Patent Application
20250197919
The present invention relates to a method for detecting the presence of a nucleic acid sequence in a sample using CRISPR technology. The method of the invention allows the detection of nucleic acid amounts as low as 100 fM with a high signal-to-noise ratio and without the need to perform any amplification of the nucleic acid of interest. The present invention also relates to a kit to carry out the method for detecting the presence of a nucleic acid sequence in a sample.
The capacity of CRISPR-Cas systems of being programmed to recognize specific nucleic acid sequences has boosted their biotechnological applications. One of them is the detection of the genetic material of pathogens or genetic markers in diagnosis. Systems to for the detection of specific nucleic acid sequences based on CRISPR-Cas technology, namely SHERLOCK, DETECTR and their derivatives, have been recently developed and promise to revolutionize point-of-care diagnostics in the near future. The basis of these systems relies, on the one hand, on the specificity and versatility conferred by their mechanism of target recognition and cleavage, which is directed by base-pair hybridization with a guide RNA (gRNA) sequence that, together with the Cas effector protein, form the Cas ribonucleoprotein (RNP). And, on the other hand, on a robust collateral nuclease activity that some of these Cas proteins acquire when they cleave their target sequence. This collateral activity consists in a sequence-independent unscheduled endonucleolytic degradation, normally of single-stranded nucleic acids of the same type as the sequence-specific target. The detection of this collateral activity by nuclease reporter substrates, either fluorescent or adapted to lateral flow devices, can be therefore used as a readout for the presence of any nucleic acid of interest (genetic material of a pathogen, for example) in a given sample, provided the design of the appropriate Cas RNP. gRNA represents either a single-guide RNA molecule or the combination of tracrRNA and crRNA molecules, Examples of widely used Cas effector proteins with collateral activity are the Cas13 and Cas12 (including Cas14/Cas12f) families of proteins, activated by and acting on RNA and DNA respectively, although some Cas12a proteins can also degrade dsDNA and ssRNA in addition to ssDNA.
These CRISPR-Cas diagnostic systems have already been proven useful for the detection of a wide range of pathogens and genetic markers. However, despite the great specificity and versatility that these systems offer, they are currently limited by the levels of sensitivity, which are outside the range of the concentrations required for diagnostic purposes and currently rely on pre-amplification of the target sequences. This introduces a complication to the reactions limiting their current use in direct point-of-care applications.
Any improvement in the sensitivity of these assays would therefore have a profound impact towards the widespread application of CRISPR-Cas technology as a reliable diagnostic tool.
Current solutions go in the direction of simplifying the pre-amplification step, for example by isothermal nucleic acid amplification, so reactions can be coupled in the minimal steps and time possible. This, however, does not prevent the requirement of at least some minimal equipment to allow incubation at constant (normally high) temperatures.
A conceptual alternative to overcome this problem is to, instead of amplifying the sequence of interest, amplifying Cas activation once it is triggered by the target nucleic acid. One way to achieve this is to include molecules that, when processed by collateral Cas activity, can lead to further Cas RNP activation. This is the type of approach described in Zeng et al., which uses a system wherein a target-activated Cas13a RNP (T-RNP) recognizes, binds to and cleaves a target RNA. The resulting activated Cas13a collateral activity can act on a ssRNA loop located in a hairpin RNA structure that they call the “mediator”, and which contains, in its dsRNA region, a target sequence for a second mediator-activated Cas13a RNP (M-RNP). The system relies on the fact that the mediator in the unprocessed hairpin form is poorly, or not recognized at all, by the M-RNP, while some of the cleaved molecules may leave a short ssRNA sequence that may serve as a “toehold” to prime annealing with the M-RNP, whose activation would lead to the processing of additional mediator molecules, subsequent increased recognition by the M-RNP, and so on and so forth, in an, in theory, exponential chain reaction. The capacity of hairpin loop-processing to stimulate M-RNP recognition, however, proves to be limited, as evidenced by the fact that a truly exponential reaction kinetics is not triggered by low concentrations of target. A similar approach is used in Sha et al., but it does not involve a chain reaction but the consecutive activation of Cas13a and Cas14a leading to substantial, but limited, amplification of the signal.
The present invention overcomes the problems of the detection methods known up to date, with an improved Cas-signal amplification strategy that allows simple, fast and on-site detection, and even quantification, of nucleic acids present in a sample in very small amounts.
