Embryonic development and cellular differentiation are considered unidirectional pathways because cells undergo a progressive loss of developmental potency during cell fate specification. Two categories of pluripotent stem cells are known to date: embryonic stem cells and embryonic germ cells. Embryonic stem cells are pluripotent stem cells that are derived directly from an embryo. Embryonic germ cells are pluripotent stem cells that are derived directly from the fetal tissue of aborted fetuses. For purposes of simplicity, embryonic stem cells and embryonic germ cells will be collectively referred to as “ES” cells herein.
The generation of live animals by nuclear transfer (NT) demonstrated that the epigenetic state of somatic cells, including that of terminally differentiated cells, is labile and can be reset to an embryonic state that is capable of directing development of a new organism. The nuclear cloning technology is of potential interest for transplantation medicine but any medical application is hampered by the inefficiency of the cloning process, the lack of knowledge of the underlying mechanisms and ethical concerns. A major breakthrough in solving these issues has been the in vitro derivation of reprogrammed somatic cells (designated as “induced Pluripotent Stem” or “iPS” cells) by the ectopic expression of the four transcription factors Oct4, Sox2, c-myc and Klf4 by Yamanaka (designated below as “reprogramming factors” or “factors”) (Takahashi and Yamanaka, Cell 126:663-676 (2006)).
Further advancement in the area of reprogramming would be facilitated by establishing robust methods for reprogramming human somatic cells and defining effective protocols for manipulating human ES and iPS cells.
The invention relates generally to the dedifferentiation of differentiated somatic cells, to methods of generating secondary iPS cells and the secondary iPS cells produced by the methods, to chimeric animals, e.g., mice, produced from said secondary iPS cells, and to methods of screening for reprogramming agents utilizing the secondary iPS cells and chimeric animals.
In one embodiment the invention relates to a method of reprogramming a differentiated somatic cell to a pluripotent state, comprising the steps of contacting a differentiated somatic cell with at least one reprogramming agent that contributes to reprogramming of said cell to a pluripotent state; maintaining said cell under conditions appropriate for proliferation of the cell and for activity of the at least one reprogramming agent for a period of time sufficient to begin reprogramming of the cell; and functionally inactivating the at least one reprogramming agent.
In another embodiment the invention relates to a method of reprogramming a differentiated somatic cell to a pluripotent state, comprising the steps of providing a differentiated somatic cell that contains at least one exogenously introduced factor that contributes to reprogramming of said cell to a pluripotent state; maintaining the cell under conditions appropriate for proliferation of the cell and for activity of the at least one exogenously introduced factor for a period of time sufficient to activate at least one endogenous pluripotency gene; and functionally inactivating the at least one exogenously introduced factor.
In a further embodiment the invention pertains to a method of selecting a differentiated somatic cell that has been reprogrammed to a pluripotent state, comprising the steps of providing a differentiated somatic cell that contains at least one exogenously introduced factor that contributes to reprogramming of the cell to a pluripotent state; maintaining the cell under conditions appropriate for proliferation of the cell and for activity of the at least one exogenously introduced factor for a period of time sufficient to activate at least one endogenous pluripotency gene; functionally inactivating the at least one exogenously introduced factor; and differentiating or distinguishing between cells which display one or more markers of pluripotency and cells which do not. In one embodiment differentiating or distinguishing between cells which display one or more markers of pluripotency and cells which do not comprises selection or enrichment for cells displaying one or more markers of pluripotency and/or selection against cells which do not display one or more markers of pluripotency.
In some embodiments of the invention the differentiated somatic cell is partially differentiated. In other embodiments of the invention the differentiated somatic cell is fully differentiated.
In some embodiments of the invention the differentiated somatic cell is cell of hematopoetic lineage or is a mesenchymal stem cell; in some embodiments the differentiated somatic cell is obtained from peripheral blood. In one embodiment of the invention the differentiated somatic cell is an immune system cell. In one embodiment the differentiated somatic cell is a macrophage. In one embodiment the differentiated somatic cell is a lymphoid cell. In other embodiments of the invention the differentiated somatic cell is a B cell, such as an immature (e.g., pro-B cell or pre-B cell) or mature (e.g., non-naïve) B-cell. In still other embodiments the differentiated cell is a neural progenitor cell, an adrenal gland cell, a keratinocyte, a muscle cell, or an intestinal epithelium cell.
In some embodiments of the invention the at least one exogenously introduced factor is a polynucleotide. In other embodiments the at least one exogenously introduced factor is a polypeptide. In one embodiment the at least one exogenously introduced factor is selected from the group consisting of Oct4, Sox2, Klf-4, Nanog, Lin28, c-Myc and combinations thereof. In particular embodiments of the invention the differentiated somatic cell contains exogenously introduced Oct4, Sox2, and Klf-4 exogenously introduced Oct4, Sox2, Klf-4 and c-Myc.
In one embodiment of the invention the at least one exogenously introduced factor is selected from the group consisting of Oct4, Sox2, Klf-4, c-Myc and combinations thereof and the differentiated somatic cell further contains at least one exogenously introduced factor (e.g., a polynucleotide or polypeptide) capable of inducing dedifferentiation of the differentiated somatic cell. In some embodiments the factor capable of inducing dedifferentiation of said differentiated somatic cell is selected from the group consisting of at least one polynucleotide which downregulates B cell late specific markers, at least one polynucleotide which inhibits expression of Pax5, at least one polypeptide which downregulates B cell late specific markers, at least one polypeptide which inhibits expression of Pax5, and combinations thereof. In one embodiment of the invention the factor capable of inducing dedifferentiation of said differentiated somatic cell is C/EBPα or a human homolog of C/EBPα.
In particular embodiments of the invention the at least one exogenously introduced factor is introduced using a vector, e.g., an inducible vector or a conditionally expressed vector. In one aspect the at least one exogenously introduced factor is introduced using a vector which is not subject to methylation-mediated silencing. In yet another embodiment the at least one exogenously introduced factor is introduced using a viral vector such as a retroviral or lentiviral vector.
The present invention also provides methods for producing a cloned animal. In the methods, a somatic cell is isolated from an animal having desired characteristics, and reprogrammed using the methods of the invention to produce one or more reprogrammed pluripotent somatic cell (“RPSC”). The RPSCs are then inserted into a recipient embryo, and the resulting embryo is cultured to produce an embryo of suitable size for implantation into a recipient female, which is then transferred into a recipient female to produce a pregnant female. The pregnant female is maintained under conditions appropriate for carrying the embryo to term to produce chimeric animal progeny. The chimeric animal can furter be mated to a wild type animal as desired. The invention further relates to a chimeric animal, e.g., a chimeric mouse, produced by the methods of the invention.
The invention further relates to an isolated pluripotent cell produced by a method comprising (a) providing a differentiated somatic cell that contains at least one exogenously introduced factor that contributes to reprogramming of said cell to a pluripotent state; (b) maintaining said cell under conditions appropriate for proliferation of said cell and for activity of said at least one exogenously introduced factor for a period of time sufficient to activate at least one endogenous pluripotency gene; (c) functionally inactivating said at least one exogenously introduced factor; and (d) differentiating cells which display one or more markers of pluripotency from cells which do not.
The invention also relates to a purified population of somatic cells comprising at least 70% pluripotent cells derived from reprogrammed differentiated somatic cells produced by a method comprising (a) providing a differentiated somatic cell that contains at least one exogenously introduced factor that contributes to reprogramming of said cell to a pluripotent state; (b) maintaining said cell under conditions appropriate for proliferation of said cell and for activity of said at least one exogenously introduced factor for a period of time sufficient begin reprogramming of said cell or to activate at least one endogenous pluripotency gene; (c) functionally inactivating said at least one exogenously introduced factor; and (d) differentiating cells which display one or more markers of pluripotency and cells which do not.
In another aspect the invention relates to a method of producing a pluripotent cell from a somatic cell, comprising the steps of (a) providing one or more somatic cells that each contain at least one exogenously introduced factor that contributes to reprogramming of said cell to a pluripotent state, wherein said exogenously introduced factor is introduced using an inducible vector which is not subject to methylation-induced silencing; (b) maintaining said one or more cells under conditions appropriate for proliferation of said cells and for activity of said at least one exogenously introduced factor for a period of time sufficient begin reprogramming of said cell or to activate at least one endogenous pluripotency gene; (c) functionally inactivating said at least one exogenously introduced factor; (d) selecting one or more cells which display a marker of pluripotency; (e) generating a chimeric embryo utilizing said one or more cells which display a marker of pluripotency; (f) obtaining one or more somatic cells from said chimeric embryo; (g) maintaining said one or more somatic cells under conditions appropriate for proliferation of said cells and for activity of said at least one exogenously introduced factor for a period of time sufficient to begin reprogramming said cell or to activate at least one endogenous pluripotency gene; and (h) differentiating between cells which display one or more markers of pluripotency and cells which do not. In a particular embodiment the method yields a purified population of somatic cells comprising at least 70% pluripotent cells derived from reprogrammed differentiated somatic cells
The invention also relates to an isolated pluripotent cell produced by a method comprising (a) providing one or more somatic cells that each contain at least one exogenously introduced factor that contributes to reprogramming of said cell to a pluripotent state, wherein said exogenously introduced factor is introduced using an inducible vector which is not subject to methylation-induced silencing; (b) maintaining said one or more cells under conditions appropriate for proliferation of said cells and for activity of said at least one exogenously introduced factor for a period of time sufficient to begin reprogramming said cell or to activate at least one endogenous pluripotency gene; (c) functionally inactivating said at least one exogenously introduced factor; (d) selecting one or more cells which display a marker of pluripotency; (e) generating a chimeric embryo utilizing said one or more cells which display a marker of pluripotency; (f) obtaining one or more somatic cells from said chimeric embryo; (g) maintaining said one or more somatic cells under conditions appropriate for proliferation of said cells and for activity of said at least one exogenously introduced factor for a period of time sufficient to activate at least one endogenous pluripotency gene; and (h) differentiating cells which display one or more markers of pluripotency and cells which do not.
In preferred embodiments of the invention the methods yield a purified population of somatic cells comprising at least 70% (e.g., 70%, 75%, 80%, 85%, 90%, 95%, 99%) pluripotent cells derived from reprogrammed differentiated somatic cells. In particular embodiments the pluripotent cells are genetically homogenous.
The invention also relates to a method of identifying a reprogramming agent comprising (a) providing one or more somatic cells that each contain at least one exogenously introduced factor that contributes to reprogramming of said cell to a pluripotent state, wherein each of said exogenously introduced factors is introduced using an inducible vector which is not subject to methylation-induced silencing and the expression of which is controlled by regulatory elements induced by distinct inducers; (b) maintaining said one or more cells under conditions appropriate for proliferation of said cells and for activity of said at least one exogenously introduced factor for a period of time sufficient to reprogram said cell or to activate at least one endogenous pluripotency gene; (c) functionally inactivating said at least one exogenously introduced factor; (d) selecting one or more cells which display a marker of pluripotency; (e) generating a chimeric embryo utilizing said one or more cells which display a marker of pluripotency; (f) obtaining one or more somatic cells from said chimeric embryo; (g) maintaining said one or more somatic cells under conditions appropriate for proliferation of said cells and for activity of said at least one exogenously introduced factor wherein activity of said at least one exogenously introduced factor is insufficient by itself to activate at least one endogenous pluripotency gene; (h) contacting the somatic cell of (g) with one or more candidate reprogramming agents; and (i) identifying cells contacted with said one or more candidate reprogramming agents which display one or more markers of pluripotency, wherein candidate reprogramming agents which induce the somatic cell of (g) to display one or more markers of pluripotency are identified as reprogramming agents.
The invention also relates to methods utilizing known inducible promoter systems. As one example, inducible vectors, e.g., DOX and tamoxifen inducible lentiviral vectors, are encompassed. DOX inducible retroviral vectors have been important to define the sequential activation of pluripotency markers and the minimum time of vector expression during reprogramming of somatic mouse cells. As described herein we have generated inducible lentiviral vectors that will allow the temporally restricted expression of the reprogramming factors. Following the same strategy as used for murine genes, we have generated lentiviral vectors that transduce the human OCT4, SOX2, KLF4 and C-MYC c-DNAs either constitutively or under the control of a DOX inducible promoter. To generate a DOX inducible system we infected human fibroblasts with a lentiviral vector carrying the rtTA transactivator.
To enable independent inducible control of vectors we also generated OCT4, SOX2 and C-MYC estrogen receptor (ER) fusion constructs by fusing the factors to the estrogen ligand binding domain to allow for tamoxifen dependent expression. Addition of tamoxifen to cells transduced with a SOX2-ER fusion construct leads to translocation of the SOX2 protein from the cytoplasm to the nucleus as expected for drug induced activation. These results show that the DOX and ER fusion inducible systems can be used to independently control the expression of transduced factors.
One embodiment of the invention relates to the use of multiple, e.g., two, different regulatable systems, each controlling expression of a subset of the factors. For example, one might place 3 of the factors under control of a first inducible (e.g., dox-inducible) promoter and the 4th factor under control of a second inducible (e.g., tamoxifen-inducible) promoter. Then, one could generate an iPS cell by inducing expression from both promoters, generate a mouse from this iPS cell, and isolate fibroblasts (or any other cell type) from the mouse. These fibroblasts would be genetically homogenous and would be reprogrammable without need for viral infection. One would then attempt to reprogram the fibroblasts under conditions in which only the first promoter is active, in the presence of different small molecules that could potentially substitute for the 4th factor, in order to identify small molecule “reprogramming agents” or optimize transient transfection or other protocols for introducing the 4th factor. A number of variations are possible; for example, one might stably induce expression of 3 factors and transiently induce expression of the 4th factor, etc. Any combination of factors can be assessed using the described methods. Also, one can modulate expression levels of the factors by using different concentrations of inducing agent.
Another approach is to place the gene that encodes one of the factors between sites for a recombinase and then induce expression of the recombinase to turn off expression of that factor. For example, a heterologous sequence could be positioned between the promoter and the coding sequence, wherein the heterologous sequence is located between sites for a recombinase; the heterologous sequence prevents expression. A recombinase is introduced into the cells (e.g., by introducing an expression vector that encodes the recombinase, e.g., Adenovirus-Cre) and causes excision of the heterologous sequence, thereby allowing expression of the transgene. Also, transgenes can be integrated at a variety of non-essential loci (e.g., loci whose disruption doesn't significantly affect development, exemplified by Collagen I or Rosa26 loci).
