Nucleic acid sequences and plasmids comprising at least one phage resistance mechanism, bacteria containing them and their use

The present invention relates to novel nucleic acid sequences and plasmids capable of hybridizing therewith and carrying at least one phage resistance mechanism, to the lactic acid bacteria containing these sequences or these plasmids, in particular the lactococci belonging to the species Lactococcus lactis, to the use of certain strains of these lactococci for transferring a phage resistance mechanism, especially by conjugation, to strains of industrial interest, particularly in the dairy industry, and to the use of certain strains of Lactococcus lactis for obtaining these plasmids.
Lactic acid bacteria are involved in the production and preservation of a large number of foodstuffs such as cheeses, butter, yogurts, sausage or sauerkraut. Among these, dairy products occupy a particularly important position. The industrial conversion of milk is carried out in ever larger fermentation vats, in which the appearance of phages of lactic acid bacteria can have serious or even catastrophic consequences, namely a variation in the characteristics, especially organoleptic characteristics, of the final product, a loss of product present in the vat, and the need to decontaminate the latter as well as the surrounding installations. The dairy industry is therefore in urgent need of novel means and novel methods of rendering bacteria more resistant to phages.
The phages of lactic acid bacteria belong to three major homology groups (I), (II) and (III) defined by DNA/DNA hybridization studies according to RELANO P. et al., (1987), J. Gen. Microbiol. 133, 3053-3063. Groups (I) and (III) comprise only virulent phages. Group (II) comprises virulent phages and temperate phages. The homologies are strong within one and the same group and very weak between groups. The phages of group (I) have an oblong nucleocapsid while the phages of groups (II) and (III) have an isometric nucleocapsid.
Several natural phage resistance mechanisms are known to exist, the three main ones being:
inhibition of phage adsorption; in this mechanism, the adsorption of the phage by the bacterium is inhibited or delayed.
the restriction/modification system; this system involves a restriction enzyme, which degrades the DNA of the phage as soon as it enters the bacterium.
abortive infection; according to this third mechanism, phage adsorption is normal but phage multiplication does not take place.
These mechanisms are described in detail by SANDERS M. in Biochimie 70, (1988), 411-421.
The development of phage resistant lactic acid bacteria has already been the subject of numerous studies.
In this connection, reference may be made to the following articles in particular:
VLEGELS et al.; Neth. Milk and Dairy J. 43, (1989), 245-259;
SANDERS and KLAENHAMMER; Applied and Environ. Microbiol. (1983), vol. 46, 1125-1133;
these articles relate to plasmids which inhibit phage adsorption;
Audrey W. JARVIS; Applied and Environ. Microbiol.; March 1988, p. 777-783;
EP-A3-0 208 468;
COFFEY et al.; Neth. Milk and Dairy J. 43, (1989), 229-244;
KLAENHAMMER and SANOZKY; Journal of General Microbiology (1985), 131, 1531-1541;
DURMAZ et al.; J. Bacteriol. (1992), 7463-7469;
these articles describe plasmids which confer phage resistance by the abortive infection mechanism;
JOSEPHSEN and KLAENHAMMER, Plasmid 23, 71-75, (1990);
MOINEAU et al.; Applied and Environ. Microbiol. (1995), 2193-2202;
U.S. Pat. No. 4,883,756;
GAUTIER and CHOPIN; Applied and Environ. Microbiol. (1987), 53, p. 923-927;
McLANDSBOROUGH et al.; Applied and Environ. Microbiol. (1995), 2023-2026;
these last articles describe especially plasmids which confer phage resistance by the restriction/modification mechanism.
Patent application EP-A1-452 224 also describes a DNA sequence comprising at least one phage resistance mechanism; this DNA sequence contains a functional portion of the HindIII--HindIII fragment of about 3.3 kb of plasmid pPF144-1 present in the Escherichia coli strain deposited on Apr. 9, 1991 in the CNCM (Collection Nationale de Cultures de Microorganismes, Institut Pasteur, Paris, France) under no. I-1070.
This HindIII--HindIII fragment of about 3.3 kb was isolated from plasmid pPF144 contained in the Lactococcus lactis ssp lactis strain deposited in the CNCM on Apr. 12, 1990 under no. I-945, which is a transconjugant resulting from the crossing of the donor strain Lactococcus lactis ssp lactis S91, deposited in the CNCM on Apr. 12, 1990 under no. I-940, and the recipient strain Lactococcus lactis ssp lactis S45, derived from the strain Lactococcus lactis ssp lactis C2-LL described by McKay et al., 1977, in J. Bacteriol. 257-265. This fragment carries one or more phage resistance mechanisms.
Following this work, a DNA sequence of 1.9 kb which by itself confers phage resistance was isolated from this HindIII--HindIII DNA sequence of 3.3 kb. This novel DNA sequence of about 1.9 kb was described in EP-A1-643 134.
The Applicant has isolated a fragment of 3704 base pairs (bp) from the total DNA of the strain Lactococcus lactis ssp diacetylactis S94, deposited in the CNCM on Apr. 12, 1990 under no. I-941, by partial digestion with the restriction enzyme Sau3A.
This fragment carries one or more phage resistance mechanisms and by itself confers phage resistance.
From this DNA sequence of 3704 bp, the Applicant subsequently isolated a DNA sequence of 1345 bp which by itself confers phage resistance.
The present invention therefore relates to two novel DNA sequences comprising at least one phage resistance mechanism, said sequences respectively containing 3704 bp and 1345 bp and consisting of:
a) the DNA sequences having the nucleic acid series of �SEQ ID No 1! or �SEQ ID No 3!;
b) the DNA sequences hybridizing with the above sequences or a fragment thereof; and
c) the corresponding mRNA and cDNA sequences.
