Nucleic acid encoding the major outer membrane protein of the causative agent of human granulocytic ehrlichiosis and peptides encoded thereby

Abstract

The present invention relates to diagnostic tools for serodiagnosing HGE. The diagnostic tools are structurally related proteins, the “Group 44 proteins”, and to antibodies to such proteins. the Group 44 proteins comprise a single central hypervariable region of approximately 94 amino acid residues, a first conserved region and a second conserved region which flank the central hypervariable region. The hypervariable region of each Group 44 protein has a higher hydrophilicity, a higher antigenic index, and a higher surface probability than either the first conserved region or the second conserved region of the respective protein. The hypervariable region is basic and has an isoelectric point, i.e., a pI, of from about 7.1 to about 9.2 and a molecular mass, i.e., an Mr, of from about 8.5 kDa to about 11 kDa. The Group 44 proteins comprise the P44 protein, the P44-2 protein, the P44-12 protein, the P44-15 protein, the P44-18 protein, and the P44-19 protein and variants of such proteins. The present invention also provides isolated polynucleotides or nucleic acids, referred to collectively hereinafter as the “Group 44 polynucleotides”, which encode the Group 44 proteins and fragments thereof. The present invention provides synthetic oligopeptides of 14-16 amino acids in length. Each of the oligopeptides comprise a sequence which is specific to one Group 44 protein. The present invention also relates to antibodies which are immunospecific for and bind to members of the P44 family of proteinss. The present invention also relates to kits containing reagents for diagnosing HGE.

Description

BACKGROUND

This work was supported by grant RO1 AI33123 and grant RO1 A140934 from the National Institutes of Health. The Government has certain rights in this invention.

Human granulocytic ehrlichiosis (HGE), an emerging human infectious disease, is increasingly being recognized in the United States. Serological and PCR studies suggest that HGE infection also exists in Europe. HGE is caused by infection with an obligatory intracellular bacterium, HGE agent. Comparison of 16S rRNA gene sequences and ultrastructure indicates that the HGE agent is closely related to Ehrlichia phagocytophila , the agent of tick-borne fever, and E. equi , the agent of equine ehrlichiosis. The HGE agent is transmitted by the Ixodes sp. tick, and the white-footed mouse is considered to be the major reservoir of the HGE agent in the United States.

HGE infection is characterized by the presence of ehrlichial inclusions called morulae in human or animal peripheral blood granulocytes. The symptoms of HGE include chills, headache, myalgia, hematological abnormalities, including leukopenia and thrombocytopenia. HGE frequently requires prolonged hospitalization. When treatment is delayed due to misdiagnosis, HGE can be fatal.

Although several laboratories have used IFA testing, acute-phase blood smear, nested PCR, and culture isolation for diagnosis of HGE, each of these diagnostic tests has disadvantages. IFA testing using the HGE agent or E. equi -infected cells has been most widely used for serodiagnosis of ehrlichiosis. IFA requires a tissue culture system for preparation of HGE-infected cell antigen slides, fluorescent microscope, and trained persons especially for evaluation of the serum reactivity to the antigen on the slide. The nested PCR, while better suited to early diagnosis of HGE than IFA testing, requires thermocycler and trained personel, and the reagents are relatively expensive. The sensitivity of culture isolation in HGE diagnosis seems to be relatively lower than that of IFA test and the nested PCR. Moreover, diagnosis by culture isolation requires serologic evidence, PCR, or 16S rRNA gene sequence for confirmation of the identity of new isolates.

Accordingly, a convenient and sensitive method with high specificity for the diagnosis of HGE infection is still desirable.

SUMMARY OF THE INVENTION

The present invention relates to improved diagnostic tools for serodiagnosing HGE. diagnostic tools are structurally related proteins, collectively referred to hereinafter as the “Group 44 proteins”, and to antibodies to such proteins. As compared to each other, the Group 44 proteins comprise a single central hypervariable region of approximately 94 amino acid residues, a first conserved region and a second conserved region which flank the central hypervariable region. The first conserved region comprises 52 amino acids and is linked directly or through a linker of from 1 to 10 amino acids to the amino terminus, i.e., the N-terminus, of the hypervariable region. The second conserved region comprises about 56 amino acids and is linked either directly or through a linker of from 1 to 10 amino acids to the carboxy terminus, i.e., the C-terminus, of the hypervariable region. The hypervariable region of each Group 44 protein has a higher hydrophilicity, a higher antigenic index, and a higher surface probability than either the first conserved region or the second conserved region of the respective protein. The hypervariable region is basic and has an isoelectric point, i.e., a p1, of from about 7.1 to about 9.2 and a molecular mass, i.e., an Mr, of from about 8.5 kDa to about 11 kDa. The hypervariable region has a first semiconserved region of 8 amino acids near the amino terminus thereof and a second semiconserved region of 11 amino acids at the carboxy terminus thereof. The hypervariable region also contains a third semiconserved region of 6 amino acids. It is believed that the third semiconserved region, which is between and separated from the first semiconserved region and the second semiconserved region is perhaps involved in adhesion of the HGE agent to other cells.

The Group 44 proteins comprise the P44 protein, the P44-2 protein, the P44-12 protein, the P44-15 protein, the P44-18 protein, and the P44-19 protein and variants of such proteins. The P44 protein and variants thereof specifically bind to antibodies found in the sera from horses infected with the HGE agent and to antibodies in the sera from humans infected with the HGE agent and horse anti- Ehrlichia equi serum. The P44 protein and variants thereof do not bind to antibodies in sera from patients infected with E.chaffeensis or Borrelia burgdorferi . In one embodiment, the P44 protein comprises the amino acid sequence, SEQ ID NO: 2, shown in FIG. 1 .

The P44-2 protein has a molecular mass of about 45 kDa. In one embodiment the P44-2 protein comprises the amino acid sequence, SEQ ID NO: 4, shown in FIG. 2 .

The P44-12 protein has a molecular mass of about 41.2 kDa. In one embodiment the P44-12 protein comprises the amino acid sequence, SEQ ID NO: 6, shown in FIG. 3 . The P44-15 protein comprises a hypervariable region which encodes a polypeptide having a molecular mass of about 10.8 kDa. In one embodiment, the P44-15 protein comprises the amino acid sequence, SEQ ID NO: 8, shown in FIG. 4 . The P44-18 protein comprises a hypervariable region which encodes a polypeptide having a molecular mass of about 26.4 kDa. In one embodiment, the P44-18 protein comprises the amino acid sequence, SEQ ID NO:10 shown in FIG. 5 . The P44-19 protein comprises a hypervariable region which encodes a polypeptide having a molecular mass of about 8.6 kDa and an isoelectric point of about 8.8. The P44-19 protein comprises the amino acid sequence, SEQ ID NO: 12, shown in FIG. 6 .

The Group 44 proteins are immunogenic and, thus, are useful for preparing antibodies. The isolated proteins of the P44 family, either individually or as a panel of proteins, are useful for detecting antibodies to the HGE agent in the blood of patients with clinical signs of HGE. The isolated, individual Group 44 proteins are also useful in an immunogenic composition for ameliorating HGE. The isolated, individual Group 44 proteins are also useful in a vaccine for protecting against infection with the HGE agent.

The present invention also provides isolated polynucleotides or nucleic acids, referred to collectively hereinafter as the “Group 44 polynucleotides”, which encode the Group 44 proteins and fragments thereof. The P44 polynucleotides encode the P44 protein. One embodiment of the P44 polynucleotides comprises the nucleotide sequence, SEQ ID NO:1, shown in FIG. 1 . The P44-2 polynucleotides encode the P44-2 protein. One embodiment of the P44-2 polynucleotides comprises the nucleotide sequence, SEQ ID NO: 3, shown in FIG. 2 . The P44-12 polynucleotides encode the P44-12. One embodiment of the P44-12 polynucleotides comprises the nucleotide sequence, SEQ ID NO: 5, shown in FIG. 3 . The P44-15 polynucleotides encode the P44-15 protein. One embodiment of the P44-15 polynucleotides comprises the nucleotide sequence, SEQ ID NO: 7, shown in FIG. 4 . The P44-18 polynucleotides encode the P44-18 protein. One embodiment of the P44-18 polynucleotides comprises the nucleotide sequence, SEQ ID NO: 9, shown in FIG. 5 . The P44-19 polynucleotides encode the P 44-19 protein. One embodiment of the P44-19 polynucleotides comprises the nucleotide sequence, SEQ ID NO: 11, shown in FIG. 6 . The Group 44 polynucleotides are useful for preparing the Group 44 proteins and variants thereof. Group 44 polynucleotides which encode fragments of the Group 44 proteins are useful as primers and probes.

The present invention provides synthetic oligopeptides of 14-16 amino acids in length. Each of the oligopeptides comprise a sequence which is specific to one Group 44 protein. Such peptides are useful for preparing antibodies which are immunospecific for one or more Group 44 proteins.

The present invention also relates to antibodies which are immunospecific for and bind to members of the P44 family of proteins. Such antibodies are useful for immunolabeling isolates of the HGE agent and for detecting the presence of HGE in body fluids, tissues, and particularly, monocytes and macrophages. The present invention also relates to kits containing reagents for diagnosing HGE.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 show the amino acid sequence, SEQ ID NO: 2, of the P44 protein and a nucleotide sequence, SEQ ID NO: 1 which encodes the P44 protein. The deduced amino acid sequence of P44 is shown beneath the DNA sequence. N terminal amino acid sequence of native isolated P44 is underlined. Arrowheads indicate 5′ annealing positions of the primer pair (24 mers for forward and 26 mers for reverse) designed for PCR amplification of partial P44 gene which was subcloned into pET30A, an expression vector.

FIG. 2 show the amino acid sequence, SEQ ID NO:4, of the P44-2 protein and a nucleotide sequence, SEQ ID NO:3, which encodes the P44-2 protein.

FIG. 3 show the amino acid sequence, SEQ ID NO:6, of the 144-12 protein and a nucleotide sequence, SEQ ID NO:5. which encodes the P44-12 protein.

FIG. 4 show the amino acid sequence, SEQ ID NO:8, of the P44-15 protein and a nucleotide sequence, SEQ ID NO:7, which encodes the P44-15 protein.

FIG. 5 show the amino acid sequence, SEQ ID NO:10, of the P44-18 protein and a nucleotide sequence, SEQ ID NO:9, which encodes the P44-18 protein.

FIG. 6 show the amino acid sequence, SEQ ID NO:12, of the P44-19 protein and a nucleotide sequence, SEQ ID NO:11, which encodes the P44-19 protein.

FIG. 7 . depicts the hydrophilicity profiles of the Group 44 proteins.

FIG. 8 . depicts the antigenic index profiles of the Group 44 proteins.

FIG. 9 . shows the surface probability profiles of the Group 44 proteins.

FIG. 10 . is an alignment of amino acid sequences of the P44 protein, the P44-2 protein, the P44-18 protein, the P44-12 protein, the P44-15 protein and the P44-19 protein, SEQ ID Nos. 2, 4, 10, 6, 8, and 12, respectively, which were deduced from cDNA clones and the corresponding p44-homologous genes of the HGE agent. Aligned positions of identical amino acids with the P44 protein are shown with dot. Gaps indicate by dashed lines were introduced for an optimal alignment of all proteins. A boxed area in the middle indicates the amino acid sequences deduced from nucleotide sequences of cDNAs. Hypervariable regions are shown in boldface. A bar indicates the N-terminal amino acid'sequence of the native P44 protein and an arrowhead shows the cleavage site of the putative signal peptide. The amino acid sequences underlined in the hypervariable regions of P44-2 and P44-1 8 indicate the sequences which were used to prepare synthetic -oligopeptides, Pep2 and Pep18, respectively. The arrows point out the positions of the primers used in RT-PCR. The numbers on the right side indicate the positions of amino acid residues in P44-homologous proteins from the N terminus to C terminus.

FIG. 11 is a restriction map of 6.9-kb genomic DNA fragment including p44 gene of the HGE agent. The closed boxes with arrow indicate four open reading frames (ORF) which are identified in this fragment. The arrows indicate the orientation of these ORFs. Shaded boxes (R1 and R2) show two regions identical in the ORF1 which encoded 59- and 65-amino acids, respectively. The solid bar at bottom indicates the region which was cloned into the pET30a expression vector.

FIG. 12 shows the primer positions in the p44 gene and the truncated ORF homologous to p44 in the recombinant plasmid pHGE1221. The primers p3708 and p4257 were designed for RT-PCR to amplify the cDNA of p44-homologous genes. The primers hvf and hvr were designed to prepare the cDNA-specific probes by PCR for Southern and Northern blot analysis.

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides a group of structurally related proteins, the Group 44 proteins, which are encoded by a group of homologous genes which are contained within the genome of the HGE causative agent. The Group 44 proteins have an amino acid sequence identity, as determined using the MEGALIGN project in the DNASTAR program (DNA STAR, Inc., Madison, Wis.), ranging from 59% to 83.4%. The Group 44 proteins comprise a single central hypervariable region of about 94 amino acid residues, a first conserved region of about 52 amino acids which is linked either directly or through a linker of from 1 to about 10 amino acids to the amino or N-terminus of the hypervariable region, and a second conserved region of about 56 amino acids which is linked either directly or through a linker of from 1 to about 10 amino acids to the carboxy or C-terminus of the hypervariable region. The Group 44 proteins also comprise an N-terminal end sequence which is linked to the N-terminal amino acid of the first conserved region and a C terminal end sequence which is linked to the C-terminal amino acid of the second conserved region. The Group 44 proteins comprise the P44 protein and variants thereof, the P44-2 protein and variants thereof, the P44-15 protein and variants thereof, the P44-18 protein and variants thereof, and the P44-19 protein and variants thereof.

