.frontiersin.org/articles/10.3389/fimmu.2017.01751/full.
Bai. A Novel Human scFv Library with Non-Combinatorial Synthetic CDR Diversity. PLoS One. 10(10):1-18 (2015).
Berg: Biochemistry. 5th ED. New York (2002) 148-149.
Borda et al.: Secret writing by DNA hybridization. Acta Technica Napocensis Electronics and Telecommunications. 50(2):21-24 (2008).
Chervin et al.: Design of T-cell receptor libraries with diverse binding properties to examine adoptive T-cell responses. Gene Therapy. 20(6):634-644 (2012).
Cleary et al.: Production of complex nucleic acid libraries using highly parallel in situ oligonucleotide synthesis. Nat Methods. 1(3):241-248 (2004).
Cui et al.: Information Security Technology Based on DNA Computing. International Workshop on Anti-Counterfeiting, Security and Identification (ASID); IEEE Xplore 4 pages (2007).
Fernández-Quintero et al.: Characterizing the Diversity ofthe CDR-H3 Loop Conformational Ensembles in Relationship to Antibody Binding Properties. Front. Immunol. 9:1-11 (2019).
GE Healthcare. AKTA oligopilot plus. Data File 18-114-66 AD ©. 8 pages (2006).
GE Healthcare. Robust and cost-efficient oligonucleotide synthesis. Application Note 28-4058-08 AA. 4 pages (2005).
Geetha et al.: Survey on Security Mechanisms for Public Cloud Data. 2016 International Conference on Emerging Trends in Engineering, Technology and Science (ICETETS). 8 pages (2016).
Goodwin et al.: Immunoglobulin heavy chain variable region, partial [Homo sapiens]. Genbank entry (online). National Institute of Biotechnology Information. (2018) https://www.ncbi.nim.nih.gov/protein/AXA12486.1.
Hauser et al.: Trends in GPCR drug discovery: new agents, targets and indications. Nature Reviews Drug Discovery, 16, 829-842 (2017). doi:10.1038/nrd.2017.178 https://www.nature.com/articles/nrd.2017.178.
Hopcroft et al.: What is the Young's Modulus of Silicon?. Journal of Microelectromechanical Systems. 19(2):229-238 (2010).
Hötzel et al.: A strategy for risk mitigation of antibodies with fast clearance. mAbs, 4(6), 753-760 (2012). doi:10.4161/mabs.22189 https://www.ncbi.nlm.nih.gov/pubmed/23778268.
Hudson: Matrix Assisted Synthetic Transformations: A Mosaic of Diverse Contributions. Journal of Combinatorial Chemistry. 1(6):403-457 (1999).
Jaiswal et al.: An architecture for creating collaborative semantically capable scientific data sharing infrastructures. Proceeding WIDM '06 Proceedings of the 8th annual ACM international workshop on Web information and data management. ACM Digital Library pp. 75-82 (2006).
Jang et al.: Characterization of T cell repertoire of blood, tumor, and ascites in ovarian cancer patients using next generation sequencing. Oncoimmunology, 4(11):e1030561:1-10 (2015).
Kalva et al.: Gibson Deletion: a novel application of isothermal in vitro recombination. Biological Procedures Online. 20(1):1-10 (2018).
Kosuri et al.: A scalable gene synthesis platform using high-fidelity DNA microchips Nat.Biotechnol. 28(12):1295-1299 (2010).
Lebl et al.: Economical Parallel Oligonucleotide and Peptide Synthesizer—Pet Oligator. Int. J. Peptide Res. Ther. 13(1-2):367-376 (2007).
Lee: Covalent End-Immobilization of Oligonucleotides onto Solid Surfaces; Thesis, Massachusetts Institute of Technology, Aug. 2001 (315 pages).
Leproust et al.: Synthesis of high-quality libraries of long (150mer) oligonucleotides by a novel depurination controlled process. Nucleic Acids Research. 38(8):2522-2540 (2010).
Malecek et al.: Engineering improved T cell receptors using an alanine-scan guided T cell display selection system. Journal of Immunological Methods. Elsevier Science Publishers. 392(1):1-11 (2013).
MLAB 2321 Molecular Diagnostics for Clinical Laboratory Science. Mar. 6, 2015.
Momentiv. Technical Data Sheet. Silquest A-1100. Momentiv. 1-6 (2020).
(Novartis Institutes for Biomedical Research) Immunoglobulin Heavy Chain [Homo sapiens]. National Center for Biotechnology Information. Genbank Entry. pp. 1-2 (2018) https://www.ncbi.nlm.nih.gov/nuccore/MH975524.1ttps://https://www.ncbi.nlm.nih.gov/nuccore/MH975524.1.
(Novartes Institutes for Biomedical Research) Immunoglobulin Lambda Chain [Homo sapiens]. National Center for Biotechnology Information. Genbank Entry. pp. 1-2 (2018) https://www.ncbi.nlm.nih.gov/nuccore/MH197552.4.1.
Nucleic acid thermodynamics. Wikipedia. Feb. 4, 2021.
O'Driscoll et al.: Synthetic DNA: The next generation of big data storage. Bioengineered. 4(3):123-125 (2013).
Opposition to European Patent No. 3030682 filed Mar. 3, 2021.
PCT/US2019/068435 International Search Report and Written Opinion dated Apr. 23, 2020.
PCT/US2020/019371 International Search Report and Written Opinion dated Jun. 25, 2020.
PCT/US2020/019986 International Search Report and Written Opinion dated Jul. 29, 2020.
PCT/US2020/019986 Invitation to Pay Additional Fees dated Jun. 5, 2020.
PCT/US2020/019988 International Search Report and Written Opinion dated Jul. 29, 2020.
PCT/US2020/019988 Invitation to Pay Additional Fees dated Jun. 8, 2020.
PCT/US2020/038679 International Search Report and Written Opinion dated Oct. 28, 2020.
PCT/US2020/052291 International Search Report and Written Opinion dated Mar. 10, 2021.
PCT/US2020/052291 Invitation to Pay Additional Fees dated Dec. 31, 2020.
PCT/US2020/052306 International Search Report and Written Opinion dated Mar. 2, 2021.
PCT/US2020/052306 Invitation to Pay Additional Fees dated Dec. 18, 2020.
PCT/US2020/064106 International Search Report and Written Opinion dated Jun. 3, 2021.
PCT/US2020/064106 Invitation to Pay Additional Fees dated Apr. 9, 2021.
Pigott et al.: The Use of a Novel Discovery Platform to Identify Peptide-Grafted Antibodies that Activate GLP-1 Receptor Signaling. Innovative Targeting Solutions Inc. (2013) XP055327428 retrieved from the internet: http://www.innovativetargeting.com/wo-content/uploads/2013/12/Pigott-et-al-Antibody-Engineering-2013.pdf.
Ponsel. High Affinity, Developability and Functional Size: The Holy Grail of Combinatorial Antibody Library Generation. Molecules. 16:3675-3700 (2011).
PubChem Data Sheet Dichloromethane. Printed from website https://pubchem.ncbi.nlm.nih.gov/compound/Dichloromethane (2020).
Quan et al.: Parallel on-chip gene synthesis and application to optimization of protein expression. Nature Biotechnology. 29:449-452 (2011).
Regep et al.: The H3 loop of antibodies shows unique structural characteristics. Proteins. 85(7):1311-1318 (2017).
Shipman et al.: Molecular recordings by directed CRISPR spacer acquisition. Science. 353(6298):1-16 (2016).
US. Appl. No. 14/452,429 Office Action dated Oct. 21, 2015.
U.S. Appl. No. 15/151,316 Final Office Action dated Jul. 9, 2020.
U.S. Appl. No. 15/156,134 Final Office Action dated Aug. 18, 2021.
U.S. Appl. No. 15/156,134 Office Action dated Nov. 25, 2020.
U.S. Appl. No. 15/245,054 Notice of Allowance dated Dec. 14, 2017.
U.S. Appl. No. 15/272,004 Final Office Action dated Mar. 18, 2021.
U.S. Appl. No. 15/272,004 Office Action dated Jun. 12, 2020.
U.S. Appl. No. 15/619,322 Final Office Action dated Jul. 9, 2021.
U.S. Appl. No. 15/619,322 Office Action dated Nov. 4, 2020.
U.S. Appl. No. 15/816,995 Office Action dated May 19, 2020.
U.S. Appl. No. 15/835,342 Final Office Action dated Sep. 8, 2020.
U.S. Appl. No. 15/835,342 Office Action dated Apr. 16, 2021.
U.S. Appl. No. 15/921,479 Final Office Action dated Jun. 15, 2020.
U.S. Appl. No. 15/921,479 Office Action dated Apr. 27, 2021.
U.S. Appl. No. 15/991,992 Office Action dated May 21, 2020.
U.S. Appl. No. 16/031,784 Office Action dated May 12, 2020.
U.S. Appl. No. 16/039,256 Final Office Action dated Mar. 30, 2021.
U.S. Appl. No. 16/039,256 Office Action dated Aug. 20, 2020.
U.S. Appl. No. 16/039,256 Restriction Requirement dated May 18, 2020.
U.S. Appl. No. 16/128,372 Final Office Action dated Mar. 18, 2021.
U.S. Appl. No. 16/128,372 Office Action dated Oct. 8, 2020.
U.S. Appl. No. 16/128,372 Restriction Requirement dated May 18, 2020.
U.S. Appl. No. 16/239,453 Office Action dated May 11, 2020.
U.S. Appl. No. 16/384,678 Final Office Action dated Oct. 15, 2020.
U.S. Appl. No. 16/530,717 Final Office Action dated Apr. 15, 2020.
U.S. Appl. No. 16/535,777 Final Office Action dated Oct. 20, 2020.
U.S. Appl. No. 16/535,777 Office Action dated Feb. 8, 2021.
U.S. Appl. No. 16/712,678 Restriction Requirement dated Aug. 25, 2021.
U.S. Appl. No. 16/798,275 Office Action dated Feb. 10, 2021.
U.S. Appl. No. 16/854,719 Restriction Requirement dated Jul. 28, 2021.
U.S. Appl. No. 16/879,705 Office Action dated Sep. 9, 2021.
U.S. Appl. No. 16/906,555 Office Action dated Aug. 17, 2021.
U.S. Appl. No. 17/154,906 Restriction Requirement dated Jul. 26, 2021.
U.S. Appl. No. 16/798,275 Roar Office Action dated Aug. 30, 2021.
Van der Velde: Thesis. Finding the Strength of Glass. Delft University of Technology. 1-16, (2015).
Xu et al.: Coordination between the Polymerase and 5 ′-Nuclease Components of DNA Porymerase I of Escherichia coli. The Journal of Biological Chemistry. 275(27):20949-20955 (2000).
Yazdi et al.: DNA-Based Storage: Trends and Methods, IEEE Transactions on Molecular, Biological and Multi-Scale Communications. IEEE. 1(3):230-246, (2016).
Abudayyeh et al., C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector. Science, available on line, Jun. 13, 2016, at: http://zlab.mit.edu/assets/reprints/Abudayyeh_OO_Science_2016.pdf , 17 pages.