The sequences �SEQ ID No. 2! and �SEQ ID No. 4! are the amino acid sequences deduced from the sequences �SEQ ID No. 1! and �SEQ ID No. 3! respectively.
The sequence �SEQ ID No. 3! is a DNA fragment of 1345 bp contained within the sequence �SEQ ID No. 1!.
This fragment of 1345 bp can be obtained by the PCR method using the following two oligonucleotides:
oligonucleotide no. 1 �SEQ No. 5!:
oligonucleotide no. 1 �SEQ No. 5!: 5' TCATAGGATCCAATAATCAACTAGCAATTCG 3' BamHIoligonucleotide no. 2 �SEQ No. 6!: 5' CATTAGTCGACAAATACAGGCTCTATAAAGC 3' SalI
The invention particularly relates to the DNA sequences respectively containing:
3704 bp and having the nucleic acid sequence �SEQ ID No. 1! below; and
1345 bp and having the nucleic acid sequence �SEQ ID No. 3! below.
The invention further relates to the DNA sequences which have a high degree of homology with the DNA sequences �SEQ ID No. 1! and �SEQ ID No. 3! above. A high degree of homology means a homology (ratio of the identical nucleotides to the total number of nucleotides) of at least 70%, preferably at least 80%, of the nucleotide sequences when they are aligned according to the maximum homology by the optimal sequence alignment method of Needleman and Wunsch, 1970, J. Mol. Biol. 48, 443-453. This method is used especially in the UWGCG software of the University of Wisconsin: Devereux et al., 1984, Nucl. Ac. Res. 12, 8711-8721--option GAP.
The present invention particularly relates to the DNA sequences which hybridize with the DNA sequence �SEQ ID No 1! and �SEQ ID No 3! or a fragment thereof. In the present specification the term "hybridization" designated the conventional hybridization conditions and more particularly the stringent hybridization conditions.
The invention further relates to the plasmids transformed with one of the nucleic acid sequences according to the invention. A possible example of these plasmids is plasmid pLDP1 into which one of the DNA sequences according to the invention has been cloned by the customary techniques known to those skilled in the art. Plasmid pLDP1 is derived from plasmid pVA838 (Macrina F. L. et al., Gene 19, 345-353) by deletion of the 1523 bp fragment between the HindIII site (0) and the EcoRI site (1523) and replacement thereof with 54 base pairs corresponding to the multiple cloning sites of plasmid pUC18 (Yanisch-Perron C. et al.; 1985--Gene 33, 103--119) which are flanked by the EcoRI and HindIII sites.
The invention further relates to the phage resistant lactic acid bacteria, preferably belonging to the species Lactococcus lactis, which contain at least one of the nucleic acid sequences or one plasmid as defined above.
These nucleic acid sequences or these plasmids may have been introduced into the lactic acid bacteria by conjugation, transformation, protoplast fusion or any other gene transfer method well known to those skilled in the art.
The lactic acid bacteria which can advantageously be transformed with the DNA sequences according to the invention, or a plasmid containing them, are for example the strains of Lactococcus lactis ssp cremoris, Lactococcus lactis ssp lactis and Lactococcus lactis ssp lactis var. diacetylactis.
These strains transformed in this way can be used for transmitting a phage resistance mechanism to a strain of industrial interest by conjugation, transformation, transduction, protoplast fusion or any other gene transfer method well known to those skilled in the art. This mechanism can be carried by a plasmid or by another part of the bacterial genome. If it is carried by a plasmid, it is advantageously transferred by conjugation.
The invention further relates to the phage resistant strains of industrial interest obtained in this way.
The invention will be understood more clearly with the aid of the following Examples, which comprise experimental results and a discussion thereof. Some of these Examples relate to experiments performed for the purpose of carrying out the invention; others relate to embodiments of the invention, which are of course given purely by way of illustration.
The majority of the techniques described in these Examples, which are well known to those skilled in the art, are explained in detail in the work by Sambrook, Fritsch and Maniatis entitled "Molecular cloning; a Laboratory Manual", published in 1989 by Cold Spring Harbor Press, New York (2nd edition).

The following description will be understood more clearly with the aid of FIGS. 1 and 2 below, which respectively show:
FIG. 1: Organization of the ORF deduced from the sequence of the fragment of 3704 base pairs.
FIG. 2: Amplification, by PCR, of 2 internal fragments of the fragment of 3704 bp conferring phage resistance.

EXAMPLE 1
Sequence of the Fragment of 3704 bp
The strain Lactococcus lactis ssp diacetylactis S94, deposited in the CNCM on Apr. 13, 1990 under no. I-941, contains one or more phage resistance mechanisms. In particular, it has transferred plasmid pPF72 by conjugation into the recipient strain Lactococcus lactis S45, derived from the strain Lactococcus lactis C2-LL described by McKay et al., 1977, J. Bacteriol. 257-265, said plasmid conferring resistance to phages .O slashed. 53 (group I) and .O slashed. 59 (group III). Other phage resistance mechanisms may be present in the strain I-941. It is for this reason that a total DNA library was constructed from the strain I-941. The restriction fragment of 3704 bp conferring phage resistance, obtained by a partial digestion of the total DNA of the strain S94 (I-941) with the restriction enzyme Sau3A, was cloned into vector pLDP1 at the BamHI site. The recombinant plasmid pLAB206 obtained confers a total resistance to phage .O slashed. 59 to the strain Lactococcus lactis ssp lactis MG 1363 disclosed by GASSON M. J. (1983) in J. Bacteriol. 154: 1-9, hereinafter named strain L. lactis S56 or S56.
The nucleic acid sequence of this fragment of 3704 bp, determined by the method of Sanger et al. (PNAS--USA, 14, 5463, 1977), is the sequence �SEQ ID No. 1! below.