The hypervariable regions of the Group 44 proteins have a higher hydrophilicity, a higher antigenic index, and a higher surface probability than either the first conserved region or the second conserved regions. The hypervariable regions of the Group 44 proteins have an average hydrophilicity index from about 0.45 to about 0.95, as determined using the Kyte-Doolitle hydrophilicity profile which is described in Kyte, Jack and R. F. Doolitle (1982). J. Mol. Biol. 157:105-132. The hypervariable regions of the Group 44 proteins have an average antigenic index of from about 0.65 to about 1.5, as determined using the Jameson-Wolf antigenic index profile, which is described in Jameson, B. A. and H. Wolf (1988) CABIOS. 4:181-186. The hypervariable regions of the Group 44 proteins have an average surface probability index of from about 1.0 to about 1.55 as determined using the Emini surface probability profile, which is described in Emini, E. A. et al (1985) J. Virology. 55:836-839. The hypervariable regions of the Group 44 proteins have an Mr of from about 8.6 kDa to about 10.9 kDa and an isoelectric point (pI) of from about 7.1 to about 9.2. The hypervariable regions of the Group 44 proteins comprise a first semiconserved region at their N-terminus and a second semiconserved region at their C-terminus. The first semiconserved region comprises the sequence Ile, X1, X2, Lys, X3, Cys wherein X1 is Asp or Gly, X2 is Gly or Lys, and X3 is Val or Ile. The second semiconserved region comprises the sequence Asn, Ala, X1, X2, X3, Ala, X4, X5, Leu, X6, and X7 wherein X1 is Asn, Thr, Lys, or Glu, X2 is Ala or Lys, X3 is Met or Val; X4 is Lys, Gly, or Thr; X5 is Asp or Glu; X6 is Val or Thr, and X7 is Gln or Lys. The hypervariable regions of the Group 44 proteins also comprise a third semiconserved region which is located between the first semiconserved region and the second semiconserved region. The third semiconserved region comprises the sequence Lys-X1-Trp-Pro-Thr-X2; wherein X1 is Asn or His and X2 is Gly, Thr, or Ser. It is believed that the third semiconserved region permits adhesion of the HGE agent to other cells. The characteristics of the hypervariable regions of individual Group 44 proteins are shown in Table 1 below:

TABLE 1
Characteristics of hypervariable regions of Group 44 Proteins
		Mr of	Pl. of
Group 44		hyper-	hyper
Proteins	Total	variable	variable	Kyte-	James-	Emini-
Hv	Mr	region	region	hydro a	antige b	surface c
P44-hv	41,293	10,327	9.16	0.45	0.65	1.0
P44-2hv	44,969	10,454	7.17	0.53	1.29	1.03
P44-12hv	41,197	10,378	8.17	0.82	1.38	1.04
P44-15hv	29,287	10,831	8.77	0.82	1.37	1.25
P44-18hv	26,400	10,186	8.65	0.94	1.49	1.53
P44-19hv		8,645	8.8	0.67	1.07	1.05
a Kyte-Doolittle hydrophilicity. Kyte, Jack And R. F. Doolittle (1982). A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157: 105-132.
b Jameson-Wolf antigenic index. Jameson, B. A. and H. Wolf (1988). The antigenic index: a novel algorithm for predicting antigen determinants. CABIOS. 4: 181-186.
c Emini surface probability. Emini, E. A. and J. Hughes, D. Perlow and J. Boger (1985). Induction of hepatits A virus-neutralizing and antibody by a virus specific synthetic peptide. J. Virology. 55: 836-839.

The present invention also encompasses variants of the proteins of the Group 44 proteins whose amino acid sequences are shown in SEQ ID Nos 2, 4, 6, 8, 10, and 12. A “variant” as used herein, refers to a protein whose amino acid sequence is similar to the amino acid sequence of a particular Group 44 protein, hereinafter referred to as the reference amino acid sequence, but does not have 100% identity with the respective reference sequence. The variant protein has an altered sequence in which one or more of the amino acids in the reference sequence is deleted or substituted, or one or more amino acids are inserted into the sequence of the reference amino acid sequence. As a result of the alterations, the variant protein has an amino acid sequence which is at least 90% identical to the reference sequence, preferably, at least 95% identical, more preferably at least 96% identical, most preferably at least 97% identical to the reference sequence. Variant sequences which are at least 90% identical have no more than 10 alterations, i.e any combination of deletions, insertions or substitutions, per 100 amino acids of the reference sequence. Percent identity is determined by comparing the amino acid sequence of the variant with the reference sequence using MEGALIGN project in the DNA STAR program.

While it is possible to have nonconservative amino acid substitutions, it is preferred that the substitutions be conservative amino acid substitutions, in which the substituted amino acid has similar structural or chemical properties with the corresponding amino acid in the reference sequence. By way of example, conservative amino acid substitutions involve substitution of one aliphatic or hydrophobic amino acids, e.g. alanine, valine, leucine and isoleucine, with another; substitution of one hydoxyl-containing amino acid, e.g. serine and threonine, with another; substitution of one acidic residue, e.g. glutamic acid or aspartic acid, with another; replacement of one amide-containing residue, e.g. asparagine and glutamine, with another; replacement of one aromatic residue, e.g. phenylalanine and tyrosine, with another; replacement of one basic residue, e.g. lysine, arginine and histidine, with another; and replacement of one small amino acid, e.g., alanine, serine, threonine, methionine, and glycine, with another.

Preferably, the amino acid sequence of the first conserved region is at least 95% identical, more preferably at least 97% identical, most preferably at least 98% identical to the amino acid sequence of the first conserved region of P44, P44-2, P44-15, P44-18, or P44-19. Preferably, the amino acid sequence of the second conserved region is at least 95% identical, more preferably at least 97% identical, most preferably at least 98% identical to the amino acid sequence of the second conserved region of P44, P44-2, P44-15, P44-18, or P44-19.

The alterations are designed not to abolish the immunoreactivity of the variant with antibodies that bind to the reference protein. Guidance in determining which amino acid residues may be substituted, inserted or deleted without abolishing such immunoreactivity of the variant protein are found using computer programs well known in the art, for example, DNASTAR software. Preferably, the alterations are not located in the variant protein regions which correspond to the first conserved region or the second conserved region of the respective Group 44 protein

The present invention also encompasses fusion proteins in which a tag or one or more amino acids, preferably from about 2 to 15 amino acids, more preferably from about 34 to about 62 amino acids are added to the amino or carboxy terminus of the amino acid sequence of a Group 44 protein or a variant of such protein. Typically, such additions are made to stabilize the resulting fusion protein or to simplify purification of an expressed recombinant form of the corresponding P44 protein or variant of such protein. Such tags are known in the art. Representative examples of such tags include sequences which encode a series of histidine residues, the Herpes simplex glycoprotein D, or glutathione S-transferase.

The present invention also encompasses Group 44 proteins in which one or more amino acids, preferably no more than 10 amino acids, in the respective Group 44 protein are altered by posttranslation processes or synthetic methods. Examples of such modifications include, but are not limited to, acetylation, amidation, ADP-ribosylation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or a lipid, cross-linking gamma-carboxylation, glycosylation, hydroxylation, iodination, methylation, myristoylation, oxidation, pegylation, proteolytic processing, phosphorylation, prenylation, racemization, sulfation, and transfer-RNA mediated additions of amino acids to proteins such as arginylation and ubiquitination.

One Group 44 protein is the P44 protein, which weighs approximately 41 kDa and has an isoelectric point of 5.11. The P44 protein and variants thereof specifically bind to antibodies found in the sera from horses infected with the HGE agent and to antibodies in the sera from humans infected with the HGE agent and horse anti- Ehrlichia equi serum. The P44 protein does not bind to antibodies in sera from patients infected with E. chaffeensis or Borrelia burgdorferi . The P44 protein comprises the amino acid sequence, SEQ ID NO: 2, shown in FIG. 1 . The hypervariable region of the P44 protein extends from amino acid 176 to amino acid 277 of the sequence, SEQ ID NO:2, shown in FIG. 1 . The hypervariable region of the P44 protein and variants thereof have an Mr of from about 8.6 to about 10.8 kDa. The first conserved region of the P44 protein extends from 124 amino acid to amino acid 184 of SEQ ID NO: 2. The second conserved region of the P44 protein extends from amino acid 114 to amino acid 175 of SEQ ID NO:2. The first semiconserved region of the hypervariable region of the P44 protein has the amino acid sequence IDGKVC; the second semiconserved region of the hypervariable region of the P44 protein NANAMAKDLVK, SEQ ID NO: 13; the third semiconserved region of the hypervariable region of the P44 protein has the amino acid sequence KNWPTG.

The P44-2 protein has an Mr of about 45 kDa and an isoelectric point of 5.20. The P44-2 protein comprises the amino acid sequence, SEQ ID NO: 4 shown in FIG. 2 . The hypervariable region of the P44-2 protein extends from amino acid 176 to amino acid 277 and has the characteristics shown in Table 1. The first conserved region of the P44-2 protein extends from amino acid 114 to amino acid 175 of SEQ ID NO: 4. The second conserved region of the P44-2 protein extends from amino acid 278 to amino acid 344 of SEQ ID NO: 4. The first semiconserved region of the hypervariable region of the P44 protein has the amino acid sequence IDGKVC; the second semiconserved region of the hypervariable region of the P44-2 protein has the amino acid sequence NAKAVATDLVQ, SEQ ID NO: 14; the third semiconserved region of the hypervariable region of the P44-2 protein has the amino acid sequence KNWPTG.

The P44-12 protein has an Mr of about 41.2 kDa and an isoelectric point of 5.19. The P44-12 protein comprises the amino acid sequence, SEQ ID NO:6, shown in FIG. 3 . The hypervariable region of the P44-12 protein extends from amino acid 176 to amino acid 279 and has the characteristics shown in Table 1. The first conserved region of the P44-12 protein extends from amino acid 114 to amino acid 175 of SEQ ID NO: 6. The second conserved region of the P44-12 protein extends from amino acid 280 to amino acid 345 of SEQ. ID. NO. 6. The first semiconserved region of the hypervariable region of the P44-12 protein has the amino acid sequence IDKKVC; the second semiconserved region of the hypervariable region of the P44-12 protein has the amino acid sequence NAEAVAKDLVQ, SEQ ID NO: 15; the third semiconserved region of the hypervariable region of the P44-12 protein has the amino acid sequence KNWPTS.

The P44-15 protein comprises a hypervariable region having an Mr of about 10.8 kDa and an isoelectric point of about 8.8. The P44-15 protein comprises the amino acid sequence, SEQ ID NO:8, shown in FIG. 4 . The hypervariable region of the P44-15 protein extend s from amino acid 82 to amino acid 184 and has the characteristics shown in Table 1 below. The first conserved region of the P44-15 protein extends from amino acid 30 to amino acid 83 of SEQ ID NO: 8. The second conserved region of the P44-15 protein extends from amino acid 185 to amino acid 250 of SEQ. ID. 8. The first semiconserved region of the hypervariable region of the P44-15 protein has the amino acid sequence IDGKVC; the second semiconserved region of the hypervariable region of the P44-15 protein has the amino. acid sequence NAKAVAKDLVQ, SEQ ID NO: 16; the third semiconserved region of the hypervariable region of the P44-2 protein has the amino acid sequence KNWPTS.

The P44-18 protein comprises a hypervariable region having an Mr of about 10.2 kDa and an isoelectric point of about 8.7. The P44-8 protein comprises the amino acid sequence, SEQ ID NO:10, shown in FIG. 5 . The hypervariable region of the P44-18 protein extends from amino acid 73 to amino acid 170 of the sequence shown in SEQ ID NO: 10. The first conserved region of the P44-48 protein extends from amino acid 21 to amino acid 72 of SEQ ID NO:10. The second conserved region of the P44-18 protein extends from amino acid 171 to amino acid 237 of the SEQ. ID. NO. 10. The first semiconserved region of the hypervariable region of the P44-18 protein has the amino acid sequence IGKKVC; the second semiconserved region of the hypervariable region of the P44-18 protein has the amino acid sequence NAKAVAGDLTK, SEQ ID NO: 17; the third semiconserved region of the hypervariable region of the P44-18 protein has the amino acid sequence KNWPTS.

The P44-19 protein comprises a hypervariable region having an Mr of about 8.6 kDa and an isoelectric point of about 8.8. The P44-19 protein comprises the amino acid sequence, SEQ ID NO: 12. shown in FIG. 6 . The hypervariable region of the P44-19 protein extends from amino acid 39 to amino acid 133. The first conserved region of the P44-19 protein extends from amino acid I to amino acid 38 of SEQ ID NO: 12. The second conserved region of the P44-19 protein extends from amino acid 134 to amino acid 164. The first semiconserved region of the hypervariable region of the P44-15 protein has the amino acid sequence IDGKIC; the second semiconserved region of the hypervariable region of the P44-19 protein has the amino acid sequence NATKVAGELTK, SEQ ID NO: 18; the third semiconserved region of the hypervariable region of the P44-19 protein has the amino acid sequence KHWPTT.

The members of the P44 family of proteins are immunogenic and, thus, are useful for preparing antibodies. Such antibodies are useful for immunolabeling isolates of the HGE agent and for detecting the presence of the HGE agent in body fluids, tissues, and particularly in neutrophils. The isolated proteins of the P44 family, particularly P44 are useful for detecting antibodies to the HGE agent in the blood of patients with clinical signs of HGE. The isolated members of the P44 family are also useful in a vaccine for protecting against infection with the HGE agent.

In another aspect, the present invention provides an isolated peptide which comprises a fragment of the P44 protein, hereinafter referred to as rP44 polypeptide. rP44 polypeptide weighs approximately 23 kDa and comprises the amino-terminal half of the P44 protein. In one embodiment, rP44 comprises the amino acid sequence extending from amino acid 30 through amino acid 248 of the amino acid sequence shown in FIG. 1 . In another embodiment the rP44 comprises the amino acid sequence extending from amino acid 38 through amino acid 248 of the amino acid sequence shown in FIG. 1 , and, thus, lacks the amino acids of the signal sequence of the P44 protein. The rP44 peptide is a useful diagnostic tools for detecting the presence of antibodies in the bodily fluids, particularly sera, of individuals infected with the causative agent of HGE.

The present invention provides oligopeptides of from about 14-16 amino acids in length and having a sequence which is specific to one or more of the P44 family proteins. Such peptides are useful for preparing chimeric peptides that are used to prepare antibodies that are immunospecific for one or more, of the P44 family proteins. In one embodiment, the synthetic oligopeptide comprises the amino acid sequence LSNGSAEAAHKYLSK, SEQ ID NO:19, which is specific for the P44 protein. In another embodiment, the synthetic oligopeptide comprises the amino acid sequence GHSSGVTQNPKLFST, SEQ ID NO20, which is specific for the P44-2 protein. In another embodiment, the synthetic oligopeptide comprises an amino acid sequence GKKSGDNGSLADYTD, SEQ ID NO:21, which is specific for the P44-12 protein. In another embodiment, the synthetic oligopeptide comprises an amino acid sequence PLYSDETHTKGASEGR, SEQ ID NO:22, which is specific for the P44-15 protein. In another embodiment, the synthetic oligopeptide comprises the amino acid sequence KNQKSSDTDTGVEKA, SEQ ID NO:23, which is specific for the P44-18 protein. In another embodiment, the synthetic oligopeptide comprises the amino acid sequence TGSNKYGTGTNSGELT, SEQ ID NO:24, which is specific for the P44-19 protein.