A first aspect of the present invention relates to a method for detecting the presence of a nucleic acid sequence in a sample, comprising the following steps:
A second aspect of the present invention relates to a kit for the detection of the presence or absence or for the quantification of a nucleic acid of interest in a sample, comprising at least one Cas RNP with collateral activity, at least one amplifier, at least one reporter substrate and, at least one of an exonuclease, or a polymerase, optionally combined with dNTPs and/or NTPs, wherein at least one Cas RNP (target-activatable RNP; T-RNP) is designed to recognize a specific sequence in the nucleic acid of interest (primary target);
A third aspect of the present invention relates to the use of the method of the first aspect or the kit of the second aspect, for the detection of the presence or absence or for the quantification of a nucleic acid of interest in a sample, preferably wherein said nucleic acid is present in the sample in a concentration of between 100 fM and 10 nM.
A fourth aspect of the present invention relates to the use of the method of the first aspect or the kit of the second aspect, for the diagnosis or prognosis of a disease or condition, wherein the presence or absence or amount of the nucleic acid is associated to said disease or condition.
Yet a fifth aspect of the present invention relates to a method for detecting the presence of a nucleic acid sequence in a sample, comprising the following steps:
The present invention constitutes a most advantageous alternative to methods of the state of the art aiming to generate a signal amplification cascade based on collateral activity of a Cas protein. The method of the present invention works more efficiently than existing methods, results in an authentic exponential chain reaction as proved by the sigmoidal nature of the graphs of the present invention which contrast with the linear nature of graphs corresponding to previous methods; offers a reduction of background signals when compared to them; and provides a tool to detect both RNA and DNA, which improves functionality of preliminary methods just allowing detection of RNA.
All these effects are achieved by means of the particular design of the present invention which makes possible that, in the absence of target nucleic acid to be detected, no basal signal is generated. In particular, this is achieved by:
The present invention thus increases the amount of target available for activation of A-RNP, either by (i) combination of the amplifier with an exonuclease (or exonuclease-proficient polymerase), (ii) combination of the amplifier with a polymerase and dNTPs and/or NTPs, or (iii) cleavage of a collateral region through which the amplifier and A-RNP are attached to a solid substrate and spatially separated.
In addition, and differently to the methods of the state of the art, one same amplifier might be useful for both RNA and DNA detection, provided RNA and/or DNA sequence is included in the collateral region, and Cas 13- and/or Cas 12-based RNPs are used.
The basis of the present invention is a reaction of effector Cas protein activity by which its collateral in trans nucleolytic activity on a specific nucleic acid molecule, the amplifier, leads to the release or appearance of more target molecules. More precisely, when activated by the nucleic acid sequence of interest, the action of a first target-inducible Cas T-RNP on amplifier molecules leads to their activation as secondary targets for a second amplifier-inducible Cas A-RNP, which also act on additional amplifier molecules (
The present invention goes beyond the disclosure of the knowledge of the state of the art, in particular of Zeng Hongwei et al., and provides a more efficient and reliable method for Cas signal amplification by the design of novel amplifier molecules and the coupling to additional enzymatic activities, which, altogether, result in highly efficient activation of amplifiers as secondary targets, and truly exponential chain amplification of Cas activity. Thus, the system of the present invention allows unleashing of a self-fueled chain reaction of Cas and additional enzymatic activities that eventually reaches full activation of reporter substrates, even with minimal initial concentrations of the target of interest. For this, the amplifiers contain a target region that is initially inert for A-RNP recognition but, upon the degradation of a specific region in its structure (collateral region) by Cas RNP collateral activity, and the subsequent additional enzymatic step/s, a recognizable target for the A-RNP is released and/or reconstituted. This is achieved by either having a concealed target that is exposed by the action of an exonuclease (
Regardless of the specific configuration, and in analogy to PCR, one can use end-point measurements for qualitative detection of a nucleic acid of interest, or real time reactions for quantitative analysis.
In the context of the present invention, CRISPR-Cas Endonuclease Chain Reaction, 3CR, CCR and ECR are equivalent terms and might be used interchangeably.