Analysis of the sequence showed that the fragment of 3704 bp possesses 2 complete open reading frames (ORF1 and ORF2) and two truncated open reading frames (ORF3 and ORF4) containing only the N-terminal parts (FIG. 1).
EXAMPLE 2
Amplification of an Internal Fragment of the 3704 bp Fragment by PCR
The PCR (Polymerase Chain Reaction) technique, described for example in the work by Maniatis cited above, makes it possible to amplify a DNA fragment contained between two appropriately chosen oligonucleotides. This amplified DNA can easily be cloned if restriction sites are provided by the oligonucleotides. In fact, the sequences of these oligonucleotides can contain, at their 5' end, a heterologous part of the DNA to be amplified, consisting of 10 to 12 base pairs, for example, 6 of which constitute a restriction site.
This technique was applied in order to determine whether one or other of the two open reading frames (ORF1, ORF2) identified in the nucleotide sequence of the 3704 bp fragment corresponds to a phage resistance gene, but also in order to form a probe specific to this gene.
This was done by synthesizing 4 oligonucleotides of 31 and 32 bases (6 of which constitute a restriction site).
These 4 oligonucleotides have the following sequences:
oligonucleotide no. 1 �SEQ No.5!:
oligonucleotide no. 1 �SEQ No. 5!: 5' TCATAGGATCCAATAATCAACTAGCAATTCG 3' BamHIoligonucleotide no. 2 �SEQ No. 6!: 5' CATTAGTCGACAAATACAGGCTCTATAAAGC 3' SalIoligonucleotide no. 3 �SEQ No. 7!: 5' TCATAGGATCCTTAACAATAAAATTACTCTGC 3' BamHIoligonucleotide no. 4 �SEQ No. 8!: 5' CATTAGTCGACTTAAATTTGATATTGATTGCG 3' SalI
Their locations on the 3704 bp fragment are indicated in FIG. 2.
The oligonucleotides no. 1 and 2 made it possible to amplify a DNA fragment of 1345 bp containing ORF1 of 1038 bp in the form of a BamHI-SalI fragment, by virtue of the restriction sites provided by the oligonucleotides, enabling directional cloning into shuttle plasmid pLDP1.
Likewise, the oligonucleotides no. 3 and 4 made it possible to amplify a DNA fragment of 1152 bp containing ORF2 of 573 bp in the form of a BamHI-SalI fragment, as above.
The DNA fragments were amplified by PCR, starting from a total DNA preparation of the strain S94 (I-941), with conventional Taq polymerase.
The PCR products were purified by phenol/chloroform extraction, precipitated with ethanol, digested with the restriction enzymes BamHI and SalI and cloned into shuttle vector pLDP1 open at the BamHI and SalI sites.
Cloning of these fragments into vector pLDP1 produced recombinant plasmids pLAB207 and pLAB 208. These plasmids were introduced into the strain E. coli TG1 and into the strain L. lactis S56.
The introduction of plasmids pLAB207 and pLAB 208 into the strain L. lactis S56 made it possible to determine whether they confer phage resistance.
The results pertaining to the cloning of the various amplified DNA fragments are summarized in Table 1 below:
TABLE 1______________________________________Pair of oligo- Size of the Cloned intonucleotides fragment Sites added pLDP1 Phenotype*______________________________________1-2 1345 bp BamHI--SalI pLAB207 pr.sup.+3-4 1152 bp BamHI--SalI pLAB208 pr.sup.-______________________________________ *phenotypes: pr.sup.+ = phage resistance pr.sup.- = no phage resistance
EXAMPLE 3
Phage Resistance Conferred by Plasmid pLAB207
Plasmid pLAB207 was introduced into the strain L. lactis S56.
The phage resistance of the clones obtained was tested by performing a titration (PFU/ml) with phages .O slashed. 53 and .O slashed. 59.
The results are given below:
______________________________________ Phage .O slashed. 53 (I) Phage .O slashed. 59 (III) Size of the Size of the Titer plaques Titer plaquesStrain (PFU/ml) (mm) (PFU/ml) (mm)______________________________________S56 10.sup.10 3 3 .multidot. 10.sup.9 2S56 6 .times. 10.sup.9 3 2 .times. 10.sup.9 2(pLDP1)S56 10.sup.6 0.5 0 --(pLAB207)______________________________________ PFU/ml = plate forming units per ml
Plasmid pLAB207 containing the PCR-amplified fragment of 1345 bp corresponding to ORF1 confers phage resistance.