Adessi, et al. Solid phase DNA amplification: characterisation of primer attachment and amplification mechanisms. Nucleic Acids Res. 28(20):E87, 2000.
Alexeyev, Mikhail F. et al., “Gene synthesis, bacterial expression and purification of the Rickettsia prowazekii ATP/ADP translocase”, Biochimica et Biophysics Acta, 1419:299-306, 1999.
Al-Housseiny et al., Control of interfacial instabilities using flow geometry Nature Physics, 8:747-750, 2012.
Amblard, Francois et al., “A magnetic manipulator for studying local rheology and micromechanical properties of biological systems”, Rev. Sci. Instrum., 67(3):18-827, 1996.
Andoni and Indyk, Near-Optimal Hashing Algorithms for Approximate Nearest Neighbor in High Dimensions, Communications of the ACM, 51(1):117-122, 2008.
Arkles, et al. The Role of Polarity in the Structure of Silanes Employed in Surface Modification. Silanes and Other Coupling Agents. 5:51-64, 2009.
Arkles, Hydrophobicity, Hydrophilicity Reprinted with permission from the Oct. 2006 issue of Paint & Coatings Industry magazine, Retrieved on Mar. 19, 2016, 10 pages.
Assi, Fabiano et al., “Massive-parallel adhesion and reactivity-measurements using simple and inexpensive magnetic tweezers”, J. Appl. Phys., 92(9):5584-5586, 2002.
ATDBio, “Nucleic Acid Structure,” Nucleic Acids Book, 9 pages, published on Jan. 22, 2005. from: http://www.atdbio.com/content/5/Nucleic-acid-structure.
ATDBio, “Solid-Phase Oligonucleotide Synthesis,” Nucleic Acids Book, 20 pages, Published on Jul. 31, 2011. from: http://www.atdbio.com/content/17/Solid-phase-oligonucleotide-synthesis.
Au, Lo-Chun et al. “Gene synthesis by a LCR-based approach: high level production of Leptin-L54 using synthetic gene in Escherichia coli”, Biochemical and Biophysical Research Communications, 248:200-203, 1998.
Baedeker, Mathias et al., Overexpression of a designed 2.2kb gene of eukaryotic phenylalanine ammonialyase in Escherichia coli⋅. FEBS Letters, 457:57-60, 1999.
Barbee, et al. Magnetic Assembly of High-Density DNA Arrays for Genomic Analyses. Anal Chem. 80(6):2149-2154, 2008.
Barton et al., A desk electrohydrodynamicjet printing system. Mechatronics, 20:611-616, 2010.
Beaucage, et al. Advances in the synthesis of oligonucleotides by the phosphoramidite approach. Tetrahedron. 48:2223-2311, 1992.
Beaucage, et al. Deoxynucleoside phosphoramidites—A new class of key intermediates for deoxypolynucleotide synthesis. Tetrahedron Lett. 22(20):1859-1862, 1981.
Beaucage, Serge L. et al., “The Chemical synthesis of DNA/RNA” Chapter 2 in: Encyclopedia of Cell Biology, 1:36-53, 2016.
Beaulieu, Martin et al., “PCR candidate region mismatch scanning adaptation to quantitative, high-throughput genotyping”, Nucleic Acids Research, 29(5):1114-1124, 2001.
Beigelman, et al. Base-modified phosphoramidite analogs of pyrimidine ribonucleosides for RNA structure-activity studies. Methods Enzymol. 317:39-65, 2000.
Bethge et al., “Reverse synthesis and 3′-modification of RNA.” Jan. 1, 2011, pages 64-64, XP055353420. Retrieved from the Internet: URL:http://www.is3na.org/assets/events/Category%202-Medicinal %20Chemistry%200f%2001igonucleotides%20%2864-108%29.pdf.
Binkowski et al., Correcting errors in synthetic DNA through consensus shuffling. Nucleic Acids Research, 33(6):e55, 8 pages, 2005.
Biswas, lndranil et al., “Identification and characterization of a thermostable MutS homolog from Thennus aquaticus”, The Journal of Biological Chemistry, 271(9):5040-5048, 1996.
Biswas, lndranil et al., “Interaction of MutS protein with the major and minor grooves of a heteroduplex DNA”, The Journal of Biological Chemistry, 272(20):13355-13364, 1997.
Bjornson, Keith P. et al., “Differential and simultaneous adenosine Di- and Tri˜hosphate binding by MutS”, The Journal of Biological Chemistry, 278(20):18557-18562, 2003.
Blanchard, et al., “High-Density Oligonucleotide Arrays,” Biosensors & Bioelectronics, 11(6/7):687-690, 1996.
Blanchard, in: Genetic Engineering, Principles and Methods, vol. 20, Ed. J. Sedlow, New York: Plenum Press, p. 111-124, 1979.
Blawat et al., Forward error correction for DNA data storage. Procedia Computer Science, 80:1011-1022, 2016.
Bonini and Mondino, Adoptive T-cell therapy for cancer: The era of engineered T cells. European Journal of Immunology, 45:2457-2469, 2015.
Bornholt et al., A DNA-Based Archival Storage System, in International Conference on Architectural Support for Programming Languages and Operating Systems (ASPLOS), Apr. 2-6, 2016, Atlanta, GA, 2016, 637-649.
Borovkov et al., High-quality gene assembly directly from unpurified mixtures of microassay synthesized oligonucleotides. Nucleic Acid Research, 38(19):e180, 10 pages, 2010.
Brunet, Aims and methods of biosteganography. Journal of Biotechnology, 226:56-64, 2016.
Buermans et al., “Next Generation sequencing technology: Advances and applications,” Biochimica et Biophysica Acta (BBA)—Molecular Basis of Disease, 1842:1931-1941, 2014.
Butler, et al. In situ synthesis of oligonucleotide arrays by using surface tension. J Am Chem Soc. 123(37):8887-94, 2001.
Calvert, Lithographically patterned self-assembled films. In: Organic Thin Films and Surfaces: Directions for The Nineties, Vvol. 20, p. 109, ed. by Abraham Ulman, San Diego: Academic Press, 1995.
Cardelli, Two-Domain DNA Strand Displacement, Electron. Proc. Theor. Comput. Sci., 26:47-61, 2010.
Carlson, “Time for New DNA Synthesis and Sequencing Cost Curves,” 2014. [Online]. Available: http://www.synthesis.cc/synthesis/2014/02/time_for_new_cost_curves_2014. 10 pages.
Carr, et al. Protein-mediated error correction for de novo DNA synthesis. Nucleic Acids Res. 32(20):e162, 9 pages, 2004.
Caruthers, Chemical synthesis of deoxyoligonucleotides by the phosphoramidite method. In Methods in Enzymology, Chapter 15, 154:287-313, 1987.
Caruthers. Gene synthesis machines: DNA chemistry and its uses. Science. 230(4723):281-5, 1985.
Caruthers, The Chemical Synthesis of DNA/RNA: Our Gift to Science. J. Biol. Chem., 288(2):1420-1427, 2013.
Casmiro, Danilo R. et al., “PCR-based gene synthesis and protein NMR spectroscopy”, Structure, 5(11):1407-1412, 1997.
Cello, et al. Chemical synthesis of poliovirus cDNA: generation of infectious virus in the absence of natural template. Science. 297(5583):1016-8, 2000.
Chalmers, et al. Scaling up the ligase chain reaction-based approach to gene synthesis. Biotechniques. 30(2):249-52, 2001.
Chan, et al. Natural and engineered nicking endonucleases—from cleavage mechanism to engineering of strand-specificity. Nucleic Acids Res. 39(1):1-18, 2011.
Chen, et al. Chemical modification of gene silencing oligonucleotides for drug discovery and development. Drug Discov Today. 10(8):587-93 2005.
Chen et al., Programmable chemical controllers made from DNA, Nat. Nanotechnol., 8(10):755-762, 2013.
Cheng, et al. High throughput parallel synthesis of oligonucleotides with 1536 channel synthesizer. Nucleic Acids Res. 30(18):e93, 2002.
Cho, et al. Capillary passive valve in microfluidic systems. NSTl-Nanotech. 2004; 1:263-266.
Chrisey et al., Fabrication of patterned DNA surfaces Nucleic Acids Research, 24(15):3040-3047 (1996).
Chung et al., One-step preparation of competentEscherichia coli:Transformation and storage of bacterial cells in the same solution. Proc Natl Acad Sci U S A. Apr. 1989;86(7):2172-2175.
Church et al., Next-generation digital information storage in DNA. Science, 337:6102, 1628-1629, 2012.
Cleary et al., “Production of complex nucleic acid libraries using highly parallel n s tu oligonucleotide synthesis,” Nature Methods, 1(13):241-248, 2004.
Cohen et al., Human population: The next half century. Science, 302:1172-1175, 2003.
Crick. On protein synthesis. Symp Soc Exp Biol12:138-163,1958.
Cutler, David J. et al., “High-throughput variation detection and genotyping using microarrays”, Genome Research, vol. 11, 1913-19 (2001 ).
Dahl, et al. Circle-to-circle amplification for precise and sensitive DNA analysis. Proc Natl Acad Sci U S A. Mar. 30, 2004;101(13):4548-53. Epub Mar. 15, 2004.
De Mesmaeker, et al. Backbone modifications in oligonucleotides and peptide nucleic acid systems. Curr Opin Struct Biol. Jun. 1995;5(3):343-55.
Deamer, David W. et al., “Characterization of nucleic acids by nanopore analysis”, Ace. Cham. Res., vol. 35, No. 10, 817-825 (2002).
Deaven, The Human Genome Project: Recombinant clones for mapping and sequencing DNA. Los Alamos Science, 20:218-249, 1992.
Deng et al., Targeted bisulfite sequencing reveals changes in DNA methylation associated with nuclear reprogramming Nature Biotechnology, 27:352-360 (2009).
Dietrich, Rudiger.et al., “Gene assembly based on blunt-ended double-stranded DNA-modules”, Biotechnology Techniques, vol. 12, No. 1, 49-54 (Jan. 1998).
Dormitzer et al., Synthetic generation of influenza vaccine viruses for rapid response to pandemics. Sci Translational Medicine, 5(185):185ra68, 14 pages, 2013.
Doudna et al. Genome editing. The new frontier ofgenome engineering with CRISPR-Cas9. Science 346(6213):1258096-1-1258096-9, 2014.
Dower et al., High efficiency transformation of E. coli by high voltage electroporation. Nucleic Acids Res. 16(13):6127-45 (1988).
Dressman, et al. Transforming single DNA molecules into fluorescent magnetic particles for detection and enumeration of genetic variations. Proc Natl Acad Sci U S A. Jul. 22, 2003;100(15):8817-22. Epub Jul. 11, 2003.
Drmanac, et al. Human genome sequencing using unchained base reads on self-assembling DNA nanoarrays. Science. Jan. 1, 2010;327(5961):78-81.doi: 10.1126/science.1181498. Epub Nov. 5, 2009.
