OLIGONUCLEOTIDE SEQUENCES AND DNA CHIP FOR IDENTIFYING FILAMENTOUS MICROORGANISMS AND THE IDENTIFICATION METHOD THEREOF

Information

  • Patent Application
  • 20090170103
  • Publication Number
    20090170103
  • Date Filed
    October 14, 2008
    16 years ago
  • Date Published
    July 02, 2009
    16 years ago
Abstract
A DNA chip for identifying filamentous microorganisms, including a substrate and a plurality of probes, wherein the probe includes SEQ ID No.1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, complementary sequences thereof, derivatives thereof or combinations thereof. The derivative is 5′ and/or 3′ end of the sequence SEQ ID No. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 with at least one thymidine residue added or is 5′ and/or 3′ end of the sequence SEQ ID No. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 with one or two nucleotides added or deleted.
Description
CROSS REFERENCE TO RELATED APPLICATIONS

This Application claims priority of Taiwan Patent Application No. 96150262, filed on Dec. 26, 2007, the entirety of which is incorporated by reference herein.


INCORPORATION BY REFERENCE OF SEQUENCE LISTING

A sequence listing submitted as a text file via EFS-Web is incorporated herein by reference. The text file containing the sequence listing is named “0956-A22348-US_Seq_Listing.txt”; its date of creation is Sep. 23, 2008; and its size is 3,069 bytes.


BACKGROUND OF THE INVENTION

1. Field of the Invention


The present invention relates to identification of filamentous microorganisms, particularly to the identification of those filamentous microorganisms which cause sludge bulking during waste water treatment.


2. Description of the Related Art


Most waste water processing stations use activated sludge technology as their main bio-process. However, due to the nature of industrial waste water, the bio-process itself has some inherent problems, particularly with excess foaming and sludge bulking. Sludge bulking is mainly caused by the uncontrolled growth of filamentous microorganisms which result in the structural destruction of the flocs, and in their decrease subsidence. Meanwhile, because identifying filamentous microorganisms that cause sludge bulking is a timely process, filamentous microorganisms are typically not well controlled in waste water treatment resulting in poorer water quality.


Note that by expediently identifying filamentous microorganisms which cause sludge bulking in waste water treatment, prophylaxis can be enhanced. However, in conventional activated sludge systems, the bacteria flora is very complicated and classification of bacteria causing bulking cannot be made by morphology or growth condition. Therefore, conventional identification methods have their shortcomings.


There are mainly two kinds of high throughput identification methods for microorganisms. The first one is immunoassay. Immunoassay utilizes specific antibodies to a microorganism for the identification of that particular microorganism. The second one is through detection of a target gene of the particular microorganism of interest. For example, a specific gene of certain microorganism can be detected using polymerase chain reaction (PCR) or DNA hybridization (Southern blotting). However, PCR can identify only one or a few microorganisms at a time, and multiple primers are needed to identify different microorganisms. For identification of the filamentous microorganisms which causes sludge bulking in waste water treatment, multiplex PCR or serial PCRs is required. However, multiplex PCR has some disadvantages, such as decreased PCR sensitivity (Chang et al., 2001). In addition, performing serial PCRs increases assay complexity, manpower and cost. Therefore, the application of multiplex PCR for the identification of filamentous microorganisms in waste water treatment has been limited.


Bacteria contain both highly conserved and highly variable regions of DNA. Depending on the bacteria of interest and on the region of interest, the DNA for that region will either be highly variable or highly conserved. The length of the 16S rRNA gene (16S rDNA) of all bacteria is about 1.5 Kb and typically conserved. In comparison with the 16S rDNA, the length of the 23S rRNA is about 3.0 Kb and typically more variable. Different bacteria vary to a large degree in both length and sequence of the 16S-23S ribosomal DNA intergenic spacer (ITS) region. The length of the 16S-23S ribosomal intergenic spacer region ranged from 60 to 1529 bp, and it was proposed by Gürtler that the intergenic spacer region can be used as an identification tool of microorganisms (Gürtler and Stanisich, 1996). Except for a few bacteria, the intraspecies sequence similarities of the 16S-23S ribosomal intergenic spacer are high, but interspecies sequence similarities are low. In comparison with the 16S rDNA sequence, wherein the sequencing of the 16S rDNA usually needs to be performed twice, the 16S-23S ribosomal DNA intergenic spacer region sequence is shorter and only requires one sequencing of the 16S-23S ribosomal DNA intergenic spacer region sequence to obtain the entire sequence. The divergence between interspecies of the 16S-23S ribosomal DNA intergenic spacer region sequence is greater than that of the 16 rDNA, (the similarities of the 16 rDNA between some bacteria can be as much as and even greater than 99%). Accordingly, Kawamura and Patel considered that the 16S-23S ribosomal DNA intergenic spacer region sequence is helpful for microorganism identification (Kawamura et al., 1995; Patel et al., 1998).