These systems are useful, e.g., for identifying reprogramming agents and studying the requirements and events that occur in reprogramming (including discovering cell-type specific differences).
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.
Also, iPS cells derived from the infected fibroblasts displayed DOX dependent expression (right two panels). As shown in
Table 1: Human iPS cells derived from factor transduced embryonic or adult human fibroblasts. Fibroblasts were infected with constitutive or DOX inducible Lenti virus vectors transducing different combinations of factors. Between 50 and 100 clones were picked in each experiment. Southern blots for viral integrations showed that the iPS lines were derived from independently infected fibroblasts. (O=OCT4, S=SOX2, K=KLF4, M=C-MYC, L=LIN28, N=NANOG).
Table 2: Summary of transgenic human ES or iPS cell lines used in this proposal. DOX inducible polycistronic vectors carrying different combinations of factors will be integrated into the 3′UTR of the COL1A1 locus or GFP will be inserted into the OCT4 locus or the indicated neural specific genes. The table also indicates the specific aims where the cells will be used.
The teachings of PCT Application Serial No. PCT/US08/004516, filed Apr. 7, 2008, and U.S. patent application Ser. No. 10/997,146, filed Nov. 24, 2004, are incorporated herein by reference in their entirety. It is contemplated that the various embodiments and aspects of the invention described herein are applicable to all different aspects and embodiments of the invention. It is also contemplated that any of the embodiments or aspects can be freely combined with one or more other such embodiments or aspects whenever appropriate.
The study of induced pluripotency is complicated by the need for infection with high titer retroviral vectors resulting in genetically heterogeneous cell populations. We generated genetically homogeneous “secondary” somatic cells that carry the reprogramming factors as defined doxycycline (dox)-inducible transgenes. These cells were produced by infecting fibroblasts with dox-inducible lentiviruses, reprogramming by dox addition, selecting iPS cells, and producing chimeric mice. Cells derived from these chimeras efficiently reprogram upon dox exposure without the need for viral infection. Utilizing this system we demonstrate that (i) various induction levels of the reprogramming factors can induce pluripotency, (ii) the duration of transgene activity directly correlates with reprogramming efficiency, (iii) cells from many somatic tissues can be reprogrammed and, (iv) different cell types require different induction levels. This system facilitates the characterization of reprogramming and provides a unique platform for genetic or chemical screens to enhance reprogramming or replace individual factors.
It has recently been shown that mouse1-4 and human5-8 fibroblasts can be reprogrammed to a pluripotent state through retroviral-mediated introduction of four transcription factors Oct4, Sox2, Klf4, and c-Myc. Reprogramming can also be achieved in the absence of c-Myc though with decreased efficiency9, 10. Nevertheless, with these approaches only a very small fraction of cells infected with all 4 factors will eventually reprogram11. The random viral infection results in genetic heterogeneity in the infected cell culture that likely plays a significant role in the low observed frequency of induced pluripotent stem (iPS) cell formation. Therefore, faithfully reprogrammed cells must be selected for by the reactivation of endogenous pluripotency genes1-3, or based on morphological criteria11, 12. The reprogramming process has been shown to require approximately 10 to 12 days of sustained transgene expression after viral transduction and follows a sequential activation of pluripotency markers, with initial activation of alkaline phosphatase and stage-specific embryonic antigen (SSEA1) followed by reactivation of the endogenous Oct4 and Nanog genes, after which the cultures are able to sustain the pluripotent state in the absence of transgene activity13, 14.
The cellular and genetic heterogeneity of randomly infected fibroblasts complicates the exploration of important molecular events occurring during reprogramming and limits the scalability required for high throughput analyses. To overcome these problems we developed a system to generate genetically identical cell populations amenable to reprogramming without any further genetic interference. To this end primary fibroblasts were infected with doxycycline-inducible lentiviruses encoding the 4 reprogramming factors. Following blastocyst injection chimeric mice were generated consisting of tissue types clonally derived from reprogrammed fibroblasts. From these mice homogeneous donor cell populations could be derived harboring pre-selected vector integrations permissible for reprogramming, allowing for the robust and simple doxycycline-induced reprogramming of primary cell types without the need for direct viral transduction of the reprogramming factors. This technology facilitates the generation of large numbers of genetically identical donor cells and represents a powerful platform for genetic or chemical screening applications to improve reprogramming. In addition, the same approach can be utilized to screen for small molecules replacing each of the 4 factors by genetic deletion of one particular factor in the pluripotent, reprogrammed fibroblasts Furthermore, this tool is not limited to fibroblast cultures but can in principle be similarly applied to all other somatic cell types, providing an attractive way to induce genes in cell types that are difficult to infect with retroviruses such as lymphocytes or intestinal epithelial cells.
To generate cell populations homogenous with respect to the number and location of proviral integrations, we utilized a doxycycline (dox)-inducible transgene system16, 17 and constructed dox-inducible lentiviral vectors encoding the 4 reprogramming factors. Mouse embryonic fibroblasts (MEFs) containing both a reverse tetracycline transactivator and a PGK promoter-driven puromycin resistance gene targeted to the ROSA locus (ROSA-M2rtTA) in addition to a green fluorescent protein (GFP) targeted to the endogenous Nanog locus (NGFP) were infected with the 4 lentiviruses. Similarly, we infected Rosa-M2rtTA MEFs harboring the Oct4 cDNA under control of the tetracycline operator targeted to the Type I Collagen locus16 and a neomycin resistance gene in the endogenous Nanog locus1, 18 (NNeo) with dox-inducible lentiviruses encoding Klf4, Sox2, and c-Myc (
After viral transduction, doxycycline was added to the culture medium to activate the transgenes and initiate the reprogramming process. As expected, Nanog-GFP positive and Nanog-neo resistant iPS colonies appeared and clonal iPS cell lines were established. All iPS cell lines could be expanded in the absence of dox, exhibited alkaline phosphatase activity and homogenously expressed the pluripotency markers SSEA1, and Nanog (not shown). This indicates that these “primary” iPS cell lines had activated their endogenous pluripotency core transcriptional network and no longer relied upon exogenous expression of the 4 reprogramming factors19. To generate somatic tissues that were composed of genetically homogenous cells carrying identical proviral insertions known to achieve reprogramming in primary fibroblasts, we injected several of these clonal primary iPS lines into blastocysts. The resulting dox-inducible iPS cell chimeras were allowed to gestate until E13.5, at which point MEFs were isolated. Puromycin selection was then used to select against cells derived from the host blastocyst leaving only iPS-derived cells. We will refer to such cells as “secondary” MEFs as they are derived from the primary iPS cells and thus carry a specific set of proviral insertions that is able to reprogram somatic cells (
Secondary MEFs were isolated from chimeric iPS cell embryos generated from three distinct, clonal primary iPS cell lines (one Nanog-neo and two Nanog-GFP lines) and were cultured in the presence of dox to determine whether the integrated lentiviral vectors retained competence to mediate epigenetic reprogramming after differentiation in the developing embryo. The addition of dox to these cultures initiated dramatic morphological changes and “secondary” iPS cell lines were efficiently isolated from these cultures by neo selection or GFP expression and subsequently propagated in the absence of dox. Immunofluorescence demonstrated that secondary iPS cells had reactivated the ES cell pluripotency markers alkaline phosphatase, SSEA1, and the endogenous Nanog gene (
Transgene induction levels, reprogramming kinetics, and efficiencies vary between secondary MEFs derived from distinct iPS cell lines
While secondary MEFs derived from all three dox-inducible iPS cell lines underwent reprogramming to form secondary iPS cell lines, we noticed differences with respect to their morphological changes and proliferation rates after dox treatment. Initially, MEFs from both Nanog-GFP lines proliferated to form a confluent fibroblastic monolayer after exposure to dox. The cells from Nanog-GFP line 3 (NGFP3) then underwent robust post confluent proliferation including growth of cells in suspension, while cells from NanogGFP line 2 (NGFP2) grew slower, forming discreet, alkaline phosphatase positive, ES like colonies upon the fibroblastic monolayer (
To evaluate the reprogramming kinetics in more detail, MEFs from the three lines were cultured in dox-containing media and flow cytometric analysis was utilized to monitor the reactivation of SSEA1 and GFP (
To monitor the timing of reactivation of the endogenous Nanog locus in NNeo secondary MEFs, we plated cells and began drug selection at various time points after dox treatment. In contrast to activation of the Nanog-GFP reporter gene around 2 weeks after induction, NNeo MEFs were neomycin resistant when neo was added to the cultures as early as day 4 (
Next we compared the reprogramming efficiencies of the various secondary MEFs. To determine the optimal plating density, we plated secondary NGFP2 MEFs at densities ranging from 0.025-500 cells/mm2 in dox-containing media and counted GFP-positive colonies 4 weeks later. As shown in
In order to stringently determine the reprogramming efficiency in the secondary system we plated single fibroblasts from the NNeo and NGFP2 lines into 96 well plates containing γ-irradiated MEFs as feeder cells to provide optimal growth support. We observed that only ˜14% and ˜8% of the seeded cells from the NNeo and NGFP2 MEFs, respectively, had proliferated sufficiently to form distinct colonies after dox administration (light grey bars in
We next compared the reproducibility of the secondary MEF system with direct infections. We infected Oct4-neo MEFs1 with Moloney-based viruses encoding the 4 reprogramming factors and counted neo-resistant colonies on day 20. Four independent experiments revealed a high degree of inter-experimental variability of iPS formation using this method (
To correlate the phenotypic behavior of the three secondary MEF populations with transgene induction, equal numbers of secondary MEFs were plated in the presence or absence of dox for 72 hours at which point the total transcript levels of the 4 factors were determined by quantitative RT-PCR. Surprisingly, both Nanog-GFP lines induced Oct4 at much lower levels than the NNeo line which expressed Oct4 from the transgene in the collagen 1A1 locus at levels similar to ES cells (
Despite their genetic homogeneity, dox induction resulted in activation of the transgenes that varied at the single cell level as determined by immunofluorescence analysis of Oct4 and Sox2 (
To investigate how long expression of the 4 reprogramming factors was required for stable reprogramming to occur, secondary NGFP2 MEFs were plated at optimal density (see above), exposed to doxycycline for various periods of time ranging from 5 to 22 days and monitored daily for GFP fluorescence. The minimum length of dox exposure resulting in GFP+ colonies was 9 days, with the first GFP+ colonies appearing seven days after dox removal at day 16 (
To correlate the duration of transgene expression with overall reprogramming efficiency we exposed secondary NGFP2 MEFs to doxycycline for 10-15 days and quantified GFP-positive colonies on day 34. We found a striking correlation between the length of transgene expression and number of GFP-positive colonies14 (
We also tested whether the secondary cells could be used to assess the effect of drugs on the efficiency of reprogramming. For this we explored the effects of the DNA demethylating compound 5-Aza-deoxycytidine (5-Aza) and the histone deacetylase inhibitor trichostatin A (TSA). Because of their action on chromatin modifications both small molecules are candidates to improve the 5reprogramming efficiency.
We sought to determine what range of tissue types are amenable to reprogramming by isolating secondary cells from iPS cell chimeras generated from the NNeo and NGFP2 lines and examined the reprogramming ability of multiple cell types derived from these chimeras. As summarized in Table 1, some cell types could readily be reprogrammed when isolated from the NGFP2 line but the same cell types isolated from the NNeo line did not yield iPS cells suggesting that different cell types require different transgene induction levels, which may result from the different proviral integration sites between the lines studied.
Purified intestinal epithelial cells from both secondary NGFP2 and NNeo chimeras responded remarkably quickly to doxycycline treatment and formed spheroids in suspension within 48 hours which subsequently adhered to the MEF feeder layer and took on ES-like morphology within 3-4 days (
In contrast, cells derived from the NNeo chimera became neo resistant after two weeks of dox culture, but were unstable and lost their ES like morphology upon dox withdrawal (
Comparison of transgene induction levels in NGFP2 and NNeo intestinal epithelial cells 48 hours after dox treatment revealed differences in induction levels similar to what was observed in secondary MEFs from these lines (
Mesenchymal Stem Cells and Tail Tip Fibroblasts
We next compared the reprogramming ability of bone marrow derived mesenchymal stem cells (MSCs) and tail tip fibroblasts (TTFs) isolated from NNeo and NGFP2 chimeras. These cells represent two mesenchymal populations that are amenable to reprogramming by direct infection1,4,12 (Supplementary
Cells isolated from the epidermis of NNeo chimeras were first propagated in the absence of doxycycline in growth conditions optimized for keratinocytes Homogeneous epithelial cultures were obtained (
Brains from NNeo chimeras were dissected and a tissue block around the lateral ventricles was dissociated into single cells and plated onto uncoated culture dishes in EGF and FGF2-containing serum-free media (N3EF) in the presence of puromycin to select for secondary cells. 4 weeks later neurospheres had formed that were subsequently plated onto polyornithine/laminin coated dishes in either ES cell or N3EF media containing dox to activate the lentiviral transgenes. As expected for neural precursors, the cells exposed to the serum-containing ES cell media differentiated into flat astrocytic cells and stopped dividing (
In addition, we also succeeded in generating secondary iPS cell lines from cells explanted from the adrenal gland, kidney, and muscle of NNeo chimeras. These tissues were dissected, dissociated in trypsin, and plated in ES cell media containing doxycycline. After 6-12 days in the presence of dox, colonies with ES cell morphology appeared that ultimately became neomycin resistant, dox-independent, and had activated Nanog (
Reprogramming of the somatic epigenome to a pluripotent, embryonic state through the ectopic expression of the 4 transcription factors Klf4, Sox2, c-Myc, and Oct4 is a slow and inefficient process. The current method for induction of reprogramming is through retroviral gene delivery resulting in heterogeneous cell populations with proviral integrations varying in both number and genomic location, offering an explanation for the variability and inefficiency of direct reprogramming. Here we describe a novel system for reprogramming genetically homogeneous cell populations. Reprogramming with doxycycline-inducible lentiviral vectors and subsequent chimera formation yields tissues comprised of genetically homogenous cells that harbor identical proviral integrations and re-express the reprogramming factors upon exposure to doxycycline. This strategy selects for cells that carry the correct number of proviruses inserted at genomic loci that are favorable to drug-induced activation and eliminates the heterogeneity inherent in de novo viral infection of target cells. Surprisingly the timing of reprogramming in this system was similar to directly infected primary fibroblasts. The minimum length of time that dox was required to initiate reprogramming was 9-13 days. This timescale is consistent with the 10-14 day time frame observed in cells that have been directly infected with vectors13, 14. We also observed that when dox was withdrawn from the cultures as early as day 9, GFP+ secondary iPS colonies continually appeared for the next several weeks in the absence of doxycycline. These results support the notion that reprogramming is driven by a stochastic sequence of epigenetic modifications requiring a minimum period of transgene expression.