Droege and Hill, The Genome Sequencer FLXTM System-Longer reads, more applications, straight forward bioinformatics and more complete data sets Journal of Biotechnology, 136:3-10, 2008.
Duffy, et al. Rapid Prototyping of Microfluidic Systems in Poly(dimethylsiloxane). Anal Chem. Dec. 1, 1998;70(23):4974-84. doi: 10.1021/a0980656z.
Duggan, et al. Expression profiling using cDNA microarrays. Nat Genet. Jan. 1999;21(1 Suppl):10-4.
Eadie, et al. Guanine modification during chemical DNA synthesis. Nucleic Acids Res. Oct. 26, 1987;15(20):8333-49.
Eisen, Jonathan A., “A phylogenomic study of the MutS family of proteins”, Nucleic Acids Research, vol. 26, No. 18, 4291-4300 (1998).
Ellis, et al. DNA assembly for synthetic biology: from parts to pathways and beyond. Integr Biol (Camb). Feb. 2011;3(2):109-18. doi: 10.1039/00ib00070a. Epub Jan. 19, 2011.
El-Sagheer, et al. Biocompatible artificial DNA linkerthat is read through by DNA polymerases and is functional in Escherichia coli. Proc Natl Acad Sci U S A. Jul. 12, 2011;108(28):11338-43. doi:10.1073/pnas.1101519108. Epub Jun. 27, 2011.
Elsik et al., The Genome sequence of taurine cattle: A window of ruminant biology and evolution. Science, 324:522-528, 2009.
Elsner et al., 172 nm excimer VUV-triggered photodegradation and micropatterning of aminosilane films, Thin Solid Films, 517:6772-6776 (2009).
Engler, et al. A one pot, one step, precision cloning method with high throughput capability. PLoS One. 2008;3(11):e3647. doi: 10.1371/journal.pone.0003647. Epub Nov. 5, 2008.
Engler, et al. Golden gate shuffling: a one-pot DNA shuffling method based on type IIs restriction enzymes. PLoS One. 2009;4(5):e5553. doi: 10.1371/journal.pone.0005553. Epub May 14, 2009.
Erlich and Zielinski, DNA fountain enables a robust and efficient storage architecture. Science, 355(6328):950-054, 2017.
European Patent Application No. 14834665.3 extended European Search Report dated Apr. 28, 2017.
Evans et al., DNA Repair Enzymes. Current Protocols in Molecular Biology 84:III:3.9:3.9.1-3.9.12 http://www.ncbi.nlm.nih.gov/pubmed/18972391 (Published online Oct. 1, 2008 Abstract only provided.
Fahy, et al. Self-sustained sequence replication (3SR): an isothermal transcription-based amplification system alternative to PCR. PCR Methods Appl. Aug. 1991;1(1):25-33.
Fedoryak, Olesya D. et al., “Brominated hydroxyquinoline as a photolabile protecting group with sensitivity to multiphoton excitation”, Org. Lett., vol. 4, No. 2 , 3419-3422 (2002).
Ferretti et al., Total synthesis of a gene for bovine rhodopsin. PNAS, 83:599-603 (1986).
Finger et al., The wonders of Flap Endonucleases: Structure, function, mechanism and regulation. Subcell Biochem., 62:301-326, 2012.
Fodor et al. “Light-Directed, Spatially Addressable Parallel Chemical Synthesis,” Science, 251(4995):767-773, 1991.
Fogg et al., Structural basis for uracil recognition by archaeal family B DNA polymerases. Nature Structural Biology, 9(12):922-927, 2002.
Foldesi, et al. The synthesis of deuterionucleosides. Nucleosides Nucleotides Nucleic Acids. Oct.-Dec. 2000;19(10-12):1615-56.
Frandsen, et al. Efficient four fragment cloning forthe construction of vectors for targeted gene replacement in filamentous fungi. BMC Molecular Biology 2008, 9:70.
Frandsen. Experimental setup. Dec. 7, 2010, 3 pages. http://www.rasmusfrandsen.dk/experimental_setup.htm.
Frandsen. The User Friendly technology. User cloning. Oct. 7, 2010, 2 pages. http://www.rasmusfrandsen.dk/user_cloning.htm.
Fullwood et al., Next-generation DNA sequencing of paired-end tags [PET] for transcriptome and genome analysis Genome Research, 19:521-532, 2009.
Galneder. et al., Microelectrophoresis of a bilayer-coated silica bead in an optical trap: application to enzymology. Biophysical Journal, vol. 80, No. 5, 2298-2309 (May 2001).
Gao, et al. A flexible light-directed DNA chip synthesis gated by deprotection using solution photogenerated acids. Nucleic Acids Res. Nov. 15, 2001;29(22):4744-50.
Gao, et al. Thermodynamically balanced inside-out (TBIO) PCR-based gene synthesis: a novel method of primer design for high-fidelity assembly of longer gene sequences. Nucleic Acids Res. Nov. 15, 2003;31(22):e143.
Garaj, et al. Graphene as a subnanometre trans-electrode membrane. Nature. Sep. 9, 2010;467(7312):190-3. doi: 10.1038/nature09379.
Garbow, Norbert et al., “Optical tweezing electroghoresis of isolated, highly charged colloidal spheres”, Colloids and Surfaces A: Physiochem. Eng. Aspects, vol. 195, 227-241 (2001).
GeneArt Seamless Cloning and Assembly Kits. Life Technologies Synthetic Biology. 8 pages, available online Jun. 15, 2012.
Genomics 101. An Introduction to the Genomic Workflow. 2016 edition, 64 pages. Available at: http://www.frontlinegenomics.com/magazine/6757/genomics-101/.
Geu-Flores, et al. User fusion: a rapid and efficient method for simultaneous fusion and cloning of multiple PCR products. Nucleic Acids Res. 2007;35(7):e55. Epub Mar. 27, 2007.
Gibson Assembly. Product Listing. Application Overview. 2 pages, available online Dec. 16, 2014.
Gibson, et al. Complete chemical synthesis, assembly, and cloning of a Mycoplasma genitalium genome. Science. Feb. 29, 2008;319(5867):1215-20. doi: 10.1126/science.1151721. Epub Jan. 24, 2008.
Goldman et al., Towards practical, high-capacity, low-maintenance information storage in synthesized DNA, Nature, 494(7435):77-80, 2013.
Gosse, Charlie et al. “Magnetic tweezers: micromanipulation and force measurement at the molecular level”, Biophysical Journal, vol. 8, 3314-3329 (Jun. 2002).
Grass, et al., Robust chemical preservation ofdigital information on DNA in silica with error-correcting codes, Angew. Chemie—Int. Ed., 54(8):2552-2555, 2015.
Greagg et al., A read-ahead function in archaeal DNA polymerases detects promutagenic template-strand uracil. Proc. Nat. Acad. Sci. USA, 96:9045-9050, 1999.
Grovenor. Microelectronic materials. Graduate Student Series in Materials Science and Engineering. Bristol, England: Adam Hilger, 1989; p. 113-123.
Gu et al., Depletion of abundant sequences by hybridization (DASH): using Cas9 to remove unwanted high-abundance species in sequencing libraries and molecular counting applications. Genome Biology, 17:41, 13 pages, 2016.
Haber, Charbel et al., Magnetic tweezers for DNA micromanipulation, Rev. Sci. lnstrum., vol. 71, No. 12, 4561-4570 (Dec. 2000).
Hanahan and Cold Spring Harbor Laboratory, Studies on transformation of Escherichia coli with plasmids J. Mol. Biol. 166:557-580 (1983).
Hanahan et al., Plasmid transformation of Escherichia coli and other bacteria. Methods Enzymol, vol. 204, p. 63-113 (1991).
Harada, et al. Unexpected substrate specificity of T4 DNA ligase revealed by in vitro selection. Nucleic Acids Res. May 25, 1993;21(10):2287-91.
Heckers Karl H. et al., “Error analysis of chemically synthesized polynucleotides”, BioTechniques, vol. 24, No. 2, 256-260 (1998).
Herzer et al.: Fabrication of patterned silane based self-assembled monolayers by photolithography and surface reactions on silicon-oxide substrates Chem. Commun., 46:5634-5652 (2010).
Hoover et al., “DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis”, Nucleic Acids Research, vol. 30, No. 10, e43, 7 pages (2002).
Hosu, Basarab G. et al., Magnetic tweezers for intracellular applications⋅, Rev. Sci. Instrum., vol. 74, No. 9, 4158-4163 (Sep. 2003).
Huang, Hayden et al., “Three-dimensional cellular deformation analysis with a two-photon magnetic manipulator workstation”, Biophysical Journal, vol. 82, No. 4, 2211-2223 (Apr. 2002).
Hughes, et al. Expression profiling using microarrays fabricated by an ink-jet oligonucleotide synthesizer. Nat Biotechnol. Apr. 2001;19(4):342-7.
Hughes et al. Principles of early drug discovery. Br J Pharmacol 162(2):1239-1249, 2011.
Hutchison, et al. Cell-free cloning using phi29 DNA polymerase. Proc Natl Acad Sci U S A. Nov. 29, 2005;102(48):17332-6. Epub Nov. 14, 2005.
In-Fusion Cloning: Accuracy, Not Background. Cloning & Competent Cells, ClonTech Laboratories, 3 pages, available online Jul. 6, 2014.
Jackson, Brian A. et al., “Recognition of DNA base mismatches by a rhodium intercalator”, J. Am. Chem. Soc., vol. 19, 12986-12987 (1997).
Jacobs and Schar, DNA glycosylases: ln DNA repair and beyond Chromosome, 121:1-20 (2012)—http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3260424/.
Jinek et al., A Programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 337:816-821, 2012.
Karagiannis and Ei-Osta, RNA interference and potential therapeutic applications of short interfering RNAs Cancer Gene Therapy, 12:787-795, 2005.
Ke, Song-Hua et al., “Influence of neighboring base pairs on the stability of single base bulges and base pairs in a DNA fragment”, Biochemistry, Vo. 34, 4593-4600 (1995).
Kelley, Shana, et al. Single-base mismatch detection based on charge transduction through DNA, Nucleic Acids Research, vol. 27, No. 24, 4830-4837 (1999).
Kim et al., High-resolution patterns ofquantum dots formed by electrohydrodynamic jet printing for light-emitting diodes. Nano Letters, 15:969-973, 2015.
Kim, Yang-Gyun et al., “Chimeric restriction endonuclease”, Proc. Natl. Acad. Sci. USA, vol. 91, 883-887 (Feb. 1994).
Kim, Yang-Gyun, “The interaction between Z-ONA and the Zab domain of double-stranded RNA adenosine deaminase characterized using fusion nucleases”, The Journal of Biological Chemistry, vol. 274, No. 27, 19081-19086 (1999).
Kim, Yan˜Gyun et al., “Site-specific cleavage of DNA-RNA hybrids by zinc finger/Fok I cleavage domain fusions” Gene, vol. 203, 43-49 (1997).