__________________________________________________________________________# SEQUENCE LISTING- (1) GENERAL INFORMATION:- (iii) NUMBER OF SEQUENCES: 8- (2) INFORMATION FOR SEQ ID NO: 1:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 3704 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (vi) ORIGINAL SOURCE:#lactis (A) ORGANISM: Lactococcus- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION:1095..2132#1: (xi) SEQUENCE DESCRIPTION: SEQ ID NO:- GATCAAAACT GATGCAAATG GAGTAATTAA GGCAAATCAT CTAAAACCAG GT - #AAATACAC 60- TTTTGTTGAA ACAGAGGCTC CAGCAGGTTA TCAATTAAGT CAAGAAACTA GA - #GCTTTTGA 120- AATTAAAGCA AGCGCAGAAA ACAAACCACA AGTTGTTAAT ACTGGAAAGT TC - #GTCAATAA 180- AAGACTTCCA ATTACACCTA AAAAGCCAGA ATTACCTAAG ACAGGAGAAG AA - #CGAAATAC 240- TTTCTTGCCT ATAGTTGGTG TTGGACTATT AATGGTGGGT GCTACTTTAT AT - #GTATTTTT 300- TAAAAGACGT AAAATGTAAA ATTATATAAA AACATGGCTT TAGCCATGTT TT - #TGATTTGG 360- GAAAAGTGGT AGTGACTTAA TACAAAAATA TTTTAGTTTG TAATACCTAA AA - #ATAATACT 420- TCAGTTTGCA GTATTCCAAT AAGTAAAAAA GATTTGGCTA TATTAGAACC AC - #CCAAAAAA 480- ACTCAAAATC ATGTAAATAT TAAGCTTGGA TTGGCCCAAT AGAGAAAATT TT - #TTCTTTCA 540- TCATTATAGT TTGCAAAATG GTATTCCAAA TGTAGTCACA GTAAATAAAA CA - #ATGAAAAA 600- GATGTTAAAT GAGTTAGAAA TTGAGCCAAT AATTACAAGT GAGGTGTTAG AT - #AAACTTGT 660- GATAGTGTAC TACTAAGTTA AGGTATCGAT AATAAAGTAG TGGCAAAGTT AA - #TGGGCATA 720- AAGATACATC AATGCTAATA AAAATATAAT TAAAAGAATA TGATAAAATA AT - #AAAAAACC 780- TTGTATATCA ACGATACAAG GTTTTTTATC TATGCCGAGT GCAGGATTGT TT - #AGATAGTT 840- TTCAAAGTTA AATACAGGCT CTATAAAGCT CTCAAAGTGT TCACTATAGA AA - #AGCTCTTA 900- AAGTGAAAAA TAAAATGGGG CAAATTGGGG GCATTTCAAG TTAAGAGTAT TC - #AAATATGT 960- AACTAAAAAA AATTATTTTT TTGAATTAGT GTTTTTCTAT TTGCATATTT TT - #TCGAGATT1020- TTCTGTTTTG ATTATTATAT AATTATATTT ATATTTATAG TTATAGTTAT TG - #AGTTAAGT1080- TAGTGGGAGA TACA ATG AAA TTA TAT ATA GTT GGT A - #AT GGC TTT GAT TTA1130 Met L - #ys Leu Tyr Ile Val Gly Asn Gly Phe Asp Le - #u# 10- TCA CAC AAT CTG AAA ACA TCA TAT ACA GAG TT - #T AGA TTA TAT TTA TTG1178Ser His Asn Leu Lys Thr Ser Tyr Thr Glu Ph - #e Arg Leu Tyr Leu Leu# 25- GAA CAT AGG GAT GAA GTA TAT ACA GAT GAA GA - #T TTA ATA ATA TCA AAA1226Glu His Arg Asp Glu Val Tyr Thr Asp Glu As - #p Leu Ile Ile Ser Lys# 40- GGA GAT ATT TTA CGA AAT TTT GAA AGA TAT TG - #T CAA CCA AAT GAT TTA1274Gly Asp Ile Leu Arg Asn Phe Glu Arg Tyr Cy - #s Gln Pro Asn Asp Leu# 60- TGG AGC GAT TTT GAA GAA CAG ACT GAG AAA AT - #A ATA TCA GAA ATA TCA1322Trp Ser Asp Phe Glu Glu Gln Thr Glu Lys Il - #e Ile Ser Glu Ile Ser# 75- GAG GGG AAA ATT ATA ATC TTT GAA GAA GAA TG - #G AGC TGC AAA TTA GAT1370Glu Gly Lys Ile Ile Ile Phe Glu Glu Glu Tr - #p Ser Cys Lys Leu Asp# 90- ATT GGA GGT GAG AGG CAT AAA TTT ATT GAT TG - #T TTT AAA AAG TTA ATA1418Ile Gly Gly Glu Arg His Lys Phe Ile Asp Cy - #s Phe Lys Lys Leu Ile# 105- AAA AAA CAA GAT AGT ACA TTC GAT ACT GAT AT - #A TAT CAT AAT GAA ATT1466Lys Lys Gln Asp Ser Thr Phe Asp Thr Asp Il - #e Tyr His Asn Glu Ile# 120- CAA GAG TAT GCC TTA AAG TAT TTT AAC AAT AA - #G GTA AGG GAA CTA TAT1514Gln Glu Tyr Ala Leu Lys Tyr Phe Asn Asn Ly - #s Val Arg Glu Leu Tyr125 1 - #30 1 - #35 1 -#40- ATA TGG GTT CCA TAT TTA TAT ATT AGT TTT CA - #A GAA TGG ATA CAA ACG1562Ile Trp Val Pro Tyr Leu Tyr Ile Ser Phe Gl - #n Glu Trp Ile Gln Thr# 155- ATT ATT TTA AAA AAT ACG AAA AAT ATC TAT GA - #A ATA GAT GAA GAT TCG1610Ile Ile Leu Lys Asn Thr Lys Asn Ile Tyr Gl - #u Ile Asp Glu Asp Ser# 170- TCT GTA ATT TCC TTT AAC TAT ACA AAT ACT AT - #G GAA GAT GTT TAT CAA1658Ser Val Ile Ser Phe Asn Tyr Thr Asn Thr Me - #t Glu Asp Val Tyr Gln# 185- CAA AAA GAT GTA CTA CAT TTA CAT