The observed reprogramming efficiency of secondary MEFs was as high as 4% which is comparable to the reprogramming efficiency of mature B-cells22 and vastly higher than the estimated 0.1% efficiency using de novo infection and drug selection, and about 8 fold higher than what has been reported using morphological selection criteria1, 11, 12. It has been well documented that iPS cells derived from infected MEFs carry on average 15 different proviral copies suggesting strong selection for the small fraction of the infected cells that carry the “correct” number of proviruses, or that express the 4 factors with the appropriate stoichiometry for successful reprogramming. Thus, the reprogramming frequency of secondary MEFs would be expected to be higher because these cells have been clonally derived from infected cells that carried the “correct” combination of proviruses. If so, why would 4% but not most, or all dox treated secondary cells give rise to secondary iPS cells? We consider several non-mutually exclusive explanations. (i) It has been established that genetically identical subclones of directly infected MEFs become reprogrammed at significantly different times or not at all11, 20. As discussed previously, this suggests that reprogramming involves a sequence of stochastic events such that cells carrying an identical number of proviral copies will activate the endogenous pluripotency genes at different times. (ii) Our data also show that dox treatment does not activate the proviruses uniformly in all cells but rather that differences in induction levels exist between individual cells. Because of these variegated expression levels only a fraction of secondary MEFs may achieve high enough expression levels of or the correct relative expression levels between the factors and therefore be capable of generating secondary iPS cells.
While reprogramming is induced by viral transduction of the 4 factors, the maintenance of the pluripotent state depends on the re-establishment of the autoregulatory loop involving the activation of the four endogenous pluripotency factors Oct4, Nanog, Sox2 and Tcf320,23 and silencing of exogenous factors. Similarly, secondary MEFs were capable of being fully reprogrammed to a pluripotent state that was maintained in the absence of transgene expression.
We also utilized the secondary system to examine the reprogramming potential of several additional adult somatic cell types. iPS cells could be derived from many other tissues including brain, epidermis, intestinal epithelium, mesenchymal stem cells, tail tip fibroblasts, kidney, muscle and adrenal gland through dox treatment indicating that the proviruses were appropriately activated in cell types other than MEFs. This demonstrates that the 4 reprogramming factors can mediate epigenetic reprogramming in cells with different developmental origins and epigenetic states and highlights the usefulness of the secondary system for the study of reprogramming in a broad range of cell types. Although special care was taken to avoid other contaminating cell types, we cannot unequivocally demonstrate the cells of origin of iPS cells from these various tissue types. Genetic lineage tracing experiments have in fact demonstrated that iPS cells can be derived from liver and pancreas cells after transduction with Oct4, Sox2, c-Myc and Klf424,25. However, not all cell types are permissive to reprogramming by these four factors. We have shown that reprogramming of mature but not of immature B cells required the transduction of an additional factor (c/EBP-alpha) or the inhibition of the B cells specific transcription factor Pax522. It is possible that additional and as yet unknown factors are required to reprogram certain cell types. One practical advantage of the system described here is that cell types including those that might be refractory to ex vivo culture and retroviral infection such as intestinal epithelial cells can be studied.
The drug-inducible system described here represents a novel reprogramming platform with predictable and highly reproducible kinetics and efficiencies (see Supplementary
The teachings of all references cited herein are incorporated herein by reference in their entirety.
Construction of lentiviral vectors containing Klf4, Sox2, Oct4, and c-Myc under control of the tetracycline operator and a minimal CMV promoter has been described previously14. Replication-incompetent lentiviral particles were packaged in 293T cells with a VSV-G coat and used to infect MEFs containing M2rtTA and PGK-Puro resistance gene at the R26 locus17, as well as either a neomycin resistance or GFP allele targeted to the endogenous Nanog locus1,11. Viral supernatants from cultures packaging each of the 4 viruses were pooled, filtered through a 0.45 μM filter and mixed 1:1 with ES-cell medium (DMEM supplemented w/10% FBS (Hyclone, Logan, Utah), leukemia inhibitory factor, beta-mercaptoethanol (SIGMA-Aldrich), penicillin/streptomycin, L-glutamine, and nonessential amino acids (all from Invitrogen, Carlsbad, Calif.) before being applied to MEFs.
Primary iPS isolation, teratoma, and chimera formation Approximately three weeks after the addition of dox (Sigma-Aldrich St. Louis Mo. 2 μg/mL), GFP+ or neomycin resistant iPS colonies were isolated and expanded in the absence of dox. The NanogGFP2 iPS line was picked from the same plate as line NanogGFP1 (described in22 as MEF-iPS #1 line) whereas line NanogGFP3 was derived from an independent experiment. iPS lines were injected into C57/B6×DBA/1 F1 blastocysts. Blastocysts were placed in a drop of DMEM with 15% FBS under mineral oil. A flat-tip microinjection pipette with an internal diameter of 12-15 mm was used for iPS cell injection using a Piezo micromanipulator. About 10 iPS cells were injected into the blastocyst cavity and blastocysts were placed in KSOM (Specialty Media, Phillipsburg, N.J.) and incubated at 37° C. until they were transferred to recipient females. Fifteen injected blastocysts were transferred to the uterine homs of psuedopregnant C57/B6×DBA/1 F1 females at 2.5 days post coitum. For teratoma generation, 2×106 cells were injected subcutaneously into the flanks of recipient SCID mice, and tumors were isolated for histological analysis 3-6 weeks later. All animals were treated in accordance with institutional IACUC guidelines.
For MEF isolation, chimeric embryos were isolated at E13.5 and the head and internal (including reproductive) organs were removed. Remaining tissue was physically dissociated and incubated in trypsin at 37° C. for 20 minutes, after which cells were resuspended in MEF media containing puromycin (2 μg/mL) and expanded for two passages prior to freezing. Secondary MEFs used for the described experiments were thawed and experiments plated 1-2 passages after thawing. Kinetic experiments (
Somatic organs were isolated from 3 to 4 month old chimeras. Epidermal keratinocytes were isolated and cultured as previously described21,26. Neural progenitor cells were isolated and cultured as previously described27. Total intestinal epithelium was dissociated using a solution of 3 mM EDTA and 0.05 mM DTT in PBS for 30 minutes at room temperature. The musculature was discarded and purified crypts/villi were plated on γ-irradiated feeder MEFs in the presence of dox. For crypt-villus fractionation, the same EDTA-DTT solution was used, but fractions were collected by gentle shaking for 10, 6, 5, 5, 9, 10, and 25 minutes (corresponding to fractions 1-7, respectively, with 1 representing the villus tip to 7 representing the crypt) after incubation as described in28. 8×106 epithelial cells from each fraction were plated on a MEF feeder layer in ES media containing 2 μg/mL dox. No growth was observed in cultures lacking dox. Whole marrow was isolated from secondary chimeric mice (or from Colll-TetO-Oct4, Rosa26-M2rtTA mice16 for direct infections) from the femur and tibia after removal of the condyles at the growth plate by flushing with a syringe and 30-gauge needle containing DMEM+5% Fetal BovineSerum (FBS) (Hyclone, Thermo Fisher Scientific). Mesenchymal stem cells were selected through differential plating on tissue culture plates for 72 hours in α-MEM supplemented with 15% FBS (HyClone). Colony formation of MSCs in culture was carried out by plating 4×106 nucleated cells from freshly isolated whole marrow onto 10 cm plates and allowed to expand for 5 days in the presence of puromycin to eliminate host-blastocyst derived cells, after which dox was introduced to induce reprogramming. Cultures derived from adrenal glands, muscle, and kidneys were dissected, mechanically dissociated, and digested in trypsin at 37° C. for 20 minutes prior to plating on gelatin-coated culture dishes with ES media containing dox.
For flow cytometric analysis we used an APC conjugated anti-mouse SSEA1 (R&D systems, Minneapolis, Minn.) and an alkaline phosphatase substrate kit: Vector Red substrate kit (Vector Laboratories, Burlingame, Calif.). For immunofluorescence, cells were fixed in 4% paraformaldehyde and we used mouse monoclonal antibodies against SSEA1 (Developmental Studies Hybridoma Bank), goat anti Sox2 (R&D Systems), mouse anti Oct4 (Santa Cruz), and rabbit anti Nanog (Bethyl). Fluorophore-labeled, appropriate secondary antibodies were purchased from Jackson ImmunoResearch.
Cells were trypsinized, washed once in PBS and resuspended in FACS buffer (PBS+5% fetal bovine serum). 106 cells were stained with 10 μl of APC-conjugated anti-SSEA1 antibody in a 100 μl volume for 30 minutes, cells were then washed twice in PBS. Cells were then washed once with wash buffer and resuspended in FACS buffer for analysis on a FACS-calibur cell sorter.
Bisulfite treatment of DNA was done using the CpGenome DNA Modification Kit (Chemicon, Temecula, Calif.) following the manufacturer's instructions. The resulting modified DNA was amplified by nested polymerase chain reaction (PCR) using two forward (F) primers and one reverse (R) primer: Oct4 (F1, GTTGTTTTGTTTTGGTTTTGGATAT; SEQ ID NO: 1); (F2, ATGGGTTGAAATATTGGGTTTATTTA; SEQ ID NO: 2); (R, CCACCCTCTAACCTTAACCTCTAAC; SEQ ID NO: 3) and Nanog (F1, GAGGATGTTTTTTAAGTTTTTTTT, SEQ ID NO: 4; F2, AATGTTTATGGTGGATTTTGTAGGT, SEQ ID NO: 5; R, CCCACACTCATATCAATATAATAAC, SEQ ID NO: 6). The first round of PCR was done as follows: 94° C. for 4 minutes; five cycles of 94° C. for 30 seconds, 56° C. for 1 minute (−1° C. per cycle), 72° C. for 1 minute; and 30 cycles of 94° C. for 30 seconds, 51° C. for 45 seconds, and 72° C. for 1 minute, 20 seconds. The second round of PCR was 94° C. for 4 minutes; 30 cycles of 94° C. for 30 seconds, 53.5° C. for 1 minute, and 72° C. for 1 minute 20 seconds. The resulting amplified products were gel-purified (Zymogen, Zymo Research, Orange, Calif.), subcloned into the TOPO TA vector (Invitrogen), and sequenced. Southern blotting of genomic DNA was carried out by digesting 10 μg of DNA with Spel (which cuts once in the lentiviral vector backbone) followed by hybridization with random primed full-length cDNA probes for the four factors.
Total RNA was isolated using Trizol reagent (Invitrogen, Carlsbad, Calif.). Five micrograms of total RNA was treated with DNase I to remove potential contamination of genomic DNA using a DNA Free RNA kit (Zymo Research, Orange, Calif.). One microgram of DNase I-treated RNA was reverse transcribed using a First Strand Synthesis kit (Invitrogen) and ultimately resuspended in 100 μl of water. Quantitative PCR analysis was performed in triplicate using 1/50 of the reverse transcription reaction in an ABI Prism 7000 (Applied Biosystems, Foster City, Calif.) with Platinum SYBR green qPCR SuperMix-UDG with ROX (Invitrogen). Primers used for amplification were as follows: Oct4 F, 5′-ACATCGCCAATCAGCTTGG-3′ SEQ ID NO: 7 and R, 5′AGAACCATACTCGAACCACATCC-3′ SEQ ID NO: 8; c-myc F, 5′-CCACCAGCAGCGACTCTGA3′ SEQ ID NO: 9 and R, 5′-TGCCTCTTCTCCACAGACACC-3′ SEQ ID NO: 10; Klf4 F, 5′-GCACACCTGCGAACTCACAC-3′ SEQ ID NO: 11 and R, 5′-CCGTCCCAGTCACAGTGGTAA-3′ SEQ ID NO: 12; Sox2 F, 5′-ACAGATGCAACCGATGCACC-3′ SEQ ID NO: 13 and R, 5′-TGGAGTTGTACTGCAGGGCG-3′ SEQ ID NO: 14; Nanog F, 5′-CCTCCAGCAGATGCAAGAACTC3′ SEQ ID NO: 15 and R, 5′-CTTCAACCACTGGTTTTTCTGCC-3′ SEQ ID NO: 16. To ensure equal loading of cDNA into RT reactions, GAPDH mRNA was amplified using the following: F, 5-TTCACCACCATGGAGAAGGC-3′ SEQ ID NO: 17; and R, 5′-CCCTTTTGGCTCCACCCT-3′ SEQ ID NO: 18. Data were extracted from the linear range of amplification. All graphs of qRT-PCR data shown represent samples of RNA that were DNase treated, reverse transcribed, and amplified in parallel to avoid variation inherent in these procedures. Error bars represent standard deviation of the mean of triplicate reactions.
Work described herein provides robust approaches for targeting genes in huES cells and to generate tools for the reprogramming of somatic cells into iPS cells. More specifically, homologous recombination is used to insert GFP into key neural lineage genes of huES and iPS cells. The GFP marker is used to isolate neuronal precursor cells from manipulated iPS cells to assess their developmental potential. The current reprogramming protocols rely on retroviral vector-mediated transduction of transcription factors resulting in multiple proviral insertions in the iPS cells. This work describes methods that either avoid the use of multiple viral infections or all but eliminate the requirement for virus-mediated reprogramming.
DOX inducible retroviral vectors have been important to define the sequential activation of pluripotency markers and the minimum time of vector expression during reprogramming of somatic mouse cells. We have generated inducible lentiviral vectors that will allow the temporally restricted expression of the reprogramming factors.