Kinde, et al. Detection and quantification of rare mutations with massively parallel sequencing. Proc Natl Acad Sci U S A. Jun. 7, 2011;108(23):9530-5. doi: 10.1073/pnas.1105422108. Epub May 17, 2011
Kodumal, et al. Total synthesis of long DNA sequences: synthesis of a contiguous 32-kb polyketide synthase gene cluster. Proc Natl Acad Sci U S A. Nov. 2, 2004;101(44):15573-8. Epub Oct. 20, 2004.
Koike-Yusa et al., Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nature Biotechnology, 32:267-273, 2014 (with three pages of supplemental “Online Methods”) .
Kong et al., Parallel gene synthesis in a microfluidic device. Nucleic Acids Res., 35(8):e61 (2007).
Kong. Microfluidic Gene Synthesis. MIT Thesis. Submitted to the program in Media Arts and Sciences, School of Architecture and Planning, in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Media Arts and Sciences at the Massachusetts Institute of Technology. 143 pages Jun. 2008.
Kopp, Martin U. et al., “Chemical amplification: continuous-flow PCR on a chip”, Science, vol. 280, 1046-1048 (May 15, 1998).
Kosuri and Church, “Large-scale de novo DNA synthesis: technologies and applications,” Nature Methods, 11:499-507, 2014. Available at: http://www.nature.com/nmeth/journal/v11/n5/full/nmeth.2918.html.
Kosuri, et al. A scalable gene synthesis by selective amplification of DNA pools from high-fidelity microchips. Nature Biotechnology. 2010; 28:1295-1299.
Krayden, Inc., A Guide to Silane Solutions. Silane coupling agents. 7 pages. Published on May 31, 2005 at: http://krayden.com/pdf/xia_silane_chemistry.pdf.
Lagally, E.T. et al., “Single-molecule DNA amplification and analysis in an integrated microfluidic device” Anal. Chem., vol. 73, No. , 565-570 (Feb. 1, 2001).
Lahue, R.S. et al., “DNA mismatch correction in a defined system”, Science, vol. 425; No. 4914, 160-164 (Jul. 14, 1989).
Lambrinakos, A. et al., “Reactivity of potassium permanganate and tetraethylammonium chloride with mismatched bases and a simple mutation detection protocol”,Nucleic Acids Research, vol. 27, No.8, 1866-1874 (1999).
Landegren, et al. A ligase-mediated gene detection technique. Science. Aug. 26, 1988;241(4869):1077-80.
Lang, Matthew J. et al., “An automated two-dimensional optical force clamp for single molecule studies”, Biophysical Journal, vol. 83, 491-501 (Jul. 2002).
Lashkari, et al. An automated multiplex oligonucleotide synthesizer: development of high-throughput, low-cost DNA synthesis. Proc Natl Acad Sci U S A. Aug. 15, 1995;92(17):7912-5.
Lausted et al., “POSaM: a fast, flexible, open-source, inkjet oligonucleotide synthesizer and microarrayer,” Genome Biology, 5:R58, 17 pages, 2004. available at https://www.ncbi.nlm.nih.gov/pmc/articles/PMC507883/.
Leamon, et al. A massively parallel PicoTiterPlate based platform for discrete picoliter-scale polymerase chain reactions. Electrophoresis. Nov. 2003;24(21):3769-77.
Lee, Covalent end-immobilization of oligonucleotides onto solid surfaces. Thesis submitted to the Department of Chemical Engineering in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in Chemical Engineering at the Massachusetts Institute of Technology. Aug. 2001, 315 pages.
Lee, C.S. et al., “Microelectromagnets forthe control of magnetic nanoparticles”, Appl. Phys. Lett., vol. 79, No. 20, 3308-3310 (Nov. 12, 2001).
Lee, et al. A microfluidic oligonucleotide synthesizer. Nucleic Acids Research 2010 vol. 38(8):2514-2521. DOI: 10.1093/nar/gkq092.
Leproust, et al. Agilent's Microarray Platform: How High-Fidelity DNA Synthesis Maximizes the Dynamic Range of Gene Expression Measurements. 2008; 1-12. http://www.miltenyibiotec.com/˜/media/Files/Navigation/Genomic%20Services/Agilent_DNA_Microarray_Platform.ashx.
Leproust et al., “Synthesis of high-quality libraries of long (150mer) oligonucleotides by a novel depurination controlled process,” Nucleic Acids Research, 35(8):2522-2540, 2010.
Lesnikowski, et al. Nucleic acids and nucleosides containing carboranes. J. Organometallic Chem. 1999; 581:156-169.
Leumann. DNA analogues: from supramolecular principles to biological properties. Bioorg Med Chem. Apr. 2002;10(4):841-54.
Levene, et al. Zero-mode waveguides for single-molecule analysis at high concentrations. Science. Jan. 31, 2003;299(5607):682-6.
Lewontin and Harti, Population genetics in forensic DNA typing. Science, 254:1745-1750, 1991.
Limbachiya et al., Natural data storage: A review on sending information from now to then via Nature. ACM Journal on Emerging Technologies in Computing Systems, V(N):Article A, May 19, 2015, 17 pages.
Link Technologies. “Product Guide 2010.” Nov. 27, 2009, 136 pages. XP055353191. Retrieved from the Internet: URL:http://www.linktech.co.uk/documents/517/517.pdf.
Lipshutz, Robert J. et al., “High density synthetic oligonucleotide arrays”, Nature Genetics Supplement, vol. 21, 20-24 (Jan. 1999).
Lishanski, Alia et al., “Mutation detection by mismatch binding protein, MutS, in amplified DNA: application to the cystic fibrosis gene”, Proc. Natl. Acad. Sci. USA, vol. 91, 2674-2678 (Mar. 1994).
Liu et al., Comparison of Next-Generation Sequencing Systems. Journal of Biomedicine and Biotechnology, 11 pages, 2012.
Liu, et al. Enhanced Signals and Fast Nucleic Acid Hybridization by Microfluidic Chaotic Mixing. Angew. Chem. Int. Ed. 2006; 45:3618-3623.
Liu et al., Rational design of CXCR4 specific antibodies with elongated CDRs. JACS, 136:10557-10560, 2014.
Lizardi, et al. Mutation detection and single-molecule counting using isothermal rolling-circle amplification. Nat Genet. Jul. 1998;19(3):225-32.
Li, Lin et al., “Functional domains in Fok I restriction endonuclease”, Proc. Natl. Acad. Sci. USA, 89:4275-4279, 1992.
Lu, A.-Lien et al., “Methyl-directed repair of DNA base-pair mismatches in vitro”, Proc. Natl. Acad. Sci. USA, 80:4639-4643, 1983.
Lund, et al. A validated system for ligation-free uracilexcision based assembly of expression vectors for mammalian cell engineering. DTU Systems of Biology. 2011. 1 page. http://www.lepublicsystemepco.com/files/modules/gestion_rubriques/REF-B036-Lund_Anne%20Mathilde.pdf.
Ma, et al. DNA synthesis, assembly and application in synthetic biology. Current Opinion in Chemical Biology. 16:260-267, 2012.
Ma et al., Versatile surface functionalization of cyclic olefin copolymer (COC) with sputtered Si02 thin film for potential BioMEMS applications. Journal of Materials Chemistry, 11 pages, 2009.
Mahato et al., Modulation of gene expression by antisense and antigene oligodeoxynucleotides and small interfering RNA Expert Opin. Drug Delivery, 2(1):3-28, 2005.
Margulies, et al. Genome sequencing in open microfabricated high-density picolitre reactors. Nature. 437(7057):376-80, 2005.
Matteucci, et al. Synthesis of deoxyoligonucleotides on a polymer support. J. Am. Chem. Soc. 103(11):3185-3191, 1981.
Matzas et al., Next generation gene synthesis by targeted retrieval of bead-immobilized, sequence verified DNA clones from a high throughput pyrosequencing device. Nat. Biotechnol., 28(12):1291-1294, 2010.
McBride & Caruthers, “An investigation of several deoxynucleoside phosphoramidites useful for synthesizing deoxyoligonucleotides.” Tetrahedron Lett. 24: 245-248, 1983.
McGall, et al. Light-directed synthesis of high-density oligonucleotide arrays using semiconductor photoresists. Proc Natl Acad Sci U S A. 93(24):13555-60, 1996.
McGall, et al. The Efficiency of Light-Directed Synthesis of DNA Arrays on Glass Substrates. J. Am. Chem. Soc. 119(22):5081-5090, 1997.
Mei et al., Cell-free protein synthesis in microfluidic array devices Biotechnol. Prog., 23(6):1305-1311, 2007.
Mendel-Hartvig. Padlock probes and rolling circle amplification. New possibilities for sensitive gene detection. Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 1175. Uppsala University. 2002, 39 pages. http://www.diva-portal.org/smash/get/diva2:161926/FULLTEXT01.pdf.
Meyers and Friedland, Knowledge-based simulation of genetic regulation in bacteriophage lambda. Nucl. Acids Research, 12(1):1-16, 1984.
Milo and Phillips, Numbers here reflect the number of protein coding genes and excludes tRNA and non-coding RNA. Cell Biology by the Numbers, p. 286, 2015.
Mitra, et al. In situ localized amplification and contact replication of many individual DNA molecules. Nucleic Acids Res. 27(24):e34, 1999.
Morin et al., Profiling the HeLa S3 transcriptome using randomly primed cDNA and massively parallel short-read sequencing. Biotechniques, 45:81-94, 2008.
Morris and Stauss, Optimizing T-cell receptor gene therapy for hematologic malignancies. Blood, 127(26):3305-3311, 2016.
Muller, Caroline et al. “Protection and labelling of thymidine by a fluorescent photolabile group”, Helvetica Chimica Acta, vol. 84, 3735-3741 (2001).
Nakatani, Kazuhiko et al., “Recognition of a single guanine bulge by 2-Acylamino-1 ,8-naphthyridine”, J. Am. Chem. Soc., vol. 122, 2172-2177 (2000).
Neiman M.S,. Negentropy principle in information processing systems. Radiotekhnika, 1966, No. 11, p. 2-9 .
Neiman M.S., On the bases ofthe theory of information retrieval. Radiotekhnika, 1967, No. 5, p. 2-10.
Neiman M.S., On the molecular memory systems and the directed mutations. Radiotekhnika, 1965, No. 6, pp. 1-8.
Neiman M.S., On the relationships between the reliability, performance and degree of microminiaturization at the molecular-atomic level. Radiotekhnika, 1965, No. 1, pp. 1-9.
Neiman M.S., Some fundamental issues of microminiaturization. Radiotekhnika, 1964, No. 1, pp. 3-12.
Nishikura, A short primer on RNAi: RNA-directed RNA polymerase acts as a key catalyst Cell, 107:415-418, 2001.
Nour-Eldin, et al. User Cloning and User Fusion: The Ideal Cloning Techniques for Small and Big Laboratories. Plant Secondary Metabolism Engineering. Methods in Molecular Biology vol. 643, 2010, pp. 185-200.
Ochman, et al. Genetic applications of an inverse polymerase chain reaction. Genetics. Nov. 1988;120(3):621-3.