Direct detection of specific nucleic acid sequences with CRISPR-Cas systems at concentrations normally found in biological or clinical samples is currently limiting and normally require methods, such as PCR, that amplify the target of interest. This imposes the need of more complex reactions and advanced equipment, limiting the capacity of point-of-care testing. As explained before, the present invention bypasses this need by dramatically increasing the sensitivity of direct CRISPR-Cas nucleic acid detection. In contrast to current amplification-based methods, the present invention does not amplify the nucleic acid sequence of interest, but instead amplifies Cas protein activation, simply boosting the signal without the need of additional pre-amplification steps. It is thus faster and easier, occurring in a single, or at least sequential reaction, without the need of further liquid handling and at a wide range of temperatures that are compatible with point-of-care testing.
The term “T-RNP” or “Target-activatable RNP”, as used herein, refers to the Cas RNP that is activated by the presence of the target sequence, i.e. of the nucleic acid of interest that is detected by the method of the present invention. The T-RNP comprises a gRNA that hybridizes with the nucleic acid to be detected by the method of the present invention. The term “A-RNP” or “Amplifier-activatable RNP”, as used herein, refers to the Cas RNP that is activated by the presence of the target sequence in the in the TS of the amplifier molecule. Thus, the A-RNP comprises a gRNA that hybridizes with the target sequence in the TS of the amplifier. The term “activated” as used herein refers to the CasRNPs, that are activated when their gRNA hybridizes with their target sequence and said target sequence is cleaved. The activated CasRNPs that are used in the present invention show collateral activity. By gRNA is meant either a single-guide RNA molecule or the combination of tracrRNA and crRNA molecules.
In step (a) of the method of the first aspect, the Cas RNPs can be added already preassembled or also as individual components, namely a Cas protein and a guide RNA (gRNA); the rest of components can be added and incubated together, or some may be pre-incubated before adding the rest in different sub-steps. In step (a), a buffer suitable for CasRNP enzymatic reactions, as well as for exonuclease and/or polymerase reactions, is used. A buffer may be, for example, buffer 2.1 NEB (New England Biolabs), which comprises at 1× concentration 50 mM NaCl, 10 mM TrisHCl, 10 mM MgCl2, 100 μg/ml BSA.
In a preferred embodiment of the first aspect, the nucleic acid to be detected is a single stranded or double stranded nucleic acid. In a preferred embodiment of the first aspect, the nucleic acid to be detected is RNA or DNA. In another preferred embodiment of the method of the first aspect, the nucleic acid of interest is RNA. In another preferred embodiment of the method of the first aspect, the nucleic acid of interest is DNA. In a preferred embodiment, the nucleic acid of interest is from SARS-CoV2. This preferred embodiment applies for the method of the first aspect, the kit of the second aspect and the use of the third aspect.
The method of the first aspect, the kit of the second aspect and the use of the third aspect have all as preferred embodiment those where the nucleic acid of interest is from a virus, a bacterium, a mammal, a human or is a genetic trait, a mutation, a disease marker, such as a cancer marker, etc., including single nucleotide polymorphisms.
The term “exonuclease” refers to an enzymatic activity that removes successive nucleotides from the 3′ end (3′ exonuclease) or 5′ end (5′ exonuclease) of a polynucleotide molecule. The term “polymerase” refers to an enzymatic activity that generates and/or extends a polynucleotide chain by the successive addition of nucleotides to its 3′ end. It is generally understood that a single enzyme can possess both polymerase and exonuclease activities. Thus, depending on the needs, a polymerase with exonuclease activity may be used to achieve polymerization, in which case the addition of dNTPs and/or NTPs is required, or exonucleolytic degradation, in which case dNTPs and/or NTPs are not needed.
The term “exonuclease” within the present invention includes any enzyme that might display exonuclease activity. This includes for example, polymerases with exonuclease activity. When any such exonuclease proficient polymerase is included to display its exonuclease activity, no combination with dNTPs/NTPs is required.
In a preferred embodiment of the first aspect, the exonuclease, the polymerase with exonuclease activity and/or the polymerase is selected from the group of Exonuclease I, Exonuclease III, Exonuclease T, Rec J F, T7 exonuclease, Lambda exonuclease, T4 DNA polymerase, T7 DNA polymerase, DNA polymerase I, Klenow fragment, Phi29 DNA polymerase.
In a preferred embodiment of the first aspect, a phosphatase and/or Cas RNP collateral activity kinase is added in step (a), preferably a polynucleotide kinase-phosphatase, more preferably T4 polynucleotide kinase-phosphatase, preferably when a Cas13 RNP is used.