(a) DOX inducible lentivirus vectors: Following the same strategy as used for murine genes we have generated lentiviral vectors that transduce the human OCT4, SOX2, KLF4 and C-MYC c-DNAs either constitutively or under the control of a DOX inducible promoter [Brambrink, 2008 #6877]. To generate a DOX inducible system we infected human fibroblasts with a lentiviral vector carrying the rtTA transactivator.
(b) Tamoxifen inducible lentivirus vectors: To enable independent inducible control of vectors we also generated OCT4, SOX2 and C-MYC estrogen receptor (ER) fusion constructs by fusing the factors to the estrogen ligand binding domain to allow for tamoxifen dependent expression [Grandori, 1996 #6505]. As shown in
One important concept is the use of two different regulatable systems, each controlling expression of a subset of the factors. For example, one might place 3 of the factors under control of a first inducible (e.g., dox-inducible) promoter and the 4th factor under control of a second inducible (e.g., tamoxifen-inducible) promoter. Then, one could generate an iPS cell by inducing expression from both promoters, generate a mouse from this iPS cell, and isolate fibroblasts (or any other cell type) from the mouse. These fibroblasts would be genetically homogenous and would be reprogrammable without need for viral infection. One would then attempt to reprogram the fibroblasts under conditions in which only the first promoter is active, in the presence of different small molecules that could potentially substitute for the 4th factor, in order to identify small molecule “reprogramming agents” or optimize transient transfection or other protocols for introducing the 4th factor. A number of variations are possible; for example, one might stably induce expression of 3 factors and transiently induce expression of the 4th factor, etc. Also, one can modulate expression levels of the factors by using different concentrations of inducing agent.
Another approach is to place the gene that encodes one of the factors between sites for a recombinase and then induce expression of the recombinase to turn off expression of that factor. Recombinase expression could be induced by infecting with a viral vector (e.g., Adenovirus-Cre). Hanna, et al, Science, 318, 1920-1923 (2007) describes such an approach, which was used to reduce the potential risk of tumor formation due to c-Myc transgene expression—Cells were infected with retroviruses encoding for Oct4, Sox2, and Klf4 factors and a lentivirus encoding a 2-lox c-Myc cDNA. iPS cells generated from these cells were infected with an adenovirus encoding Cre recombinase to delete the lentivirus-transduced c-Myc copies.
These systems are useful, e.g., for identifying reprogramming agents and studying the requirements and events that occur in reprogramming (including discovering cell-type specific differences).
2. Generation of Human iPS Cells Confirming that the Inducible System Works as Expected in Human as Well as Mouse.
A number of different strategies have been shown to induce iPS cells from mouse or human somatic donor cells including the constitutive or inducible expression of the four transcription factors Oct4, Sox2, Klf4 and c-myc or a subset of the four factors or alternative factor combinations [Lowry, 2008 #6827; Park, 2008 #6783; Takahashi, 2007 #6769; Yu, 2007 #6793]. The utility of the different vector systems described in
Many current protocols to generate iPS cells call for transduction of the 4 transcription factors Oct4, Sox2, c-myc and Klf4 by four different retroviral vectors. Reprogramming in this manner involves the selection for the small fraction of infected cells that carry multiple integrated vectors (up to 15 or more proviruses:) raising concerns of cancer due to the use of powerful oncogenes and/or retrovirus induced insertional mutagenesis. To reduce the number of independent proviral integrations required for reprogramming we have designed and used a polycistronic vector that can transduce any combination of the factors with a goal of reducing the number of proviral integrations.
Internal ribosomal entry sites (IRES) are widely used to express multiple genes from one promoter but this frequently leads to non-stoichiometric expression of the genes. The self-cleaving 18-22 amino acids long 2A peptides mediate ‘ribosomal skipping’ between the proline and glycine residues and inhibit peptide bond formation without affecting downstream translation. These peptides allow multiple proteins to be encoded as polyproteins, which dissociate into component proteins upon translation. Use of the term “self-cleaving” is not intended to imply proteolytic cleavage reaction.
Self-cleaving peptides are found in members of the Picomaviridae virus family, including aphthoviruses such as foot-and-mouth disease virus (FMDV), equine rhinitis A virus (ERAV), Thosea asigna virus (TaV) and porcine teschovirus-1 (PTV-1) (Donnelly, M L, et al., J. Gen. Virol., 82, 1027-101 (2001); Ryan, M D, et al., J. Gen. Virol., 72, 2727-2732 (2001) and cardioviruses such as Theilovirus (e.g., Theiler's murine encephalomyelitis) and encephalomyocarditis viruses. The 2A peptides derived from FMDV, ERAV, PTV-1, and TaV are sometimes referred to herein as “F2A”, “E2A”, “P2A”, and “T2A”, respectively. Aphthovirus 2A polypeptides are typically˜18-22 amino acids long and contain a Dx1Ex2NPG (SEQ ID NO: 34), where x1 is often valine or isoleucine. As noted above, the 2A sequence is believed to mediate ‘ribosomal skipping’ between the proline and glycine, impairing normal peptide bond formation between the P and G without affecting downstream translation. An exemplary 2A sequence is VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 35) from FMDV, where underlined residues are conserved in many 2A peptides. The C terminus of cardiovirus 2A peptides is conserved, shows a high degree of similarity with FMDV 2A peptide, and has been shown to also mediate self-cleavage (Donnelly, M L, et al., J. Gen. Virol., 78, 13-21 (1997). FDMV 2A peptide has been shown to mediate cleavage of an artificial polyprotein (Ryan, M D and Drew, J., EMBO J., 13, 928-933 (1994). The ability to express four proteins efficiently and stoichiometrically from one polycistron in vivo was demonstrated recently using self-processing 2A peptides to express the four CD3 proteins (Szymczak et al., Nature Biotech. 5, 589-594, 2004). Polycistronic transgenes in which the individual cDNAs are separated by 2A peptides have been shown to promote polycistronic gene expression in transfected cells including huES cells (Hasegawa, K., et al., Stem Cells. 2007 July; 25(7):1707-12, 2007).
The present invention provides polycistronic nucleic acid constructs, expression cassettes, and vectors useful for generating induced pluripotent stem (iPS) cells. In certain embodiments the polycistronic nucleic acid constructs comprise a portion that encodes a self-cleaving peptide. The invention provides a polycistronic nucleic acid construct comprising at least two coding regions, wherein the coding regions are linked to each by a nucleic acid that encodes a self-cleaving peptide so as to form a single open reading frame, and wherein the coding regions encode first and second reprogramming factors capable, either alone or in combination with one or more additional reprogramming factors, of reprogramming a mammalian somatic cell to pluripotency. In some embodiments of the invention the construct comprises two coding regions separated by a self-cleaving peptide. In some embodiments of the invention the construct comprises three coding regions each encoding a reprogramming factor, wherein adjacent coding regions are separated by a self-cleaving peptide. In some embodiments of the invention the construct comprises four coding regions each encoding a reprogramming factor, wherein adjacent coding regions are separated by a self-cleaving peptide. The invention thus provides constructs that encode a polyprotein that comprises 2, 3, or 4 reprogramming factors, separated by self-cleaving peptides. In some embodiments the construct comprises expression control element(s), e.g., a promoter, suitable to direct expression in mammalian cells, wherein the portion of the construct that encodes the polyprotein is operably linked to the expression control element(s). The invention thus provides an expression cassette comprising a nucleic acid that encodes a polyprotein comprising the reprogramming factors, each reprogramming factor being linked to at least one other reprogramming factor by a self-cleaving peptide, operably linked to a promoter (or other suitable expression control element). The promoter drives transcription of a polycistronic message that encodes the reprogramming factors, each reprogramming factor being linked to at least one other reprogramming factor by a self-cleaving peptide. The promoter can be a viral promoter (e.g., a CMV promoter) or a mammalian promoter (e.g., a PGK promoter). The expression cassette or construct can comprise other genetic elements, e.g., to enhance expression or stability of a transcript. In some embodiments of the invention any of the foregoing constructs or expression cassettes may further include a coding region that does not encode a reprogramming factor, wherein the coding region is separated from adjacent coding region(s) by a self-cleaving peptide. In some embodiments the additional coding region encodes a selectable marker.
Specific reprogramming factors that may be encoded by the polycistronic construct include transcription factors Oct4, Sox2, Klf4, c-Myc, and Nanog, which are further described herein and known in the art. The invention encompasses all combinations of two or more of the foregoing factors, in each possible order. For purposes of brevity, not all of these combinations are individually listed herein. In some embodiments, the construct encodes Oct4, Klf4, and Sox2, separated by 2A peptides. In some embodiments the construct does not encode c-Myc. In some embodiments, the construct contains a coding region that encodes Lin28. In some embodiments, the construct contains a coding region that encodes C/EBP alpha.
In some embodiments the construct comprises one or more sites that mediates or facilitates integration of the construct into the genome of a mammalian cell. In some embodiments the construct comprises one or more sites that mediates or facilitates targeting the construct to a selected locus in the genome of a mammalian cell. For example, the construct could comprise one or more regions homologous to a selected locus in the genome.
In some embodiments the construct comprises sites for a recombinase that is functional in mammalian cells, wherein the sites flank at least the portion of the construct that comprises the coding regions for the factors (i.e., one site is positioned 5′ and a second site is positioned 3′ to the portion of the construct that encodes the polyprotein), so that the sequence encoding the factors can be excised from the genome after reprogramming. The recombinase can be, e.g., Cre or Flp, where the corresponding recombinase sites are LoxP sites and Frt sites. In some embodiments the recombinase is a transposase. It will be understood that the recombinase sites need not be directly adjacent to the region encoding the polyprotein but will be positioned such that a region whose eventual removal from the genome is desired is located between the sites. In some embodiments the recombinase sites are on the 5′ and 3′ ends of an expression cassette. Excision may result in a residual copy of the recombinase site remaining in the genome, which in some embodiments is the only genetic change resulting from the reprogramming process.
In some embodiments the construct comprises a single recombinase site, wherein the site is copied during insertion of the construct into the genome such that at least the portion of the construct that encodes polyprotein comprising the factors (and, optionally, any other portion of the construct whose eventual removal from the genome is desired) is flanked by two recombinase sites after integration into the genome. For example, the recombinase site can be in the 3′ LTR of a retroviral (e.g., lentiviral) vector (see, e.g., Example 4).
In some aspects, the invention provides vectors comprising the polycistronic nucleic acid constructs. In some embodiments the vectors are retroviral vectors, e.g., lentiviral vectors. In other embodiments the vectors are non-retroviral vectors, e.g., which may be viral (e.g., adenoviral) or non-viral. Exemplary polycistronic nucleic acid constructs, expression cassettes, and vectors are described in Example 3 In some aspects, the invention provides cells and cell lines (e.g., somatic cells and cell lines such as fibroblasts, keratinocytes, and cells of other types discussed herein) in which a polycistronic nucleic acid construct or expression cassette (e.g., any of the constructs or expression cassettes described herein) is integrated into the genome. In some embodiments the cells are rodent cells, e.g., a murine cells. In some embodiments the cells are primate cells, e.g., human cells.
In some embodiments at least the portion of the construct that encodes the polyprotein is flanked by sites for a recombinase. After a reprogrammed cell is derived, a recombinase can be introduced into the cell, e.g., by protein transduction, or a gene encoding the recombinase can be introduced into the cell, e.g., using a vector such as an adenoviral vector. The recombinase excises the sequences encoding the exogenous reprogramming factors from the genome. In some embodiments the cells contain an inducible gene that encodes the recombinase, wherein the recombinase is expressed upon induction and excises the cassette. In some embodiments the inducible gene is integrated into the genome. In some embodiments the inducible gene is on an episome. In some embodiments the cells do not contain an inducible gene encoding the recombinase.
In some embodiments, the nucleic acid construct or cassette is targeted to a specific locus in the genome, e.g., using homologous recombination. In some embodiments the locus is one that is dispensable for normal development of most or all cell types in the body of a mammal. In some embodiments the locus is one into which insertion does not affect the ability to derive pluripotent iPS cells from a somatic cell having an insertion in the locus. In some embodiments the locus is one into which insertion would not perturb pluripotency of an ES cell. In some embodiments the locus is the COL1A1 locus or the AAV integration locus. In some embodiments the locus comprises a constitutive promoter. In some embodiments the construct or cassette is targeted so that expression of the polycistronic message encoding the polypeptide comprising the factors is driven from an endogenous promoter present in the locus to which the construct or cassette is targeted.
The invention further provides pluripotent reprogrammed cells (iPS cells) generated from the somatic cells that harbor the nucleic acid construct or expression cassette in their genome. The iPS cells can be used for any purpose contemplated for pluripotent cells. Further provided are differentiated cell lines (e.g., neural cells, hematopoietic cells, muscle cells, cardiac cells), derived from the pluripotent reprogrammed cells. Exemplary somatic cells and iPS cell generated therefrom are described in Example 3.
The present invention establishes that the reprogramming factors possess the requisite structural features to allow efficient processing of the 2A sequence when located between reprogramming factors, an important finding since it is recognized that cleavage is a structure-based event (Szymczak, supra). The present disclosure establishes that transcription factors having the additional ˜17-21 amino acids from the 2A peptide at their C-terminus retain the ability to enter the nucleus and perform their functions. The present disclosure also establishes that reprogramming factors can tolerate the presence of the additional ˜17-21 amino acids from the 2A peptide that remain on the C-terminus of the upstream protein and remain functional in reprogramming.