The present invention also provides isolated polynucleotides or nucleic acids which encode the proteins of the P-44 family or variants of the P44 family proteins. The polynucleotide is a DNA or RNA molecule, preferably a DNA molecule, and comprises a sequence which codes for a Group 44 protein or a variant thereof One polynucleotide, referred to hereinafter as the p44 polynucleotide” encodes the P44 protein. In one embodiment, the p44 polynucleotide comprises the nucleotide sequence, SEQ ID NO. 1, shown in FIG. 1 . Another polynucleotide, the p44-2 polynucleotide encodes the P44-2 protein. In one embodiment the p44-2 polynucleotide comprises the nucleotide sequence, SEQ ID NO: 3 shown in FIG. 2 . Another polynucleotide, the p 44-12 polynucleotide encodes the P44-12 protein. In one embodiment the p44-12 polynucleotide comprises the nucleotide sequence, SEQ ID NO: 5, shown in FIG. 3 . Another polynucleotide, the p 44-15 polynucleotide encodes the P44-15. protein. In one embodiment the p44-15 polynucleotide comprises the nucleotide sequence, SEQ ID NO: 7, shown in FIG. 4 . Another polynucleotide, the p44-18 polynucleotide encodes the P44-18 protein. In one embodiment the p44-18 polynucleotide comprises the nucleotide sequence, SEQ ID NO: 9, shown in FIG. 5 . Another polynucleotide, the p44-19 polynucleotide encodes the P44-19 protein. In one embodiment the p44-19 polynucleotide comprises the nucleotide sequence, SEQ ID NO: 11, shown in FIG. 6 .

Polynucleotides that encode the Group 44 proteins are useful tools that can be used in recombinant techniques for producing the Group 44 proteins. Polynucleotides encoding the Group 44 proteins are also useful for designing hybridization probes for isolating and identifying cDNA clones and genomic clones encoding the Group 44 proteins or allelic forms thereof. Such hybridization techniques are known to those of skill in the art. Sequence of polynucleotides that encode the Group 44 proteins are also useful for designing primers for polymerase chain reaction (PCR), a technique useful for obtaining large quantities of cDNA molecules that encode the Group 44 proteins.

Also encompassed by the present invention, are single stranded polynucleotides, hereinafter referred to as antisense polynucleotides, having sequences which are complementary to the DNA and RNA sequences which encode the P44 protein, the P44-2 protein, the P44-15 protein, the P44-18 protein, and the P44-19 protein. The term complementary as used herein refers to the natural binding of the polynucleotides under permissive salt and temperature conditions by base pairing,

The present invention also encompasses oligonucleotides that are used as primers in polymerase chain reaction (PCR) technologies to amplify transcripts of the genes which encode the P44 family proteins or portions of such transcripts. Preferably, the primers comprise 18-30 nucleotides, more preferably 19-25 nucleotides. Preferably, the primers have a G+C content of 40% or greater. Such oligonucleotides are at least 98% complementary with a portion of the DNA strand, i.e., the sense strand, which encodes the respective P44 family protein or a portion of its corresponding antisense strand. Preferably, the primer has at least 99% complementarity, more preferably 100% complementarity, with such sense strand or its corresponding antisense strand. Primers which are which have 100% complementarity with the antisense strand of a double-stranded DNA molecule which encodes a P44 family protein have a sequence which is identical to a sequence contained within the sense strand. The identity of primers which are 15 nucleotides in length and have full complementarity with a portion of the antisense strand of a double-stranded DNA molecule which encodes the P44 protein is determined using the nucleotide sequence, SEQ ID NO:1, shown in FIG. 1 A and described by the general formula a-b, where a is any integer between 1 to 1239, where b is equal to a+14, and where both a and b correspond to the positions of nucleotide residues shown in SEQ ID NO: 1.

The present invention also encompasses oligonucleotides that are useful as hybridization probes for detecting transcripts of the genes which encode the P44 family proteins or for mapping of the genes which encode the P44 family proteins Preferably, such oligonucleotides comprise at least 210 nucleotides, more preferably at least 230, most preferably from about 210 to 280 nucleotides. Such hybridization probes have a sequence which is at least 90% complementary with a sequence contained within the sense strand of a DNA molecule which encodes a P44 family protein or with a sequence contained within its corresponding antisense strand. Such hybridization probes bind to the sense strand under stringent conditions. The term “stringent conditions” as used herein is the binding which occurs within a range from about Tm 5° C. (5° C. below the melting temperature Tm of the probe) to about 20° C. to 25° C. below Tm. The probes are used in Northern assays to detect transcripts of p44 homologous genes and in Southern assays to detect p44 homologous genes. The identity of probes which are 200 nucleotides in length and have fill complementarity with a portion of the antisense strand of a double-stranded DNA molecule which encodes the P44 protein is determined using the nucleotide sequence, SEQ ID NO: 2, shown in FIG. 1 A and described by the general formula a-b, where a is any integer between 1 to 1239, b is equal to a +200, and where both a and b correspond to the positions of nucleotide residues shown in SEQ ID NO:1.

The present invention also encompasses isolated polynucleotides which are alleles of the genes which encode the Group 44 proteins. As used herein, an allele or allelic sequence is an alternative form of the gene which may result from one or more mutations in the sequences which encode the Group 44 proteins. Such mutations typically arise from natural addition, deletion of substitution of nucleotides in the open reading frame sequences Any gene may have none, one, or several allelic forms. Such alleles are identified using conventional techniques, such as for example screening libraries with probes having sequences identical to or complementary with one or more Group 44 polynucleotides.

The present invention also encompasses altered polynucleotides which encode Group 44 proteins or Group 44 protein variants. Such alterations include deletions, additions, or substitutions. Such alterations may produce a silent change and result in a Group 44 protein having the same amino acid sequence as the Group 44 protein encoded by the unaltered polynucleotide. Such alterations may produce a nucleotide sequence possessing non-naturally occurring codons. For example, codons preferred by a particular prokaryotic or eucaryotic host may be incorporated into the nucleotide sequences shown in FIGS. 1-6 to increase the rate of expression of the proteins encoded by such sequences. Such alterations may also introduce new restriction sites into the sequence or result in the production of a Group 44 protein variant. Typically, such alterations are accomplished using site-directed mutagenesis.

In another aspect, the present invention relates to antibodies which are specific for and bind to at least one Group 44 protein or a peptide specific for one or more Group 44 proteins. Such antibodies are useful research tools for identifying cells, particularly granulocytes, infected with the causative agent of HGE and for purifying the major outer membrane protein of the causative agent of HGE from partially purified preparations by affinity chromatography. Such antibodies are also useful for identifying bacterial colonies, particularly colonies of genetically-engineered bacteria, that are expressing the major outer membrane protein of the causative agent of HGE.

The present invention also relates to kits containing reagents for diagnosing HGE. The kit comprises one or more Group 44 proteins or antigenic fragments thereof. Preferably, the kit comprises a panel of Group 44 proteins or peptide fragments thereof. For ease of detection, it is preferred that the Group 44 proteins or peptides be attached to a substrate such as a column, plastic dish, matrix, or membrane, preferably nitrocellulose. The kit may further comprise a biomolecule, preferably a secondary antibody, for detecting interactions between the isolated Group 44 protein or peptide and antibodies in a patient sample. Preferably, the biomolecule is coupled to a detectable tag such as an enzyme, chromophore, fluorophore, or radio-isotope. The kit is used by contacting a patient sample with the Group 44 proteins or peptides under conditions that permit formation of antigen-antibody complexes. Then the biomolecule is added and the presence or absence of any resulting antigen-antibody complexes is detected by assaying for a change in the sample, for example, by observing the formation of a precipitate in the sample, the presence of radioactivity on the substrate, or a color change in the sample or on the substrate.

The present invention also provides a method for detecting antibodies to the HGE agent in a sample of a bodily fluid from a patient. The method comprises providing one or more Group 44 proteins or antigenic fragments thereof, contacting the Group 44 protein or antigenic fragment thereof with a bodily sample taken from the patient; and assaying for the formation of a complex between Group 44 protein or antigenic fragment thereof and antibodies in the bodily sample. The sample may be a tissue or a biological fluid, including urine, whole blood, or exudate, preferably serum. The sample may be untreated, subjected to precipitation, fractionation, separation, or purification before combining with the Group 44 protein. Interactions between antibodies in the sample and the Group 44 protein are detected by radiometric, calorimetric, or fluorometric means, size-separation, or precipitation. Preferably, detection is by addition of a secondary antibody that is coupled to a detectable tag, such as for example, an enzyme, fluorophore, or chromophore.

Formation of the antigen-antibody complex is indicative of the presence of anti-HGE antibodies, either IgM or IgG, in the patient. Thus,.the method is used to determine whether a patient is infected with the HGE agent. The method can also be used to distinguish patients infected with HGE from patients infected with Ehrlichia chaffeensis or Borrelia burgdorferi as there is no cross-reactivity between the isolated Group 44 proteins, particularly the P44 protein or the rP44 polypeptide, and antibodies produced in individuals infected with either Ehrlichia chaffeensis or Borrelia burgdorferi.

Preparing the Group, 44 Proteins and Pentides

The Group 44 proteins, the rP44 polypeptide, and the synthetic P44 oligopeptides may be produced by conventional peptide synthesizers. The Group 44 proteins and rP44 polypeptide may also be produced using cell-free translation systems and RNA molecules to derived from DNA constructs that encode the Group 44 proteins and the rP44 polypeptide. Alternatively, the Group 44 proteins and the rP44 polypeptide are made by transfecting host cells with expression vectors that comprise a DNA sequence that encodes the respective Group 44 protein or the rP44 polypeptide and then inducing expression of the protein or polypeptide in the host cells. For recombinant production, recombinant constructs comprising one or more of the sequences which encode the respective Group 44 protein or rP44 peptide are introduced into host cells by conventional methods such as calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape lading, ballistic introduction or infection.

The Group 44 proteins and rP44 polypeptide may be expressed in suitable host cells, such as for example, mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters using conventional techniques. Following transformation of the suitable host strain and growth of the host strain to an appropriate cell density, the cells are harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification of the P44 protein or rP44 polypeptide.

Conventional procedures for isolating recombinant proteins from transformed host cells, such as isolation by initial extraction from cell pellets or from cell culture medium, followed by salting-out, and one or more chromatography steps, including aqueous ion exchange chromatography, size exclusion chromatography steps, and high performance liquid chromatography (HPLC), and affinity chromatography may be used to isolate recombinant Group 44 proteins or rP44 polypeptide.

Synthetic oligopeptides specific for a particular Group 44 protein are identified by examining and comparing the hypervariable regions of the known Group 44 proteins.

Preparation of Antibodies

The Group 44 proteins, the rP44 polypeptide, and the P44 synthetic oligopeptides are used as immunogens to produce antibodies immunospecific for one or more Group 44 proteins. The term “immunospecific” means the antibodies have substantially greater affinity for one or more Group 44 proteins than for other proteins. Such antibodies may include, but are not limited to, polyclonal, monoclonal, chimeric, single chain, and Fab fragments.

It is preferred that the peptides, fragments, or oligopeptides that are used to induce antibodies to the P44 family proteins have an amino acid sequence of at least five amino acids, and more preferably, at least 10 amino acids that are identical to a portion of the amino acid sequence of a Group 44 protein. Preferably, the oligopeptide has a sequence which is identical to a portion of the hypervariable region of a Group 44 protein. Such peptides are conventionally fused with those of another protein such as keyhole limpet hemocyanin and antibody produced against the chimeric molecule.

Polyclonal antibodies are generated using conventional techniques by administering the Group 44 protein or a portion thereof, i.e., the rP44 polypeptide, or the P44 chimeric molecule to a host animal. Depending on the host species, various adjuvants may be used to increase immunological response. Among adjuvants used in humnas, BCG (bacilli Calmette-Guerin, and Corynebacterium parvum are especially preferable. Conventional protocols are also used to collect blood from the immunized animals and to isolate the serum and or the IgG fraction from the blood.

For preparation of monoclonal antibodies, conventional hybridoma techniques are used. Such antibodies are produced by continuous cell lines in culture. Suitable techniques for preparing monoclonal antibodies include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV hybridoma technique.

Various immunoassays may be used for screening to identify antibodies having the desired specificity. These include protocols which involve competitive binding or immunoradiometric assays and typically involve the measurement of complex formation between the respective Group 44 protein and the antibody.

Polynucleotides that Encode Group 44 Proteins or Variants Thereof

Polynucleotides comprising sequences encoding a Group 44 protein or a variant thereof may be synthesized in whole or in part using chemical methods. Polynucleotides which encode a Group 44 protein, particularly alleles of the genes which encode a Group 44 protein, may be obtained by screening a genomic library of an HGE isolate with a probe comprising sequences identical or complementary to the sequences shown in FIGS. 1-6 or with antibodies immunospecific for a Group 44 protein to identify clones containing such polynucleotide.

The probes are used in Southern blot or colony hybridization assays under high stringency conditions. Alternatively, polynucleotides encoding Group 44 proteins may be made using polymerase chain reaction (PCR) technology and primers which bind specifically to sequences which are known to encode a Group 44 protein.

The following examples are for purposes of illustration only and are not intended to limit the scope of the claims which are appended hereto.

EXAMPLES

Example 1

p44 Polynucleotide

A. Cloning

HGE agent No. 2, 3, 6, 11 and 13 isolates isolated from patients in New York State were cultivated in HL-60 cells. The organisms were purified by the Sephacryl S-1000 chromatography method as described by Rikihisa et al in Analysis of Ehrlichia canis and canine granulocytic Ehrlichia infection. J. Clin. Microbiol. 30: 143-148 (1992). Genomic DNA of the HGE agent was isolated from purified ehrlichial organisms by SDS lysis, pronase digestion, phenol-chloroform extraction, and ethanol precipitation, according to the procedure of Ohashi et al (1998). Immunodominant major outer membrane proteins of Ehrlicha chaffeensis are encoded by a polymorphic multigene family. Infect Immun. 66: 132-139. Purified genomic DNA was completely digested with 20 units of EcoRI at 37° C. for 4 h, and then litigated into the λZAPII vector. All procedures were carried out by using λZAPII/EcoRI/CIAP cloning kit (Stratagene, La Jolla, Calif.) according to the manufacturer's instruction. The gene library was constructed by infecting E. coli AL1-blue MRF1 strain with the recombinant phage. Clones and strain with the recombinant phage. Clones expressing ehrlichiial proteins were identified by using horse anti-HGE serum which has been preabsorbed with E. coli lysate. Positive recombinant pBluescript phagemids were excised from the λZAPII phages in the presence of helper f1 and were used to transform E. coli SOL R cells (Stratagene). All of the positive clones were analyzed by Western blotting using the horse anti-HE gent serum. Phagemids purification, restriction enzyme digestion, and gel electrophoresis were carried out as described by Sambrook et at in Molecular cloning: a laboratory manuals. 2nd ed. Cold Spring Harbor Laboratory Press. Plainview, N.Y. (1989).

DNA sequencing was determined by dideoxyl-termination method with an Applied Biosystems 373 DNA sequencer. DNA sequencing was performed by primer-walking method using synthetic oligonucleotides as primers. Translation of the nucleotide sequence and alignment of the amino acid sequence were made by using DNASIS computer software (Hitachi Software Engineering Co. Ltd., Yokohama, Japan). A homology search was done with data base of GenBank (National Center for Biotechnology Information, Bethesda, Md.) by using the software local alignment search tool (Altschul, S. F et al, Basic local alignment search tool. J. Mol. Biol. 215: 403-410. 1990) in the BLAST network service (NCBI). GenBank.