GGT TCT GT - #A AAA AAT CTA GAA GAT1706Gln Lys Asp Val Leu His Leu His Gly Ser Va - #l Lys Asn Leu Glu Asp# 200- GTA GTA TTA GGA TTT CAT TCG CCA GAA ATA GA - #C GAC AAA TTA CCA GGG1754Val Val Leu Gly Phe His Ser Pro Glu Ile As - #p Asp Lys Leu Pro Gly205 2 - #10 2 - #15 2 -#20- TTA GAA ACA AGT TTT ACG AAG GAA TTT AAG GA - #A ACA CAA AGA ATG TTT1802Leu Glu Thr Ser Phe Thr Lys Glu Phe Lys Gl - #u Thr Gln Arg Met Phe# 235- GCA GAA CAG GGT TCT AGA AAG CTT AAT TCT AA - #T AAG TTT TAT GAT GAA1850Ala Glu Gln Gly Ser Arg Lys Leu Asn Ser As - #n Lys Phe Tyr Asp Glu# 250- AAT ATA GGA AGA TTT TAT AAA CCA GTA AAT CT - #T TTA AAA GAC TCA ATT1898Asn Ile Gly Arg Phe Tyr Lys Pro Val Asn Le - #u Leu Lys Asp Ser Ile# 265- GAG TCT TTT GTT AAA AAT AAA AAT ATT CAT GA - #A GTA ATA ATC TTA GGT1946Glu Ser Phe Val Lys Asn Lys Asn Ile His Gl - #u Val Ile Ile Leu Gly# 280- CAT TCA TAT AAT AAG ATA GAC TGG GTT TAT TT - #T AAA GAA CTA GTC AGA1994His Ser Tyr Asn Lys Ile Asp Trp Val Tyr Ph - #e Lys Glu Leu Val Arg285 2 - #90 2 - #95 3 -#00- TGC GCC CCT GAA GCA AAA TAT TTA TTT AGC TA - #T TAT TCC CAA AAT GAT2042Cys Ala Pro Glu Ala Lys Tyr Leu Phe Ser Ty - #r Tyr Ser Gln Asn Asp# 315- AAA GAA AAC ATA AAT AAA ATT ATA TTG GAG AA - #T AAA TTT GAT ATT GAT2090Lys Glu Asn Ile Asn Lys Ile Ile Leu Glu As - #n Lys Phe Asp Ile Asp# 330- TGC GAA AAA ATA CAT GTA GAT AAC TTT AAA AT - #T AAA AAA GAT#2132Cys Glu Lys Ile His Val Asp Asn Phe Lys Il - #e Lys Lys Asp# 345- TAGCAAAAAT TTAGGAGTTT TATATGATTA TATTTATAGA CCCGAATTGC TA - #GTTGATTA2192- TTTAGCCATG ACTTGATACC CGATAGAATA TCTTAAAGTC TCTGGTTCCA GT - #GATTTAGC2252- TGATTTTAAC AGTAAAGAAT ACGCTAAAAG TATCATCTCT AATTTCAATT GA - #AAACCTTG2312- AGGCGAACGA CTTTTACAAC GCTCAGCTCC TAGATTTGTC AAAAAAGAGA AA - #ACTCGCTC2372- AATCACTTTT CTACGTTTTG AAAAATTAGG GAAAAGGATT TTCTTTCGCT TC - #ATGTTCTT2432- CCTGACAGGT GTCATTAGAT CAATTCCTTT TAATTCCAGC CTATCATGCA GT - #GACTGACC2492- TAAATATCCC ATATCTCCAA GGACTGTTGG TGTCCCAAAT TGACTCAACA CT - #TCCTCGGC2552- CATTGTACTG TCAGCTATTG AAGCAGGAGT AATTGTGTAG TCTATGACAT AG - #CCTGATTC2612- ACTGACTAAA GCATGACATT TACATCCATA GAAGTACTGT CCCTTTGTAA CA - #TTGTAGCC2672- AACATTTGCA TAATCTCCAA GAACTTTGCT TCTGAAATTA CGAATCGACT GA - #CACAAAGG2732- AATGGGGAAG CTGTCAATAA TGGATACACT CATTCCTTCA ACCTCTTTAA AG - #ACGAGTGC2792- TTGGCGAATG ACTTGGATAC TCGGTAAGAG GGCATTACAA CGGCGGACAA AG - #CGAGAATA2852- TTCTAGGAAA TTAGGAAATA AACTTTGAGC CAATTGGTGC TTAGCTTTAA GT - #GTTTCACT2912- AAAATGCAGT ACGCCCCATA GGTAACAAGC GATAACTAAG CAATCTGATG TT - #GCGAGATG2972- GACGTTCTTT CGGTTTTGAA CCTCAAGGGG ACACTCGTTT GATAAATCGT CT - #CAATGGTT3032- GTCAGTAAAT AAACCAAAAA CTTTTGGAAG TGTGCTATTA TAAGTCATAT AA - #GTCGTGCG3092- CTTTCTAATG CTTAGTGGGT TAAGATTAGG ATAGCACGAC TTATTTATTT TC - #CAATGAAA3152- TTAACTAGCA ATTCGGGTTT TCTTAATTTT TTTTATAAAA AAATTACTCC TA - #AAGCAGAG3212- TAATTTTATT GTTAATTTTT ATCAGAGATT ATTCCAAAAA TTTTTCTGAT AA - #AAATGAAG3272- TATCACTCCT ACCGAAAATC CTAAAAGGAG GACTAGGGCA AGGTTAACAA CT - #AAAGGATA3332- TGGAATAAAG ATAATCAGGG CAATAATTGC TCCAATGAGT GCTCCTGCTC CC - #AAAAGCGT3392- AGCAAAGAAA ATGATAAAAA CCCGAAATCC CCCAGAACCT CTTGTAAAAA GT - #TGAGTCAA3452- CGCAGTCCAA TTTAAATTTA AGAGATGCCA ATCTCTGACA AAATAATGAA GT - #GAAATCAG3512- ATATACCCCA ATAACATTCC CAATTAACAG CCCAAAGAGC AAGGTAACAG GG - #ACTTTCAG3572- TAAAATACCA ATCACTAAAG ATAAGATTAA GTCAAGAACT AGTTGAATAA AA - #AAGGCAAA3632- ATGAAATTTC ACTCTGAGAT AGAAATTCAA CTTCATGGGT AAGCTTTTAA AA - #TAATTAAA3692# 3704- (2) INFORMATION FOR SEQ ID NO: 2:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 346 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein#2: (xi) SEQUENCE DESCRIPTION: SEQ ID