The present invention relates to a new method for identifying filamentous microorganisms which causes sludge bulking in waste water treatment via use of the 16S-23S ribosomal DNA intergenic spacer sequence. The new method involves amplifying the DNA of target microorganisms using PCR, and then detecting the PCR product by oligonucleotide sequence from the 16S-23S ribosomal DNA intergenic spacer sequence which are used as probes on microarrays. Currently, only Kim (Kim et al., 2004) uses a DNA chip having oligonucleotide sequences from the 16S rDNA sequence to detect filamentous microorganisms in activated sludge. Meanwhile, the intergenic spacer region sequence (ITS) has been mainly used to identify bacteria for some pathogens in biology and medicine, such as Entercoccus species (Tung et al., 2006), E. coil (Lin et al., 2005), Granulicatella species (Tung et al., 2006), Pseudomonas aeruginosa (Lin et al., 2005), Streptococcus species (Tung et al., 2006), etc. The intergenic spacer region sequence has not been applied for detecting filamentous microorganisms in activated sludge.


BRIEF SUMMARY OF THE INVENTION

In a first aspect, the invention provides an oligonucleotide sequence for identifying Leucothrix mucor, comprising: SEQ ID No. 1, SEQ ID No. 2, the complementary sequences thereof or derivatives thereof, wherein the derivative is 5′ and/or 3′ end of the sequence SEQ ID No. 1 or 2 with at least one thymidine residue added or is 5′ and/or 3′ end of the sequence SEQ ID No. 1 or 2 with one or two nucleotides added or deleted.


In a second aspect, the invention provides an oligonucleotide sequence for identifying Leptothrix sp., comprising: SEQ ID No. 3, SEQ ID No. 4, the complementary sequences thereof or derivatives thereof, wherein the derivative is 5′ and/or 3′ end of the sequence SEQ ID No. 3 or 4 with at least one thymidine residue added or is 5′ and/or 3′ end of the sequence SEQ ID No. 3 or 4 with one or two nucleotides added or deleted and Leptothrix sp. comprises Leptothrix sp. LMG 9068 and Leptothrix sp. LMG 9069.


In a third aspect, the invention provides an oligonucleotide sequence for identifying Haliscomenobacter hydrossis, comprising: SEQ ID No. 5, SEQ ID No. 6, the complementary sequences thereof or derivatives thereof, wherein the derivative is 5′ and/or 3′ end of the sequence SEQ ID No. 5 or 6 with at least one thymidine residue added or is 5′ and/or 3′ end of the sequence SEQ ID No. 5 or 6 with one or two nucleotides added or deleted.


In a fourth aspect, the invention provides an oligonucleotide sequence for identifying Nocardia sp., comprising: SEQ ID No. 7, SEQ ID No. 8, the complementary sequences thereof or derivatives thereof, wherein the derivative is 5′ and/or 3′ end of the sequence SEQ ID No. 7 or 8 with at least one thymidine residue added or is 5′ and/or 3′ end of the sequence SEQ ID No. 7 or 8 with one or two nucleotides added or deleted and Nocardia sp. comprises Nocardia sp. BCRC 15149, Nocardia sp. BCRC 15708 and Nocardia sp. BCRC 15709.


In a fifth aspect, the invention provides an oligonucleotide sequence for identifying Nocardia amarae, comprising: SEQ ID No. 9. SEQ ID No. 10, the complementary sequences thereof or derivatives thereof, wherein the derivative is 5′ and/or 3′ end of the sequence SEQ ID No. 9 or 10 with at least one thymidine residue added or is 5′ and/or 3′ end of the sequence SEQ ID No. 9 or 10 with one or two nucleotides added or deleted.


In a sixth aspect, the invention provides an oligonucleotide sequence for identifying Thiothrix sp., comprising: SEQ ID No. 11, SEQ ID No. 12, the complementary sequences thereof or derivatives thereof, wherein the derivative is 5′ and/or 3′ end of the sequence SEQ ID No. 11 or 12 with at least one thymidine residue added or is 5′ and/or 3′ end of the sequence SEQ ID No. 11 or 12 with one or two nucleotides added or deleted and Thiothrix sp. comprises Thiothrix sp. DSM 12730.


In a seventh aspect, the invention provides an oligonucleotide sequence for identifying Thiothrix eikelboomii, comprising: SEQ ID No. 13, SEQ ID No. 14, the complementary sequences thereof or derivatives thereof, wherein the derivative is 5′ and/or 3′ end of the sequence SEQ ID No. 13 or 14 with at least one thymidine residue added or is 5′ and/or 3′ end of the sequence SEQ ID No. 13 or 14 with one or two nucleotides added or deleted.


In an eighth aspect, the invention provides an oligonucleotide sequence for identifying Sphaerotilus natans, comprising: SEQ ID No. 15, SEQ ID No. 16, the complementary sequences thereof or derivatives thereof, wherein the derivative is 5′ and/or 3′ end of the sequence SEQ ID No. 15 or 16 with at least one thymidine residue added or is 5′ and/or 3′ end of the sequence SEQ ID No. 15 or 16 with one or two nucleotides added or deleted.


The invention also provides a DNA chip for identifying filamentous microorganisms, including a substrate and a plurality of probes, wherein the probe comprises SEQ ID No. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, complementary sequences thereof, derivatives thereof or combinations thereof. The derivative is 5′ and/or 3′ end of the sequence SEQ ID No. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 with at least one thymidine residue added or is 5′ and/or 3′ end of the sequence SEQ ID No. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 with one or two nucleotides added or deleted.