In a preferred embodiment of the method of the first aspect, the TS comprises fully, partially or does not comprise the target region of the A-RNP.
In a preferred embodiment of the method of the first aspect, the amplifier comprises one or more nucleic acid molecules, preferably no more than three molecules in total, and more preferably comprises two molecules: one single molecule for each the NTS and the TS.
In a preferred embodiment of the method of the first aspect, 3′, 5′ or both ends of at least one of the molecules of the amplifier are chemically modified to prevent degradation by exonucleases and/or priming of nucleic acid synthesis by polymerases. In another preferred embodiment at least one of the nucleic acid molecules is ligated to another DNA strand or circularized by ligation between its 5′ and 3′ ends (
In a preferred embodiment of the method of the first aspect, the amplifier comprises a collateral region comprised by at least one extension in the TS and/or NTS, preferably the collateral region is single-stranded DNA (ssDNA) and/or RNA (ssRNA); and wherein, optionally, this collateral region comprises at least one strand (TS or NTS) that is protected from the collateral activity of the Cas RNPs.
Regardless of the structure (
In another preferred embodiment of the method of the first aspect, at least one exonuclease is added in step (a), and the amplifier comprises a complete target region in the TS but does not comprise a PAM motif, and the collateral region is located on the NTS, either 3′ (
As used herein, the term “PAM motif” refers to the protospacer adjacent motif (PAM), which is a 2-6-base pair DNA sequence immediately following the DNA sequence targeted by the Cas RNP. The presence of this PAM motif near the target sequence is necessary for dsDNA Cas RNPs to bind and cleave the molecule in the target sequence. The PAM motif is not relevant for ssRNA-directed Cas proteins such as Cas13.
In another preferred embodiment of the method of the first aspect, at least one polymerase and dNTPs (deoxynucleotide triphosphates) or NTPs (nucleotide triphosphates) are added in step (a), and wherein the TS does not fully comprise the target region, or comprises at least one mutated or missing nucleotide, or is at least partially comprised by a nucleic acid type not recognized by the A-RNP; the collateral region being located on the TS, 5′ of these modifications (
In a preferred embodiment of the method of the first aspect (
In a preferred embodiment of the method of the first aspect, a single Cas RNP is used, and the target region of the amplifier NTS comprises a sequence that is reverse-complementary to the primary target sequence in the nucleic acid of interest; the T-RNP therefore acts also as A-RNP.
In another preferred embodiment of the method of the first aspect, the first and second Cas RNP comprise the same Cas protein, but a different gRNA, or a different Cas protein.
In a preferred embodiment, at least one Cas RNP comprises a Cas12 protein, preferably Cas12a, more preferably Lachnospiraceae bacterium Lba Cas12a. In another preferred embodiment, at least one Cas RNP comprises a Cas13 protein, preferably Cas13a, more preferably Leptotrichia wadei Lwa Cas13a.
In a preferred embodiment, both T-RNP and A-RNP comprise a Cas12 protein, preferably Cas12a, more preferably Lba Cas12a.
In a preferred embodiment, both T-RNP and A-RNP comprise a Cas13 protein, preferably Cas13a, more preferably Lwa Cas13a.
In a preferred embodiment, the T-RNP comprises a Cas13 protein, preferably Cas13a, more preferably Lwa Cas13a, and the A-RNP comprises a Cas12 protein, preferably Cas12a, more preferably Lba Cas12a.
In another preferred embodiment of the method of the first aspect, the amplifier is prepared by mixing the TS and NTS in a ratio between 1:1 and 1:5, preferably between 1:1 and 1:3, more preferably between 1:1 and 1:2.
In another preferred embodiment of the method of the first aspect, the non-annealed TS and/or NTS is removed from the reaction or quenched with the reverse-complementary strand; in another preferred embodiment, correctly assembled amplifiers are purified by PAGE or HPLC before adding the amplifier in step (a).
In another preferred embodiment of the method of the first aspect, the amplifier is a dsDNA lacking a PAM motif, comprising the target sequence of a Cas12 A-RNP, and the NTS has a 3′ extension of ssDNA and/or RNA terminally protected from exonucleolytic degradation; and a 3′ exonuclease is added in step (a), optionally wherein a phosphatase is also added in step (a).