One of the positive clone which expressed a 44-kDa antigenic protein was named pHGE1221. The insert size of pHGE1221 was approximately 6.9 kb. The map of pHGE1221 contained five ORFs and the second ORF of 1239 bp encoding a 413-amino acid protein with a molecular mass of 43,739 Da including signal peptide. This protein was designated the P44 proteinThe nucleotide sequence, SEQ ID NO:1, of ORF2 and the amino acid sequence, SEQ ID NO:2, encoded by ORF2 is shown in FIG. 1 . The ORF1 contained 759 nucleotide base pairs encoding 253-amino acids without start codon. Two regions in the ORF1 were found to share the exact same sequences within ORF2. These conserved regions were named R1 and R2, which encoded 59- and 65-amino acids, respectively.

B. p44 Polynucleotide Probe

A 1.2-kb p44 gene fragment generated by PCR from the clone pHGE1221 was labeled with [32P] dATP by the random primer method using a kit (Boehringer Mannheim, Indianapolis, Ind.) and the labeled fragment and used as a DNA probe to detect p44 homologous genes. Genomic DNA (200 ng) extracted from the purified HGE agent HZ strain was completely digested with 20 units of restriction endonucleases at 37° C. for 4 h, electrophoresed, and transferred to Hybond-N+ nylon membrane (Amersham, Arlington Heights, Ill.) by a standard method . Hybridization was 16 h. The nylon sheet was washed in 01.×SSC )1×SSC containing 0.15M sodium chloride and 0.015M sodium citrate) with 1% SDS at 55° C. and hybridized probes were exposed to Hyperfilm (Amsersham) at −80° C. Genomic Southern blot analysis revealed more than 10 bands bound to the p44 gene probe, suggesting the existence of additional p44-homologous genes in the HGE agent genome.

Example 2

Polynucleotides Encoding P44-2 Protein, P44-12 Protein, P44-15 Protein P44-18 Protein. and P44-19 Protein

A. RT-PCR and Cloning of cDNAs

A pair of oligonucleotides used for RT-PCR (p3708 and p4257 as shown in FIG. 12 and Table 2 below) was designed based on the conserved regions between DNA sequences of the p44 gene and a truncated p44-homologous gene downstream from the p44. Total RNA was extracted from HL-60 cells infected with the HGE agent by d using TRIzol reagent (GIBCO-BRL, Gaithersburg, Md.). The isolated RNA (3 μg) was heated at 70° C. for 10 min and reverse transcribed in a 20-μl reaction mixture (0.5 mM deoxynuleoside triphophate mixture (dNTP), 200 U of SuperScript II reverse transcriptase (GIBCO-BRL), 2 pmole of p4257 primer, and 3 mM MgCl 2 ) at 42° C. for 50 min. PCR was performed in a 100-μl reaction mixture containing 2 μl of the cDNA product, 10 pmole of each of p3726 and p4257 primers, 0.2 mM dNTP mixture, 5 U of Taq DNA polymerase, and 1.5 mM MgCl 2 , with 3 min of denaturation at 94° C. followed by 30 cycles consisting of 1 min of denaturation at 94° C., 1 min of annealing at 52° C., and 2 min of extension at 72° C. To rule out contamination of DNA in the RNA preparation, RT-PCR without reverse transcriptase was carried out (negative control). The amplified RT-PCR products were cloned in a pCRII vector by using the TA Cloning Kit (Invitrogen Co., San Diego, Calif.). Twenty five cDNA clones, which were randomly selected from the transformants, were sequenced by dideoxy chain termination method with an Applied Biosystems 373 DNA sequencer.

After cloning the amplicons, only five different nucleotide sequences were found in the 25 randomly selected cDNA. The five sequences of the cDNAs were represented as p44-2 cDNA, p44-18cDNA, p44-12 cDNA, p44-15 cDNA, p44-18 cDNA and p44-19 cDNA. A comparison of the deduced amino acid sequences among then proteins and polypeptides encoded by the five different cDNAs and the p44 gene revealed that a central region of approximately 94-amino acid residues corresponding to the 175th- to 269th-amino acid sequence of the P44 protein was hypervariable, and flanked regions of approximately 30 residues each was highly conserved (FIG. 11 ). Within the hypervariable region, the highest amino acid sequence similarity was 32.8% between the P44-2 and P44-18 proteins, and the lowest similarity was 19.9% between P44-15 and P44 proteins. In comparison with flanking regions, the hypervariable region had higher hydrophilicity and antigenic index.

The N-terminal amino acid sequence (HDDVSALETG) of the native 44-kDa protein was found in P44, P 4 4- 2 and P44-12 proteins. A comparison of deduced amino acid sequences of these proteins revealed anidentical amino acid sequence consisting of 15 residues at their N terminus. It is believed that this sequence is a signal peptide. The alignment also showed that the N- and C-terminal portions are highly conserved among three Group 4 proteins (P44-2, P44-12 and P44), except existence of additional 34-amino acid residues at C terminus of P44-2 (FIG. 11 ). At N and C termini of both P44-15 and P44-18 proteins there is a short stretch of an amino acid sequence consisting of 8 to 28 residues without any homology to other Group 44 proteins including P44, P44-2 and P44-12 (FIG. 11 ).

B. P44-2, p44-12, p44-14, p44-18, and p44-19 Probes

DNA probes specific to each of the cDNAs for Southern blotting were designed based on a comparison of deduced amino acid sequences among these cDNAs. The central hypervariable regions in each cDNA and in the p44 gene were amplified by PCR with primer pairs as shown in Table 2 below. The amplicons were cloned into a pCRII vector. The DNA insert excised from each recombinant plasmid was labeled with [α- 32 P]dATP by the random primer method with a kit (Amersham, Arlington Heights, Ill.) and used as a probe to detect genes in the genome of the HGE agent.

DNA Hybridization was performed in a Rapid Hybridization Buffer (Amersham). The membrane was exposed to a Hyperfilm (Amersham). A single DNA band was detected in all restriction digestions tested. Since restriction enzymes used do not cut within a p44 gene and all cDNA clones, this suggests that each gene corresponding to the four probes is a single copy in the HGE agent genome. The probes specific to the cDNAs of P44-2 and P44-15 generated two or three bands, showing that two to three gene copies with sequences identical or highly homologous to those of the cDNAs of P44-2 or P44-15 exist in the HGE agent genome.

The XbaI DNA fragments of the HGE agent, which were detected by genomic Southern blot analysis, were inserted into a pBluescript II KS(+) vector, and the recombinant plasmids were introduced into Escherichia coli DH5α. By using the colony hybridization method (29) with the specific DNA probes same as those used for Southern blot analysis, three positive clones were isolated and the DNA inserts were sequenced. The clones were designated pHGE3.0, pHGE3.4, and pHGE3.9 containing ehrlichial DNA fragments of 3.0, 3.4, and 3.9 kb, respectively.

Sequencing of the 3.9- and 3.0-kb fragments revealed two complete ORFs of 1,275 bp and 1,173 bp encoding 425- and 391-amino acid proteins with Mr of 44,969 and 41,179, respectively. As expected, these ORFs (p44-2 and p44-12) contained the sequences identical to the cDNAs of P44-2 and P44-12, respectively ( FIG. 2 , 4The 3.4-kb DNA fragment contained an ORF of 834 bp encoding 278-amino acid protein with Mr of 29,387. This ORF (p44-15) included a sequence identical to P44-15 cDNA. The p44-15 did not have a universal start codon and lacked DNA sequence corresponding to 82-amino acid residues at the N terminus of the P44 protein. Consensus sequences of σ 70 promoter (AT-rich region about 10 base pairs upstream of the transcription start site; the −10 sequence) and Shine-Dalgarno sequence were found in the regions upstream from the start codon of p44-2 and p44-12. The nucleotide sequence(s) of the cDNAs and genes have been submitted to GenBank™/EBI Data Bank and assigned accession number(s) AF135254, AF135255, AF135256, AF135257, AF135258, AF135259, AF132260, AF132261, AF132262, and AF 132263. The nucleotide sequences of the cDNAs (SEQ ID Nos 3, 5, 7, 9, and 11) and the amino acid sequences, SEQ ID Nos 4, 6, 8, 10, and 12, of the proteins and polypeptides, encoded by the cDNas are shown in FIGS. 2-6 .

TABLE 2
Oligodeocynucleotides used in RT-PCR and PCR
		Nucleotide Sequences	Regions a	PCR products
Target Genes	Primers	(5′-3′)	(nt.)	(pb)	Usage
	P3708	GCTAAGGAGTTAGCTTATGAT	411-432
	P4257	AAGAAGATCATAACAAGCAT	936-960	549	Cloning of DNA
	(hvf and hvr b
P44-2	2hvf	TACTGGTAGCCATGCTGACC	542-563
	2hvr	AATCACCCGTCTTCAGTGATG	769-789	231	Southern/Northern blot
P44-18	18hvf	GGAGATTTCTAATTCCGGTAT	542-563
	18hvf	AGTCATTATTCGATTTAGACG	769-789	234	Southern/Northern blot
P44-12	12hvf	TGATAAGAAGGTTTGTGATGG	542-563
	12hvr	AGAGCACATTAACGTTGTCAC	769-789	270	Southern blot
P44-15	15hvf	GAAGGTTTGTAAGACGAAGGC	542-563
	15hvr	AGTTCGTGACAGGTTTTGGAG	769-789	240	Southern blot
P44-19	19hvf	CATTGATGGGAAGATTTGTAAG	542-564
	19hvr	AGGTGAGCTTTGTTAGTTCTC	769-789	234	Southern blot
P44	44hvf	GAAGGTTTGTAGTGGAAAGCA	542-563
	44hvr	ATGCTCCAACTACAATGCTAT	769-789	247	Southern/Northern blot
3′ end of p44-12	pnfl2	CAAGTTTGACTGGAACACTCC	218-239
(p44#12n) C	pnrl2	AACAATATCTTTACCAGAGG	478-498	280	Southern blot
5′ end of p44-12	pcfl2	CTAAAGACCTAGTACAGGAGC	880-901
(p44-12C) c	pcrl2	GAGAGAGCTGATAACTCAACC	1072-1093	210	Southern blot
a Numbers correspond to the nucleotides in the p44 gene which was cloned in reference 34 (GenBank accession number: AF059181) and the primer positions are shown in FIG. 1.
b Primer pairs are used to amplify hypervariable regions of each of cDNA's.
c Probes p44-12N and p44-12C are specific to 5′- and 3′- end conserved regions of p44 homologous genes.

Example 3

P44 Protein and rP44 Polypeptide.

Amino acid sequence analysis of the P44 protein indicated that it is a typical transmembrane protein which contains alternative hydrophilic and hydrophobic motifs with a signal peptide of 37 amino acid residues. Searching of the GenBank database revealed amino acid sequence similarity between the HGE agent P44 and Anaplasma marginale, a bovine intraerythocytic bacteria, major surface protein 2 (66% similarity; 44% identity).

The entire P44 protein was expressed by cloning whole p44 gene into pET30a vector.

However, the expression level is low.

To effectively overexpress antigenic epitopes of recombinant P44, the deduced amino acid sequences based on the sequences of a plasmid pHGE 1221, which was positive in immunoscreening and contained an ORF encoding the proposed P44, were analyzed with DNASTAR computer software (DNASTAR Inc., 1228 South Park Street, Madison.). Several motifs with high antigenic index and probability of surface exposure were found in NH2-terminal portion. Therefore, the primers were designed to amplify the DNA sequence encoding for a 219-amino acid polypeptide from NH 2 -terminus including 8 amino acid residues of signal peptide, and were prepared by BioServe (Laurel, Md.). The 5′ oligonucleotide primer consists. of the DNA sequence coding for the NH 2 -terminal region of the HGE agent P44 and the NcoI restriction sites (underlined) [5′-CG CCATGG CTGGGAGTGATGTCA-3′] and the 3′ oligonucleotide primers consists of the DNA sequence coding for the amino acids from No. 243 to 247 with the addition of a stop codon (TAG, boldface) and a EcoRi restriction site (underlined) [5′-GC GAATTC TACGCACTACCATTACTCA-3′) (FIG. 1 ). PCR amplification was carried out with a Perkin-Elmer Cetus DNA Thermal Cycler (Model 480) by using standard procedures. The 657-bp amplified product containing approximately half of the P44 gene was digested with NcoI and EcoRI, and ligated into dephosphorylated NcoI- and EcoRI-digested pET30a expression vector (Novagen, Inc., Madison, Wis.). The recombinant plasmid was designated as pEP44 . E. coli NovaBlue strain (Novagen, Inc.) was transformed with recombinant pET30a. A plasmid preparation of pEP44 from transformed NovaBlue was then used to transform E. coli BL21(DE3)pLysS. The purification of rP44 protein was performed by using the His-Bind Buffer Kit (Novagen, Inc.) according to the manufacturer's instruction. The expressed partial recombinant P44 antigenic polypeptide (rP44) purified by affinity chromatography was 35 kDa in SDS-PAGE. It was a fusion polypeptide in which a 44-amino acid sequence including the His tag peptide derived from pET30a expression vector was located at the NH 2 -terminus.

Example 3

Detecting HGE Infection with the rP44 Polypetide

A. Western Immunoblot Analysis

The affinity-purified rP44 polypeptide and purified HGE organisms were used for Western immunoblot analysis of patient sera. All HGE patient sera No. 2, 3, 4, 6, 11, 13, 21 and 22 were collected in the patients from Westchester County Medical Center in New York State. The diagnosis was confirmed by using PCR, IFA testing and culture islation. Patient sera No. 21-1, -2, -3, -4 and -5 were collected at different stages of illness (Jul. 25, 1995-first acute stage, Aug. 24, 1995-convalescent stage, Oct. 5, 1995, Jun. 13, 1996, and Jul. 17, 1997-second acute stage) from a patient suspected of having re-infection with the HGE agent.

Purified HGE agent and rP44 polypeptide separated by 10% PAGE were transferred to a nitrocellulose sheet, then immersed in TBS buffer (150 mM NaCl, 50 mM Tris-HCI [pH 7.4]) containing 0.05% Tween 20 (T-TBS) and 5% milk at 4° C. overnight to saturate protein-binding site. The nitrocellulose membrane was incubated with the primary mouse, human or horse sera at a 1:1,000 dilution and then with peroxidase-conjugated affinity purified anti-human, anti-horse or anti-mouse immunoglobulin G (Kirkegaard & Perry Laboratories, Inc., Gaithersburg, Md.) at a 1:1,000 or I:2,000 dilution. The peroxidase-positive bands were detected by immersing the sheet in a developing solution (70 mM sodium acetate, pH 6.2) containing 0.005% diaminobenzidine tetrahydrochloride (Nacalai Tesque, Inc., Kyoto, Japan) and 0.03% H 2 O 2 at room temperature for 5 min. The enzyme reaction was terminated by washing the sheet in 0.1 M H 2 SO 4 .