While reprogramming by infecting with high titer retroviral vectors to express the required reprogramming factors is highly reproducible, the process is relatively inefficient and the precise requirements in terms of timing and order of expression of the factors, as well as the absolute and relative levels of expression required, remain incompletely understood. Moreover, when iPS cells are generated by infecting cells with multiple viruses, each encoding a single factor, in many current protocols, each virus has been shown to cause integrations at between 2-6 locations, resulting in ˜14-20 insertion events throughout the genome. This process creates iPS cells that are genetically modified and may contain unknown insertion-generated mutations. Furthermore, since only a small fraction of infected cells become reprogrammed, the results obtained using these multi-virus protocols leave open the question as to whether the location of the integrations and/or the relative timing at which expression from the transgenes occurs is an important determinant of whether a cell will become reprogrammed. The instant invention establishes that essentially simultaneous expression of multiple factors from a polycistronic transcript and at relative levels dependent on the efficiency of the 2A cleavage event, is effective to induce reprogramming. Furthermore, the invention establishes that a single copy of the factors is sufficient for reprogramming. Because the four factors are expressed from a defined location in certain embodiments of the invention (e.g., a location that is preselected or one that is determined after integration of the vector) the polycistronic vector system may simplify the study of reprogramming mechanisms and facilitates the excision of the vector. In some embodiments, such excision results in removal of at least the exogenous sequences encoding the reprogramming factors. In some embodiments, such excision results in iPS cells that carry no genetic modification other than, in some embodiments, a residual recombinase site. In other embodiments, there are no more than 2, 3, 4, or 5 residual recombinase sites. Without wishing to be bound by theory, reprogramming cells containing a single integrated construct will increase the likelihood or ease of recovering transgene-free iPS cells using recombinase-based approaches. It is also contemplated that polycistronic vectors encoding 2, 3, or 4 factors may be used in combination with small molecules, proteins, or other agents that enhance reprogramming and/or that substitute for one or more factors not encoded by the polycistronic vector.
Example 4 describes experiments in which human induced pluripotent stem cells (hiPSCs) free of reprogramming factors were derived using Cre-recombinase excisable viruses from fibroblasts from individuals with Parkinson's disease (PD). In some embodiments of the invention, iPS cells carrying no exogenous genes encoding reprogramming factors are derived as described in Example 4 or using similar methods, except that a single vector comprising a polycistronic nucleic acid construct encoding a polyprotein comprising multiple (2, 3, or 4 factors) is used rather than multiple vectors encoding single factors. Of course the methods described in Example 4 can also be used with multiple vectors encoding individual factors in order to obtain iPS cells without exogenous genes encoding reprogramming factors, wherein the resulting iPS cells have only a small number of residual recombinase sites. While fibroblasts from individuals with PD were used as an exemplary cell type in Example 4, the methods are applicable to derive iPS cells with minimal genetic alteration from normal somatic cells (e.g., fibroblasts or other cell types such as keratinocytes, intestinal cells, blood cells) or from somatic cells from individuals with a disease of interest. In some embodiments, the gene encoding the transactivator is also flanked by recombinase sites, so that it is removed from the genome as well.
The iPS cells and differentiated cells obtained from them are of use for research purposes (e.g., as a model system to study the disease and/or identify therapeutic agents for the disease) and/or for the development of cell-based therapies, which in some embodiments are patient-specific cell-based therapies.
C. Developmental Potential of Human iPS Cells and Derivation from Peripheral Blood
An exciting potential of the iPS system is to derive patient specific pluripotent cells. Work described herein describes protocols that will allow the study of complex human diseases in vitro using patient specific iPS cells. For example, at present patient specific iPS cells are derived from deep skin biopsies. In an effort to establish a potentially more simple protocol to isolate iPS cells in a clinical setting procedures described here use peripheral blood as donor material for generating iPS cells.
Work described herein provides high throughput systems for identifying small molecules that improve reprogramming efficiency. This allows for the establishment of a reprogramming method that does not require the genetic manipulation or insertion of exogenous genetic elements such as vector mediated transduction of oncogenes like C-MYC or KLF4.
In the mouse system the use of vectors that allowed for drug inducible expression of the transcription factors has been crucial to define the molecular events that cause reprogramming. These experiments indicated that reprogramming involves the sequential activation of ES cell markers such as alkaline phosphatase, SSEA1, Oct4 and Nanog and that the transduced transcription factors needed to be expressed for at least 12 days in order to give rise to iPS cells [Brambrink, 2008 #6877]. A major goal of aim A is to generate tools that will help in reprogramming somatic cells and allow the genetic manipulation of human ES and iPS cells. These tools will be important for aim B which focuses on the mechanism of human somatic cell reprogramming. The goal of aim C is establishing experimental systems to evaluate the potential of human iPS cells to differentiate into functional neuronal cells in vitro as well as in vivo in chimeric mice. Furthermore, we will design protocols to generate iPS cells from human peripheral blood. Finally, the focus of aim D is to screen for chemical compounds as alternatives to activating reprogramming pathways by genetic means.
The ability to genetically alter endogenous genes by homologous recombination has revolutionized biology and, in combination with embryonic stem cells, holds great promise for molecular medicine. Although gene targeting is a routine procedure in mouse ES cells, it has previously been difficult to transfer this technology to human embryonic stem cells [Giudice, 2008 #6863]. Indeed, only 4 publications have appeared reporting successful targeting of an endogenous gene since the first isolation of human ES cells by Thomson 10 years ago [Davis, 2008 #6860; Irion, 2007 #6857; Zwaka, 2003 #6223; Urbach, 2004 #6163]. The difficulties of genetically modifying endogenous genes need to be overcome to realize the full potential of human ES cells.
The focus of this work is to establish tools that will allow for the efficient genetic manipulation of human ES and iPS cells. To produce huES cells carrying marker in lineage specific genes we will use two different approaches, genetically modified human ES cells were created carrying markers in key developmental regulators using conventional homologous recombination. These markers, inserted in lineage specific genes, will be used in subsequent aims for differentiation of iPS cells into specific neuronal lineages. An experimental system that allows for the efficient reprogramming of somatic cells in the absence of retrovirus mediated factor transduction was also developled.
The derivation of differentiated cells from undifferentiated ES cells is facilitated by markers inserted into lineage specific endogenous genes that can be used for the isolation of a desired differentiated cell type. Our preliminary experiments demonstrated targeting of the OCT4 as well as the COL1A1 locus with GFP or drug resistance markers. Accordingly a goal was togenerate ES and iPS cells that carry drug resistance markers and/or GFP (or other detectable marker) sequences in genes that are expressed in cells of the neural or other lineage and can be used for screening or selection of differentiated cell types that are affected in diseases such as Alzheimer's and Parkinson's.
In contrast to mouse ES cells, human ES cells are usually passaged mechanically using only limited enzymatic digestion as cellular cloning selects for chromosomal aberrations that enhance single cell growth. This as well as the slow growth may be important reasons that gene targeting has been so inefficient in huES cells. Recently, application of the ROCK inhibitor Y-27632 to huES cells has been shown to markedly diminish dissociation-induced apoptosis and to increase cloning efficiency [Watanabe, 2007 #6549]. All experiments will, therefore, be done in the presence of this inhibitor.
For homologous recombination, targeting vectors containing GFP and neo resistance markers separated by 2A sequences will be constructed from isogenic genomic DNA of BGO2 or H9 ES cells using routine procedures. The DNA will be electroporated into the cells following published procedures [Costa, 2007 #6868], and DNA from drug resistant colonies will be isolated and analyzed for correct targeting. We will target genes that are activated at different times during neural differentiation and in different subsets of neurons as detailed below.
SOX1: The transcription factor SOX1 is the earliest known gene that is exclusively expressed in neural precursors of the mouse [Aubert, 2003 #6841]. GFP inserted into this gene will serve as a convenient marker for selecting huES or iPS cell-derived neural precursor cells.
FOXG1: Expression of this gene has been demonstrated in proliferating telencephalic precursor cells and in acetyl-cholinergic neurons of the basal forebrain [Hebert, 2000 #6844], cells that are affected in Alzheimer's.
PITX3: This homeodomain transcription factor is selectively expressed during terminal differentiation of tyrosine hydroxylase positive neurons and sorting of differentiated ES cells derived from PITX3-GFP transgenic mice has been shown to enrich for dopaminergic neurons [Hedlund, 2008 #6845; Zhao, 2004 #6846].
LMX1: This homeodomain transcription factor appears to be a crucial determinant of proliferating dopaminergic precursor cells [Andersson, 2006 #6840].
The marking of relevant lineage specific genes by GFP has been shown to aid in establishing robust differentiation protocols that allow for the isolation of enriched or even homogeneous populations of differentiated cells. HuES cells carrying GFP in the 4 genes will allow enrichment for precursors as well as more differentiated cells that are relevant for the study of iPS cells derived from patients with diseases such as Alzheimer's or Parkinson's disease.
The difficulty of establishing efficient methods of homologous recombination has greatly impeded the utility of the huES cell system. Preliminary data are encouraging and demonstrate that two endogenous loci, OCT4 and COL1A1, have been targeted with GFP and puromycin resistance cDNAs (
We have shown that mouse iPS cells may carry 15 or more proviral inserts [Wemig, 2007 #6641] suggesting a strong selection for the small fraction of cells that harbor multiple copies of each vector to achieve high levels or a certain stoichiometry of factor expression required for the initiation of the reprogramming process. Described herein is a system that circumvents the need for viral transduction and thus eliminates the necessity to select for the small fraction of cells carrying the “right” combination of proviruses. Indeed, the generation of “secondary” fibroblasts that were clonally derived from “primary” iPS cells and carried the appropriate number of DOX inducible proviruses that had achieved reprogramming in the first place allowed us to reprogram mature B cells to a pluripotent state [Hanna, 2008 #6842]. This approach was adapted to human cells and generated secondary fibroblasts that carry the reprogramming factors (i) either as proviral vectors integrated into pre-selected chromosomal positions or (ii) inserted by homologous recombination into a genomic expression locus. This system can be used to determine the mechanisms of reprogramming and to screen for small molecules that enhance reprogramming or replace any of the factors.
(i). Secondary fibroblasts carrying pre-selected proviruses: To pre-select for cells that carry the “right” combination and number of retroviral copies, a two-step protocol may be utilized.
(ii). Secondary fibroblasts carrying reprogramming factors in the COL1A1 locus: In an effort to avoid all retrovirus infection secondary fibroblasts that carry all reprogramming factors in the COL1A1 locus or other non-essential locus such as ROSA26 or AAVS1 locus (a specific locus into which Adeno-associated virus (AAV) integrates) are produced. In mouse ES cells we have shown that the Col1a1 locus can be efficiently targeted resulting in reproducible ubiquitous or inducible expression of inserted transgenes [Beard, 2006 #6199; Hochedlinger, 2005 #5758]. Reporter cells will be constructed that carry, in addition to the Dox inducible rtTA transactivator and the OCT4 GFP reporter a polycistronic vector inserted into the COL1A locus encoding all or a subset of the reprogramming factors under the control of the tet operator (
Reprogramming selects for the small fraction of iPS cells that carry a high number of proviral insertions. The experiments proposed in this aim seek to establish an experimental system that allows a more efficient and reproducible reprogramming as the process would be independent of random proviral insertions that select the rare iPS cells. The goal is to generate secondary fibroblasts that carry any combination of 2 or 3 DOX inducible factors and thus would allow screening for small molecules that replace the missing factor(s) for our aim to screen for small molecules that can enhance or induce reprogramming (Aim D). Also, this system will be important for studying the molecular mechanisms of reprogramming (Aim B.4).
The DOX inducible lentivirus system has been used to define the reprogramming kinetics of mouse fibroblasts. Work described herein uses the tools described above to determine the kinetics and minimal vector expression for reprogramming of human somatic cells. Furthermore, we will develop methods of reprogramming that would minimize or circumvent genetic alterations and we will use insertional mutagenesis to isolate additional genes that enhance reprogramming. Finally, we will define the epigenetic state of iPS cells as well as of intermediate stages of reprogramming.
C. Developmental Potential and Derivation from Blood Donor Cells
The most important application of patient specific iPS cells is their potential use in studying complex human diseases in the test tube. For this application robust experimental approaches need to be established before this technology can be used in a clinical setting. Work described herein establishes procedures that allow the reproducible in vitro differentiation of iPS and huES cells and the evaluation of the in vivo potential of iPS cells. Isolation of iPS cells from peripheral human blood samples may also be performed.
It is of interest to directly reprogram cells obtained from peripheral blood samples instead of from deep skin biopsies, as this would facilitate generating patient specific iPS cells in a clinical setting. We have recently shown that immature and mature mouse B cells can efficiently be reprogrammed to pluripotent iPS cells and that these cells carried the donor cell specific genetic rearrangements of the immunoglobulin locus [Hanna, 2008 #6842]. Surprisingly, the efficiency of reprogramming mature mouse B cells was 3%, which is substantially higher than that of adult fibroblasts or MEFs. This aim will seek to adapt the methods used for reprogramming of mouse lymphoid cells to human peripheral blood samples. Donor cells: Transduction with the c/EBPa transcription factor was required to render mature mouse B cells susceptible to the action of the four reprogramming factors [Hanna, 2008 #6842]. We will isolate various cell populations from human peripheral blood and test their susceptibility to reprogramming.
(i) B and T cells: In an effort to adapt the protocol for mouse B cell reprogramming we will use established procedures to stimulate proliferation of B and T cells [Mercier-Letondal, 2008 #6855] and infect the cells with vectors transducing c/EBPa and the tet rtTA transactivator. After a few days of culture in cytokines the cells will be transduced with the four DOX inducible reprogramming factors OCT4, SOX2, C-MYC and KLF4 and cultured in ES cell medium. Reprogrammed colonies will be isolated by morphology and tested for the expression of pluripotency markers such as TRA160, SSEA3/4, NANOG and OCT4. To verify the donor cell origin of the iPS cells we will analyze genomic DNA for the presence of Ig or TCR rearrangements.
(ii) Monocytes: Our results with mouse suggested that an intermediate step in the reprogramming of mature B cells might be a macrophage-like cell [Hanna, 2008 #6842]. Monocytes will be isolated from buffy coats of human volunteers by Ficoll gradient centrifugation and adherent cells will be collected. The cells will be grown in IL4 and GM-CSF following established procedures [Damaj, 2007 #6854]. We will then transduce the cells with the four factors OCT4, SOX2, cMYC and KLF4 as above and continue cultivation in ES cell medium in the presence of DOX. Colonies with iPS morphology will be picked and analyzed for the expression of pluripotency markers as above. The developmental potential of the blood-derived iPS cells will be assessed by standard procedures such as teratoma formation and in vitro differentiation.
Presently, the strategy of isolating patient specific iPS cells envisions the reprogramming of donor cells derived from deep skin biopsies, a procedure that is more complex and painful than collecting blood. For the routine clinical application it would be of obvious interest to design reproducible protocols for the routine isolation of patient specific iPS cells from peripheral blood samples. We anticipate that the proposed experiments will help in establishing such protocols.