The invention further provides a method for identifying filamentous microorganisms causing sludge bulking, comprising: (a) extracting a DNA having a 16S-23S ribosomal DNA intergenic spacer region sequence of a filamentous microorganism which is to be identified; (b) amplifying the 16S-23S ribosomal DNA intergenic spacer region sequence via PCR and a pair of universal primers; (c) letting the 16S-23S ribosomal DNA intergenic spacer region sequence amplified in step (b) hybridize with the DNA chip for the identification of the filamentous microorganisms mentioned above; and (d) observing which probe of the DNA chip the 16S-23S ribosomal DNA intergenic spacer region sequence amplified in step (b) is hybridized with to identify the filamentous microorganism which is to be identified.


Further scope of the applicability of the present invention will become apparent from the detailed description given hereinafter. However, it should be understood that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.





BRIEF DESCRIPTION OF THE DRAWINGS

The present invention can be more fully understood from the detailed description given herein below and the accompanying drawings which are given by way of illustration only, and thus are not limitative of the present invention, wherein:



FIG. 1 shows the position of each probe on the DNA chip of the invention; and



FIG. 2 (A)-(O) show the results of different bacterial strains reacting with the DNA chip of one embodiment of the invention.





DETAILED DESCRIPTION OF THE INVENTION

The following description is of the best-contemplated mode of carrying out the invention. This description is made for the purpose of illustrating the general principles of the invention and should not be taken in a limiting sense. The invention utilizes the 16S-23S ribosomal DNA intergenic spacer region sequences of filamentous microorganisms to design specific probes for each kind of filamentous microorganisms. The probes of the invention comprise SEQ ID Nos. 1-16. The probes may be used to form a DNA chip for identifying the filamentous microorganisms causing sludge bulking, such as Leucothrix mucor, Leptothrix sp., Haliscomenobacter hydrossis, Nocardia sp., Nocardia amarae, Thiothrix sp., Thiothrix eikelboomii and Sphaerotilus natans, etc.


First, each kind of filamentous microorganism strain are collected and the 16S-23S ribosomal DNA intergenic spacer region sequences thereof are obtained from a bio-information data base (GenBank database). DNA sequencing is used for any filamentous microorganism strain for which the 16S-23S ribosomal DNA intergenic spacer region sequences could not be obtained from the bio-information data base (GenBank).


Universal primers are then used to amplify the 16S-23S ribosomal DNA intergenic spacer region sequence of the DNA of the filamentous microorganisms. The 16S-23S ribosomal DNA intergenic spacer region sequence of each filamentous microorganism is aligned by a sequence alignment software, Vector NTI (Invitrogen Corporation Carisbead, Calif., USA), and several oligonucleotide sequence fragments having specificity and similar melting temperature (Tm) are selected for each microorganism as probes for detecting filamentous microorganisms. In addition, the complementary sequences or derivatives of the sequences selected may be used as probes. The length of the probes is about 20-30 nucleotides. Furthermore, the derivative is 5′ and/or 3′ ends of the selected sequences with at least one thymidine residue added or is 5′ and/or 3′ ends of the selected sequences with one or two nucleotides added or deleted. Note that adding at least one thymidine residue at 3′ ends of the selected sequences may enhance the signal of the hybridization and the number of added thymidine residues is preferably about 5-15.


After that, the probes are dissolved in a dye liquor and spotted on a substrate to form a DNA chip by automatic arrayer (SR-A300; Ezspot, Taipei, Taiwan) by using a solid pin (diameter, 400 μm). The substrate may comprise nylon membrane, glass, cellulose nitrate membrane or plastic.


The DNA chip may further comprise a plurality of position markers, a plurality of positive control probes and a plurality of negative controls. The position marker may comprise an internal transcribed spacer 4 (ITS-4) (5′ TCCTCCGCTTATTGATATGC 3′) labeled with a digokigenin (DIG). The positive control probe may comprise a sequence of 5′ GGGTGAAGTCGTAACAAGGTAGCCGTAtttttttttt 3′; while the negative control may contain no probes at all, comprising only of the dye liquor which is used for dissolving the probes.


The DNA of the filamentous microorganism are then extracted and used to perform a polymerase chain reaction or a nested polymerase chain reaction by universal primers for the 16S-23S ribosomal DNA intergenic spacer region sequence of bacterium to amplify the 16S-23S ribosomal DNA intergenic spacer region sequence of the filamentous microorganism which is to be identified. The universal primers used in this polymerase chain reaction have been labeled in order to produce a signal when the polymerase chain reaction product of the 16S-23S ribosomal DNA intergenic spacer region sequence hybridizes with the probes. In one embodiment, a digoxigenin is labeled at the 5′ end of the primer.


The polymerase chain reaction product is heated so as to denature the double stranded product and form single strands to hybridize with the probes of the DNA chip of the invention. If the polymerase chain reaction product of the filamentous microorganism which is to be identified hybridizes with a certain probe of the DNA chip of the invention, the filamentous microorganism can be identified.