Horse anti-HGE serum and eleven sera from the HGE patients specifically recognized the rP44 polypeptide. All these patients were confirmed to have HGE by PCR and/or culture isolation previously. Five sera collected over 2 year period at different stages of illness from a patient (No. 21) reacted with rP44. This patient was suspected of having re-infection with HOE agent, since IFA titer at 8 days before 21-5 serum collection date was 1:40. The result indicates that regardless of stages of infection or reinfection P44 is the major antigen recognized by the patient sera. The horse anti- E. equi serum strongly reacted with both native 44-kDa protein in whole cell organisms and rP44 polypeptide. Human anti- E. chaffeensis and rabbit anti- B. burgdorferi did not recognize rP44. This indicates that rP44 polypeptide can be used as a testing antigen to differentiate infection with HGE agent from infection with E. chaffeensis or B. burgdorferi.

B. Dot Immunoblot Assay

The affinity-purified rP44 polypeptide in TBS was blotted onto a nitrocellulose membrane (Schleicher & Schuell, Keene, N H), and then immersed T-TBS containing 5% milk at room temperature for 30 min, air dried, and stored at −20° C. until required. Based on the results of quantitative analysis, 0.5 ug per dot of rP44 was used in the immunoassay to assay the clinical specimens. For immunoassay, sera to be tested were diluted at 1:1,000 in T-TBS containing 5% milk and incubated with the antigen dots for 1 h at room temperature After being washed three times with T-TBS, the nitrocellulose sheets were incubated with peroxidase-conjugated affinity-purified anti-human IgG (Kirkegaard & Perry) at 1:2,000 dilution. The peroxidase-positive bands were detected by immersing the sheet in a developing solution as described in the Western immunoblot section. The color density was measured using background correction of ImageQuant program Molecular Dynamics, Sunnyvale, Calif.).

To determine the optimal amount of antigen of per dot and dilution of patient sera for dot blot immunoassay, nitrocellulose membrane strips, each having eight dots containing a different amount of purified rP44 antigen, were incubated with five different sera with IFA titers in a range from 1: 2,560 to <1: 20. There was a positive correlation between color densities of dot reactions and IFA titers when >50 ng of recombinant antigen was used per dot. No reaction was detected using negative control sera (IFA titer <1: 20). Since the difference of color density among sera with different IFA titers was quite distinct, and the color density progressively increased (especially at antigen amounts of 0.25 ug to 1 ug per dot), 0.5 ug per dot was used in the following assays. This amount of protein can distinguish both high and low titers.

A total of 25 clinical patient sera with different IFA titers (from 1:2,560 to <1: 20) were examined by dot blot immunoassay using 0.5 ug per dot of affinity-purified rP44. As shown in FIG. 6A , the color density of the each dot is highly correlated with the IFA titer. In five tested sera with an IFA titer <1: 20, the color density of one dot can be clearly distinguished from other negative sera by the naked eye. This sera was collected at acute phase from the patient No. 3 who was nested PCR and culture isolation positive for the HGE agent. This patient developed a convalescent IFA titer of 1: 640. The remaining four <1: 20 sera were derived from patients who were negative by convalescent serum IFA, PCR, or isolation. These results indicate that the dot immunoassay using rP44 protein provides a simpler serodiagnosis of HGE infection than the IFA test.

Example 4

Oligopeptides Specific to the P44 Protein, the P44-2 Protein, the P44-15 Protein, the P44-18 Protein, and the P44-19 Protein

Synthetic oligopeptides specific to each Group 44 Protein were prepared. Such oligopeptides were identified, by using DNASTAR program (DNASTAR Inc., Madison, Wis.) and selected from the hypervariable region of the P44 protein, the P44-2 protein, the P44-15 protein and the P44-18 protein, and the P44-19 protein. Two oligopeptides with sequences of GHSSGVTQNPKLFST and KNQKSSDTDTGVEKA were synthesized (Alpha Diagnostic, San Antonio, Tex.) and named Pep2 and Pep18, respectively. Pep2 and Pep28 were conjugated to keyhole limpet hemocyanin (KLH) and and the resulting KLH-conjugated oligopeptide Pep2 and Pep18 were used as antigens in a dot blot assay. The assay was carried out as described above in example 3. Convalescent sera tested were from two patients (no. 7, and no. 11) with clinical signs of HGE was confirmed by IFA and PCR. The results showed that oligopeptides are useful for detecting antibodies to the HGE causative agent in serum from patients afflicted with HGE.

Example 5

Anti-rP44 Polyclonal Antiserum

Hyperimmune anti-rP44 polyclonal antiserum was generated by intraperitoneal immunization of BALB/c male mice (6 weeks old) with rP44 affinity-purified as described above. Primary immunization of each animal was with 15 ug of purified rP44 in Freund's complete adjuvant. Two boosts of 10 ug each of rP44 in Freund's incomplete adjuvant followed at day 14 and 28. Hyperimmune serum was obtained 14 days after last boost

The mouse antiserum specific to rP44 was used in a western immunoblot analysis. The antiserum strongly reacted with 44- and 42-kDa proteins in all isolates tested, and recognized a 27-kDa protein in No. 2 and 6 isolates, and a 1 5-kDa protein in No.2, 3, 6 and USG isolates.

Example 6

Antisera to KLH-coniugated Oligopeptide Pep2 and Pep18

Antisera against the KLH-conjugated oligopeptide Pep2 and Pep18 were generated by immunization of a rabbit and a mouse with keyhole limpet hemacyanin KLH) (PIERCE, Rockford, Ill.)-conjugated synthetic oligopeptide Pep2 and Pep18, respectively.

The resulting sera was used in a Western immunoblot analysis of the HGE agent lysate as described in example 3. The mouse anti-recombinant rP44 polypeptide anti-serum was used as a positive control. For double IFA staining, a lissamine rhodamine (LR)-labeled goat anti-rabbit IgG and fluorescein isothiocyanate (FITC)-labeled goat anti-mouse IgG (Jackson ImmunoResearch Laboratories, Inc., West Grove, Pa.) were used as secondary antibodies. The rabbit anti-Pep2 and the mouse anti-Pep18 sera reacted with a single band of 44 kDa and 43 kDa, respectively in the HGE agent lysate, respectively.

In host cells the HGE agent resides in membrane-bound inclusions that appear as clusters of organisms like mulberries, therefore, are called morulae. The morulae are considered as microcolonies derived from a single organism. Six morulae in an HL-60 cell which reacted with the mouse anti-rP44 serum were also recognized by the rabbit anti-Pep2 serum. All organisms were doublelabeled in 100 infected cells scored in three independent labeling experiments. This means a p44-2 gene is probably expressed in all of the HGE agent organisms cultivated in HL-60 cells. With a mouse anti-Pep18 serum even at low (1:5) dilution, the immunofluorescence labeling of organisms or morulae was extremely weak.