Given the ease and efficiency of mouse B cell reprogramming we are encouraged that this protocol should also be effective in reprogramming human peripheral blood derived cells. Because B or T cell-derived iPS cells would carry genetic rearrangements at the Ig or TCR locus, respectively, it may be advantageous for potential therapeutic applications to use macrophages or monocytes as donors as they would harbor no genetic changes. Although we do not know the mechanism that causes c/EBPalpha to render mature B cells susceptible to reprogramming by OCT4, SOX2, cMYC and KLF4, it may involve the conversion of B cell identity to that of macrophages [Xie, 2004 #5447]. These considerations suggest that deriving iPS cells from human monocytes may be straightforward. However, if the procedures developed in the mouse fail to yield blood derived human iPS cells, we will screen for additional factors using established approaches.
The induction of reprogramming by retroviral vector mediated gene transfer, in particular the transduction of oncogenes, represents a serious impediment to the eventual therapeutic application of this approach. For example, we and others [Okita, 2007 #6542] have seen that tumors form in chimeras produced with iPS cells due to v-myc c-Myc activation. It is, therefore, of interest to identify small molecules that would either improve reprogramming efficiency or would activate a relevant pathway and thus could replace the need for expressing a given factor such as C-MYC or KLF4. The goal of this aim is to establish high-throughput cell-based assay systems to screen chemical libraries for such compounds.
To detect reprogramming in a high-throughput screen we need cells carrying a marker such as GFP inserted into the endogenous OCT4 or NANOG locus. Such cells will not express the marker but can be used to screen for compounds that activate either of the endogenous genes.
For setting up a high-throughput screen for reprogramming we consider two major constraints that limit the experimental design.
To overcome these limitations we will generate fibroblast populations that are genetically homogenous because they (i) carry the identical number of vector integrations or (ii) carry various combinations of reprogramming factors inserted into an endogenous expression locus by homologous recombination.
(i). “Secondary” clonal fibroblasts that carry a specific and predetermined combination of proviruses: We have recently shown that “secondary” mouse iPS cells can be derived from “primary” iPS cells that had been generated by infection of fibroblasts with DOX inducible lentiviruses transducing the four transcription factors Oct4, Sox2, c-myc and Klf4 [Hanna, 2008 #6842]. Because the “right” combination and number of proviral copies was carried in the “secondary” fibroblasts, no viral infection was needed to induce reprogramming of B cells to secondary iPS cells.
We will follow a similar protocol to pre-select for cells that carry the “right” combination and number of retroviral copies. As shown in
(ii). Transgenic fibroblasts that carry DOX-inducible reprogramming factors in the COL1A1 locus: We have shown that transgenes inserted into the Col1a1 locus are highly expressed in transgenic mice and, if under the control of the tet operator, are reproducibly activated in all tissues upon DOX application [Beard, 2006 #6199; Hochedlinger, 2005 #5758]. We will insert polycistronic constructs expressing different combinations of 3 or of all four reprogramming factors under the control of the tet operator into the COL1A1 locus of huES cells carrying the GFP marker in the OCT4 locus (
D.2 Screen for Compounds that Enhance Reprogramming Efficiency
To screen for compounds that increase reprogramming efficiency we will culture secondary iPS cells carrying the “right” combination of all four factors or fibroblasts carrying all four factors in the COL1A1 locus in the presence of DOX (
In pilot screens we will test the fraction of GFP positive cells arising in the four factor reporter cells, which are cultured in the presence of DOX and have or have not been treated with 5-azadC or infected with the DNMT1 siRNA vector, both of which will decrease global DNA methylation levels, a treatment which has been shown to enhance reprogramming of mouse fibroblasts [Mikkelsen, 2008 #6891]. The fraction of GFP positive cells under any of these conditions will determine how many cells need to be plated per well to detect a compound that enhances the fraction of GFP positive cells in a less stringent screen. A more stringent screen would use cells that have not been treated with 5-azadC or infected with the DNMT1 siRNA vector as this would monitor non-sensitized cells for compounds that more efficiently activate the reporter than above.
D.3 Screen for Compounds that Replace any of the Four Factors
To screen for compounds that could replace any of the retrovirus transduced factors we will transduce cells with vectors that can be independently regulated. The concept of the approach is that 3 factors will be under the control of one inducible system and the fourth factor under independent inducible control. We will use two different strategies to produce the cells used for screening.
(i) Tamoxifen inducible vectors: We have generated vectors transducing OCT4, SOX2, KLF4 and C-MYC estrogen receptor (ER) fusion constructs [Grandori, 1996 #6505] whose expression is activated by the addition of tamoxifen to the medium (
(ii) Transgenic fibroblasts carrying different combinations of factors in the COL1A1 locus: We will pursue an alternative strategy that avoids retroviral infection as outlined in
The screening of small molecule libraries will be performed in collaboration with the laboratory of S. Ding at Scripps (see letter by S. Ding). For example, the Ding laboratory has developed and optimized cell-based phenotypic high throughput screens [Xu, 2008 #6875] and identified the small molecule pluripotin that sustains self renewal of ES cells in chemically defined medium and in the absence of LIF [Chen, 2006 #6871]. The screen was based upon the expression of an Oct4 promoter driven GFP marker. We will screen the OCT4-GFP transgenic fibroblasts carrying the different combinations of factors as described above for GFP activation.
The activity of any compounds that score positive in the screens will be verified under defined culture conditions. A major issue will be to investigate the molecular pathways that are involved in the reprogramming process.
Possible outcome and interpretation: We expect that the screen for activation of the OCT4 gene will identify compounds that facilitate the transition from a somatic epigenetic state to one that is characteristic of pluripotent cells and thus render the reprogramming process more efficient. Another important goal of these experiments is to find small molecule compounds that could replace the need for genetic manipulations involving transduction of genes encoding oncogenes such as cMYC, OCT4 or KLF4.
The two most significant potential problems for a high-throughput screen are (i) the time required for reprogramming to take place and (ii) whether a rare reprogramming event can be detected in the limited number of cells that can be plated per well of a 96 or 384 well plate. As discussed above, we will precondition the cells to carry the “right” number and combination of factors and further sensitize the cells to increase the frequency of reprogramming-induced activation of the various reporter genes. Once compounds have been identified which increase reprogramming efficiency they will be used as sensitizers in subsequent screens for additional compounds that could further enhance iPS cell formation.
Significance: The present strategies to induce reprogramming rely on the transduction of powerful oncogenes, a stumbling block to any therapeutic application. This goal seeks to identify small molecules that could activate relevant pathways and thus would improve efficiency and possibly minimize the genetic alterations required for inducing reprogramming.
The method of the in vitro generation of pluripotent iPS cells promises to revolutionize the study of complex human diseases and has significant implications for the eventual treatment of degenerative diseases. In vitro reprogramming of mouse somatic cells to a pluripotent state has been shown to be reasonably efficient and the underlying molecular mechanisms of this process are being actively studied. However, reprogramming of human cells has proved to be more laborious and difficult and major technical issues need to be resolved before this technology could be adapted for clinical use. Work described herein seeks to define the molecular mechanisms that bring about the conversion of human somatic cells to a pluripotent state, to devise strategies for assessing the developmental potential of human iPS cells and to achieve reprogramming without the need for genetic manipulation. Work described herein will contribute to solving some of the crucial obstacles that presently hamper the application of the technology to study human diseases and to its eventual use for transplantation therapy of degenerative diseases.
Construction of 4F2A lentiviral vectors containing Oct4, Sox2, Klf4, and c-Myc under control of the tetracycline operator and a minimal CMV promoter was generated after EcoRI cloning from a FUW lentivirus backbone. All constructs were generated using unique restriction sites after amplification by PCR to place an individual factor between a respective 2A peptide (1st XbaI-NheI; 2nd SphI; 3rd XhoI; 4th AscI). Respective 2A sequences:
Replication-incompetent lentiviral particles (4F2A and M2rtTA) were packaged in 293T cells with a VSV-G coat and used to infect MEFs containing a GFP allele targeted to the endogenous Nanog locus (25) (7). 14-week old tail tip fibroblasts were derived from mice previously published (12). Human keratinocytes (NHFK) were obtained from Coriell Institute for Medical Research Camden, N.J. Viral supernatants from cultures packaging each of the two viruses were pooled, filtered through a 0.45 muM filter and subjected to ultracentrifugation for concentration. Virus pellets were resuspended in ES cell medium (DMEM supplemented with 10% FBS (Hyclone), leukemia inhibitory factor, (3-mercaptoethanol (Sigma-Aldrich), penicillin/streptomycin, L-glutamine and nonessential amino acids (all from Invitrogen) before being applied to cells for 24 hours.
100 μl of lysis buffer containing 2% SDS, 10 mM dithiothreitol, 10% glycerol, 12% urea, 10 mM Tris-HCl (pH 7.5), 1 mM phenylmethylsulfonyl fluoride, 1× protease inhibitor mixture (Roche), 25 μM MG132 proteosome inhibitor, and boiled for 5 min. Proteins were then quantified using Bradford reagent (Pierce) and taking spectrophotometric readings at 590 nm. Concentrations were estimated against a standard curve generated using bovine serum albumin. Total protein (5 μg) was subjected to electrophoreses in a denaturing 10% polyacrylamide gel containing 10% SDS. Proteins were then transferred onto Immobilon-P membranes (Millipore) using a semi-dry transfer apparatus. Membranes were blocked in PBS, 0.01% Tween 20 containing 2% nonfat powdered milk (Bio-Rad). Proteins were detected by incubating with antibodies at a concentration of 50 ng/ml in blocking solution. Antibodies used were Oct4 (h-134 Santa Cruz Biotechnology); Sox2 (mouse monoclonal R&D Biosystems); c-Myc (06-340 Upstate); Klf4 (H-180 Santa Cruz Biotechnology); GAPDH (sc-25778 Santa Cruz Biotechnology).
Total RNA was isolated using Trizol reagent (Invitrogen). Five micrograms of total RNA was treated with DNase I to remove potential contamination of genomic DNA using a DNA Free RNA kit (Zymo Research). One microgram of DNase I-treated RNA was reverse transcribed using a First Strand Synthesis kit (Invitrogen) and ultimately resuspended in 100 mul of water. Quantitative PCR analysis was performed in triplicate using 1/50 of the reverse transcription reaction in an ABI Prism 7000 (Applied Biosystems) with Platinum SYBR green qPCR SuperMix-UDG with ROX (Invitrogen). Equal loading was achieved by amplifying GAPDH mRNA and all reactions were performed in triplicate. Primers used for amplification were as follows:
Error bars represent s.d. of the mean of triplicate reactions.
10 μg of BamHI digested genomic DNA was separated on a 0.7% agarose gel, transferred to a nylon membrane (Amersham) and hybridized with 32P random primer (Stratagene) labeled probes for OCT4 (EcoRI-PstI fragment of pFUW-tetO-OCT4 plasmid), KLF4 (full length KLF4 cDNA), c-MYC (full length c-MYC cDNA) and SOX2 (full length fragment of pFUW-tetO-SOX2 plasmid).
Cells were fixed in 4% paraformaldehyde for 20 minutes at 25° C., washed 3 times with PBS and blocked for 15 min with 5% FBS in PBS containing 0.1% Triton-X. After incubation with primary antibodies against Oct4 (Santa Cruz h-134), Sox2 (R&D Biosystems), Nanog (anti-ms R&D and anti-h), Tra-1-60, (mouse monoclonal, Chemicon International); hNANOG (goat polyclonal R&D Systems); mNANOG (Bethyl A300-398A), Tra1-81 (mouse monoclonal, Chemicon International), SSEA4 and SSEA1 (monoclonal mouse, Developmental Studies Hybridoma Bank) for 1 h in 1% FBS in PBS containing 0.1% Triton-X, cells were washed 3 times with PBS and incubated with fluorophore-labeled appropriate secondary antibodies purchased from Jackson Immunoresearch. Specimens were analyzed on an Olympus Fluorescence microscope and images were acquired with a Zeiss Axiocam camera.
Diploid blastocysts (94-98 h after hCG injection) were placed in a drop of Hepes-CZB medium under mineral oil. A flat tip microinjection pipette with an internal diameter of 16 m was used for iPS cell injections. Each blastocyst received 8-10 iPS cells. After injection, blastocysts were cultured in potassium simplex optimization medium (KSOM) and placed at 37° C. until transferred to recipient females. About 10 injected blastocysts were transferred to each uterine horn of 2.5-day-postcoitum pseudo-pregnant B6D2F1 female. Pups were recovered at day 19.5 and fostered to lactating B6D2F1 mothers when necessary. Teratoma formation was performed by depositing 2×10{circumflex over ( )}6 cells under the flanks of recipient SCID or Rag2−/− mice. Tumors were isolated 3-6 weeks later for histological analysis.
hiPSCs were collected by collagenase treatment (1.5 mg/ml) and separated from feeder cells by subsequent washes with medium and sedimentation of iPSC colonies. iPSC aggregates were collected by centrifugation and resuspended in a ratio of 10{circumflex over ( )}6 cells in 250l1 of iPSC culture media. iPSCs were injected subcutaneously by 21 gauge needle in the back of SCID mice (Taconic). A tumor developed within 6 weeks and the animal was sacrificed before tumor size exceeded 1.5 cm in diameter. Teratomas were isolated after sacrificing the mice and fixed in formalin. After sectioning, teratomas were diagnosed base on hematoxylin and eosin staining. Karyotype analysis was done with CLGenetics (Madison, Wis.).
In Vitro Differentiation of Human IPS Cells into Neuronal Progenitors:
Human keratinocyte iPS cells were allowed to outgrow in culture without pasaging for 2 weeks with daily medium change. At day 15 after passage distinct neural rossets were observed and picked mechanically by pooled glass pipett (26). Rosettes were replated on dishes precoated with 15 μg/ml polyomithin/10 μg/ml of laminin (Po/Lam) in N2B27 medium supplemented with FGF2 (20 ng/ml) EGF (20 ng/ml) (All R&D Systems). After 5-7 d cells were dissociated by scraping with cell lifter and pippeting to single cells in N2B27 medium and replated to Po/Lam culture dishes.