Organick et al., Random access in large-scale DNA data storage. Nature Biotechnology, Advance Online Publication, 8 pages, 2018.
Organick et al., Scaling up DNA data storage and random access retrieval, bioRxiv, preprint first posted online Mar. 7, 2017, 14 pages.
Pan, et al. An approach for global scanning of single nucleotide variations. Proc Natl Acad Sci U S A. Jul. 9, 2002;99(14):9346-51.
Pankiewicz. Fluorinated nucleosides. Carbohydr Res. Jul. 10, 2000;327(1-2):87-105.
PCT/US14/049834 International Preliminary Report on Patentability dated Feb. 18, 2016.
PCT/US2014/049834 International Search Report and Written Opinion dated Mar. 19, 2015.
PCT/US2014/049834, “Invitation to Pay Additional Fees and, where applicable, protest fee,” dated Jan. 5, 2015.
PCT/US2015/043605 International Preliminary Report on Patentability dated Feb. 16, 2017.
PCT/US2015/043605 International Search Report and Written Opinion dated Jan. 6, 2016.
PCT/US2015/043605 Invitation to Pay Additional Fees dated Oct. 28, 2015.
PCT/US2016/016459 International Preliminary Report on Patentability dated Aug. 17, 2017.
PCT/US2016/016459 International Search Report and Written Opinion dated Apr. 18, 2016.
PCT/US2016/016636 International Preliminary Report on Patentability dated Aug. 17, 2017.
PCT/US2016/016636 International Search Report and Written Opinion dated May 2, 2016.
PCT/US2016/028699 International Preliminary Report on Patentability dated Nov. 2, 2017.
PCT/US2016/028699 International Search Report and Written Opinion dated Jul. 29, 2016.
PCT/US2016/031874 International Preliminary Report on Patentability dated Nov. 23, 2017.
PCT/US2016/031674 International Search Report and Written Opinion dated Aug. 11, 2016.
PCT/US2016/052336 International Search Report and Written Opinion dated Dec. 7, 2016.
PCT/US2016/052916 International Search Report and Written Opinion dated Dec. 30, 2016.
PCT/US2016/064270 International Search Report and Written Opinion dated Apr. 28, 2017.
PCT/US2017/026232 International Search Report and Written Opinion dated Aug. 28, 2017.
PCT/US2017/036868 International Search Report and Written Opinion dated Aug. 11, 2017.
PCT/US2017/045105 International Search Report and Written Opinion dated Oct. 20, 2017.
PCT/US2017/052305 International Search Report and Written Opinion dated Feb. 2, 2018.
Pease, et al. Light-generated oligonucleotide arrays tor rapid DNA sequence analysis. Proc Natl Acad Sci U S A. May 24, 1994;91(11):5022-6.
Peisajovich, et al. BBF RFC 28; A method for combinatorial muiti-part assembly based on the type-lis restriction enzyme aarl. Sep. 16, 2009, 7 pages.
Pellois, et al. “Individually addressable parallel peptide synthesis on microchips”. Nature Biotechnology, vol. 20 , 922-926 (Sep. 2002).
Petersen, et al. LNA: a versatile fool for therapeufics and genomics. Trends Biotechnol. Feb. 2003;21(2):74-81.
Pierce and Wangh, Linear-after-the-exponential polymerase chain reaction and allied technologies Real-time detection strategies for rapid, reliable diagnosis from single cells Methods Mol. Med. 132:65-85 (2007) (Abstract only).
Pirrung. How to make a DNA chip. Angew. Chem. Int. Ed., 41:1278-1289, 2002.
Plesa et al., Multiplexed gene synthesis in emulsions for exploring protein functional landscapes. Science, 10.1126/science.aa05167, 10 pages, 2018.
Pon. Solid-phase supports for oligonucleotide synthesis. Methods Mol Biol. 1993;20:465-96.
Poster. Reimagine Genome Scale Research. 2016, 1 page. Available at http://www2.twistbioscience.com/Oligo_Pools_CRlSPR_poster.
Powers et al. Optimal strategies forthe chemical and enzymatic synthesis of bihelical deoxyribonucleic acids. J Am Chem Soc., 97(4):875-884, 1975.
Pray. “Discovery of DNA Structure and Function: Watson and Crick,” Nature Education, 2008, 6 pages. available at: http://www.nature.com/scitable/topicpage/discovery-of-dna-structure-and-function-watson-397.
Prodromou, et al. Recursive PCR: a novel technique fortotal gene synthesis. Protein Eng. Dec. 1992;5(8):827-9.
Qian and Winfree, Scaling up digital circuit computation with DNA strand displacement cascades. Science, 332(6034):196-1201, 2011.
Qian, et al., Neural network computation with DNA strand displacement cascades, Nature, 475(7356):368-372, 2011.
Quan et al., “Parallel on-chip gene synthesis and application to optimization of protein expression,” Nature Biotechnology, 29(5):449-452, 2011.
Rafalski and Morgante, Corn and humans: recombination and linkage disequilibrium in two genomes of similar size. Trends in Genetics, 20(2):103-111, 2004.
Raje and Murma, A Review of electrohydrodynamic-inkjet printing technology. International Journal of Emerging Technology and Advanced Engineering, 4(5):174-183, 2014.
Rastegari, et al., XNOR-Net: ImageNet Classification Using Binary Convolutional Neural Networks, in ECCV 2016, Part IV, LNCS 9908, p. 525-542, 2016.
Reimagine SequenceSpace, Reimagine Research, Twist Bioscience, Product Brochure, Published Apr. 6, 2016 online at: www2.twistbioscience.com/TB_Product_Brochure_04.2016, 8 pages.
RF Electric discharge type excimer lamp. Products Catalog. Excimer lamp light source “flat excimer,” 16 pages dated Jan. 2016. From: http://www.hamamatsu.com/jp/en/product/category/1001/3026/index.html.
Richmond, et al. Amplification and assembly of chip-eluted DNA (AACED): a method for high-throughput gene synthesis. Nucleic Acids Res. Sep. 24, 2004;32(17):5011-8. Print 2004.
Roche. Restriction Enzymes from Roche Applied Science-A Tradition of Premium Quality and Scientific Support. FAQS and Ordering Guide. Roche Applied Science. Accessed Jan. 12, 2015, 37 pages.
Rogozin et al., Origin and evolution of spliceosomal introns. Biology Direct, 7:11, 2012.
Ruminy, et al., “Long-range identification of hepatocyte nuclear factor-3 (FoxA) high and low-affinity binding Sites with a chimeric nuclease”, J. Mol. Bioi., vol. 310, 523-535 (2001).
Saaem et al., In situ synthesis of DNA microarray on functionalized cyclic olefin copolymer substrate ACS Applied Materials & Interfaces, 2(2):491-497, 2010.
Saboulard, et al. High-throughput site-directed mutagenesis using oligonucleotides synthesized on DNA chips. Biotechniques. Sep. 2005;39(3):363-8.
Sacconi, L. et al., Three-dimensional magneto-optic trap for micro-object manipulation, Optics Letters, vol. 26, No. 17, 1359-1361 (Sep. 1, 2001).
Saiki et al. Analysis of enzymatically amplified beta-globin and HLA-DQ alpha DNA with allele-specific oligonucleotide probes. Nature 324:163-166 (1986).
Sandhu, et al. Dual asymmetric PCR: one-step construction of synthetic genes. Biotechniques. Jan. 1992;12(1):14-6.
Sargolzaei et al., Extent of linkage disequilibrium in Holstein cattle in North America. J.Dairy Science, 91:2106-2117, 2007.
Schaller, et al. Studies on Polynucleotides. XXV.1 The Stepwise Synthesis of Specific Deoxyribopolynucleotides (5). Further Studies on the Synthesis of Internucleotide Bond by the Carbodiimide Method. The Synthesis of Suitably Protected Dinucleotides as Intermediates in the Synthesis of Higher Oligonucleotides. J. Am. Chem. Soc. 1963; 85(23):3828-3835.
Schmalzing et al. Microchip electrophoresis: a method for high-speed SNP detection. Nucleic Acids Res 28(9):E43 (2000).
Schmitt et al., New strategies in engineering T-cell receptor gene-modified T cells to more effectively target malignancies. Clinical Cancer Research, 21(23):5191-5197, 2015.
Seelig, et al., Enzyme-Free Nucleic Acid Logic Circuits, Science 314(5805):1585-1588, 2006.
Sharpe and Mount, Genetically modified T cells in cancertherapy: opportunities and challenges. Disease Models and Mechanisms, 8:337-350, 2015.
Sierzchala, Agnieszka B. et al., “Solid-phase oligodeoxynucleotide synthesis : a two-step cycle using peroxy anion eprotection”, J. Am. Chem. Soc., vol. 125, No. 44, 13427-13441 (2003).
Simonyan and Zisserman, Very Deep Convolutional Networks for Large-Scale Image Recognition, Published as a conference paper at Int. Conf. Learn. Represent., pp. 1-14, 2015.
Singh-Gasson, Sangeet et al., Maskless fabrication of light-directed olxyonucleotide microarrays using a digital micromirror array, Nature Biotechnology, vol. 17, 974-978 (Oct. 1999).
Smith, et al. Generating a synthetic genome by whole genome assembly: phiX174 bacteriophage from synthetic oligonucleotides. Proc Natl Acad Sci U S A. Dec. 23, 2003;100(26):15440-5. Epub Dec. 2, 2003.
Smith, et al. Generation of cohesive ends on PCR products by UDG-mediated excision of dU, and application for cloning into restriction digest-linearized vectors. PCR Methods Appl. May 1993;2(4):328-32.
Smith, Jane et al., “Mutation detection with MutH, MutL, and MutS mismatch repair proteins”, Proc. Natl. Acad. Sci. USA, vol. 93, 4374-4379 (Apr. 1996).
Smith Jane et al., “Removal of Polymerase-Produced mutant sequences from PCR products”, Proc. Natl. Acad. Sci. USA, vol. 94, 6847-6850 (Jun. 1997).
Smith, Steven B. et al., “Direct mechanical measurements of the elasticity of single DNA molecules using magnetic beads”, Science, vol. 258, 1122-1126 (Nov. 13, 1992).
Soni, et al. Progress toward ultrafast DNA sequencing using solid-state nanopores. Clin Chem. Nov. 2007;53(11):1996-2001.
Southern, et al. Analyzing and comparing nucleic acid sequences by hybridization to arrays of oligonucleotides: evaluation using experimental models. Genomics. Aug. 1992;13(4):1008-17.
Sproat, et al. An efficient method forthe isolation and purification of oligoribonucleotides. Nucleosides & Nucleotides. 1995; 14(1&2):255-273.
Srivannavit et al., Design and fabrication of microwell array chips for a solution-based, photogenerated acid-catalyzed parallel oligonuclotide DNA synthesis. Sensors and Actuators A, 116:150-160, 2004.
Srivastava et al., “RNA synthesis: phosphoramidites for RNA synthesis in the reverse direction. Highly efficient synthesis and application to convenient introduction of ligands, chromophores and modifications of synthetic RNA at the 3′-end”, Nucleic Acids Symposium Series, 52(1):103-104, 2008.