44 1 1242 DNA P44 CDS (1)..(1242) 1atg ttc tca ttt tct tta aaa ggc aga cct tcc ttt ttc gaa ata gcc 48Met Phe Ser Phe Ser Leu Lys Gly Arg Pro Ser Phe Phe Glu Ile Ala 1 5 10 15ttt tct tta gga agc gta atg atg tct atg gct ata gtc atg gct ggg 96Phe Ser Leu Gly Ser Val Met Met Ser Met Ala Ile Val Met Ala Gly 20 25 30agt gat gtc agg gct cat gat gac gtt agc gct ttg gag act ggt ggt 144Ser Asp Val Arg Ala His Asp Asp Val Ser Ala Leu Glu Thr Gly Gly 35 40 45gcg gga tat ttc tat gtt ggt ttg gat tac agt cca gcg ttt agc aag 192Ala Gly Tyr Phe Tyr Val Gly Leu Asp Tyr Ser Pro Ala Phe Ser Lys 50 55 60ata aga gat ttt agt ata agg gag agt aac gga gag act aag gca gta 240Ile Arg Asp Phe Ser Ile Arg Glu Ser Asn Gly Glu Thr Lys Ala Val 65 70 75 80tat cca tac tta aag gat gga aag agt gta aag cta gag tca cac aag 288Tyr Pro Tyr Leu Lys Asp Gly Lys Ser Val Lys Leu Glu Ser His Lys 85 90 95ttt gac tgg aac aca cct gat cct cgg att ggg ttt aag gac aac atg 336Phe Asp Trp Asn Thr Pro Asp Pro Arg Ile Gly Phe Lys Asp Asn Met 100 105 110ctt gta gct atg gaa ggc agt gtt ggg tac cct att ggt ggt gcc agg 384Leu Val Ala Met Glu Gly Ser Val Gly Tyr Pro Ile Gly Gly Ala Arg 115 120 125gtt gag ctt gag att ggt tac gag cgt ttc aag act aag ggt att aga 432Val Glu Leu Glu Ile Gly Tyr Glu Arg Phe Lys Thr Lys Gly Ile Arg 130 135 140gat agt ggt agt aag gaa gat gaa gct gat aca gta tat cta cta gct 480Asp Ser Gly Ser Lys Glu Asp Glu Ala Asp Thr Val Tyr Leu Leu Ala145 150 155 160aag gag tta gct tat gat gtt gtt act ggg cag act gat aac ctt gct 528Lys Glu Leu Ala Tyr Asp Val Val Thr Gly Gln Thr Asp Asn Leu Ala 165 170 175gct gct ctt gcc aaa acc tcc ggt aag gac atc gtt cag ttt gct aag 576Ala Ala Leu Ala Lys Thr Ser Gly Lys Asp Ile Val Gln Phe Ala Lys 180 185 190gcg gtg gag atc tct tac cct agt atc gat ggg aag gtt tgt agt gga 624Ala Val Glu Ile Ser Tyr Pro Ser Ile Asp Gly Lys Val Cys Ser Gly 195 200 205aag cat gcg gcg ctt gca gca aac acg aac gcg gag aaa aag tac gcg 672Lys His Ala Ala Leu Ala Ala Asn Thr Asn Ala Glu Lys Lys Tyr Ala 210 215 220gtt gag cct gcg aac ggc gga aca gac ggg agc acg tcg cag tgt agt 720Val Glu Pro Ala Asn Gly Gly Thr Asp Gly Ser Thr Ser Gln Cys Ser225 230 235 240ggt ttg agt aat ggt agt gcg gag gct gct cat aaa tat ttg agt aag 768Gly Leu Ser Asn Gly Ser Ala Glu Ala Ala His Lys Tyr Leu Ser Lys 245 250 255ttt gta agt ctt acg gga gtg gtt gaa ggg aaa aac tgg cct act ggt 816Phe Val Ser Leu Thr Gly Val Val Glu Gly Lys Asn Trp Pro Thr Gly 260 265 270aga tcg agt aac aac agc aat agc att gta gtt gga gca cct aat agt 864Arg Ser Ser Asn Asn Ser Asn Ser Ile Val Val Gly Ala Pro Asn Ser 275 280 285aac gca aac gcg atg gcc aaa gat cta gta aag gaa cta aca cca gag 912Asn Ala Asn Ala Met Ala Lys Asp Leu Val Lys Glu Leu Thr Pro Glu 290 295 300gag aaa acc ata gtt gcc ggg tta cta gct aaa act att gaa ggg ggt 960Glu Lys Thr Ile Val Ala Gly Leu Leu Ala Lys Thr Ile Glu Gly Gly305 310 315 320gag gtt gta gaa att agg gcg gtt tct tct act tct gta atg gtc aat 1008Glu Val Val Glu Ile Arg Ala Val Ser Ser Thr Ser Val Met Val Asn 325 330 335gct tgt tat gat ctt ctt agt gaa ggt tta ggt gtt gtt cct tat gct 1056Ala Cys Tyr Asp Leu Leu Ser Glu Gly Leu Gly Val Val Pro Tyr Ala 340 345 350tgt gtt ggt tta ggt ggt aac ttc gta ggt gtt gtt gat ggg cat atc 1104Cys Val Gly Leu Gly Gly Asn Phe Val Gly Val Val Asp Gly His Ile 355 360 365act cct aag ctt gct tat agg tta aag gct ggc ttg agt tat cag ctc 1152Thr Pro Lys Leu Ala Tyr Arg Leu Lys Ala Gly Leu Ser Tyr Gln Leu 370 375 380tct cct gaa atc tcc gct ttt gcg ggt gga ttc tac cat cgt gtt gtg 1200Ser Pro Glu Ile Ser Ala Phe Ala Gly Gly Phe Tyr His Arg Val Val385 390 395 400gga gat ggc gtt tat gat gat ctg ccg gag cct atg caa taa 1242Gly Asp Gly Val Tyr Asp Asp Leu Pro Glu Pro Met Gln 405 410 2 413 PRT P44 2Met Phe Ser Phe Ser Leu Lys Gly Arg Pro Ser Phe Phe Glu Ile Ala 1 5 10 15Phe Ser Leu Gly Ser Val Met Met Ser Met Ala Ile Val Met Ala Gly 20 25 30Ser Asp Val Arg Ala His Asp Asp Val Ser Ala Leu Glu Thr Gly Gly 35 40 45Ala Gly Tyr Phe Tyr Val Gly Leu Asp Tyr Ser Pro Ala Phe Ser Lys 50 55 60Ile Arg Asp Phe Ser Ile Arg Glu Ser Asn Gly Glu Thr Lys Ala Val 65 70 75 80Tyr Pro Tyr Leu Lys Asp Gly Lys Ser Val Lys Leu Glu Ser His Lys 85 90 95Phe Asp Trp Asn Thr Pro Asp Pro Arg Ile Gly Phe Lys Asp Asn Met 100 105 110Leu Val Ala Met Glu Gly Ser Val Gly Tyr Pro Ile Gly Gly Ala Arg 115 120 125Val Glu Leu Glu Ile Gly Tyr Glu Arg Phe Lys Thr Lys Gly Ile Arg 130 135 140Asp Ser Gly Ser Lys Glu Asp Glu Ala Asp Thr Val Tyr Leu Leu Ala145 150 155 160Lys Glu Leu Ala Tyr Asp Val Val Thr Gly Gln Thr Asp Asn Leu Ala 165 170 175Ala Ala Leu Ala Lys Thr Ser Gly Lys Asp Ile Val Gln Phe Ala Lys 180 185 190Ala Val Glu Ile Ser Tyr Pro Ser Ile Asp Gly Lys Val Cys Ser Gly 195 200 205Lys His Ala Ala Leu Ala Ala Asn Thr Asn Ala Glu Lys Lys Tyr Ala 210 215 220Val Glu Pro Ala Asn Gly Gly Thr Asp Gly Ser Thr Ser Gln Cys Ser225 230 235 240Gly Leu Ser Asn Gly Ser Ala Glu Ala Ala His Lys Tyr Leu Ser Lys 245 250 255Phe Val Ser Leu Thr Gly Val Val Glu Gly Lys Asn Trp Pro Thr Gly 260 265 270Arg Ser Ser Asn Asn Ser Asn Ser Ile Val Val Gly Ala Pro Asn Ser 275 280 285Asn Ala Asn Ala Met Ala Lys Asp Leu Val Lys Glu Leu Thr Pro Glu 290 295 300Glu Lys Thr Ile Val Ala Gly Leu Leu Ala Lys Thr Ile Glu Gly Gly305 310 315 320Glu Val Val Glu Ile Arg Ala Val Ser Ser Thr Ser Val Met Val Asn 325 330 335Ala Cys Tyr Asp Leu Leu Ser Glu Gly Leu Gly Val Val Pro Tyr Ala 340 345 350Cys Val Gly Leu Gly Gly Asn Phe Val Gly Val Val Asp Gly His Ile 355 360 365Thr Pro Lys Leu Ala Tyr Arg Leu Lys Ala Gly Leu Ser Tyr Gln Leu 370 375 380Ser Pro Glu Ile Ser Ala Phe Ala Gly Gly Phe Tyr His Arg Val Val385 390 395 400Gly Asp Gly Val Tyr Asp Asp Leu Pro Glu Pro Met Gln 405 410 3 1278 DNA P44-2 CDS (1)..(1278) 3atg atg tca atg gct ata gtc atg gct ggg aat gat gtc agg gct cat 48Met Met Ser Met Ala Ile Val Met Ala Gly Asn Asp Val Arg Ala His 1 5 10 15gat gac gtt agc gct ttg gag aat ggt ggt gcg gga tat ttc tat gtt 96Asp Asp Val Ser Ala Leu Glu Asn Gly Gly Ala Gly Tyr Phe Tyr Val 20 25 30ggt ttg gat tac agt cca gcg ttt agc aag ata aga gat ttt agt ata 144Gly Leu Asp Tyr Ser Pro Ala Phe Ser Lys Ile Arg Asp Phe Ser Ile 35 40 45agg gag agt aac gga gag aca aag gca gta tat cca tac tta aag gat 192Arg Glu Ser Asn Gly Glu Thr Lys Ala Val Tyr Pro Tyr Leu Lys Asp 50 55 60gga aag agt gta aag ctt gag tcg cac aag ttt gac tgg aac aca cct 240Gly Lys Ser Val Lys Leu Glu Ser His Lys Phe Asp Trp Asn Thr Pro 65 70 75 80gat cct cgg att ggg ttt aag gac aac atg ctt gta gct atg gaa ggc 288Asp Pro Arg Ile Gly Phe Lys Asp Asn Met Leu Val Ala Met Glu Gly 85 90 95agt gtt ggt tat ggt att ggt ggt gcc agg gtt gag ctt gag att ggt 336Ser Val Gly Tyr Gly Ile Gly Gly Ala Arg Val Glu Leu Glu Ile Gly 100 105 110tac gag cgc ttc aag acc aag ggt att aga gat agt ggt agt aag gaa 384Tyr Glu Arg Phe Lys Thr Lys Gly Ile Arg Asp Ser Gly Ser Lys Glu 115 120 125gat gaa gct gat aca gta tat cta cta gct aag gag tta gct tat gat 432Asp Glu Ala Asp Thr Val Tyr Leu Leu Ala Lys Glu Leu Ala Tyr Asp 130 135 140gtt gtt act gga cag act gat aag ctt acc gct gct ctt gcc aag acc 480Val Val Thr Gly Gln Thr Asp Lys Leu Thr Ala Ala Leu Ala Lys Thr145 150 155 160tcc ggt aaa gat atc gtt cag ttt gcg aat gct gtg aaa att tct agc 528Ser Gly Lys Asp Ile Val Gln Phe Ala Asn Ala Val Lys Ile Ser Ser 165 170 175tct gcc atc gat ggg aag gtt tgt act ggt agc cat gct gac cta gcg 576Ser Ala Ile Asp Gly Lys Val Cys Thr Gly Ser His Ala Asp Leu Ala 180 185 190cct ggt acg aat gcg ggg aaa aag ttc gtt gtg aac ccg gaa gcc agc 624Pro Gly Thr Asn Ala Gly Lys Lys Phe Val Val Asn Pro Glu Ala Ser 195 200 205ggg agt act gat ggg gat acg tca cag tgt agt ggt tta ggg cat agt 672Gly Ser Thr Asp Gly Asp Thr Ser Gln Cys Ser Gly Leu Gly His Ser 210 215 220agt ggt gtt aca cag aat ccg aag tta ttt agt act ttt gtg gac act 720Ser Gly Val Thr Gln Asn Pro Lys Leu Phe Ser Thr Phe Val Asp Thr225 230 235 240gtg aag att gct gag gat aaa aac tgg ccg acg ggc agg gca aaa tcg 768Val Lys Ile Ala Glu Asp Lys Asn Trp Pro Thr Gly Arg Ala Lys Ser 245 250 255aac aca tca ctg aag acg ggt gat act aat agt aac gcc aaa gcc gtg 816Asn Thr Ser Leu Lys Thr Gly Asp Thr Asn Ser Asn Ala Lys Ala Val 260 265 270gct aca gac cta gta cag gag cta acc cct gaa gaa aaa acc ata gta 864Ala Thr Asp Leu Val Gln Glu Leu Thr Pro Glu Glu Lys Thr Ile Val 275 280 285gca ggg tta cta gct aag act att gaa ggg ggt gaa gtt gtt gag atc 912Ala Gly Leu Leu Ala Lys Thr Ile Glu Gly Gly Glu Val Val Glu Ile 290 295 300agg gcg gtt tct tct act tcc gta atg gtc aat gct tgt tat gat ctt 960Arg Ala Val Ser Ser Thr Ser Val Met Val Asn Ala Cys Tyr Asp Leu305 310 315 320ctt agt gaa ggt tta tgt gtt gtt cct tat gct tgt gtt ggt ctt ggc 1008Leu Ser Glu Gly Leu Cys Val Val Pro Tyr Ala Cys Val Gly Leu Gly 325 330 335ggt aac ttc gtg ggc gtg gtt gat ggc cat atc act cct aag ctt gct 1056Gly Asn Phe Val Gly Val Val Asp Gly His Ile Thr Pro Lys Leu Ala 340 345 350tat aga tta aag gct ggg ttg agt tat cag ctc tct cct gta atc tcc 1104Tyr Arg Leu Lys Ala Gly Leu Ser Tyr Gln Leu Ser Pro Val Ile Ser 355 360 365gct ttt gcg ggt gga ttc tac cat cgc gtt gtg gga gat ggc gtt tat 1152Ala Phe Ala Gly Gly Phe Tyr His Arg Val Val Gly Asp Gly Val Tyr 370 375 380gat gat ctg ccg gct caa cgt ctt gta gat gat act agt ccg gcg ggc 1200Asp Asp Leu Pro Ala Gln Arg Leu Val Asp Asp Thr Ser Pro Ala Gly385 390 395 400cgt act aag gat act gct att gct aac ttc tcc atg gct tat gtc ggt 1248Arg Thr Lys Asp Thr Ala Ile Ala Asn Phe Ser Met Ala Tyr Val Gly 405 410 415ggg gaa ttt ggt gtt agg ttc gct ttt taa 1278Gly Glu Phe Gly Val Arg Phe Ala Phe 420 425 4 425 PRT P44-2 4Met Met Ser Met Ala Ile Val Met Ala Gly Asn Asp Val Arg Ala His 1 5 10 15Asp Asp Val Ser Ala Leu Glu Asn Gly Gly Ala Gly Tyr Phe Tyr Val 20 25 30Gly Leu Asp Tyr Ser Pro Ala Phe Ser Lys Ile Arg Asp Phe Ser Ile 35 40 45Arg Glu Ser Asn Gly Glu Thr Lys Ala Val Tyr Pro Tyr Leu Lys Asp 50 55 60Gly Lys Ser Val Lys Leu Glu Ser His Lys Phe Asp Trp Asn Thr Pro 65 70 75 80Asp Pro Arg Ile Gly Phe Lys Asp Asn Met Leu Val Ala Met Glu Gly 85 90 95Ser Val Gly Tyr Gly Ile Gly Gly Ala Arg Val Glu Leu Glu Ile Gly 100 105 110Tyr Glu Arg Phe Lys Thr Lys Gly Ile Arg Asp Ser Gly Ser Lys Glu 115 120 125Asp Glu Ala Asp Thr Val Tyr Leu Leu Ala Lys Glu Leu Ala Tyr Asp 130 135 140Val Val Thr Gly Gln Thr Asp Lys Leu Thr Ala Ala Leu Ala Lys Thr145 150 155 160Ser Gly Lys Asp Ile Val Gln Phe Ala Asn Ala Val Lys Ile Ser Ser 165 170 175Ser Ala Ile Asp Gly Lys Val Cys Thr Gly Ser His Ala Asp Leu Ala 180 185 190Pro Gly Thr Asn Ala Gly Lys Lys Phe Val Val Asn Pro Glu Ala Ser 195 200 205Gly Ser Thr Asp Gly Asp Thr Ser Gln Cys Ser Gly Leu Gly His Ser 210 215 220Ser Gly Val Thr Gln Asn Pro Lys Leu Phe Ser Thr Phe Val Asp Thr225 230 235 240Val Lys Ile Ala Glu Asp Lys Asn Trp Pro Thr Gly Arg Ala Lys Ser 245 250 255Asn Thr Ser Leu Lys Thr Gly Asp Thr Asn Ser Asn Ala Lys Ala Val 260 265 270Ala Thr Asp Leu Val Gln Glu Leu Thr Pro Glu Glu Lys Thr Ile Val 275 280 285Ala Gly Leu Leu Ala Lys Thr Ile Glu Gly Gly Glu Val Val Glu Ile 290 295 300Arg Ala Val Ser Ser Thr Ser Val Met Val Asn Ala Cys Tyr Asp Leu305 310 315 320Leu Ser Glu Gly Leu Cys Val Val Pro Tyr Ala Cys Val Gly Leu Gly 325 330 335Gly Asn Phe Val Gly Val Val Asp Gly His Ile Thr Pro Lys Leu Ala 340 345 350Tyr Arg Leu Lys Ala Gly Leu Ser Tyr Gln Leu Ser Pro Val Ile Ser 355 360 365Ala Phe Ala Gly Gly Phe Tyr His Arg Val Val Gly Asp Gly Val Tyr 370 375 380Asp Asp Leu Pro Ala Gln Arg Leu Val Asp Asp Thr Ser Pro Ala Gly385 390 395 400Arg Thr Lys Asp Thr Ala Ile Ala Asn Phe Ser Met Ala Tyr Val Gly 405 410 415Gly Glu Phe Gly Val Arg Phe Ala Phe 420 425 5 1176 DNA P44-12 CDS (1)..(1176) 5atg atg tct atg gct ata gtc atg gct ggg aat gat gtc agg gct cat 48Met Met Ser Met Ala Ile Val Met Ala Gly Asn Asp Val Arg Ala His 1 5 10 15gat gac gtt agc gct ttg gag act ggt ggt gcg gga tat ttc tat gtt 96Asp Asp Val Ser Ala Leu Glu Thr Gly Gly Ala Gly Tyr Phe Tyr Val 20 25 30ggc ttg gat tac agt cca gcg ttt agc aag ata aga gat ttt agt ata 144Gly Leu Asp Tyr Ser Pro Ala Phe Ser Lys Ile Arg Asp Phe Ser Ile 35 40 45agg gag agt aac gga gag act aag gca gta tat cca tac tta aag gat 192Arg Glu Ser Asn Gly Glu Thr Lys Ala Val Tyr Pro Tyr Leu Lys Asp 50 55 60gga aag agt gta aag cta gag tca cac aag ttt gac tgg aac act cct 240Gly Lys Ser Val Lys Leu Glu Ser His Lys Phe Asp Trp Asn Thr Pro 65 70 75 80gat cct cgg att ggg ttt aag gac aac atg ctt gta gct atg gaa ggc 288Asp Pro Arg Ile Gly Phe Lys Asp Asn Met Leu Val Ala Met Glu Gly 85 90 95agt gtt ggt tat ggt att ggt ggt gcc agg gtt gag ctt gag att ggt 336Ser Val Gly Tyr Gly Ile Gly Gly Ala Arg Val Glu Leu Glu Ile Gly 100 105 110tac gag cgc ttc aag acc aag ggt att aga gat agt ggt agt aag gaa 384Tyr Glu Arg Phe Lys Thr Lys Gly Ile Arg Asp Ser Gly Ser Lys Glu 115 120 125gat gaa gct gat aca gta tat cta cta gct aag gag tta gct tat gat 432Asp Glu Ala Asp Thr Val Tyr Leu Leu Ala Lys Glu Leu Ala Tyr Asp 130 135 140gtt gtt act ggg cag act gat aac ctt gct gct gct ctt gcc aag acc 480Val Val Thr Gly Gln Thr Asp Asn Leu Ala Ala Ala Leu Ala Lys Thr145 150 155 160tct ggt aaa gat att gtt cag ttt gct aag gcg gtt ggg gtt tct cat 528Ser Gly Lys Asp Ile Val Gln Phe Ala Lys Ala Val Gly Val Ser His 165 170 175ccc ggt att gat aag aag gtt tgt gat ggg ggt cat gca cgg gga aaa 576Pro Gly Ile Asp Lys Lys Val Cys Asp Gly Gly His Ala Arg Gly Lys 180 185 190aag agt gga gat aat ggc tcg ctg gcc gac tat acg gat ggt ggc gcg 624Lys Ser Gly Asp Asn Gly Ser Leu Ala Asp Tyr Thr Asp Gly Gly Ala 195 200 205tca cag acg aat aag acg gct cag tgt agt ggt atg gga acc ggc aaa 672Ser Gln Thr Asn Lys Thr Ala Gln Cys Ser Gly Met Gly Thr Gly Lys 210 215 220gcc ggc aag aga gga ttg ggc ttg act gag ttt gtt aac aaa aca aag 720Ala Gly Lys Arg Gly Leu Gly Leu Thr Glu Phe Val Asn Lys Thr Lys225 230 235 240gtt gga gaa ggt aag aat tgg cca acg ggg tac gtt aat gat ggc gac 768Val Gly Glu Gly Lys Asn Trp Pro Thr Gly Tyr Val Asn Asp Gly Asp 245 250 255aac gtt aat gtg ctc ggc gat acg aat ggt aac gcc gaa gcc gta gct 816Asn Val Asn Val Leu Gly Asp Thr Asn Gly Asn Ala Glu Ala Val Ala 260 265 270aaa gac cta gta cag gag cta acc cct gaa gaa aaa acc ata gta gca 864Lys Asp Leu Val Gln Glu Leu Thr Pro Glu Glu Lys Thr Ile Val Ala 275 280 285ggg tta cta gct aag act att gaa ggg ggt gaa gtt gtt gag atc agg 912Gly Leu Leu Ala Lys Thr Ile Glu Gly Gly Glu Val Val Glu Ile Arg 290 295 300gcg gtt tct tct act tcc gta atg gtc aat gct tgt tat gat ctt ctt 960Ala Val Ser Ser Thr Ser Val Met Val Asn Ala Cys Tyr Asp Leu Leu305 310 315 320agt gaa ggt tta ggt gtt gtt cct tat gct tgt gtt