Induction of differentiation of neural progenitors was performed by withdrowal of FGF2 and EGF from culture medium for 5 days. Cells were fixed in 4% paraformaldehyde for 20 min and stained for human nestin (Chemicon; 1:100) and Tuj-1 (1:100) and subsequently washed 3 times with PBS and incubated with fluorophore-labeled appropriate secondary antibodies purchased from Jackson Immunoresearch. Specimens were analyzed on an Olympus Fluorescence microscope and images were acquired with a Zeiss Axiocam camera.
Vectors were constructed with different combinations of two, three, or all four reprogramming factors from one promoter. The goal was to generate polycistronic viral vectors that would express multiple reprogramming genes from a single promoter using 2A peptides. For this one, two, or three 2A oligopeptides containing unique restriction sites were ligated into FUW lentivirus (18) backbones to allow efficient cloning of Oct4, Sox2, c-Myc and Klf4 each separated by a different 2A sequence. Vectors carrying four, three or two factors consecutively with different combinations of F2A, T2A, E2A or P2A sequences (
To test the utility of polycistronic vectors for reprogramming we initially transduced retroviral vectors carrying different combinations of 2 or 3 reprogramming factors into MEFs and showed that these constructs were able to generate iPS cells in combination with vectors carrying the additional single factor-cDNA(s). Importantly, a polycistronic vector carrying all four factors was able to generate iPS cells. In this preliminary experiment we co-infected Oct4-GFP fibroblasts with the polycistronic Sox2-Oct4-Klf4-myc vector and an additional Oct4 vector (to account for the possibility that relatively more Oct4 protein might be needed for reprogramming;
A tetracycline inducible lentivirus vector was constructed where expression of the genes was controlled from the tetracycline operator minimal promoter (tetOP;
To test whether the 4F2A vector was able to reprogram somatic cells to a pluripotent state MEFs containing a GFP reporter driven by the endogenous Nanog promoter were infected with virus (4F2A+rtTA). 85-90% of the cells stained for Oct4 at 48 hours after transduction indicating high titre infection (
To investigate whether adult somatic cells could be reprogrammed using the 4F2A vector, we infected tail-tip fibroblasts (TTFs) from 14 week-old mice with the 4F2A+rtTA vectors. Similar to MEFs, typical morphological changes were observed a few days after addition of DOX media. Colonies appeared around 8 days and continued to expand until they were picked (day 16) based on morphology. After several passages four stable iPS cell lines were established that stained positive for all pluripotency markers (Nanog, Oct4, SSEA1, AP) (
To determine the number of proviruses carried in the 4F2A iPS cell lines, DNA was extracted and subjected to Southern blot analysis using an enzyme that does not cut in the vector sequences. Using Oct4, Sox2, c-Myc and Klf4 probes for hybridization, we detected bands of identical molecular weight confirming that the factor sequences were carried in one provirus. The total number of proviruses was between one and three with iPS cell line #4 carrying a single viral insert (
To estimate reprogramming efficiency MEFs were infected with the 4F2A and rtTA vectors and plated at 0.25×10{circumflex over ( )}6 per 10 cm plate culture dish. About 70% of the MEFs were infected as estimated by immunostaining of Oct4 at 48 hours after infection (
To test the kinetics of reprogramming using the 4F2A virus we performed dox-withdrawl experiments where at specified days (i.e. 2, 4, 8, 12 etc) DOX containing media is replaced with ES media and the number of Nanog-GFP+ colonies are counted at day 25. Using separate drug-inducible viruses to deliver the four factors it has been reported that ˜9-12 days is the minimum time required for the generation of stable iPS cells (20, 21). Cells are not passaged during this time in order to minimize duplication of reprogramming events. Two independent experiments were performed and in both cases single Nanog-GFP+ colonies were present on plates cultured in DOX media for 8 days, similar to the minimum time required using separate viruses (
These data demonstrate that a single polycistronic virus containing the four factors linked by three 2A peptides allows factor expression sufficient to generate iPS cells from embryonic or adult somatic cells. Importantly, our results also show that a single polycistronic proviral copy is sufficient to reprogram somatic cells to pluripotency.
To investigate whether human cells could be reprogrammed with the polycistronic vector, neonatal human foreskin keratinocytes (NHFK) were transduced with both the constitutive rtTA and DOX-inducible 4F2A vectors. The fraction of infected cells was 10% as determined by staining for Oct4 at 48 hours after transduction (
To test for pluripotency, one line, Ker-iPS #1.1, was injected subcutaneously into SCID mice. These cells induced teratomas and after histological examination differentiated into cells of all three germ layers (
The experiments described above show that up to four different reprogramming factors inserted into a polycistronic vector separated by 2A sequences can be expressed at levels sufficient to achieve reprogramming. Embryonic and adult murine fibroblasts as well as postnatal human keratinocytes were induced to form pluripotent iPS cells when infected with the FUW rtTA and 2A vector transducing Oct4, Sox2, Klf4 and c-Myc.
We observe a reprogramming efficiency significantly lower than previous experiments using single vectors to transduce each of the four factors (
It is possible that the lower reprogramming efficiency is due to the stochiometry of factor expression from the polycistronic vector, which may be suboptimal for inducing reprogramming. Transduction with separate vectors allows integration of different numbers of proviruses for each factor, therefore reprogramming may select for a specific set of proviral integrations that result in high expression or an optimal stochiometry between the different factors. However, the 2A system, has been reported to support near equimolar protein expression in vivo (17). Also, when separate vectors transducing each of the four factors were used for induction of iPS cells, Nanog-GFP positive cells were detected as early as 16 days after DOX induction in contrast to GFP positive cells observed 22-25 days after 4F2A vector transduction, consistent with less optimal reprogramming. Moreover, whereas iPS cells frequently carry multiple Oct4 or Klf4 proviruses, consistently fewer Sox2 proviruses were found suggesting that a high level of Sox2 expression may perhaps be unfavorable for reprogramming (24).
In other experiments, the flp-in transgenic system is used to create multiple murine cell lines containing 4-, 3- and 2-factor 2A constructs in the collagen gene locus (
All primary fibroblast cell lines described in this paper were purchased from the Coriell Cell Repository. Fibroblasts were cultured in fibroblast medium [DMEM supplemented with 15% FBS (Hyclone), 1 mM glutamine (Invitrogen), 1% nonessential amino acids (Invitrogen) and penicillin/streptomycin (Invitrogen)]. HiPSCs and the hESC lines BG01 and BG02 (NIH Code: BG01 and BG02; BresaGen, Inc., Athens, Ga.) were maintained on mitomycin C (MMC)-inactivated mouse embryonic fibroblast (MEF) feeder layers in hESC medium [DMEM/F12 (Invitrogen) supplemented with 15% FBS (Hyclone), 5% KnockOut™ Serum Replacement (Invitrogen), 1 mM glutamine (Invitrogen), 1% nonessential amino acids (Invitrogen), 0.1 mM β-mercaptoethanol (Sigma) and 4 ng/ml FGF2 (R&D systems)]. Cultures were passaged every 5 to 7 days either manually or enzymatically with collagenase type IV (Invitrogen; 1.5 mg/ml). Human embryonic stem cells H9 (NIH Code: WA09, Wisconsin Alumni Research Foundation, Madison, Wis.) were maintained on MMC-inactivated MEFs or on MMC-inactivated human fibroblasts (D551; American Type Culture Collection, Manassas, Va.) according to the manufacturer's protocol. For EB induced differentiation, ESC/hiPSC colonies were harvested using 1.5 mg/ml collagenase type IV (Invitrogen), separated from the MEF feeder cells by gravity, gently triturated and cultured for 10 days in non-adherent suspension culture dishes (Corning) in DMEM supplemented with 15% FBS.
For Cre-recombinase mediated vector excision, hiPSC lines were cultured in Rho Kinase (ROCK)-inhibitor (Calbiochem; Y-27632) 24 hours prior to electroporation. Cell were harvested using 0.05% trypsin/EDTA solution (Invitrogen) and 1×107 cells resuspended in PBS were transfected with either pCre-PAC (50 jtg; Taniguchi et al., 1998) or co-transfected with pTurbo-Cre (40 μg; Genbank Accession Number AF334827) and pEGFP-N1 (10 μg; Clontech) by electroporation as described previously (Costa et al., 2007; Gene Pulser Xcell System, Bio-Rad: 250 V, 500 μF, 0.4 cm cuvettes). Cells were subsequently plated on MEF feeder layers (DR4 MEFs for puromycin selection) in hESC medium supplemented with ROCK-inhibitor for the first 24 hours. Cre-recombinase expressing cells were selected using one of the following methods: 1) addition of puromycin (2 jtg/ml) 2 days after electroporation for a period of 48 hours. 2) FACS sorting (FACS-Aria; BD-Biosciences) of a single cell suspension for EGFP expressing cells 60 hours after electroporation followed by replating at a low density in ROCK-inhibitor containing hESC medium. Individual colonies were picked 10 to 14 days after electroporation.
The FUW-M2rtTA lentiviral vector and lentiviral vectors containing the human c-DNAs for KLF4 (FUW-tetO-hKLF4), OCT4 (FUW-tetO-hOCT4), SOX2 (FUW-tetO-hSOX2), and c-MYC (FUW-tetO-hMYC) under the control of the tetracycline operator and a minimal CMV promoter have been described previously (Hockemeyer et al., 2008). To generate the Cre-recombinase excisable DOX-inducible lentiviral vectors, a Not I/Bsu36 I fragment containing the tetracycline operator/minimal CMV promoter and the human c-DNAs for either KLF4, OCT4 or SOX2 were subcloned from each FUW-tetO vector into the Not I/BSU36 I sites of the FUGW-loxP, which contains a loxP site in the 3′LTR (Hanna et al., 2007).
Lentiviral Infection and hiPSC Derivation
VSVG coated lentiviruses were generated in 293 cells as described previously (Brambrink et al., 2008). Briefly, culture medium was changed 12 hours post-transfection and virus-containing supernatant was collected 60-72 hours post transfection. Viral supernatant was filtered through a 0.45 am filter. Virus-containing supernatants were pooled for 3 and 4 factor infections and supplemented with FUW-M2rtTA virus and an equal volume of fresh culture medium. 1×106 human fibroblasts were seeded 24 hours before transduction in T75 flasks. Four consecutive infections in the presence of 2 μg/ml of polybrene were performed over a period of 48 hours. Culture medium was changed 12 hours after the last infection. Five days after transduction, fibroblasts were passaged using trypsin and re-plated at different densities between 5×104 and 2×105 cells per 10 cm2 on gelatin coated dishes. To induce reprogramming, culture medium was replaced 48 hours later by hESC medium supplemented with DOX (Sigma-Aldrich; 2 μg/ml). HiPSCs colonies were picked manually based on morphology between 3 and 5 weeks after DOX-induction and manually maintained and passaged according hESC protocols in the absence of DOX. To determine reprogramming efficiencies, 1×105 human fibroblasts were seeded onto 10 cm2 gelatin coated dishes. Reprogramming efficiencies were calculated after 20 days based on immunocytochemistry for the pluripotency markers Tra-1-60 and NANOG.
RNA was isolated from hESCs and iPSCs, which were mechanically separated from feeder cells, using the RNeasy Mini Kit (Qiagen). 2 μg total RNA was used to prepare biotinylated cRNA according to the manufacturer's protocol (Affymetrix One Cycle cDNA Synthesis Kit). Briefly, this method involves SuperScript II-directed reverse transcription using a T7-Oligo(dT) Promoter Primer to create first strand cDNA. RNase H-mediated second strand cDNA synthesis is followed by T7 RNA Polymerase directed in vitro transcription, which incorporates a biotinylated nucleotide analog during cRNA amplification. Samples were prepared for hybridization using 15 μg biotinylated cRNA in a 1× hybridization cocktail according the Affymetrix hybridization manual. GeneChip arrays (Human U133 2.0) were hybridized in a GeneChip Hybridization Oven at 45° C. for 16 hours at 60 RPM.
Washing was done using a GeneChip Fluidics Station 450 according to the manufacturer's instructions, using the buffers provided in the Affymetrix GeneChip Hybridization, Wash and Stain Kit. Arrays were scanned on a GeneChip Scanner 3000 and images were extracted and analyzed using GeneChip Operating Software v1.4.
U133 Plus 2.0 microarrays (Affymetrix) were processed using the MASS algorithm and absent/present calls for each probeset were determined using the standard Affymetrix algorithm, both as implemented in Bioconductor. Probesets that were absent in all samples were removed for subsequent analysis. Differential expression was determined a moderated t-test using the ‘limma’ package in R (corrected for false discovery rate) or by fold change. Where a gene was represented by multiple probesets (based on annotation from Affymetrix), gene expression log-ratios and p-values were calculated as the mean and minimum of these probesets, respectively. Hierarchical clustering was performed on log-transformed gene expression ratios using uncentered Pearson correlation and pairwise average linkage. Correlations were compared using Fisher's Z transformation. Confidence of the hierarchical clustering was computed using multiscale bootstrap resampling with the R package ‘pvclust’.
RNA was isolated from EBs or hESCs and iPSCs, which were mechanically separated from feeder cells, using either the RNeasy Mini Kit (Qiagen) or Trizol extraction and subsequent ethanol precipitation. Reverse transcription was performed on 1 μg of total RNA using oligo dT priming and Thermoscript reverse transcriptase at 50° C. (Invitrogen). Real-time PCR was performed in an ABI Prism 7000 (Applied Biosystems) with Platinum SYBR green pPCR SuperMIX-UDG with ROX (Invitrogen) using primers that were in part previously described (Hockemeyer et al., 2008; Yu et al., 2007) and in part are described in Soldner, et al., 2009, Supplemental Experimental Procedures.
HiPSCs were collected by collagenase treatment (1.5 mg/ml) and separated from feeder cells by subsequent washes with medium and sedimentation by gravity. HiPSC aggregates were collected by centrifugation and resuspended in 250 μl of phosphate buffered saline (PBS). HiPSCs were injected subcutaneously in the back of SCID mice (Taconic). Tumors generally developed within 4-8 weeks and animals were sacrificed before tumor size exceeded 1.5 cm in diameter. Teratomas were isolated after sacrificing the mice and fixed in formalin. After sectioning, teratomas were diagnosed based on hematoxylin and eosin staining.