Steel, The Flow-Thru Chip A Three-dimensional biochip platform. In: Schena, Microarray Biochip Technology, Chapter 5, Natick, MA: Eaton Publishing, 2000, 33 pages.
Stemmer, et al. Single-step assembly of a gene and entire plasmid from large numbers of oligodeoxyribonucleotides. Gene. Oct. 16, 1995;164(1):49-53.
Stryer. “DNA Probes and genes can be synthesized by automated solid-phase methods.” Biochemistry, 3rd edition, New York: W.H. Freeman and Company, 1988; 123-125.
Stutz, et al. Novel fluoride-labile nucleobase-protecting groups for the synthesis of 3′(2′)-O-amino-acylated RNA sequences. Helv. Chim. Acta. 2000; 83(9):2477-2503.
Takahashi, Cell-free cloning using multiply-primed rolling circle amplification with modified RNA primers. Biotechniques. Jul. 2009;47(1):609-15.
Tanase, M. et al., “Magnetic trapping of multicomponent nanowires”, The Johns Hopkins University, Baltimore, Maryland, p. 1-3 (Jun. 25, 2001).
Taylor et al., Impact of surface chemistry and blocking strategies on DNA microarrays. Nucleic Acids Research, 31(16):e87, 19 pages, 2003.
The Hood Laboratory, “Beta Group.” Assembly Manual forthe POSaM: The ISB Piezoelelctr Oligonucleotide Synthesizer and Microarrayer, lnkjet Microarrayer Manual Version 1.2, 50 pages, May 28, 2004.
The SLIC, Gibson, CPEC and SLiCE assembly methods (and GeneArt Seamless, In-Fusion Cloning). 5 pages, available online Sep. 2, 2010.
Tian, et al. Accurate multiplex gene synthesis from programmable DNA microchips. Nature. Dec. 23, 2004;432(7020):1050-4.
Tsal et al., Dimeric CRISPR RNA-guided Fokl nucleases for highly specific genome editing Nat. Biotechnol., 32(6):569-576, 2014.
Unger, et al. Monolithic microfabricated valves and pumps by multilayer soft lithography. Science. Apr. 7, 2000;288(5463):113-6.
U.S. Appl. No. 14/241,874 Office Action dated Feb. 27, 2017.
U.S. Appl. No. 14/452,429 Notice of Allowance dated Jun. 7, 2016.
U.S. Appl. No. 14/452,429 Restriction Requirement dated Dec. 12, 2014.
U.S. Appl. No. 14/885,962 Notice of Allowance dated Nov. 8, 2017 and Sep. 29, 2017.
U.S. Appl. No. 14/885,962 Office Action dated Dec. 16, 2016.
U.S. Appl. No. 14/885,962 Office Action dated Sep. 8, 2016.
U.S. Appl. No. 14/885,962 Restriction Requirement dated Mar. 1, 2016.
U.S. Appl. No. 14/885,963 Notice of Allowance dated May 24, 2016.
U.S. Appl. No. 14/885,963 Office Action dated Feb. 5, 2016.
U.S. Appl. No. 14/885,965 Office Action dated Aug. 30, 2017.
U.S. Appl. No. 14/885,965 Office Action dated Feb. 10, 2017.
U.S. Appl. No. 14/885,965 Office Action dated Feb. 18, 2016.
U.S. Appl. No. 14/885,965 Office Action dated Jan. 4, 2018.
U.S. Appl. No. 14/885,965 Office Action dated Jul. 7, 2016.
U.S. Appl. No. 15/135,434 Notice of Allowance dated Feb. 9, 2018.
U.S. Appl. No. 15/135,434 Office Action dated Nov. 30, 2017.
U.S. Appl. No. 15/135,434 Restriction Requirement dated Jul. 12, 2017.
U.S. Appl. No. 15/154,879 Notice of Allowance dated Feb. 1, 2017.
U.S. Appl. No. 15/187,721 Notice of Allowance dated Dec. 7, 2018.
U.S. Appl. No. 15/187,721 Office Action dated Oct. 14, 2016.
U.S. Appl. No. 15/233,835 Notice of Allowance dated Oct. 4, 2017.
U.S. Appl. No. 15/233,835 Office Action dated Feb. 8, 2017.
U.S. Appl. No. 15/233,835 Office Action dated Jul. 26, 2017.
U.S. Appl. No. 15/233,835 Restriction Requirement dated Nov. 4, 2016.
U.S. Appl. No. 15/245,054 Office Action dated Mar. 21, 2017.
U.S. Appl. No. 15/245,054 Office Action dated Oct. 19, 2018.
U.S. Appl. No. 15/377,547 Office Action dated Mar. 24, 2017.
U.S. Appl. No. 15/377,547 Office Action dated Nov. 30, 2017.
U.S. Appl. No. 15/602,991 Notice of Allowance dated Oct. 25, 2017.
U.S. Appl. No. 15/602,991 Office Action dated Sep. 21, 2017.
U.S. Appl. No. 15/603,013 Office Action dated Jan. 30, 2018.
U.S. Appl. No. 15/603,013 Office Action dated Oct. 20, 2017.
U.S. Appl. No. 15/682,100 Office Action dated Jan. 2, 2018.
U.S. Appl. No. 15/682,100 Restriction Requirement dated Nov. 8, 2017.
U.S. Appl. No. 14/452,429 Office Actian dated Apr. 9, 2015.
Vaijayanthi, et al. Recent advances in oligonucleotide synthesis and their applications. Indian J Biochem Biophys. 40(6):377-91, 2003.
Van Den Brulle, et al. A novel solid phase technology for high-throughput gene synthesis. Biotechniques. 45(3):340-343, 2008.
Van Tassell et al., SNP discovery and allele frequency estimation by deep sequencing of reduced representation libraries. Nature Methods, 5:247-252, 2008.
Vargeese, et al. Efficient activation of nucleoside phosphoramidites with 4,5-dicyanoimidazole during oligonucleotide synthesis. Nucleic Acids Res. 26(4):1046-50, 1998.
Verma et al. Modified oligonucleotides: synthesis and strategy for users. Annu Rev Biochem 67:99-134, 1998.
Vincent, et al. Helicase-dependent isothermal DNA amplification. EMBO Rep. 5(8):795-800, 2004.
Visscher et al., “Construction of multiple-beam optical traps with nanometer-resolution position sensing”, IEEE Journal of Selected Topics in Quantum Electronics, 2(4):1066-1076, 1996.
Voldmans Joel et al., “Holding forces of single-particle dielectrophoretic traps.” Biophysical Journal, 80(1):531-541, 2001.
Vos, et al. AFLP:A new technique for DNA fingerprinting. Nucleic Acids Res. 23(21):4407-14, 1995.
Wagner et al., “Nucleotides, Part LXV, Synthesis of 2′-Deoxyribonucleoside 5′-Phosphoramidites: New Building Blocks for the Inverse (5′-3′)-0iigonucleotide Approach.” Helvetica Chimica Acta, 83(8):2023-2035, 2000.
Wah, David A. et al., “Structure of Fok I has implications for DNA cleavage”, Proc. Natl. Acad. Sci. USA, 95:10564-10569, 1998.
Wah, David A. et al., “Structure of the multimodular endonuclease Fok I bound to DNA”, Nature, 388:97-100, 1997.
Walker, et al. Strand displacement amplification—an isothermal, in vitro DNA amplification technique. Nucleic Acids Res. 20(7):1691-6, 1992.
Wan et al., Deep Learning for Content-Based Image Retrieval: A comprehensive study. in Proceedings of the 22nd ACM International Conference on Multimedia—Nov. 3-7, 2014, Orlando, FL, p. 157-166, 2014.
Weber, et al. A modular cloning system for standardized assembly of multigene constructs. PLoS One. 6(2):e16765, 2011.
Welz, et al. 5-(Benzylmercapto)-1H-tetrazole as activator for 2′-O-TBDMS phosphoramidite building blocks in RNA synthesis. Tetrahedron Lett. 43(5):795-797, 2002.
Westin et al., Anchored multiplex amplification on a microelectronic chip array Nature Biotechnology, 18:199-202, 2000 (abstract only).
Whitehouse, Adrian et al. “Analysis ofthe mismatch and insertion/deletion binding properties of Thermus thermophilus, HB8, MutS”, Biochemical and Biophysical Research Communications, vol. 233, 834-837, 1997.
Wiedenheft et al., RNA-guided genetic silencing systems in bacteria and archaea. Nature, 482:331-338, 2012.
Wijshoff, Herman. Structure and fluid-dynamics in Piezo inkjet printheads. Thesis. Venio, The Netherlands, published 2008, p. 1-185.
Wirtz, Denis, “Direct measurement ofthe transport properties of a single DNA molecule”, Physical Review Letters, vol. 75, No. 12, 2436-2439, 1995.
Withers-Martinez, Chrislaine et al., “PCR-based gene synthesis as an efficient approach for expression of the A+ T-rich malaria genome”, Protein Engineering, 12(12):1113-1120, 1999.
Wood, Richard D. et al., “Human DNA repair genes”, Science 291:1284-1289, 2001.
Wosnick, et al. Rapid construction of large synthetic genes: total chemical synthesis of two different versions of the bovine prochymosin gene. Gene. 60(1):115-27, 1987.
Wright and Church, An open-source oligomicroarray standard for human and mouse. Nature Biotechnology, 20:1082-1083, 2002.
Wu, et al. RNA-mediated gene assembly from DNA arrays. Angew Chem Int Ed Engl. 51(19):4628-32, 2012.
Wu, et al. Specificity ofthe nick-closing activity of bacteriophage T4 DNA ligase. Gene. 76(2):245-54, 1989.
Wu, Xing-Zheng et al., “An improvement of the on-line electrophoretic concentration method for capillary electrophoresis of proteins an experimental factors affecting he concentration effect”, Analytical Sciences, 16:329-331, 2000.
Xiong, et al. A simple, rapid, high-fidelity and cost-effective PCR-based two-step DNA synthesis method for long gene sequences. Nucleic Acids Res. 32(12):e98, 2004.
Xiong et al., Chemical gene synthesis: Strategies, softwares, error corrections, and applications. FEMS Microbiol. Rev., 32:522-540, 2008.
Xiong, et al. Non-polymerase-cycling-assembly-based chemical gene synthesis: Strategies, methods, and progress. Biotechnology Advances. 26(2):121-134, 2008.
Xu et al., Design of 240,000 orthogonal 25mer DNA barcode probes. PNAS, 106(7):2289-2294, 2009.
Yang, et al “Purification, cloning, and characterization of the CEL I nuclease”, Biochemistry, 39(13):3533-35, 2000.
Yazdi, et al., A Rewritable, Random-Access DNA-Based Storage System, Scientific Reports, 5, Article No. 14138, 27 pages, 2015.
Yehezkel et al., De novo DNA synthesis using single molecule PCR Nucleic Acids Research, 36(17):e107, 2008.