ggt ctt ggc ggt 1008Ser Glu Gly Leu Gly Val Val Pro Tyr Ala Cys Val Gly Leu Gly Gly 325 330 335aac ttc gtg ggc gtg gtt gat ggc cat atc act cct aag ctt gct tat 1056Asn Phe Val Gly Val Val Asp Gly His Ile Thr Pro Lys Leu Ala Tyr 340 345 350aga tta aag gct ggg ttg agt tat cag ctc tct cct gta atc tcc gct 1104Arg Leu Lys Ala Gly Leu Ser Tyr Gln Leu Ser Pro Val Ile Ser Ala 355 360 365ttt gcg ggt gga ttc tac cat cgc gtt gtg gga gat ggc gtt tat gat 1152Phe Ala Gly Gly Phe Tyr His Arg Val Val Gly Asp Gly Val Tyr Asp 370 375 380gat ctg ccg gct caa cta cct tga 1176Asp Leu Pro Ala Gln Leu Pro385 390 6 391 PRT P44-12 6Met Met Ser Met Ala Ile Val Met Ala Gly Asn Asp Val Arg Ala His 1 5 10 15Asp Asp Val Ser Ala Leu Glu Thr Gly Gly Ala Gly Tyr Phe Tyr Val 20 25 30Gly Leu Asp Tyr Ser Pro Ala Phe Ser Lys Ile Arg Asp Phe Ser Ile 35 40 45Arg Glu Ser Asn Gly Glu Thr Lys Ala Val Tyr Pro Tyr Leu Lys Asp 50 55 60Gly Lys Ser Val Lys Leu Glu Ser His Lys Phe Asp Trp Asn Thr Pro 65 70 75 80Asp Pro Arg Ile Gly Phe Lys Asp Asn Met Leu Val Ala Met Glu Gly 85 90 95Ser Val Gly Tyr Gly Ile Gly Gly Ala Arg Val Glu Leu Glu Ile Gly 100 105 110Tyr Glu Arg Phe Lys Thr Lys Gly Ile Arg Asp Ser Gly Ser Lys Glu 115 120 125Asp Glu Ala Asp Thr Val Tyr Leu Leu Ala Lys Glu Leu Ala Tyr Asp 130 135 140Val Val Thr Gly Gln Thr Asp Asn Leu Ala Ala Ala Leu Ala Lys Thr145 150 155 160Ser Gly Lys Asp Ile Val Gln Phe Ala Lys Ala Val Gly Val Ser His 165 170 175Pro Gly Ile Asp Lys Lys Val Cys Asp Gly Gly His Ala Arg Gly Lys 180 185 190Lys Ser Gly Asp Asn Gly Ser Leu Ala Asp Tyr Thr Asp Gly Gly Ala 195 200 205Ser Gln Thr Asn Lys Thr Ala Gln Cys Ser Gly Met Gly Thr Gly Lys 210 215 220Ala Gly Lys Arg Gly Leu Gly Leu Thr Glu Phe Val Asn Lys Thr Lys225 230 235 240Val Gly Glu Gly Lys Asn Trp Pro Thr Gly Tyr Val Asn Asp Gly Asp 245 250 255Asn Val Asn Val Leu Gly Asp Thr Asn Gly Asn Ala Glu Ala Val Ala 260 265 270Lys Asp Leu Val Gln Glu Leu Thr Pro Glu Glu Lys Thr Ile Val Ala 275 280 285Gly Leu Leu Ala Lys Thr Ile Glu Gly Gly Glu Val Val Glu Ile Arg 290 295 300Ala Val Ser Ser Thr Ser Val Met Val Asn Ala Cys Tyr Asp Leu Leu305 310 315 320Ser Glu Gly Leu Gly Val Val Pro Tyr Ala Cys Val Gly Leu Gly Gly 325 330 335Asn Phe Val Gly Val Val Asp Gly His Ile Thr Pro Lys Leu Ala Tyr 340 345 350Arg Leu Lys Ala Gly Leu Ser Tyr Gln Leu Ser Pro Val Ile Ser Ala 355 360 365Phe Ala Gly Gly Phe Tyr His Arg Val Val Gly Asp Gly Val Tyr Asp 370 375 380Asp Leu Pro Ala Gln Leu Pro385 390 7 837 DNA P44-15 CDS (1)..(837) 7ttt acc ttg gaa cca tta tca ggg aga aga aat agg aat att aag agt 48Phe Thr Leu Glu Pro Leu Ser Gly Arg Arg Asn Arg Asn Ile Lys Ser 1 5 10 15cta ata agt tta tta ttg aga cca agg gta tta gag att agt ggt agt 96Leu Ile Ser Leu Leu Leu Arg Pro Arg Val Leu Glu Ile Ser Gly Ser 20 25 30aag gaa gat gaa gct gat aca gta tat cta cta gct aag gag tta gct 144Lys Glu Asp Glu Ala Asp Thr Val Tyr Leu Leu Ala Lys Glu Leu Ala 35 40 45tat gat gtt gtt act ggg cag act gat aac ctt gcc gct gct ctg gcc 192Tyr Asp Val Val Thr Gly Gln Thr Asp Asn Leu Ala Ala Ala Leu Ala 50 55 60aaa acc tcc ggt aaa gac ttt gtc cag ttt gct aag gcg gtt ggg gtt 240Lys Thr Ser Gly Lys Asp Phe Val Gln Phe Ala Lys Ala Val Gly Val 65 70 75 80tct cat cct agt att gat ggg aag gtt tgt aag acg aag gcg gat agc 288Ser His Pro Ser Ile Asp Gly Lys Val Cys Lys Thr Lys Ala Asp Ser 85 90 95tcg aag aaa ttt ccg tta tat agt gac gaa acg cac acg aag ggg gca 336Ser Lys Lys Phe Pro Leu Tyr Ser Asp Glu Thr His Thr Lys Gly Ala 100 105 110agt gag ggg aga acg tct ttg tgc ggt gac aat ggt agt tct acg ata 384Ser Glu Gly Arg Thr Ser Leu Cys Gly Asp Asn Gly Ser Ser Thr Ile 115 120 125aca aac agt ggt gcg aat gta agt gaa act ggg cag gtt ttt agg gat 432Thr Asn Ser Gly Ala Asn Val Ser Glu Thr Gly Gln Val Phe Arg Asp 130 135 140ttt atc agg gca acg ctg aaa gag gat ggt agt aaa aac tgg cca act 480Phe Ile Arg Ala Thr Leu Lys Glu Asp Gly Ser Lys Asn Trp Pro Thr145 150 155 160tca agc ggc acg gga act cca aaa cct gtc acg aac gac aac gcc aaa 528Ser Ser Gly Thr Gly Thr Pro Lys Pro Val Thr Asn Asp Asn Ala Lys 165 170 175gcc gta gct aaa gac cta gta cag gag cta acc cct gaa gaa aaa acc 576Ala Val Ala Lys Asp Leu Val Gln Glu Leu Thr Pro Glu Glu Lys Thr 180 185 190ata gta gca ggg tta cta gct aaa act att gaa ggt ggt gag gtt att 624Ile Val Ala Gly Leu Leu Ala Lys Thr Ile Glu Gly Gly Glu Val Ile 195 200 205gaa atc agg gcg gtt tct tct act tct gtg atg gtc aat gct tgt tat 672Glu Ile Arg Ala Val Ser Ser Thr Ser Val Met Val Asn Ala Cys Tyr 210 215 220gat ctt ctt agt gaa ggt tta ggt gtt gtc cct tat gct tgt gtt ggt 720Asp Leu Leu Ser Glu Gly Leu Gly Val Val Pro Tyr Ala Cys Val Gly225 230 235 240ctt gtg ggt aac ttc gta ggt gtt gtt gat ggg cat atc act cct aag 768Leu Val Gly Asn Phe Val Gly Val Val Asp Gly His Ile Thr Pro Lys 245 250 255ctt gct tat aga tta aag gct ggc ttg agt tat cag ctc tct cct gta 816Leu Ala Tyr Arg Leu Lys Ala Gly Leu Ser Tyr Gln Leu Ser Pro Val 260 265 270atc tct tct ttc tca gta tga 837Ile Ser Ser Phe Ser Val 275 8 278 PRT P44-15 8Phe Thr Leu Glu Pro Leu Ser Gly Arg Arg Asn Arg Asn Ile Lys Ser 1 5 10 15Leu Ile Ser Leu Leu Leu Arg Pro Arg Val Leu Glu Ile Ser Gly Ser 20 25 30Lys Glu Asp Glu Ala Asp Thr Val Tyr Leu Leu Ala Lys Glu Leu Ala 35 40 45Tyr Asp Val Val Thr Gly Gln Thr Asp Asn Leu Ala Ala Ala Leu Ala 50 55 60Lys Thr Ser Gly Lys Asp Phe Val Gln Phe Ala Lys Ala Val Gly Val 65 70 75 80Ser His Pro Ser Ile Asp Gly Lys Val Cys Lys Thr Lys Ala Asp Ser 85 90 95Ser Lys Lys Phe Pro Leu Tyr Ser Asp Glu Thr His Thr Lys Gly Ala 100 105 110Ser Glu Gly Arg Thr Ser Leu Cys Gly Asp Asn Gly Ser Ser Thr Ile 115 120 125Thr Asn Ser Gly Ala Asn Val Ser Glu Thr Gly Gln Val Phe Arg Asp 130 135 140Phe Ile Arg Ala Thr Leu Lys Glu Asp Gly Ser Lys Asn Trp Pro Thr145 150 155 160Ser Ser Gly Thr Gly Thr Pro Lys Pro Val Thr Asn Asp Asn Ala Lys 165 170 175Ala Val Ala Lys Asp Leu Val Gln Glu Leu Thr Pro Glu Glu Lys Thr 180 185 190Ile Val Ala Gly Leu Leu Ala Lys Thr Ile Glu Gly Gly Glu Val Ile 195 200 205Glu Ile Arg Ala Val Ser Ser Thr Ser Val Met Val Asn Ala Cys Tyr 210 215 220Asp Leu Leu Ser Glu Gly Leu Gly Val Val Pro Tyr Ala Cys Val Gly225 230 235 240Leu Val Gly Asn Phe Val Gly Val Val Asp Gly His Ile Thr Pro Lys 245 250 255Leu Ala Tyr Arg Leu Lys Ala Gly Leu Ser Tyr Gln Leu Ser Pro Val 260 265 270Ile Ser Ser Phe Ser Val 275 9 759 DNA P44-18 CDS (1)..(759) 9tct gcc gga gcc tat gca ata att ctt att att gaa aac aag acc aag 48Ser Ala Gly Ala Tyr Ala Ile Ile Leu Ile Ile Glu Asn Lys Thr Lys 1 5 10 15ggt att aga gat agt ggt agt aag gaa gat gaa gct gat aca gta tat 96Gly Ile Arg Asp Ser Gly Ser Lys Glu Asp Glu Ala Asp Thr Val Tyr 20 25 30cta cta gct aag gag tta gct tat gat gtt gtt act ggg cag act gat 144Leu Leu Ala Lys Glu Leu Ala Tyr Asp Val Val Thr Gly Gln Thr Asp 35 40 45aac ctt gcc gct gct ctt gcc aaa acc tca ggt aag gac atc gtt cag 192Asn Leu Ala Ala Ala Leu Ala Lys Thr Ser Gly Lys Asp Ile Val Gln 50 55 60ttt gct aag gcc gtg gag att tct aat tcc ggt att ggt aag aag gtg 240Phe Ala Lys Ala Val Glu Ile Ser Asn Ser Gly Ile Gly Lys Lys Val 65 70 75 80tgt gag aca aag cgg aag gat ggt gat act acg aac agg ttt gca aag 288Cys Glu Thr Lys Arg Lys Asp Gly Asp Thr Thr Asn Arg Phe Ala Lys 85 90 95tat ata gtt ggt gcg ggt gat agt agc aat gct ggt aca tca ttg tgt 336Tyr Ile Val Gly Ala Gly Asp Ser Ser Asn Ala Gly Thr Ser Leu Cys 100 105 110ggt ggt aag aac caa aag agt tcg gac aca gac acc ggg gtg gag aag 384Gly Gly Lys Asn Gln Lys Ser Ser Asp Thr Asp Thr Gly Val Glu Lys 115 120 125gct cag gct ctg cat gac ttt gtt tct aac aca ttg agt gat ggt act 432Ala Gln Ala Leu His Asp Phe Val Ser Asn Thr Leu Ser Asp Gly Thr 130 135 140aag aac tgg cct acg tcg agt gaa acg tct aaa tcg aat aac gac aac 480Lys Asn Trp Pro Thr Ser Ser Glu Thr Ser Lys Ser Asn Asn Asp Asn145 150 155 160gcc aaa gct gta gcg gga gac tta act aag aag ctc acc cct gaa gaa 528Ala Lys Ala Val Ala Gly Asp Leu Thr Lys Lys Leu Thr Pro Glu Glu 165 170 175aaa acc ata gta gca ggg tta cta gct aag act att gaa ggt ggt gag 576Lys Thr Ile Val Ala Gly Leu Leu Ala Lys Thr Ile Glu Gly Gly Glu 180 185 190gtt gtt gaa att agg gcg gtt tct tct act tct gtg atg gtt aat gct 624Val Val Glu Ile Arg Ala Val Ser Ser Thr Ser Val Met Val Asn Ala 195 200 205tgt tat gat ctt ctt agt gaa ggt tta ggc gtt gtt cct tat gct tgt 672Cys Tyr Asp Leu Leu Ser Glu Gly Leu Gly Val Val Pro Tyr Ala Cys 210 215 220gtt ggt ctc ggt gga aac ttc gtt ggt gtt gtt gac gag tac agc aca 720Val Gly Leu Gly Gly Asn Phe Val Gly Val Val Asp Glu Tyr Ser Thr225 230 235 240atc cgt ccg tct tta acc cta tat gcc cgt aga aag taa 759Ile Arg Pro Ser Leu Thr Leu Tyr Ala Arg Arg Lys 245 250 10 252 PRT P44-18 10Ser Ala Gly Ala Tyr Ala Ile Ile Leu Ile Ile Glu Asn Lys Thr Lys 1 5 10 15Gly Ile Arg Asp Ser Gly Ser Lys Glu Asp Glu Ala Asp Thr Val Tyr 20 25 30Leu Leu Ala Lys Glu Leu Ala Tyr Asp Val Val Thr Gly Gln Thr Asp 35 40 45Asn Leu Ala Ala Ala Leu Ala Lys Thr Ser Gly Lys Asp Ile Val Gln 50 55 60Phe Ala Lys Ala Val Glu Ile Ser Asn Ser Gly Ile Gly Lys Lys Val 65 70 75 80Cys Glu Thr Lys Arg Lys Asp Gly Asp Thr Thr Asn Arg Phe Ala Lys 85 90 95Tyr Ile Val Gly Ala Gly Asp Ser Ser Asn Ala Gly Thr Ser Leu Cys 100 105 110Gly Gly Lys Asn Gln Lys Ser Ser Asp Thr Asp Thr Gly Val Glu Lys 115 120 125Ala Gln Ala Leu His Asp Phe Val Ser Asn Thr Leu Ser Asp Gly Thr 130 135 140Lys Asn Trp Pro Thr Ser Ser Glu Thr Ser Lys Ser Asn Asn Asp Asn145 150 155 160Ala Lys Ala Val Ala Gly Asp Leu Thr Lys Lys Leu Thr Pro Glu Glu 165 170 175Lys Thr Ile Val Ala Gly Leu Leu Ala Lys Thr Ile Glu Gly Gly Glu 180 185 190Val Val Glu Ile Arg Ala Val Ser Ser Thr Ser Val Met Val Asn Ala 195 200 205Cys Tyr Asp Leu Leu Ser Glu Gly Leu Gly Val Val Pro Tyr Ala Cys 210 215 220Val Gly Leu Gly Gly Asn Phe Val Gly Val Val Asp Glu Tyr Ser Thr225 230 235 240Ile Arg Pro Ser Leu Thr Leu Tyr Ala Arg Arg Lys 245 250 11 492 DNA P44-19 CDS (1)..(492) 11gct aag gag tta gct tat gat gtt gtt act gga cag act gat aac ctt 48Ala Lys Glu Leu Ala Tyr Asp Val Val Thr Gly Gln Thr Asp Asn Leu 1 5 10 15gct gct gct ctt gcc aaa acc tca ggt aag gac atc gtt cag ttt gct 96Ala Ala Ala Leu Ala Lys Thr Ser Gly Lys Asp Ile Val Gln Phe Ala 20 25 30aag gcg gtg gag ata tcc tcc ccc acc att gat ggg aag att tgt aag 144Lys Ala Val Glu Ile Ser Ser Pro Thr Ile Asp Gly Lys Ile Cys Lys 35 40 45ata aat aca gga agt aat aaa tac ggc act gga aca aat tct gga gaa 192Ile Asn Thr Gly Ser Asn Lys Tyr Gly Thr Gly Thr Asn Ser Gly Glu 50 55 60ctc act tgt gga gtt ggc cac gcg agc gga tct cta gga gcg gcg aac 240Leu Thr Cys Gly Val Gly His Ala Ser Gly Ser Leu Gly Ala Ala Asn 65 70 75 80gga gcc ttt aag gat ttt cga cag cat gtg tta gaa gtt gaa agt cat 288Gly Ala Phe Lys Asp Phe Arg Gln His Val Leu Glu Val Glu Ser His 85 90 95aaa cat tgg cct act acg cag ggt tct agt gat aaa ggt agt aat aac 336Lys His Trp Pro Thr Thr Gln Gly Ser Ser Asp Lys Gly Ser Asn Asn 100 105 110gca aca aag gta gcc gga gaa cta aca aag ctc acc aca gaa gaa aaa 384Ala Thr Lys Val Ala Gly Glu Leu Thr Lys Leu Thr Thr Glu Glu Lys 115 120 125acc ata gta gca ggg tta cta gct aaa act att gaa ggg gga gag gtt 432Thr Ile Val Ala Gly Leu Leu Ala Lys Thr Ile Glu Gly Gly Glu Val 130 135 140gtt gaa atc agg gct gtc tct tct act tct gtg atg gtt aat gct tgt 480Val Glu Ile Arg Ala Val Ser Ser Thr Ser Val Met Val Asn Ala Cys145 150 155 160tat gat ctt ctt 492Tyr Asp Leu Leu 12 164 PRT P44-19 12Ala Lys Glu Leu Ala Tyr Asp Val Val Thr Gly Gln Thr Asp Asn Leu 1 5 10 15Ala Ala Ala Leu Ala Lys Thr Ser Gly Lys Asp Ile Val Gln Phe Ala 20 25 30Lys Ala Val Glu Ile Ser Ser Pro Thr Ile Asp Gly Lys Ile Cys Lys 35 40 45Ile Asn Thr Gly Ser Asn Lys Tyr Gly Thr Gly Thr Asn Ser Gly Glu 50 55 60Leu Thr Cys Gly Val Gly His Ala Ser Gly Ser Leu Gly Ala Ala Asn 65 70 75 80Gly Ala Phe Lys Asp Phe Arg Gln His Val Leu Glu Val Glu Ser His 85 90 95Lys His Trp Pro Thr Thr Gln Gly Ser Ser Asp Lys Gly Ser Asn Asn 100 105 110Ala Thr Lys Val Ala Gly Glu Leu Thr Lys Leu Thr Thr Glu Glu Lys 115 120 125Thr Ile Val Ala Gly Leu Leu Ala Lys Thr Ile Glu Gly Gly Glu Val 130 135 140Val Glu Ile Arg Ala Val Ser Ser Thr Ser Val Met Val Asn Ala Cys145 150 155 160Tyr Asp Leu Leu 13 11 PRT Hypervariable region of P44 protein 13Asn Ala Asn Ala Met Ala Lys Asp Leu Val Lys 1 5 10 14 11 PRT Hypervariable region of P44-2 protein 14Asn Ala Lys Ala Val Ala Thr Asp Leu Val Gln 1 5 10 15 11 PRT Hypervariable region of P44-12 protein 15Asn Ala Glu Ala Val Ala Lys Asp Leu Val Gln 1 5 10 16 11 PRT Hypervariable region of P44-15 protein 16Asn Ala Lys Ala Val Ala Lys Asp Leu Val Gln 1 5 10 17 11 PRT Hypervariable region of P44-18 protein 17Asn Ala Lys Ala Val Ala Gly Asp Leu Thr Lys 1 5 10 18 11 PRT Hypervariable region of P44-19 protein 18Asn Ala Thr Lys Val Ala Gly Glu Leu Thr Lys 1 5 10 19 15 PRT Synthetic oligopeptide of P44 protein 19Leu Ser Asn Gly Ser Ala Glu Ala Ala His Lys Tyr Leu Ser Lys 1 5 10 15 20 15 PRT Synthetic oligopeptide of P44-2 protein 20Gly His Ser Ser Gly Val Thr Gln Asn Pro Lys Leu Phe Ser Thr 1 5 10 15 21 15 PRT Synthetic oligopeptide of P44-12 protein 21Gly Lys Lys Ser Gly Asp Asn Gly Ser Leu Ala Asp Tyr Thr Asp 1 5 10 15 22 16 PRT Synthetic oligopeptide of P44-15 protein 22Pro Leu Tyr Ser Asp Glu Thr His Thr Lys Gly Ala Ser Glu Gly Arg 1 5 10 15 23 15 PRT Synthetic oligopeptide of P44-18 protein 23Lys Asn Gln Lys Ser Ser Asp Thr Asp Thr Gly Val Glu Lys Ala 1 5 10 15 24 16 PRT Synthetic oligopeptide of P44-19 protein 24Thr Gly Ser Asn Lys Tyr Gly Thr Gly Thr Asn Ser Gly Glu Leu Thr 1 5 10 15 25 21 DNA Primer P3708 25gctaaggagt tagcttatga t 21 26 20 DNA Primer P4257 26aagaagatca taacaagcat 20 27 20 DNA Primer 2hvf 27tactggtagc catgctgacc 20 28 21 DNA Primer 2hvr 28aatcacccgt cttcagtgat g 21 29 21 DNA Primer 18hvf 29ggagatttct aattccggta t 21 30 21 DNA Primer 18hvf 30agtcattatt cgatttagac g 21 31 21 DNA Primer 12hvf 31tgataagaag gtttgtgatg g 21 32 21 DNA Primer 12 hvr 32agagcacatt aacgttgtca c 21 33 21 DNA Primer 15hvf 33gaaggtttgt aagacgaagg c 21 34 21 DNA Primer 15hvr 34agttcgtgac aggttttgga g 21 35 22 DNA Primer 19hvf 35cattgatggg aagatttgta ag 22 36 21 DNA Primer 19hvr 36aggtgagctt tgttagttct c 21 37 21 DNA Primer 44hvf 37gaaggtttgt agtggaaagc a 21 38 21 DNA Primer 44hvr 38atgctccaac tacaatgcta t 21 39 21 DNA Primer pnf12 39caagtttgac tggaacactc c 21 40 20 DNA Primer pnr12 40aacaatatct ttaccagagg 20 41 21 DNA Primer pcf12 41ctaaagacct agtacaggag c 21 42 21 DNA Primer pcr12 42gagagagctg ataactcaac c 21 43 23 DNA NH2-terminal of HGE agent of P44 43cgccatggct gggagtgatg tca 23 44 27 DNA oligonucleotide primers of P44 44gcgaattcta cgcactacca ttactca 27