In a preferred embodiment, the reporter substrate is a nucleic acid of between 2 and 100 nucleotides. In a preferred embodiment, the reporter substrate is between 3 and 10, more preferably between 4 and 8, even more preferably between 4 and 6 or 5 nucleotides long. In a preferred embodiment, the reporter substrate contains markers, which can be for example a fluorophore/quencher pair attached to each end of the nucleic acid, or a molecule such as biotin or fluorescein, etc, that can be further detected by streptavidin or specific antibodies.
For fluorescent detection, the reporter contains a fluorophore/quencher pair attached to each end of the nucleic acid. The nucleic acid is short (typically 5 nucleotides) to allow quenching of the fluorescence unless it is degraded, but of sufficient length to allow the action of the activated Cas RNPs. The structure of the reporter is known by the skilled person and can be designed using the general knowledge in the field. Fluorescence is typically measured using a fluorimeter. For quantitative analysis, a standard curve generated with known concentrations of the nucleic acid is used. In an analogous manner to quantitative PCR, for quantitative assays, the fluorescence is measured and the time when half of the maximum fluorescence signal is detected, is used for the quantification. For example, for lateral flow detection, the reporter contains two motifs that can be specifically recognized, one at each end of the nucleic acid. One is used for capture/immobilization and the other one for detection, so cleaved and uncleaved molecules can be distinguished. Preferably biotin is used for immobilization and fluorescein is used for detection with specific antibodies. Since the length of the molecule is less relevant in this case, the amplifier itself can be used as a reporter by adding the biotin and fluorescein moieties to the strand that is subject to degradation. Therefore, in a preferred embodiment, the amplifier is also the reporter substrate.
The term “56-FAM” or “FAM”, as used herein, refers to the marker fluorescein. The term “3IABkFQ”, as used herein, refers to the quencher Iowa Black® FQ, which has a broad absorbance spectrum ranging from 420 to 620 nm with peak absorbance at 531 nm. This quencher is ideal for use with fluorescein.
In another preferred embodiment of the method of the first aspect, the reporter is a nucleic acid molecule with a fluorescent marker in one end and a quencher in the other end.
In another preferred embodiment of the method of the first aspect, steps (a) and (b) are performed in sub-steps:
In another preferred embodiment, sub-steps (a2) and (b2) are omitted.
In a preferred embodiment of the first aspect, the T-RNP comprises a Cas13 protein, and the amplifier comprises a DNA TS containing a target region for a Cas12 A-RNP and with at least one phosphorothioate linkage, and a DNA NTS without PAM motif, containing at least one phosphorothioate linkage, and comprising a single-stranded collateral region with at least 3 ribonucleotides.
In another preferred embodiment of the method of the first aspect, the T-RNP comprises a Lwa Cas13a protein and a gRNA of SEQ ID NO: 6, the A-RNP comprises a Lba Cas12a protein and a gRNA of SEQ ID NO: 3, and the amplifier comprises SEQ ID NO:4 and SEQ ID NO: 5 as TS and NTS, respectively.
In a preferred embodiment of the first aspect (
In a preferred embodiment of the first aspect (
The method of the present invention will preferably occur in the absence of amplification of the nucleic acid sequence of interest, but may also be compatible with an additional amplification step or steps. In other words, it is not relevant for the method, kit or uses of the present invention, whether amplification of the nucleic acid sequence of interest is performed or not in addition to the respective method, kit or uses of the present invention.
In another preferred embodiment, the method of the first aspect of the present invention is used in a diagnostic method (in vitro method): said diagnostic method comprises the method for the detection of the presence of a nucleic acid sequence in a sample of the first aspect, and also comprises associating the presence or absence, or the amount of the nucleic acid sequence in the sample to a disease or condition. The method can be performed in a qualitative or quantitative manner, for example, using a lateral-flow device, the method can be performed for qualitative detection, while by measuring the fluorescence of the reporter in real time using a fluorometer, the method can be quantitative. As explained above, the time when the level of fluorescence reaches half of the maximum fluorescence is used for quantification. Particular embodiments of interest are as shown in the examples, a SARS-CoV2 quantitative detection method or a SARS-CoV2 qualitative detection method which uses a lateral-flow device.
In relation to the second aspect of the present invention, the kit can be a kit-of-parts and also a device, such as a lateral-flow device. Thus, the term “kit”, as used herein, means both a kit-of-parts and a device.