NO:- Met Lys Leu Tyr Ile Val Gly Asn Gly Phe As - #p Leu Ser His Asn Leu# 15- Lys Thr Ser Tyr Thr Glu Phe Arg Leu Tyr Le - #u Leu Glu His Arg Asp# 30- Glu Val Tyr Thr Asp Glu Asp Leu Ile Ile Se - #r Lys Gly Asp Ile Leu# 45- Arg Asn Phe Glu Arg Tyr Cys Gln Pro Asn As - #p Leu Trp Ser Asp Phe# 60- Glu Glu Gln Thr Glu Lys Ile Ile Ser Glu Il - #e Ser Glu Gly Lys Ile# 80- Ile Ile Phe Glu Glu Glu Trp Ser Cys Lys Le - #u Asp Ile Gly Gly Glu# 95- Arg His Lys Phe Ile Asp Cys Phe Lys Lys Le - #u Ile Lys Lys Gln Asp# 110- Ser Thr Phe Asp Thr Asp Ile Tyr His Asn Gl - #u Ile Gln Glu Tyr Ala# 125- Leu Lys Tyr Phe Asn Asn Lys Val Arg Glu Le - #u Tyr Ile Trp Val Pro# 140- Tyr Leu Tyr Ile Ser Phe Gln Glu Trp Ile Gl - #n Thr Ile Ile Leu Lys145 1 - #50 1 - #55 1 -#60- Asn Thr Lys Asn Ile Tyr Glu Ile Asp Glu As - #p Ser Ser Val Ile Ser# 175- Phe Asn Tyr Thr Asn Thr Met Glu Asp Val Ty - #r Gln Gln Lys Asp Val# 190- Leu His Leu His Gly Ser Val Lys Asn Leu Gl - #u Asp Val Val Leu Gly# 205- Phe His Ser Pro Glu Ile Asp Asp Lys Leu Pr - #o Gly Leu Glu Thr Ser# 220- Phe Thr Lys Glu Phe Lys Glu Thr Gln Arg Me - #t Phe Ala Glu Gln Gly225 2 - #30 2 - #35 2 -#40- Ser Arg Lys Leu Asn Ser Asn Lys Phe Tyr As - #p Glu Asn Ile Gly Arg# 255- Phe Tyr Lys Pro Val Asn Leu Leu Lys Asp Se - #r Ile Glu Ser Phe Val# 270- Lys Asn Lys Asn Ile His Glu Val Ile Ile Le - #u Gly His Ser Tyr Asn# 285- Lys Ile Asp Trp Val Tyr Phe Lys Glu Leu Va - #l Arg Cys Ala Pro Glu# 300- Ala Lys Tyr Leu Phe Ser Tyr Tyr Ser Gln As - #n Asp Lys Glu Asn Ile305 3 - #10 3 - #15 3 -#20- Asn Lys Ile Ile Leu Glu Asn Lys Phe Asp Il - #e Asp Cys Glu Lys Ile# 335- His Val Asp Asn Phe Lys Ile Lys Lys Asp# 345- (2) INFORMATION FOR SEQ ID NO: 3:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1345 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (vi) ORIGINAL SOURCE:#lactis (A) ORGANISM: Lactococcus- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION:246..1283#3: (xi) SEQUENCE DESCRIPTION: SEQ ID NO:- AAATACAGGC TCTATAAAGC TCTCAAAGTG TTCACTATAG AAAAGCTCTT AA - #AGTGAAAA 60- ATAAAATGGG GCAAATTGGG GGCATTTCAA GTTAAGAGTA TTCAAATATG TA - #ACTAAAAA 120- AAATTATTTT TTTGAATTAG TGTTTTTCTA TTTGCATATT TTTTCGAGAT TT - #TCTGTTTT 180- GATTATTATA TAATTATATT TATATTTATA GTTATAGTTA TTGAGTTAAG TT - #AGTGGGAG 240#TTT GAT TTA TCA CAC 287 GGT AAT GGC#Asn Gly Phe Asp Leu Ser Hisl Gly# 10- AAT CTG AAA ACA TCA TAT ACA GAG TTT AGA TT - #A TAT TTA TTG GAA CAT 335Asn Leu Lys Thr Ser Tyr Thr Glu Phe Arg Le - #u Tyr Leu Leu Glu His# 30- AGG GAT GAA GTA TAT ACA GAT GAA GAT TTA AT - #A ATA TCA AAA GGA GAT 383Arg Asp Glu Val Tyr Thr Asp Glu Asp Leu Il - #e Ile Ser Lys Gly Asp# 45- ATT TTA CGA AAT TTT GAA AGA TAT TGT CAA CC - #A AAT GAT TTA TGG AGC 431Ile Leu Arg Asn Phe Glu Arg Tyr Cys Gln Pr - #o Asn Asp Leu Trp Ser# 60- GAT TTT GAA GAA CAG ACT GAG AAA ATA ATA TC - #A GAA ATA TCA GAG GGG 479Asp Phe Glu Glu Gln Thr Glu Lys Ile Ile Se - #r Glu Ile Ser Glu Gly# 75- AAA ATT ATA ATC TTT GAA GAA GAA TGG AGC TG - #C AAA TTA GAT ATT GGA 527Lys Ile Ile Ile Phe Glu Glu Glu Trp Ser Cy - #s Lys Leu Asp Ile Gly# 90- GGT GAG AGG CAT AAA TTT ATT GAT TGT TTT AA - #A AAG TTA ATA AAA AAA 575Gly Glu Arg His Lys Phe Ile Asp Cys Phe Ly - #s Lys Leu Ile Lys Lys#110- CAA GAT AGT ACA TTC GAT ACT GAT ATA TAT CA - #T AAT GAA ATT CAA GAG 623Gln Asp Ser Thr Phe Asp Thr Asp Ile Tyr Hi - #s Asn Glu Ile Gln Glu# 125- TAT GCC TTA AAG TAT TTT AAC AAT AAG GTA AG - #G GAA CTA TAT ATA TGG 671Tyr Ala Leu Lys Tyr Phe Asn Asn Lys Val Ar - #g Glu Leu Tyr Ile Trp# 140- GTT CCA TAT TTA TAT ATT AGT TTT CAA GAA TG - #G ATA CAA ACG ATT ATT 719Val Pro Tyr Leu