Claims

1. An isolated outer membrane protein of the human granulocytic ehrlichiosis causative agent, said protein comprising:a) a hypervariable region of about 94 amino acids, wherein said hypervariable region has an isoelectric point of from about 7.1 to about 9.2 and an Mr of from about 8.5 kDa to about 11 kDa; b) a first conserved region of about 52 amino acids linked directly or through a linker of from 1 to about 10 amino acids to the N-terminus of the hypervariable region; c) a second conserved region of about 56 amino acids linked directly or through a linker of from 1 to about 10 amino acids to the C teminus of said hypervariable region; wherein said hypervariable region has a hydrophilicity index of from about 0.45 to 0.95, an antigenic index of from about 0.65 to 1.5, and a surface probability index of from about 1.0 to 1.55.

2. The isolated protein of claim 1 wherein said isolated protein is immunoreactive with antiserum from patients with human granulocytic ehrlichiosis.

3. The isolated protein of claim 1 wherein said hypervariable region comprises:a) a first semiconserved region near the amino terminus thereof, said first semiconserved region comprising the sequence X1-X2-Lys-X3-Cys; wherein X1 is Asp or Gly, X2 is Gly or Lys, and X3 is Val or Ile; b) a second semiconserved region at the carboxy terminus thereof, said second second semiconserved region comprising the sequence Asn-Ala-X1-X2-X3-Ala-X4-X5-Leu-X6-X7; wherein X1 is Asn, Thr, Lys, or Glu, X2 is Ala or Lys, X3 is Met or Val; X4 is Lys, Gly, or Thr; X5 is Asp or Glu; X6 is Val or Thr, and X7 is Gln or Lys; and c) a third semiconserved region between the first and second semiconserved region, said third semiconserved region comprising the sequence Lys-X1-Trp-Pro-Thr-X2; wherein X1 is Asn or His and X2 is Gly, Thr, or Ser.

4. The isolated protein of claim 1wherein said first conserved region has an amino acid sequence which is at least 95% identical to the amino acid sequence of the first conserved region of a protein selected from the group consisting of: the P44 protein, the P44-2 protein, the P44-12 protein, the P44-15 protein, the P44-18 protein, and the P44-19 protein, and wherein said second conserved region has an amino acid sequence which is at least 95% identical to the amino acid sequence of the second conserved region of a protein selected from the group consisting of: the P44 protein, the P44-2 protein, the P44-12 protein, the P44-15 protein, the P44-18 protein, and the P44-19 protein.

5. An isolated outer membrane protein of the causative agent to human granulocytic ehrlichiosis, wherein said protein is selected from the group consisting of the P44 protein or a variant thereof; the P44-2 protein or a variant thereof; the P44-12 protein or a variant thereof; the P44-15 protein or a variant thereof, [a] the P44-18 protein or a variant thereof; and the P44-19 protein or a variant thereof.

6. The isolated protein of claim 5 wherein said protein comprises an amino acid sequence which is at least 90% identical to an amino acid sequence selected from the group consisting of the amino acid sequence SEQ ID NO:2, shown in FIG. 1; the amino acid sequence, SEQ ID NO: 4, shown in FIG. 2; the amino acid sequence, SEQ ID NO:6, shown in FIG. 3; the amino acid sequence, SEQ ID NO:8, shown in FIG. 4; the amino acid sequence, SEQ ID NO:10 shown in FIG. 5; and the amino acid sequence, SEQ ID NO:12, shown in FIG. 6.

7. The isolated protein of claim 6 wherein said protein is a mature protein and the amino acid sequence lacks the signal sequence.

8. An isolated polypeptide for producing antibodies immunospecific for a Group 44 protein, said polypeptide comprising a sequence which is at least 98% identical to an amino acid sequence selected from the group consisting of the amino acid sequence, SEQ ID NO:2, shown in FIG. 1; the amino acid sequence, SEQ ID NO: 4, shown in FIG. 2, the amino acid sequence, SEQ ID NO:6, shown in FIG. 3; the amino acid sequence, SEQ ID NO:8, shown in FIG. 4; the amino acid sequence, SEQ ID NO:10 shown in FIG. 5; and the amino acid sequence, SEQ ID NO:12, shown in FIG. 6.

9. An isolated polypeptide for producing antibodies immunospecific for a Group 44 protein, wherein said isolated polypeptide is 250 amino acids in length or less and comprises a sequence which is identical to the sequence of the hypervariable region of the P44 protein, the P44-2 protein, the P44-12 protein, the P44-15 protein, the P44-18 protein, or the P44-19 protein.

10. An isolated polypeptide for producing antibodies immunospecific for a Group 44 protein, wherein said polypeptide comprises amino acid 30 through amino acid 248 of the P44 protein or amino acid 38 through amino acid 248 of the P44 protein.

11. An isolated polypeptide for producing antibodies immunospecific for a Group 44 protein, wherein said polypeptide is 14 to 16 amino acids in length and comprises from 14 to 16 consecutive amino acids withinLSNGSAEAAHKYLSK, SEQ ID NO: 19, GHSSGVTQNPKLFST, SEQ ID NO: 20, GKKSGDNGSLADYTD, SEQ ID NO: 21; PLYSDETHTKGASEGR, SEQ ID NO: 22; KNQKSSDTDTGVEKA, SEQ ID NO:23, or TGSNKYGTGTNSGELT, SEQ ID NO: 24.