In one embodiment, by using the DNA chip of the invention, 15 filamentous microorganism strains which were the target microorganisms were correctly identified; the DNA chip thus demonstrated 100% sensitivity. Furthermore, 65 non-filamentous microorganism strains which were not the target of the DNA chip of the invention showed no hybridization signal at all; the DNA chip thus demonstrated 100% specificity. Accordingly, the probes and the DNA chip of the invention had excellent sensitivity and specificity.


EXAMPLE

Collection of the Filamentous Microorganism Strains


Most of the filamentous microorganism strains collected in the invention were from the Bioresources Collection and Research Center, Taiwan (BCRC), American Type Culture Collection (ATCC), Manassa, Va., USA, Deutsche Sammlung von Mikroorganismen und Zellkulture (DSMZ) and Laboratorium voor Microbiologie Gent, Belgium (LMG).


Amplification and Sequencing of the 16S-23S Ribosomal DNA Intergenic Spacer Region Sequence of the Filamentous Microorganisms


DNA of each filamentous microorganism used in the invention was extracted to perform a polymerase chain reaction in order to amplify the 16S-23S ribosomal DNA intergenic spacer region sequence of the DNA.


Polymerase Chain Reaction:


Each 50 μl of polymerase chain reaction solution contained 5 μl of template DNA, 5 μl of PCR buffer (10×), 0.15 mM of deoxyribonucleoside triphosphates (dNTP) (PROtech Technologies, Inc. PTM8014, Taipei, Taiwan), 1 μM of universal primer pair: 2F (5′ TTGTACACACCGCCCGTA 3′) and 10R (5′ TTCGCCTTTCCCTCACGGTA 3′), and 1 U of Taq polymerase (ProZyme™ II, PROtech Technologies, Inc., Taipei, Taiwan). 50 μl of mineral oil was added on each reaction solution. The polymerase chain reaction condition was: 94° C., 3 minutes; 94° C., 1 min, 55° C., 1 minute, 72° C., 1.5 minutes (35 cycles); 72° C., 7 minutes (1 cycle).


Molecular Cloning


Gel electrophoresis of the PCR products were performed in 2% agarose and 100 bp ladder was used as a marker. The gel electrophoresis was performed with 100 V voltage for 30 minutes. Then, the agarose gel was stained with ethidium bromide in sharking condition for 20 minutes and an UV light image process system (IS-2000 Digital Imaging System, Alpha Innotech Corporation, San Leandro, Calif., USA) was used to record the result image. After that, the PCR products were purified by a kit (PCR-M Clean Up System, Viogene, Taipei, Taiwan) and then sequencing of the purified PCR products was performed by ABI Prism 377 automated system (Applied Biosystems, Taipei, Taiwan).


If the PCR product of the filamentous microorganism on the electrophoresis gel was not a single band, molecular cloning of the PCR product was performed. TOPO TA Cloning Kit (Invitrogen, USA) was used for molecular cloning and the plasmid thereof was PCR 2.1-TOPO, competent cells thereof were Top10F′ One Shot. The PCR product was inserted in the plasmid DNA and then the plasmid DNA was transplanted into E. coli competent cells (Top10F′ One Shot). The competent cells were incubated in S.O.C medium (from the kit) at 37° C. for 1 hour. Then the E. coli bacterium containing plasmid were applied on an LB agar plate containing kanamycin (50 μg/μl), 40 μl of IPTG (100 mM) and 40 μl of X-gal (40 mg/ml) and incubated at 37° C. for about 12-16 hours. The blue colonies meant that no plasmid was inserted. Therefore, the white colonies were picked up. Then, PCR, using a specific primer (M13F, M13R), and gel electrophoresis, were performed to further select the white colonies. After the selection, the target DNA fragment was amplified by universal primers (2F, 10R) for the target DNA fragment. The amplified target DNA fragment was then confirmed by a gel electrophoresis, and sequencing of the amplified target DNA fragment was performed. The sequences of the primers are shown in Table 1.









TABLE 1







The sequences of the primers:











Primers
Sequence (5′---3′)















Molecular
M13F
GTAAAACGACGGCCAG
Plasmid



cloning
M13R
CAGGAAACAGCTATGAC
Plasmid





Sequencing
2F
TTGTACACACCGCCCGTA
Bacteria



10R
TTCGCCTTTCCCTCACGGTA
Bacteria









Probe Design


Alignments of the 16S-23S ribosomal DNA intergenic spacer region sequences of the filamentous microorganisms were performed by using the PrettyBox algorithm of the Wisconsin Genetics Computer Group package (version 10.3; Accelrys Inc., San Diego, Calif.) and the similarities of the 16S-23S ribosomal DNA intergenic spacer region sequences were obtained. The 16S-23S ribosomal DNA intergenic spacer region sequences of the filamentous microorganisms were aligned to the 16S-23S ribosomal DNA intergenic spacer region sequences of related or other strain or genus of bacteria, and then specific sequence in the 16S-23S ribosomal DNA intergenic spacer region sequence of each filamentous microorganism were obtained. Several oligonucletide probes for each filamentous microorganism were designed from the 16S-23S ribosomal DNA intergenic spacer region sequence thereof. The length of the probes were about 20-30 nucleotides. The melting temperatures of the probes were similar. The obtained probes and the target filamentous microorganisms thereof are listed in Table 2.