Yes HMDS vapor prime process application note Prepared by UC Berkeley and University of Texas at Dallas and re-printed by Yield Engineering Systems, Inc., 6 pages (http://www.yieldengineering.com/Portals/0/HMDS%20Application%20Note.pdf (Published online Aug. 23, 2013).
Youil, Rima et al., “Detection of 81 of 81 known mouse Beta-Giobin promoter mutations with T4 Endonuclease VII⋅ The EMC Method”, Genomics, 32:431-435, 1996.
Young, et al. Two-step total gene synthesis method. Nucleic Acids Res. 32(7):e59, 2004.
Zhang and Seelig, Dynamic DNA nanotechnology using strand-displacement reactions, Nat. Chem., 3(2):103-113, 2011.
Zheleznaya, et al. Nicking endonucleases. Biochemistry (Mosc). 74(13):1457-66, 2009.
Zhirnov et al., Nucleic acid memory. Nature Materials, 15:366, 2016.
Zhou et al., Microfluidic PicoArray synthesis of oligodeoxynucleotides and simultaneous assembling of multiple DNA sequences Nucleic Acids Research, 32(18):5409-5417, 2004.
Eroshenko et al.: Gene Assembly from Chip-Synthesized Oligonucleotides; Current Protocols in Chemical biology 4: 1-17 (2012).
European Patent Application No. 16871446.7 First Official Action dated Nov. 13, 2019.
Galka et al.: QuickLib, a method for building fully synthetic plasmid libraries by seamless cloning of degenerate oligonucleotides. PLOS One, 12, e0175146:1-9 (2017).
Galka et al.: QuickLib, a method for building fully synthetic plasmid libraries by seamless cloning of degenerate oligonucleotides. PLOS One, 12, e0175146:S1 figure (2017).
Galka et al.: QuickLib, a method for building fully synthetic plasmid libraries by seamless cloning of degenerate oligonucleotides. PLOS One, 12, e0175146:S1 Table (2017).
Galka et al.: QuickLib, a method for building fully synthetic plasmid libraries by seamless cloning of degenerate oligonucleotides. PLOS One, 12, e0175146:S2 figure (2017).
International Application No. PCT/US2018/019268 International Preliminary Report on Patentability dated Sep. 6, 2019.
International Application No. PCT/US2019/032992 International Search Report and Written Opinion dated Oct. 28, 2019.
International Application No. PCT/US2019/032992 Invitation to Pay Additional Fees dated Sep. 6, 2019.
Paul et al.: Acid binding and detritylation during oligonucleotide synthesis. Nucleic Acids Research. 15. pp. 3048-3052 (1996).
Pierce et al.: Linear-after-the-exponential polymerase chain reaction and allied technologies. Real-time detection strategies for rapid, reliable diagnosis from single cells. Methods Mol Med. 2007;132:65-85.
PubChem Data Sheet Acetonitrile. Printed from website https://pubchem.ncbi.nlm.nig.gov/ pp. 1-124 (2020).
PubChem Data Sheet Methylene Chloride. Printed from website https://pubchem.ncbi.nlm.nih.gov/ pp. 1-140 (2020).
Rajpal et al.: A general method for greatly improving the affinity of antibodies by using combinatorial libraries. Proc. Natl. Acad. Sci. 102(24):8466-8471 (2005).
Solomon et al.: Genomics at Agilent: Driving Value in DNA Sequencing.https://www.agilent.com/labs/features/2010_genomics.html, 8 pages (Aug. 5, 2010).
U.S. Appl. No. 14/241,874 Final Office Action dated Jan. 28, 2019.
U.S. Appl. No. 15/015,059 Office Action dated Aug. 19, 2019.
U.S. Appl. No. 15/151,316 Office Action dated Oct. 4, 2019.
U.S. Appl. No. 15/156,134 Final Office Action dated Jan. 3, 2020.
U.S. Appl. No. 15/187,714 Final Office Action dated Sep. 17, 2019.
U.S. Appl. No. 15/268,422 Final Office Action dated Oct. 3, 2019.
U.S. Appl. No. 15/603,013 Final Office Action dated Nov. 6, 2019.
U.S. Appl. No. 15/619,322 Final Office Action dated Mar. 30, 2020.
U.S. Appl. No. 15/619,322 Office Action dated Aug. 14, 2019.
U.S. Appl. No. 15/816,995 Office Action dated Sep. 20, 2019.
U.S. Appl. No. 15/835,342 Office Action dated Dec. 2, 2019.
U.S. Appl. No. 15/835,342 Restriction Requirement dated Sep. 10, 2019.
U.S. Appl. No. 15/844,395 Office Action dated Jan. 24, 2020.
U.S. Appl. No. 15/921,479 Office Action dated Nov. 12, 2019.
U.S. Appl. No. 15/960,319 Office Action dated Aug. 16, 2019.
U.S. Appl. No. 15/991,992 Restriction Requirement dated Mar. 10, 2020.
U.S. Appl. No. 16/006,581 Office Action dated Sep. 25, 2019.
U.S. Appl. No. 16/165,952 Office Action dated Mar. 12, 2020.
U.S. Appl. No. 16/239,453 Office Action dated Nov. 7, 2019.
U.S. Appl. No. 16/384,678 Office Action dated Jan. 21, 2020.
U.S. Appl. No. 16/409,608 Office Action dated Sep. 9, 2019.
U.S. Appl. No. 16/530,717 Office Action dated Sep. 6, 2019.
U.S. Appl. No. 16/535,777 Office Action dated Jan. 23, 2020.
U.S. Appl. No. 16/535,779 First Action Interview dated Feb. 10, 2020.
U.S. Appl. No. 15/921,537 Office Action dated Apr. 1, 2020.
Acevedo-Rocha et aI. Directed evolution of stereoselective enzymes based on genetic selection as opposed to screening systems. J. Biotechnol. 191:3-10 (2014).
Arand et al. Structure of Rhodococcus erythropolis limonene-1,2-epoxide hydrolase reveals a novel active site. EMBO J. 22:2583-2592 (2003).
Assembly manual for the POSaM: The ISB Piezoelelctric Oligonucleotide Synthesizer and Microarrayer, The Institute for Systems Biology, May 28, 2004 (50 pages).
Carter and Friedman, DNA synthesis and Biosecurity: Lessons learned and options forthe future. J. Craig Venter Institute, La Jolla, CA, 28 pages, Oct. 2015.
CeGaT. Tech Note available at https://www.cegat.de/web/wp-content/uploads/2018/06/Twist-Exome-Tech-Note.pdf (4 pgs.) (2018).
Chilamakuri et al. Performance comparison of four exome capture systems for deep sequencing. BMC Genomics 15(1):449 (2014).
Cruse et al. Atlas of Immunology, Third Edition. Boca Raton: CRC Press (pp. 282-283) (2010).
De Silva et al. New Trends of Digital Data Storage in DNA. BioMed Res Int. 2016:8072463 (2016).
Dillon et al. Exome sequencing has higher diagnostic yield compared to simulated disease-specific panels in children with suspected monogenic disorders. Eur J Hum Genet 26(5):644-651 (2018).
Dvorsky. Living Bacteria Can Now Store Data. Gizmodo internet publication. Retrieved from https://gizmodo.com/living-bacteria-can-now-store-data-1781773517 (4 pgs) (Jun. 10, 2016).
European Patent Application No. 12827479.2 Extended European Search Report dated May 18, 2015.
European Patent Application No. 12827479.2 Partial European Search Report dated Jan. 29, 2015.
European Patent Application No. 14834665.3 Further Examination Report dated Nov. 28, 2018.
European Patent Application No. 14834665.3 Office Action dated May 2, 2018.
European Patent Application No. 16847497.1 Extended European Search Report dated Jan. 9, 2019.
European Patent Application No. 16871446.7 European Search Report dated Apr. 10, 2019.
Gao et al. A method forthe generation of combinatorial antibody libraries using pIX phage display. PNAS 99(20):12612-12616 (2002).
Gibson et al. Creation ofa Bacterial Cell Controlled by A Chemically Synthesized Genome. Science 329(5989):52-56 (2010).
Goldfeder et al. Medical implications of technical accuracy in genome sequencing. Genome Med 8(1):24 (2016).
Han et al. Linking T-cell receptor sequence to functional phenotype at the single-cell level. Nat Biotechnol 32(7):684-692 (2014).
Imgur: The magic of the internet. Uploaded May 10, 2012, 2 pages, retrieved from: https://imgur.com/mEWuW.
International Application No. PCT/US2017/026232 International Preliminary Report on Patentability dated Feb. 26, 2019.
International Application No. PCT/US2017/045105 International Preliminary Report on Patentability dated Feb. 5, 2019.
International Application No. PCT/US2017/052305 International Preliminary Report on Patentability dated Apr. 30, 2019.
International Application No. PCT/US2017/062391 International Preliminary Report on Patentability dated May 21 , 2019.
International Application No. PCT/US2018/050511 International Search Report and Written Opinion dated Jan. 11, 2019.
International Application No. PCT/US2018/057857 International Search Report and Written Opinion dated Mar. 18, 2019.
International Application No. PCT/US2019/012218 International Search Report and Written Opinion dated Mar. 21, 2019.
Jacobus et al. Optimal cloning of PCR fragments by homologous recombination in Escherichia soli. PLoS One 10(3):e0119221 (2015).
Jager et al. Simultaneous Humoral and Cellular: Immune Response against Cancer—Testis Antigen NY-ES0-1: Definition of Human Histocompatibility LeukocyteAntigen (HLA)-A2—binding Peptide Epitopes. J. Exp. Med. 187(2):265-270 (1998).
Li et al., Beating bias in the directed evolution of proteins: Combining high-fidelity on-chip solid-phase gene synthesis with efficient gene assembly for combinatorial library construction. First published Nov. 24, 2017, 2 pages. retrieved from: https://doi.org/10.1002/cbic.201700540.
Li et al. Beating Bias in the Directed Evolution of Proteins: Combining High-Fidelity on-Chip Solid-Phase Gene Synthesis with Efficient Gene Assembly for Combinatorial Library Construction. ChemBioChem 19:221-228 (2018).
Light source unit for printable patterning VUV-Aligner / USHIO Inc., Link here: https://www.ushio.co.jp/en/products/1005.html, published Apr. 25, 2016, printed from the internet on Aug. 2, 2016, 3 pages.
Mazor et al.: Isolation of Full-Length IgG Antibodies from Combinatorial Libraries Expressed in Escherichia coli; Antony S. Dimitrov (ed.), Therapeutic Antibodies: Methods and Protocols, vol. 525, Chapter 11, pp. 217-239 (2009).
Meynert et al. Quantifying single nucleotide variant detection sensitivity in exome sequencing. BMC Bioinformatics 14:195 (2013).
Meynert et al. Variant detection sensitivity and biases in whole genome and exome sequencing. BMC Bioinformatics 15:247 (2014).
Mulligan. Commercial Gene Synthesis Technology PowerPoint presentation. BlueHeron® Biotechnology. Apr. 5, 2006 (48 pgs).
Jo et al.: Engineering therapeutic antibodies targeting G-protein-coupled receptors; Experimental & Molecular Medicine; 48; 9 pages (2016).