In relation to the kit of the second aspect of the invention, the means for amplifying the nucleic acid sequence of interest in the sample are, for example, a thermoresistant DNA polymerase for PCR, a reverse polymerase that copies cDNA from RNA or specific primer pairs for amplifying a sequence by PCR or other amplification means, such as Loop-mediated isothermal amplification (LAMP) or Recombinase polymerase amplification (RPA).
In a preferred embodiment, the kit comprises a T-RNP that comprises a Cas13a protein, preferably Lwa Cas13a protein, and a gRNA of SEQ ID NO: 6, a A-RNP that comprises a Cas12a protein, preferably Lba Cas12a, and a gRNA of SEQ ID NO: 3, and an amplifier that comprises SEQ ID NO:4 and SEQ ID NO: 5 as TS and NTS, respectively. This kit is useful for detecting the presence and also quantifying the amount of nucleic acid from SARS-CoV2.
In a preferred embodiment of the second aspect, the kit further comprises the components required for lateral-flow detection, or is a lateral-flow device, as described in Gootenberg et al. 2018 (Science, 360 (6387): 439-444) and Broughton et al. 2020 (Nature Biotechnology, 38 (7): 870-874), and wherein the kit optionally comprises means for taking a sample and/or for extracting nucleic acids from a sample.
In a lateral flow kit, the sample is applied on one end (pad) of a solid support, through which it migrates by capillarity. The lateral-flow reporter substrate is a nucleic acid molecule with two different marker molecules at each end, preferably biotin and fluorescein. The solid support contains two regions with immobilized molecules that bind each of these makers, and through which the sample migrates sequentially, preferably first through a stripe coated with streptavidin proximal to the pad, and preferably then through a stripe coated with anti-fluorescein antibodies distal to the pad. One of the markers, preferably fluorescein, is used for detection of the reporter, preferably with anti-fluorescein antibodies conjugated to gold nano-particles that are embedded in the pad, while the other marker, preferably biotin, is used for retention at the first stripe, preferably by interaction with streptavidin. When the reporter reaches the first stripe, all the uncleaved molecules will be retained by interaction with the retention marker, while the fragments of cleaved reporter containing the detection marker will continue migrating through the solid support until reaching the second stripe. Visualization of signal only in the first stripe (control region) is indicative of the absence of the nucleic acid of interest in the sample, while visualization of signal in the second stripe (test region) is indicative of the presence of the nucleic acid of interest in the sample. This type of lateral flow test is shown in
As used herein, the expression “at least one” means one, two, three or more, preferably means one or two, more preferably means one.
In a preferred embodiment of the first and second aspect, the amplifier is modified to directly act as reporter for lateral flow by including retention and visualization markers (as described above) at either end of the collateral region, either on the same strand or one marker on each strand.
The method, kit and use of the present invention can be adapted to the detection of proteins or metabolites of interest by attaching nucleic acids to specific antibodies or binding molecules, and then detecting these nucleic acids. Thus, this is a preferred embodiment for the four aspects of the present invention.
All the above embodiments of the first aspect also apply to the second, third and fourth aspects. All the embodiments of the second aspect apply also to the first, third and fourth aspects. All the embodiments of the third aspect apply also the first, second and fourth aspects. All the embodiments of the fourth aspect apply also to the first, second and third aspects. The present disclosure includes all the combinations of all the aspects disclosed above. The term “comprising” or “comprise” or “comprises” includes the term “consisting of” or “consist of” or “consists of”.
The following examples illustrate the present invention and are not to be understood as limiting the invention. In the examples, nucleic acid sequences related to SARS-CoV-2 are detected, but the claimed technology described herein can easily be adapted by the skilled person to any nucleic acid of interest, including other viruses, bacteria, genetic traits, cancer markers, etc., including the identification of single nucleotide polymorphisms.