Tyr Ile Ser Phe Gln Glu Tr - #p Ile Gln Thr Ile Ile# 155- TTA AAA AAT ACG AAA AAT ATC TAT GAA ATA GA - #T GAA GAT TCG TCT GTA 767Leu Lys Asn Thr Lys Asn Ile Tyr Glu Ile As - #p Glu Asp Ser Ser Val# 170- ATT TCC TTT AAC TAT ACA AAT ACT ATG GAA GA - #T GTT TAT CAA CAA AAA 815Ile Ser Phe Asn Tyr Thr Asn Thr Met Glu As - #p Val Tyr Gln Gln Lys175 1 - #80 1 - #85 1 -#90- GAT GTA CTA CAT TTA CAT GGT TCT GTA AAA AA - #T CTA GAA GAT GTA GTA 863Asp Val Leu His Leu His Gly Ser Val Lys As - #n Leu Glu Asp Val Val# 205- TTA GGA TTT CAT TCG CCA GAA ATA GAC GAC AA - #A TTA CCA GGG TTA GAA 911Leu Gly Phe His Ser Pro Glu Ile Asp Asp Ly - #s Leu Pro Gly Leu Glu# 220- ACA AGT TTT ACG AAG GAA TTT AAG GAA ACA CA - #A AGA ATG TTT GCA GAA 959Thr Ser Phe Thr Lys Glu Phe Lys Glu Thr Gl - #n Arg Met Phe Ala Glu# 235- CAG GGT TCT AGA AAG CTT AAT TCT AAT AAG TT - #T TAT GAT GAA AAT ATA1007Gln Gly Ser Arg Lys Leu Asn Ser Asn Lys Ph - #e Tyr Asp Glu Asn Ile# 250- GGA AGA TTT TAT AAA CCA GTA AAT CTT TTA AA - #A GAC TCA ATT GAG TCT1055Gly Arg Phe Tyr Lys Pro Val Asn Leu Leu Ly - #s Asp Ser Ile Glu Ser255 2 - #60 2 - #65 2 -#70- TTT GTT AAA AAT AAA AAT ATT CAT GAA GTA AT - #A ATC TTA GGT CAT TCA1103Phe Val Lys Asn Lys Asn Ile His Glu Val Il - #e Ile Leu Gly His Ser# 285- TAT AAT AAG ATA GAC TGG GTT TAT TTT AAA GA - #A CTA GTC AGA TGC GCC1151Tyr Asn Lys Ile Asp Trp Val Tyr Phe Lys Gl - #u Leu Val Arg Cys Ala# 300- CCT GAA GCA AAA TAT TTA TTT AGC TAT TAT TC - #C CAA AAT GAT AAA GAA1199Pro Glu Ala Lys Tyr Leu Phe Ser Tyr Tyr Se - #r Gln Asn Asp Lys Glu# 315- AAC ATA AAT AAA ATT ATA TTG GAG AAT AAA TT - #T GAT ATT GAT TGC GAA1247Asn Ile Asn Lys Ile Ile Leu Glu Asn Lys Ph - #e Asp Ile Asp Cys Glu# 330- AAA ATA CAT GTA GAT AAC TTT AAA ATT AAA AA - #A GAT TAGCAAAAAT1293Lys Ile His Val Asp Asn Phe Lys Ile Lys Ly - #s Asp335 3 - #40 3 - #45- TTAGGAGTTT TATATGATTA TATTTATAGA CCCGAATTGC TAGTTGATTA TT - #1345- (2) INFORMATION FOR SEQ ID NO: 4:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 346 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein#4: (xi) SEQUENCE DESCRIPTION: SEQ ID NO:- Met Lys Leu Tyr Ile Val Gly Asn Gly Phe As - #p Leu Ser His Asn Leu# 15- Lys Thr Ser Tyr Thr Glu Phe Arg Leu Tyr Le - #u Leu Glu His Arg Asp# 30- Glu Val Tyr Thr Asp Glu Asp Leu Ile Ile Se - #r Lys Gly Asp Ile Leu# 45- Arg Asn Phe Glu Arg Tyr Cys Gln Pro Asn As - #p Leu Trp Ser Asp Phe# 60- Glu Glu Gln Thr Glu Lys Ile Ile Ser Glu Il - #e Ser Glu Gly Lys Ile# 80- Ile Ile Phe Glu Glu Glu Trp Ser Cys Lys Le - #u Asp Ile Gly Gly Glu# 95- Arg His Lys Phe Ile Asp Cys Phe Lys Lys Le - #u Ile Lys Lys Gln Asp# 110- Ser Thr Phe Asp Thr Asp Ile Tyr His Asn Gl - #u Ile Gln Glu Tyr Ala# 125- Leu Lys Tyr Phe Asn Asn Lys Val Arg Glu Le - #u Tyr Ile Trp Val Pro# 140- Tyr Leu Tyr Ile Ser Phe Gln Glu Trp Ile Gl - #n Thr Ile Ile Leu Lys145 1 - #50 1 - #55 1 -#60- Asn Thr Lys Asn Ile Tyr Glu Ile Asp Glu As - #p Ser Ser Val Ile Ser# 175- Phe Asn Tyr Thr Asn Thr Met Glu Asp Val Ty - #r Gln Gln Lys Asp Val# 190- Leu His Leu His Gly Ser Val Lys Asn Leu Gl - #u Asp Val Val Leu Gly# 205- Phe His Ser Pro Glu Ile Asp Asp Lys Leu Pr - #o Gly Leu Glu Thr Ser# 220- Phe Thr Lys Glu Phe Lys Glu Thr Gln Arg Me - #t Phe Ala Glu Gln Gly225 2 - #30 2 - #35 2 -#40- Ser Arg Lys Leu Asn Ser Asn Lys Phe Tyr As - #p Glu Asn Ile Gly Arg# 255- Phe Tyr Lys Pro Val Asn Leu Leu Lys Asp Se - #r Ile Glu Ser Phe Val# 270- Lys Asn Lys Asn Ile His Glu Val Ile Ile Le - #u Gly His Ser Tyr Asn# 285- Lys Ile Asp Trp Val Tyr Phe Lys Glu Leu Va - #l Arg Cys Ala Pro Glu# 300- Ala Lys Tyr Leu Phe Ser Tyr Tyr Ser Gln As - #n Asp Lys Glu Asn Ile305 3 - #10 3 - #15 3 -#20- Asn Lys Ile Ile Leu Glu Asn Lys Phe Asp Il - #e Asp Cys Glu Lys Ile# 335- His Val Asp Asn Phe Lys Ile Lys Lys Asp# 345- (2) INFORMATION FOR SEQ ID NO: 5:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 31 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (ix) FEATURE: (A) NAME/KEY: misc.sub.