Genomic DNA was collected from hESCs and hiPSCs by mechanical separation from feeder cells. DNA was proteinase K treated and phenol chloroform extracted and 1 μg of DNA was subjected to conversion using the Qiagen EpiTect Bisulfite Kit. Promoter regions of OCT4 were amplified using previously described primers (Yu et al., 2007):
PCR products were cloned using the pCR2.1-TOPO vector and sequenced using M13 forward and reverse primers.
Cells were fixed in 4% paraformaldehyde in PBS and immunostained according to standard protocols using the following primary antibodies: SSEA4 (mouse monoclonal, Developmental Studies Hybridoma Bank); Tra 1-60, (mouse monoclonal, Chemicon International); hSOX2 (goat polyclonal, R&D Systems); Oct-3/4 (mouse monoclonal, Santa Cruz Biotechnology); hNANOG (goat polyclonal R&D Systems); appropriate Molecular Probes Alexa Fluor® dye conjugated secondary antibodies (Invitrogen) were used.
XbaI, EcoRI or MfeI digested genomic DNA was separated on a 0.7% agarose gel, transferred to a nylon membrane (Amersham) and hybridized with 32P random primer (Stratagene) labeled probes for OCT4 (EcoRI-PstI fragment of pFUW-tetO-hOCT4 plasmid), KLF4 (full length hKLF4 cDNA), c-MYC (full length c-MYC cDNA), SOX2 (FspI-EcoRI fragment of pFUW-tetO-hSOX2 plasmid) and M2rtTA (380 bp C-terminal fragment of the M2rtTA c-DNA).
Microarray data are available at the NCBI Gene Expression Omnibus database under the series accession number GSE14711.
In this example we show that fibroblasts from five patients with idiopathic Parkinson's disease (PD) can be efficiently reprogrammed. Moreover, we derived human induced pluripotent stem cells (hiPSCs) free of reprogramming factors using Cre-recombinase excisable viruses. Factor-free iPSCs maintain a pluripotent state and show a global gene expression profile, more closely related to hESCs than to hiPSCs carrying the transgenes. Our results indicate that residual transgene expression in virus-carrying hiPSCs can affect their molecular characteristics and suggest that factor-free hiPSCs therefore represent a more suitable source of cells for modeling of human disease.
Reprogramming of Fibroblasts from PD Patients by DOX-Inducible Lentiviral Vectors
Dermal fibroblasts from five patients with idiopathic PD (age of biopsy between 53 and 85 years) and from two unaffected subjects were obtained from the Coriell Institute for Medical Research (see Table 4). To induce reprogramming, 1×106 fibroblasts were infected with a constitutively active lentivirus expressing the reverse tetracycline transactivator (FUW-M2rtTA) together with DOX-inducible lentiviruses transducing either 4 (OCT4, SOX2, c-MYC, KLF4) or 3 (OCT4, SOX2, KLF4) reprogramming factors. We will subsequently refer to hiPSC lines derived by transduction of 4 factors as hiPSC4F and those obtained by 3 factors as hiPSC3F Colonies with well-defined hESC like morphology were selected and manually picked 3 to 5 weeks after DOX-induced transgene expression. All fibroblasts obtained from PD patients and non-PD patients gave rise to stable hiPSCs that were maintained in the absence of DOX for more than 30 passages. At least one cell line from each donor fibroblast line was analyzed in detail (Table 4). All of these hiPSCs uniformly expressed the pluripotency markers Tra-1-60, SSEA4, OCT4, SOX2 and NANOG as determined by immunocytochemistry (
Cytogenetic analysis of PD specific hiPSC lines revealed a normal karyotype in 11 out of 12 lines (see Supplemental FIG. 1 of Soldner, 2009). Only one out of three clones derived from the fibroblast line PDD that had been transduced with 4 factors (iPS PDD4F-5), showed an unbalanced translocation between the long-arm of chromosome 18 and the long arm of chromosome 22 resulting in a derivative chromosome 18 and a single copy of chromosome 22. Two independent hiPSCs derived from a non-PD patient fibroblast line (iPS M3F-1 and iPS M3F-2) showed a balanced translocation between the short and long arms of chromosomes 4 and 7, suggesting that the 4; 7 translocation was already present in the donor fibroblasts (see Soldner, et al., 2009, Supplemental
In order to further characterize the usefulness of this system, we determined the reprogramming efficiencies for one fibroblast line (PDB) in detail. Reprogramming efficiencies were calculated after 20 days based on immunocytochemistry for the pluripotency markers Tra-1-60 and NANOG. HiPSCs arose with an efficiency of approximately 0.005% after transduction with 3 factors and approximately 0.01% after transduction with 4 factors. This is comparable to previously reported efficiencies using either Moloney-based retroviral vectors or constitutively active lentiviral vectors (Nakagawa et al., 2008; Takahashi et al., 2007; Yu et al., 2007). Immunocytochemistry for NANOG and Tra-1-60 at different time points after DOX addition revealed that small pluripotent colonies could be detected in 4 factor transduced fibroblasts as early as 8 days after transgene induction (
The results described so far show that DOX-inducible delivery of the reprogramming factors can efficiently generate hiPSCs from skin biopsies obtained from PD patients in the absence of c-MYC with similar kinetics and efficiencies as previously reported using other approaches. Importantly, 8 of 13 3 factor hiPSCs carried a total of only 3 to 5 proviral integrations (
Generation of PD Patient-Derived hiPSCs Free of Viral Reprogramming Factors
In order to derive hiPSCs that were free of proviruses, we generated lentiviral vectors that could be excised after integration using Cre-recombinase. The human ubiquitin promoter of the FUGW-loxP lentivirus, which contains a loxP site in the 3′LTR (Hanna et al., 2007), was replaced with a DOX-inducible, minimal CMV promoter followed by the human c-DNAs for OCT4, KLF4 or SOX2. Upon proviral replication, the loxP site in the 3′LTR is duplicated into the 5′LTR resulting in an integrated transgene flanked by loxP sites in both LTRs (
We focused on two clones, with either 5 (PDB2lox-21) or 7 (PDB2lox-17) total integrations of the reprogramming factors to test whether the excision of the loxP site-flanked lentiviral vectors would generate transgene-free cells. Two different strategies for Cre-mediated vector excision were used (
All virus-free clones retained a stable hESC like morphology upon prolonged culture for more than 15 passages and maintained all the characteristics of hIPSCs such as expression of the hESC related marker proteins Tra-1-60, SSEA4, OCT4, SOX2 and NANOG as shown by immunocytochemistry (
In order to compare residual transgene expression between distinct hiPSCs with integrated transgenes and factor-free hiPSCs, we performed quantitative RT-PCR using transgene-specific PCR primers. As reported previously using either lentiviral or Moloney-based retroviral vectors (Dimos et al., 2008; Ebert et al., 2008; Hockemeyer et al., 2008; Park et al., 2008a; Yu et al., 2007) we detected residual expression of the reprogramming factors for most of the transgenes in all cell lines with integrated viruses but not in uninfected fibroblasts, hESCs, or PDB1lox lines (
To address whether residual transgene expression could affect the overall gene expression profile of the reprogrammed cells, we compared hESCs, the parental fibroblasts, and hiPSCs before and after transgene excision by genome-wide gene expression analysis. Initial correlation analysis based on all genes which show at least a 4-fold expression difference between fibroblasts and hESCs confirmed that all hiPSCs are closely related to hESCs regardless of whether the transgenes were removed or not (see Soldner, et al. 2009, Supplemental
In the work described in this example we derived hiPSCs from skin biopsies obtained from patients with idiopathic PD. We developed a robust reprogramming protocol that allows the reproducible generation of patient-specific hiPSCs carrying a low number of proviral vector integrations. The use of modified lentiviruses carrying a loxP site flanking the integrated proviruses allowed the efficient removal of all transgene sequences and generated reprogramming-factor-free hiPSCs. The factor-free hiPSCs were pluripotent and, using molecular criteria, were more similar to embryo-derived hESCs than to the conventional vector-carrying parental hiPSCs. Efforts to understand the underlying pathophysiology of many neurodegenerative diseases such as PD are hampered by the lack of genuine in vitro models. Using hiPSC technology we established hiPSC lines from five patients with idiopathic PD using DOX-inducible lentiviral vectors transducing either 3 or 4 reprogramming factors. These cells were shown to have all of the features of pluripotent ES cells including the ability to differentiate into cell types of all embryonic lineages.
Our results indicate that removal of the integrated transgenes by Cre/lox mediated recombination can lead to vector-free hiPSCs. A previous report failed to excise transgenes flanked by loxP sites (Takahashi and Yamanaka, 2006). Without being bound by theory, this is probably due to the high number of retroviral integrations (more than 20) which made complete removal of all proviruses impossible or caused catastrophic genomic instability. Our results, based upon DOX-inducible lentiviral transduction, show that hiPSCs carrying as few as 3 or 4 viral integrations can be generated. Using DOX-inducible lentiviral vectors with a loxP site within the 3′LTR, we derived PD patient-specific reprogramming factor-free hiPSCs after Cre-recombinase mediated excision of the transgenes. Removal of the promoter and transgene sequences in self-inactivating (SIN) lentiviral vectors is expected to considerably reduce the risk of oncogenic transformation due to virus mediated oncogene activation and/or re-expression of the transduced transcription factors (Allen and Bems, 1996; von Kalle et al., 2004). The remaining risk of gene disruption could be eliminated by targeting the reprogramming factors as a polycistronic single expression vector flanked by loxP sites into a genomic safe-harbor locus.
Factor-Free hiPSCs Maintain a Pluripotent ESC Like State
Although silencing of transgene expression has been reported for several hiPSCs, all hiPSCs generated to date (including the lines described in this example prior to removal of the reprogramming factors), sustain a low but detectable residual transgene expression (Dimos et al., 2008; Ebert et al., 2008; Hockemeyer et al., 2008; Park et al., 2008a; Yu et al., 2007). The question of whether hiPSCs depend on the expression of the reprogramming factors to maintain a pluripotent ESC-like state has therefore not been conclusively resolved. The observation that factor-free hiPSCs were morphologically and biological indistinguishable from the parental hiPSCs and maintained all the characteristics of hESCs demonstrates that human somatic cells can be reprogrammed to a self-sustaining pluripotent state which can be maintained in the complete absence of the exogenous reprogramming factors. These results provide additional proof that hiPSCs reestablish a pluripotency related autoregulatory loop that has been proposed to rely on the activation of the four endogenous transcription factors OCT4, NANOG, SOX2 and TCF3 (Jaenisch and Young, 2008).
Residual Transgene Expression from Partially Silenced Viral Vectors Perturbs the Transcriptional Profile of hiPSCs
Because the genomic integration site of a particular provirus influences proviral silencing as well as its risk of being reactivated, hiPSCs with identical and predictable properties cannot be generated by approaches relying on stochastic silencing. Residual transgene expression might affect the differentiation properties of iPSCs. Indeed, significant differences between mouse ES cells and iPSCs in their ability to differentiate into cardiomyocytes (K. Hochedlinger, personal communication) as well as partially blocked EB induced differentiation along with incomplete OCT4 and NANOG downregulation of distinct hiPSC clones (Yu et al., 2007) have been observed. These observations are consistent with the possibility that the variable basal transcription of only partially silenced vectors might influence the generation of functional differentiated cells.
In an effort to assess whether the removal of the vectors would affect the properties of the hiPSCs, we compared overall gene expression patterns in parental provirus-carrying hiPSCs, factor-free hiPSCs, and in embryo-derived hESCs. As reported previously (Park et al., 2008b; Takahashi et al., 2007; Yu et al., 2007), the provirus-carrying hiPSCs and factor-free hiPSCs clustered closely with the hESCs when compared to the donor fibroblasts. However, a more detailed analysis of the most divergent genes between the different hiPSCs cell types revealed that embryo-derived hESCs and factor-free hiPSCs were more closely related to each other than to the provirus-carrying parental hiPSCs. It is possible that the remaining small difference in gene expression between the vector-free hiPSCs and hESCs may be due to expression of the transactivator that had not been excised in our experiments. These results presented here provide clear evidence that the basal expression of proviruses carried in conventional iPS cells can affect the molecular characteristics of the cells. The system described here provides the basis to further elucidate the effect of residual transgene expression, e.g., in the context of in vitro and in vivo differentiation paradigms. Furthermore, these results demonstrate that the derivation of reprogramming factor-free hiPSCs is of great benefit not only for potential therapeutic applications, but also for biomedical research in order to develop more reliable and reproducible in vitro models of disease. To this end, we suggest that generating transgene-free hiPSCs by Cre-mediated excision offers significant advantages such as its high efficiency and experimental simplicity. The system described here has the potential to become a routine technology for the derivation of hiPSCs that will allow the generation of standardized hiPSCs from different sources using different combinations of reprogramming factors.
aAdditional information about these fibroblast cell lines can be obtained from the Coriell Institute.
bPDB3F-12d was isolated in experiments to determine the temporal requirements of transgene expression. PDB3F-12d was isolated from cultures exposed for 12 days to doxycycline.
cThese cells were derived in experiments to determine the temporal requirements of transgene expression. PDB4F-1 to -3 were isolated from cultures exposed for 8 days to doxycyline, whereas PDB4F-4 and -5 were exposed to doxycycline for 10 and 12 days, respectively.
dThese hiPSCs cells have been previously characterized in Hockemeyer et al., 2008.
This application is a continuation of U.S. patent application Ser. No. 15/354,604, filed Nov. 17, 2016, which is a continuation of U.S. patent application Ser. No. 12/997,815, filed Oct. 21, 2011, now U.S. Pat. No. 9,497,943, which is a national stage filing under 35 U.S.C. 371 of International Application No. PCT/US2009/047423, filed Jun. 15, 2009, which claims the benefit of U.S. Provisional Application No. 61/061,525, filed Jun. 13, 2008, and U.S. Provisional Application No. 61/077,068, filed Jun. 30, 2008. The entire teachings of these applications are incorporated herein by reference.
The invention was supported, in whole or in part, by a grants 5-RO1-HD045022, 5-R37-CA084198 and 5-RO1-CA087869 from The National Institutes of Health. The Government has certain rights in the invention.
| Number | Date | Country | |
|---|---|---|---|
| 61061525 | Jun 2008 | US | |
| 61077068 | Jun 2008 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 15354604 | Nov 2016 | US |
| Child | 16438424 | US | |
| Parent | 12997815 | Oct 2011 | US |
| Child | 15354604 | US |