In the simplest embodiment, the method of the invention is based on the use of a Cas protein, such as those of the Cas12 family, that only recognize their target sequence in a double-stranded form (dsDNA for Cas12 proteins) if they contain an adjacent PAM motif, while this is not necessary to detect its target strand when single-stranded. The same applies to Cas proteins, such as the Cas13 family, that only recognize single-stranded nucleic acids (RNA in this case) and do not have a PAM motif. With this in mind, as can be seen in
This target-exposure approach is also useful to detect RNA by using, for example, a Cas13β-based T-RNP; in which case the collateral region of the amplifier contains ribonucleotides to allow collateral cleavage by activated Cas13a. With this in mind, we generated an amplifier molecule based on a previously described DNA target of LbaCas12a with a mutated PAM, adding on the NTS a 3′ extension of 8 uracil ribonucleotides, and with the last 5 containing phosphorothioate linkages (
All amplifier TS molecules should be annealed to the corresponding NTS, as any free TS present could be sufficient to trigger the reaction. In order to ensure that this is the case, we tested the capacity of amplifier molecules annealed with different TS:NTS ratios to activate its corresponding Cas12a A-RNP. As shown in
Although an overhang is the simplest configuration for the collateral region, additional structures, such as for example loops, bubbles or serial mismatches, can be used (
Examples 1 to 6 display some representative results corresponding to the exonuclease version of the system of the present invention. Examples 7 and 8 correspond to the polymerase version, the former protecting the NTS from Cas-mediated degradation by a partial cover of the NTS, the latter through a full cover with the addition of mismatches.
We used the amplifier described above (
The main problem for the sensitivity of 3CR as determined in Example 1 is the background signal that starts to appear around 100 min even in the absence of target DNA (
As in Example 1.
We tested other 3′ exonuclease activities other than Exo III, and turned our attention to T7 pol, in line with the results of
As in Example 1.
We also tested T4 pol. We included a preincubation step with amplifiers generated with a 1:1 ratio TS:NTS, then added an excess of NTS to bring it to the 1:2 ratio, and finally incubated with the rest of the components. As can be seen in
As in Example 1.
We used the amplifiers and 2-step incubation approach described in Example 2 to extend the capabilities of 3CR into RNA detection. For this, we used LwaCas13a as T-RNP, which was specifically directed against a target sequence in SARS-CoV2 gene S. We also used ExoIII for the proven activity extending ribonucleolytic cleavage (
TAATACGACTCACTATAGGTAACATCACTA
We therefore demonstrated that 3CR is a useful method for detecting specific sequences of both DNA and RNA without target amplification, at room temperature and with a sensitivity that can go up to 100 fM.
As discussed above, an excess of NTS is advantageous to limit direct activation by the amplifier. Another advantageous possibility is to prepare the amplifier with a 1:2 TS:NTS ratio as described in the examples, and then quench the excess of NTS with a non-activating TS (for example containing mutations in the target sequence). Other advantageous embodiments include a step for purifying correctly assembled amplifiers by PAGE or HPLC.
The absence of gRNA hybridization with the 4 last PAM-distal nucleotides of the target, strongly affects Cas12a cleavage and activation with dsDNA, even in the presence of a PAM motif, while minimally affecting in a ssDNA form. Another advantageous embodiment is achieved by using this or other reduced targets by either changing the sequence in the amplifier or the gRNA used in the A-RNP. Systematic and/or massive screening methods are available to the skilled person to identify the optimal target sequences for this purpose. In another embodiment, other Cas proteins, either natural or engineered, with a stronger preference for PAM-less ssDNA than Cas12a, are used.
In another embodiment, the target sequence is not originally present in the amplifier, and it is then synthesized, instead of exposed, in the course of the reaction. In the simplest configuration (
For the target-synthesis approach we used the same target sequence in the amplifier as in Example 1, and designed a structure formed by the NTS and a primer containing a 25-nucleotide ssDNA flap annealed to its 3′ end (
We used this amplifier molecule and performed 3CR reactions, essentially as described in Example 1, but with Klenow instead of T4 pol/PNK, and the addition of dNTPs for DNA synthesis. No preincubation was included, so reactions were directly placed at 37° C. during 2 h, with continuous analysis of reporter activation by fluorescence emission. As can be observed in
We also tested another strategy to protect the NTS, essentially as in Example 6, but based on a full cover of the portion of the NTS not covered by the TS Primer. To avoid direct activation of the A-RNP by the amplifier, we included 8 mismatches that prevented hybridization with the gRNA of the A-RNP, as generally described in
3CR can be adapted to qualitative diagnosis with lateral flow devices. For this, the amplifier itself is used as a reporter, simply by adding biotin and FAM moieties to the ends of the NTS, or one in the TS and the other one in the NTS (
| Number | Date | Country | Kind |
|---|---|---|---|
| 22382608.2 | Jun 2022 | EP | regional |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/EP2023/067698 | 6/28/2023 | WO |