-- - #signal (B) LOCATION:6..11 (D) OTHER INFORMATION:/fun - #ction= "BamHI restriction site"- (ix) FEATURE: (A) NAME/KEY: misc.sub.-- - #structure (B) LOCATION:12..31 (D) OTHER INFORMATION:/fun - #ction= "sequence homologous to#corresponding to nucleotides 1326-1345#ID NO: 3" of SEQ#5: (xi) SEQUENCE DESCRIPTION: SEQ ID NO:# 31 TCAA CTAGCAATTC G- (2) INFORMATION FOR SEQ ID NO: 6:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 31 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (ix) FEATURE: (A) NAME/KEY: misc.sub.-- - #signal (B) LOCATION:6..11 (D) OTHER INFORMATION:/fun - #ction= "SalI restriction site"- (ix) FEATURE: (A) NAME/KEY: misc.sub.-- - #structure (B) LOCATION:12..31 (D) OTHER INFORMATION:/fun - #ction= "sequence homologous to to nucleo - #tides 1-20 of SEQ ID NO:3"#6: (xi) SEQUENCE DESCRIPTION: SEQ ID NO:# 31 CAGG CTCTATAAAG C- (2) INFORMATION FOR SEQ ID NO: 7:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 32 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (ix) FEATURE: (A) NAME/KEY: misc.sub.-- - #signal (B) LOCATION:6..11 (D) OTHER INFORMATION:/fun - #ction= "BamHI restriction site"#7: (xi) SEQUENCE DESCRIPTION: SEQ ID NO:# 32 AATA AAATTACTCT GC- (2) INFORMATION FOR SEQ ID NO: 8:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 32 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (ix) FEATURE: (A) NAME/KEY: misc.sub.-- - #signal (B) LOCATION:6..11 (D) OTHER INFORMATION:/fun - #ction= "SalI restriction site"#8: (xi) SEQUENCE DESCRIPTION: SEQ ID NO:# 32 TTTG ATATTGATTG CG__________________________________________________________________________

Number	Date	Country
0208468A3	Jan 1987	EPX
0246909A2	Nov 1987	EPX
0355036A1	Feb 1990	EPX
0452224A1	Oct 1991	EPX
WO9205260	Apr 1992	WOX

Nucleic acid sequences and plasmids comprising at least one phage resistance mechanism, bacteria containing them and their use

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

US Referenced Citations (1)

Foreign Referenced Citations (5)

Non-Patent Literature Citations (19)

Entry
Jarvis et al. Applied and Environmental Microbiology 55(6): 1537-1543 (1989).
Hill et al. Applied and Environmental Microbiology 55(7): 1684-1689 (1989).
Steenson et al. Applied and Environmental Microbiology 50(4): 851-858 (1985).
Steele et al. Plasmid 22: 32-43 (1989).
Laible et al. J. Diary Science 70: 2211-2219 (1987).
Froseth et al. J. Diary Science 71: 275-284 (1988).
Sanders et al. Applied and Environmental Microbiology 47(5): 979-985 (1984).
Sanders. Biochimie 70: 411-421 (1988).
Gautier et al. Applied and Environmental Microbiology 53(5): 923-927 (1987).
Josephsen et al. Plasmid 23: 71-75 (1990).
Klaenhammer et al. Journal of General Microbiology 131: 1531-1541 (1985).
Coffey et al. Neth. Milk Dairy J. 43: 229-244 (1989).
Vlegels et al. Neth. Milk Dairy J. 43: 245-259 (1989).
Sanders et al. Applied and Environmental Microbiology 46(5): 1125-1133 (1983).
Jarvis et al. Applied and Environmental Microbiology 54: 777-783 (1988).
Hill et al. Applied and Environmental Microbiology 56(7): 2255-2258 (1990).
Prevots et al. Applied and Environmental Microbiology 56(7): 2180-2185 (1990).
Lerayer. Revistra de Microbiologia 20(2): 197-209 (1989).
Klaenhammer. J. Diary Science 72: 3429-3443.