TABLE 2







Probes and the target filamentous microorganisms thereof:










Strains
Sequence of probes








Leucothrix mucor

SEQ ID No. 1




SEQ ID No. 2




Leptothrix sp.

SEQ ID No. 3




SEQ ID No. 4




Haliscomenobacter

SEQ ID No. 5




hydrossis

SEQ ID No. 6




Nocardia sp.

SEQ ID No. 7




SEQ ID No. 8




Nocardia amarae

SEQ ID No. 9




SEQ ID No. 10




Thiothrix sp.

SEQ ID No. 11




SEQ ID No. 12




Thiothrix eikelboomii

SEQ ID No. 13




SEQ ID No. 14




Sphaerotilus natans

SEQ ID No. 15




SEQ ID No. 16










Note that the probes can also be the complementary sequences and derivatives of SEQ ID Nos. 1-16. The derivative is 5′ and/or 3′ ends of the sequence SEQ ID Nos. 1-16 with at least one thymidine residue added to enhance the hybridization signal or is 5′ and/or 3′ end of the sequence SEQ ID Nos. 1-16 with one or two nucleotides added or deleted. The probes used in this example are listed in Table 3.









TABLE 3







Probes used in the example:












Code name



Strains
Sequence of probes
of probes
Tm (° C.)






Leucothrix mucor

SEQ ID No. 1
I
60.5



SEQ ID No. 2
II
52.8



Leptothrix sp.

SEQ ID No. 3 adding
III
60.9



7 thymidine



residues at 3′ end



SEQ ID No. 4 adding
IV
60.2



7 thymidine



residues at 3′ end



Haliscomenobacter

SEQ ID No. 5 adding
V
52.9



hydrossis

9 thymidine



residues at 3′ end



SEQ ID No. 6 adding
VI
61.4



10 thymidine



residues at 3′ end



Nocardia sp.

SEQ ID No. 7 adding
VII
53.4



8 thymidine



residues at 3′ end



SEQ ID No. 8 adding
VIII
50.6



8 thymidine



residues at 3′ end



Nocardia amarae

SEQ ID No. 9 adding
IX
54.2



12 thymidine



residues at 3′ end



SEQ ID No. 10
X
51.4



adding 8 thymidine



residues at 3′ end



Thiothrix sp.

SEQ ID No. 11
XI
59.6



SEQ ID No. 12
XII
59.5



adding 9 thymidine



residues at 3′ end



Thiothrix

SEQ ID No. 13
XIII
56.5



eikelboomii

adding 6 thymidine



residues at 3′ end



SEQ ID No. 14
XIV
54.0



Sphaerotilus

SEQ ID No. 15
XV
59.7



natans

SEQ ID No. 16
XVI
50.9



adding 11 thymidine



residues at 3′ end









Formation of DNA Chip


A DNA chip was formed by a microarray spot maker with pin having a diameter of 400 μm by spotting probes on a nylon membrane having positive charges (Roche, USA). The distance between the center of each two spots (probes) was 800 μm. The size of the chip was 0.45×0.50 cm2 (5×6 spots). The probes listed in Table 3 were dissolved in a dye liquor (probe: dye liquor=1:1). The final concentration of the probe was 10 μM. The position of each probe is shown in FIG. 1. There are 30 spots in the FIG. 1. I-XVI indicate each probe listed in Table 3. M indicates position marker, PC indicates positive control probe, and NC indicates negative control (dye liquor only).


The formulation of the dye liquor was 10 ml of dye liquor containing 3 ml of 100% glycerol, 3 ml of bromophenol blue (per ml containing 5 mg of bromophenol blue, which was dissolved completely and filtered), 4 ml of 100% dimethyl sulfoxide, 20 μl of disodium ethylenediaminetraacetate (EDTA, 500 mM) and 0.1 ml of Tris-HCl (1 M, pH 7.5).


The sequence of the positive probe was 5′ GGGTGAAGTCGTAACAAGGTAGCCGTAtttttttttt 3′ (in 16A rDNA) (final concentration: 2.5 μM) and 9 position markers were 5′-digoxygenin-labeled ITS4 (TCCTCCGCTTATTGATATGC) (final concentration: 0.1 μM).


After the DNA chip was completely formed, the DNA chip was dried in air and irradiated by a shortwave UV (Stratalinker 1800; Stratagen, La Jolla, Calif.) with an energy of 3 W/cm2 for 30 seconds to fix the probes on the DNA chip. Then the DNA chip was stored in a dark and dry place.


