Claims
- 1. A vector comprising a nucleotide molecule selected from the group consisting of a nucleotide molecule coding for a Hantaan virus nucleocapsid N protein and a nucleotide molecule coding for a precursor of Hantaan virus G1 and G2 glycoproteins.
- 2. A vector as claimed in claim 1, wherein said nucleotide molecule coding for said necleocapsid N protein is defined by the formula: ##STR1##
- 3. A vector as claimed in claim 2, wherein said nucleotide molecule coding for said nucleocapsid N protein further comprises at least one of
- (a) a leader-sequence that precedes said nucleotide molecule coding for said nucleocapsid N protein, wherein said leader-sequence comprises a sequence defined by the formula:
- TAGTAGTAGACTCCCTAAAGAGCTACTAGAACAACG, and
- (b) a tail-sequence that follows said nucelotide molecule coding for said nucleocapsid N protein, wherein said tail-sequence comprises a sequence defined by the formula: ##STR2##
- 4. A vector as claimed in claim 1, wherein said nucleotide molecule coding for said precursor is defined by the formula: ##STR3##
- 5. A vector as claimed in claim 4, wherein said nucleotide molecule coding for said precursor further comprises at least one of
- (a) a leader-sequence that precedes said nucleotide molecule coding for said precursor, wherein said leader-sequence is comprised of a sequence defined by the formula: ##STR4## (b) a tail-sequence that follows said nucleotide molecule coding for said precursor, wherein said tail-sequence is comprised of a sequence defined by the formula: ##STR5##
- 6. A vector as claimed in claim 1, wherein said nucleocapsid N protein has an amino acid sequence defined by the formula: ##STR6##
- 7. A vector as claimed in claim 1, wherein said precursor has an amino acid sequence defined by the formula: ##STR7##
- 8. A vector as claimed in claim 7, wherein said amino acid sequence is preceded by a leader-sequence that comprises a sequence defined by the formula: ##STR8##
- 9. A cDNA molecule comprising a nucleotide molecule selected from the group consisting of a nucleotide molecule coding for a Hantaan virus nucleocapsid N protein and a nucleotide molecule coding for a precursor of Hantaan virus G1 and G1 glycoproteins.
- 10. A cDNA molecule as claimed in claim 9, wherein said nucleotide molecule coding for said nucleocapsid N protein is defined by the formula: ##STR9##
- 11. A cDNA molecule as claimed in claim 10, wherein said nucleotide molecule coding for said nucleocapsid N protein further comprises at least one of
- (a) a leader-sequence that precedes said nucleotide molecule coding for said nucleocapsid N protein, wherein said leader-sequence is comprised of a sequence defined by the formula:
- TAGTAGTAGACTCCCTAAAGAGCTACTAGAACAACG, and
- (b) a tail-sequence that follows said nucleotide molecule coding for said nucleocapsid N protein, wherein sad tail-sequence is comprised of a sequence defined by the formula: ##STR10##
- 12. A cDNA molecule as claimed in claim 9, wherein said nucleotide molecule coding for said precursor is defined by the formula: ##STR11##
- 13. A cDNA molecule as claimed in claim 12, wherein said nucleotide molecule coding for said precursor further comprises at least one of
- (a) a leader-sequence that precedes said nucleotide molecule coding for said precursor, wherein said leader-sequence is comprised of a sequence defined by the formula: ##STR12## (b) a tail-sequence that follows said nucleotide molecule coding for said precursor, wherein said tail-sequence is comprised of a sequence defined by the formula: ##STR13##
Parent Case Info
This is a continuation, of application Ser. No. 07/125,105, filed Nov. 25, 1987, now abandoned.
Non-Patent Literature Citations (3)
Entry |
Schmaljohn et al. 1986 Virology 155: 633-643. |
Schmaljohn et al., 1987 Virology 157: 31-39. |
Yoo et al., 1987 NAR 15:6299-6300. |
Continuations (1)
|
Number |
Date |
Country |
Parent |
125105 |
Nov 1987 |
|