Lausted et al.: POSaM: a fast, flexible, open-source, inkjet oligonucleotide synthesizer and microarrayer; Genome Biology 2004, 5:R58.
Douthwaite et al.: Affinity maturation of a novel antagonistic human monoclonal antibody with a long VH CDR3 targeting the Class A GPCR formyl-peptide receptor 1; mAbs, vol. 7, Iss. 1, pp. 152-166 (Jan. 1, 2015).
PCT/IL2012/000326 International Preliminary Report on Patentability dated Dec. 5, 2013.
PCT/IL2012/000326 International Search Report dated Jan. 29, 2013.
PCT/US2016/052336 International Preliminary Report on Patentability dated Mar. 29, 2018.
PCT/US2016/052916 International Preliminary Report on Patentability dated Apr. 5, 2018.
PCT/US2016/064270 International Preliminary Report on Patentability dated Jun. 14, 2018.
PCT/US2017/062391 International Search Report and Written Opinion dated Mar. 28, 2018.
PCT/US2017/066847 International Search Report and Written Opinion dated May 4, 2018.
PCT/US2018/022487 International Search Report and Written Opinion dated Aug. 1, 2018.
PCT/US2018/022493 International Search Report and Written Opinion dated Aug. 1, 2018.
PCT/US2018/037152 International Search Report and Written Opinion dated Aug. 28, 2018.
PCT/US2018/037161 International Search Report and Written Opinion dated Oct. 22, 2018.
PCT/US2018/037161 Invitation to Pay Additional Fees dated Aug. 27, 2018.
PCT/US2018/056783 International Search Report and Written Opinion of the International Searching Authority dated Dec. 20, 2018.
PCT/US2018/19268 International Search Report and Written Opinion dated Jun. 26, 2018.
PCT/US2018/19268 Invitation to Pay Additional Fees and, where applicable, protest fee dated May 2, 2018.
PCT/US2018/22487 Invitation to Pay Additional Fees and, where applicable, protest fee dated May 31, 2018.
PCT/US2018/22493 Invitation to Pay Additional Fees and, where applicable, protest fee dated May 31, 2018.
Puigbo. Optimizer: a web server for optimizing the codon usage of DNA sequences. Nucleic Acid Research, 35(14):126-131, 2007.
Sharan et al.: Recombineering: a homologous recombination-based method ofgenetic engineering. Nat Profile 4(2):1-37 (originally pp. 206-223) (2009).
Skerra. Phosphorothioate primers improve the amplification of DNA sequences by DNA polymerases with proofreading activity. Nucleic Acids Res. Jul. 25, 1992; 20(14):3551-4.
Martinez-Torrecuadradaet al.: Targeting the Extracellular Domain of Fibroblast Growth Factor Receptor 3 with Human Single-Chain Fv Antibodies lnhibits Bladder Carcinoma Cell Line Proliferation; Clinical Cancer Research; vol. 11; pp. 6282-6290 (2005).
U.S. Appl. No. 15/187,714 Office Action dated Apr. 4, 2019.
U.S. Appl. No. 15/603,013 Office Action dated Jun. 26, 2019.
Sullivan et al.: Library construction and evaluation for site saturation mutagenesis. Enzyme Microb. Technol. 53:70-77 (2013).
Sun et al.: Structure-Guided Triple-Code Saturation Mutagenesis: Efficient Tuning ofthe Stereoselectivity of an Epoxide Hydrolase. ACS Catal. 6:1590-1597 (2016).
Twist Bioscience | White Paper. DNA-Based Digital Storage. Retrieved from the internet, Twistbioscience.com, Mar. 27, 2018, 5 pages.
U.S. Appl. No. 14/241,874 Office Action dated Jul. 14, 2016.
U.S. Appl. No. 14/241,874 Office Action dated May 4, 2018.
U.S. Appl. No. 14/885,965 Office Action dated Aug. 28, 2018.
U.S. Appl. No. 15/015,059 Final Office Action dated Jul. 17, 2019.
U.S. Appl. No. 15/015,059 Office Action dated Feb. 7, 2019.
U.S. Appl. No. 15/151,316 Office Action dated Jun. 7, 2018.
U.S. Appl. No. 15/156,134 Office Action dated Apr. 4, 2019.
U.S. Appl. No. 15/187,714 Restriction Requirement dated Sep. 17, 2018.
U.S. Appl. No. 15/268,422 Office Action dated Mar. 1, 2019.
U.S. Appl. No. 15/268,422 Restriction Requirement dated Oct. 4, 2018.
U.S. Appl. No. 15/377,547 Final Office Action dated Feb. 8, 2019.
U.S. Appl. No. 15/377,547 Office Action dated Jul. 27, 2018.
U.S. Appl. No. 15/433,909 Non-Final Office Action dated Feb. 8, 2019.
U.S. Appl. No. 15/433,909 Restriction Requirement dated Sep. 17, 2018.
U.S. Appl. No. 15/602,991 Final Office Action dated Dec. 13, 2018.
U.S. Appl. No. 15/602,991 Office Action dated May 31, 2018.
U.S. Appl. No. 15/602,991 Office Action dated May 31, 2019.
U.S. Appl. No. 15/603,013 Office Action dated Jul. 10, 2018.
U.S. Appl. No. 15/709,274 Notice of Allowance dated Apr. 3, 2019.
U.S. Appl. No. 15/729,564 Final Office Action dated Dec. 13, 2018.
U.S. Appl. No. 15/729,564 Office Action dated Jan. 8, 2018.
U.S. Appl. No. 15/729,564 Office Action dated Jun. 6, 2018.
U.S. Appl. No. 15/729,564 Office Action dated May 30, 2019.
U.S. Appl. No. 15/816,995 Restriction Requirement dated Apr. 4, 2019.
U.S. Appl. No. 15/844,395 Restriction Requirement dated May 17, 2019.
U.S. Appl. No. 15/860,445 Final Office Action dated Dec 13, 2018.
U.S. Appl. No. 15/860,445 Office Action dated May 30, 2018.
U.S. Appl. No. 15/921,479 Restriction Requirement dated May 24, 2019.
U.S. Appl. No. 15/151,316Final Office Action dated Feb. 21, 2019.
Van Der Werf et al.: Limonene-1,2-epoxide hydrolase from Rhodococcus erythropolis DCL14 belongs to a novel class of epoxide hydrolases. J. Bacteriol. 180:5052-5057 (1998).
Warr et al.: Exome Sequencing: current and future perspectives. G3: (Bethesda) 5(8):1543-1550 (2015).
Wu, et al.: Sequence-Specific Capture of Protein-DNA Complexes for Mass Spectrometric Protein Identification; PLoS One. Oct. 20, 2011, vol. 6, No. 10.
Zheng et al.: Manipulating the Stereoselectivity of Limonene Epoxide Hydrolase by Directed Evolution Based on Iterative Saturation Mutagenesis. J. Am. Chem. Soc. 132:15744-15751 (2010).
Zhou, et al.: Establishment and application ofa loop-mediated isothermal amplification (LAMP) system for detection of cry1Ac transgenic sugarcane Scientific Reports May 9, 2014, vol. 4, No. 4912.
Agbavwe et al.: Efficiency, Error and Yield in Light-Directed Maskless Synthesis of DNA Microarrays. Journal of Nanobiotechnology. 9(57):1-17 (2011).
De Graff et al.: Glucagon-Like Peptide-1 and its Class B G Protein-Coupled Receptors: A Long March to Therapeutic Successes. Pharmacol Rev. 68(4):954-1013 (2016).
Diehl et al.: BEAMING: single-molecule PCR on microparticles in water-in-oil emulsions. Nature Methods. 3(7):551-559 (2006).
PCT/US2020/052291 International Preliminary Report on Patentability dated Apr. 7, 2022.
PCT/US2020/052306 International Preliminary Report on Patentability dated Mar. 15, 2022.
U.S. Appl. No. 15/272,004 Office Action dated Apr. 13, 2022.
U.S. Appl. No. 15/921,479 Final Office Action dated Dec. 20, 2021.
U.S. Appl. No. 15/921,479 Office Action dated Apr. 28, 2022.
U.S. Appl. No. 16/128,372 Office Action dated Dec. 13, 2021.
U.S. Appl. No. 16/590,301 Restriction Requirement dated Apr. 28, 2022.
U.S. Appl. No. 16/712,678 Office Action dated Nov. 26, 2021.
U.S. Appl. No. 16/737,401 Office Action dated Jan. 5, 2022.
U.S. Appl. No. 16/737,401 Restriction Requirement dated Nov. 15, 2021.
U.S. Appl. No. 16/802,423 Restriction Requirement dated Dec. 29, 2021.
U.S. Appl. No. 16/802,439 Office Action dated Mar. 17, 2022.
U.S. Appl. No. 16/802,439 Restriction Requirement dated Oct. 1, 2021.
U.S. Appl. No. 16/854,719 Office Action dated Nov. 24, 2021.
U.S. Appl. No. 17/154,906 Office Action dated Nov. 10, 2021.
Williams et al.: Amplification of complex gene libraries by emulsion PCR. Nature Methods. 3(7):545-550(2006).
Altshuler et al.: Generation of Recombinant Antibodies and Means for Increasing Their Affinity. Biochemistry (Moscow). 75(13:1584-1605 (2010).
Damha et al.: An improved procedure forderivatization of controlled-pore glass beads for solidphase oligonucleotide synthesis. Nucleic Acids Research. 18(13):3813-3821 (1990).
PCT/US2022/023936 International Search Report and Written Opinion dated Jul. 14, 2022.
Smith et al.: Changing the peptide specificity of a human T-cell receptor by directed evolution. Nature Communications. 5:1-13 (2014).
Sommermeyer et al.: Minimal Amino Acid Exchange in Human TCR Constant Regions Fosters Improved Function of TCR Gene-Modified T Cells. Journal of Immunology. 184:6223-6231 (2010).
U.S. Appl. No. 16/737,401 Final Office Action dated Jun. 13, 2022.
U.S. Appl. No. 15/835,342 Office Action dated Jun. 17, 2022.
U.S. Appl. No. 16/039,256 Office Action dated May 10, 2022.
U.S. Appl. No. 16/417,023 Final Office Action dated Aug. 2, 2022.
U.S. Appl. No. 16/417,023 Office Action dated Feb. 22, 2022.
U.S. Appl. No. 16/590,301 Office Action dated Jul. 20, 2022.
U.S. Appl. No. 16/726,073 Office Action dated Jun. 30, 2022.
U.S. Appl. No. 16/802,423 Notice of Allowance dated Jul. 25, 2022.
U.S. Appl. No. 16/854,719 Office Action dated Jun. 2, 2022.
U.S. Appl. No. 17/154,906 Office Action dated May 17, 2022.
U.S. Appl. No. 17/180,614 Office Action dated Oct. 5, 2022.
Related Publications (1)
Number Date Country
20180253563 A1 Sep 2018 US
Provisional Applications (1)
Number Date Country
62462284 Feb 2017 US