Amplification of the 16S-23S Ribosomal DNA Intergenic Spacer Region Sequence of the Filamentous Microorganisms Which is to be Identified


The DNA of filamentous microorganisms which are to be identified are extracted to perform PCR. The filamentous microorganisms which are to be identified are shown in Table 4. Each 50 μl of polymerase chain reaction solution contained 5 μl of template DNA, 5 μl of PCR buffer (10×), 0.15 mM of deoxyribonucleoside triphosphates (dNTP) (PROtech Technologies, Inc. PTM8014, Taipei, Taiwan), 1 μM of universal primers pair: 2F-DIG (5′ TTGTA CACAC CGCCC GTA 3′) and 10R-DIG (5′ TTCGC CTTTC CCTCA CGGTA 3′), and 1 U of Taq polymerase (ProZyme™ II, PROtech Technologies, Inc., Taipei, Taiwan). An aliquot (50 μl) of mineral oil was added on each reaction solution. The polymerase chain reaction condition was: 94° C., 3 minutes; 94° C., 1 minutes, 55° C., 1 minute, 72° C., 1.5 minutes (35 cycles); 72° C., 7 minutes (1 cycle).









TABLE 4







The filamentous microorganisms which is to be identified:










Strain
No.








Leucothrix mucor

DSM 621




Leucothrix mucor

DSM 2157




Leptothrix sp.

LMG 9068




Leptothrix sp.

LMG 9069




Haliscomenobacter

DSM 1100




hydrossis





Nocardia sp.

BCRC 15149




Nocardia sp.

BCRC 15708




Nocardia sp.

BCRC 15709




Nocardia amarae

BCRC 13728




Nocardia amarae

DSM 43391




Thiothrix sp.

DSM 12730




Thiothrix eikelboomii

ATCC 49788




Sphaerotilus natans

DSM 565




Sphaerotilus natans

DSM 5675




Sphaerotilus natans

BCRC 10775










Hybridization of the DNA Chip and the 16S-23S Ribosomal DNA Intergenic Spacer Region Sequence of the Filamentous Microorganisms


Each chip was placed in a 0.5×SSC buffer [1×SSC buffer containing 0.15 M NaCl, 0.015 M sodium citrate and 0.1% sodium dodecyl sulfate (SDS)] on a shaker (60 rpm) at room temperature and washed for 3 times for 3 minutes each time to remove the dye liquor and the probes which were not fixed on the nylon membrane. Pre-hybridization of the DNA chips was performed with a hybridization solution (5×SSC buffer, 1%(w/v) blocking solution (Roche, Mannheim, Germany), 0.1 % N-laurylsarcosine (Sigma) and 0.02% SDS) at room temperature on a shaker for 2 hours. PCR products of 16S-23S ribosomal DNA intergenic spacer region sequence of the filamentous microorganisms were heated at 95° C. for 5 minutes to allow the double helix DNA to loosen and form single stranded DNA which were immediately placed in ice to hold the single stranded form. Each pre-hybridized DNA chip was put in different wells of the 24-well cell culture plate, 10 μl of the PCR product (labeled with DIG) of the filamentous microorganism which is to be identified and 300 μl of hybridization solution were added into the well and the 24 well cell culture plate was put in a hybridization oven (Firstek Scientific, DHO-100, Taipei, Taiwan) at 50° C. and shaken to perform hybridization for 1.5 hours. Afterwards, the hybridization solution was removed from the well and each DNA chip was washed with a 0.25×SSC buffer [1×SSC buffer containing 0.15 M NaCl, 0.015 M sodium citrate and 0.1% sodium dodecyl sulfate (SDS)] at room temperature 4 separate times, each time for 5 minutes in order to wash out the PCR product which had not hybridized.


Then, a 1× blocking solution (Roche, Germany) was added into the well at room temperature and shaken for 1 hour. After that, anti-digoxygenin-AP Fab fragments (Roche 1093274, Germany) which were diluted by 2500 times with the blocking solution was added into the well at room temperature and incubated for 1 hour, and then the antibody solution was removed. Each DNA chip was washed at room temperature 3 separate times, for 15 minutes each time by maleic acid buffer (0.1 M maleic acid, 0.15 M NaCl, 0.3% (v/v) Tween 20, pH 7.5) to wash out any antibody which did not bind to the DIG. A detection buffer was added into the well (0.1 M Tris-HCl and 0.15 M NaCl, pH 9.5) at room temperature and shaken for 5 minutes and then the detection buffer was removed.


NBT/BCIP (nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indolylphosphate) (Roche 1681451, Mannheim, Germany) was diluted with the detection buffer for 50 times and well mixed to form a mixture solution. The mixture solution was added on each DNA chip and reacted with each DNA chip at 37° C. for 30-60 minutes without light and shaking during the color reaction. After the color reaction was complete, each DNA chip was washed with sterilized water 4 separate times, for 5 minutes each time in order to wash out the remaining NBT/BCIP. The DNA chips with color reactions were put on a filter paper and put into an oven for drying. After that, 3000 dpi high resolution scanner (Umax Powerlook 3000, Taipei, Taiwan) was used to scan each DNA chip and store the image results.


Results of Hybridization


(1) Leucothrix mucor


The results of hybridization showed that probes I and II on the DNA chip had excellent hybridization result for 2 strains of Leucothrix mucor and did not have a cross-reaction with other filamentous microorganism strains. Moreover, probe II had a better hybridization result. FIG. 2(A) and (B) show the results of Leucothrix mucor DSM 621 and Leucothrix Mucor DSM 2157 reacting with the probes on the DNA chip, respectively. Compared with FIG. 1, the two spots shown in FIG. 2(A) and (B) are the results of the color reaction of probes I and II and there is no cross-reaction. Therefore, probes I and II can identify Leucothrix mucor accurately.


(2) Leptothrix sp.


The results of hybridization showed that probes III and IV on the DNA chip had excellent hybridization result for 2 strains of Leucothrix mucor and did not have a cross-reaction with other filamentous microorganism strains. FIG. 2(C) and (D) show the results of Leptothrix sp. LMG 9068 and Leptothrix sp. LMG 9069 reacting with the probes on the DNA chip, respectively. Compared with FIG. 1, the two spots shown in FIG. 2(C) and (D) are the results of the color reaction of probes Ill and IV and there is no cross-reaction. Therefore, probes III and IV can identify Leptothrix sp. accurately.


(3) Haliscomenobacter hydrossis


The results of hybridization showed that probes V and VI on the DNA chip had excellent hybridization result for Haliscomenobacter hydrossis and did not have a cross-reaction with other filamentous microorganism strains. Moreover, probe V had a better hybridization result. FIG. 2(E) shows the result of Haliscomenobacter hydrossis DSM 1100 reacting with the probes on the DNA chip. Compared with FIG. 1, the two spots shown in FIG. 2(E) is the result of the color reaction of probes V and VI and there is no cross-reaction. Therefore, probes V and VI can identify Haliscomenobacter hydrossis accurately.


(4) Nocardia sp.


The results of hybridization showed that probes VII and VIII on the DNA chip had excellent hybridization result for 3 strains of Nocardia sp. and did not have a cross-reaction with other filamentous microorganism strains. FIG. 2 (F)-(H) show the results of Nocardia sp. BCRC 15149, Nocardia sp. BCRC 15708 and Nocardia sp. BCRC 15709 reacting with the probes on the DNA chip, respectively. Compared with FIG. 1, the two spots shown in FIG. 2(F)-(H) are the results of the color reaction of probes VII and VIII and there is no cross-reaction. Therefore, probes VII and VIII can identify Nocardia sp. accurately.


(5) Nocardia amarae


The results of hybridization showed that probes IX and X on the DNA chip had excellent hybridization result for 2 strains of Nocardia amarae and did not have a cross-reaction with other filamentous microorganism strains. Moreover, probe IX had a better hybridization result. FIG. 2(I) and (J) show the results of Nocardia amarae BCRC 13728 and Nocardia amarae DSM 43391 reacting with the probes on the DNA chip, respectively. Compared with FIG. 1, the two spots shown in FIG. 2(I) and (J) are the results of the color reaction of probes IX and X and there is no cross-reaction. Therefore, probes IX and X can identify Nocardia amarae accurately.


(6) Thiothrix sp.


The results of hybridization showed that probes XI and XII on the DNA chip had excellent hybridization result for Thiothrix sp. and did not have a cross-reaction with other filamentous microorganism strains. Moreover, probe XII had a better hybridization result. FIG. 2(K) shows the result of Thiothrix sp. DSM 12730 reacting with the probes on the DNA chip. Compared with FIG. 1, the two spots shown in FIG. 2(K) is the result of the color reaction of probes XI and XII and there is no cross-reaction. Therefore, probes XI and XII can identify Thiothrix sp. accurately.


(7) Thiothrix eikelboomii


The results of hybridization showed that probes XIII and XIV on the DNA chip had excellent hybridization result for Thiothrix eikelboomii and did not have a cross-reaction with other filamentous microorganism strains. Moreover, probe XIV had a better hybridization result. FIG. 2(L) shows the result of Thiothrix eikelboomii ATCC 49788 reacting with the probes on the DNA chip. Compared with FIG. 1, the two spots shown in FIG. 2(L) is the result of the color reaction of probes XIII and XIV and there is no cross-reaction. Therefore, probes XIII and XIV can identify Thiothrix eikelboomii accurately.


(8) Sphaerotilus nalans


The results of hybridization showed that probes XV and XVI on the DNA chip had excellent hybridization result for 3 strains of Sphaerotilus nalans and did not have a cross-reaction with other filamentous microorganism strains. Moreover, probe XVI had a better hybridization result. FIG. 2(M)-(O) show the results of Sphaerotilus natans DSM 565, Sphaerotilus natans DSM 5675 and Sphaerotilus natans BCRC 10775 reacting with the probes on the DNA chip, respectively. Compared with FIG. 1, the two spots shown in FIG. 2(M)-(O) are the results of the color reaction of probes XV and XVI and there is no cross-reaction. Therefore, probes XV and XVI can identify Sphaerotilus natans accurately.


Sensitivity and Specificity of the DNA Chip of the Invention


By using the DNA chip of the invention, 15 filamentous microorganism strains which were the target microorganisms were correctly identified; the DNA chip thus demonstrated 100% sensitivity. Furthermore, 65 non-filamentous microorganism strains which were not the target microorganisms of the DNA chip showed no hybridization signal at all; the DNA chip thus demonstrated 100% specificity. Table 5 shows the results of the PCR products of non-filamentous microorganism hybridized to the probes on the DNA chip of the invention.









TABLE 5







Results of the PCR products of non-filamentous microorganism


hybridized to the probes on the DNA chip of the invention.












Number of
Number of




bacteria
bacteria which




which
have cross-




is to be
reaction with


Strain
No.
tested
the DNA chip














Acinetobacter

BCRC 15884
1
0



baumannii




Acinetobacter

LMG 1046
1
0



calcoaceticus




Acinetobacter

LMG 1035
1
0


genomic species 3



Acinetobacter junii

BCRC 14854
1
0



Acinetobacter

LMG 985
1
0


genomic species 9



Acinetobacter

BCRC 15417
1
0


genomic species


13TU



Acinetobacter

CCUG 26390
1
0


genomic species


15TU



Acinetobacter lwoffii

BCRC 14855
1
0



Alcaligenes faecalis

BCRC 10828,
3
0



subdp. faecalis

ATCC 8748, ATCC



19018



A. xylosoxidans

BCRC 12839
1
0


subsp. xylosoxidans



Bacillus subtilis

BCRC 10225,
3
0



BCRC 10029,



BCRC 10058



Branhamella

BCRC 10628,
2
0



catarrhalis

BCRC 10629



Burkholderia

BCRC 13208
1
0



cepacia




Chryseobacterium

ATCC 29897
1
0



indologenes




Chryseobacterium

ATCC 13254,
2
0



meningosepticum

ATCC 13255



Comamonas

BCRC 10956,
2
0



testosteroni

BCRC 14822



Delftia acidovorans

ATCC 17455,
2
0



BCRC 14819



Eikenella corrodens

BCRC 14415
1
0



Exiguobacterium

BCRC 17392
1
0



auarantiacum




Gordonia

DSM 44462
1
0



alkanivorans




Gordonia westfalica

DSM 44215
1
0



Moraxella atlantae

CCUG 31324
1
0



Moraxella bovis

BCRC 11229
1
0



Moraxella canis

LMG 11194, CCUG
2
0



2153



Moraxella caviae

CCUG 355
1
0



Moraxella

BCRC 11230T,
2
0



nonliquefaciens

BCRC11071



Moraxella osloensis

BCRC 10705T,
2
0



LMG 9616



Pseudomonas

ATCC 27853
1
0



aeruginosa




Pseudomonas

ATCC 55044
1
0



alcaligenes




Pseudomonas

BCRC 10304,
3
0



fluorescens

BCRC 13902,



BCRC 14347



Pseudomonas

ATCC 25412,
2
0



mendocina

BCRC 10458



Pseudomonas

BCRC 11902
1
0



pseudoalcaligenes




Pseudomonas putida

BCRC 10459
1
0



Pseudomonas

ATCC 17588,
2
0



stutzeri

BCRC 14821



Ralstonia pickettii

BCRC 14093,
2
0



BCRC 14820



Rhodococcus

CC-BC11
1
0



erythropolis




Rhodococcus ruber

BCRC 13379
1
0



Serratia marcescens

BCRC 12833,
3
0



BCRC 11576,



BCRC 15326



Shewanella

ATCC 49138,
2
0



putrefaciens

BCRC 10596



Sphingomonas

BCRC 13893,
2
0



paucimobilis

BCRC 13954



Stenotrophomonas

BCRC 10737,
3
0



maltophilia

BCRC 12495,



BCRC 14110



Streptococcus

CCUG48465,
2
0



pseudopneumoniae

CCUG 48455


Total number


65





* ATCC: American Type Culture Collection, Manassa, Va., USA


BCRC, Bioresources Collection and Research Center, Hsinchu, Taiwan


CCUG, Culture Collection, University of Göteborg, Göteborg, Sweden


LMG, Laboratorium voor Microbiologie, Gent, Belgium


NCCB, The Netherlands Culture Collection of Bacteria. Utrecht, Netherlands


DSMZ, Deutsche Sammlung von Mikroorganismen und Zellkulture, Braunschweig, Germany






While the invention has been described by way of example and in terms of the embodiment embodiment, it is to be understood that the invention is not limited to the disclosed embodiments. To the contrary, it is intended to cover various modifications and similar arrangements (as would be apparent to those skilled in the art). Therefore, the scope of the appended claims should be accorded the broadest interpretation so as to encompass all such modifications and similar arrangements.

Claims
  • 1. An oligonucleotide sequence for identifying Leucothrix mucor, comprising: SEQ ID No. 1, SEQ ID No. 2, the complementary sequences thereof or derivatives thereof, wherein the derivative is 5′ and/or 3′ end of the sequence SEQ ID No. 1 or 2 with at least one thymidine residue added or is 5′ and/or 3′ end of the sequence SEQ ID No. 1 or 2 with one or two nucleotides added or deleted.
  • 2. The oligonucleotide sequence for identifying Leucothrix mucor as claimed in claim 1, wherein Leucothrix mucor comprises Leucothrix mucor DSM 621 or Leucothrix mucor DSM 2157.
  • 3. An oligonucleotide sequence for identifying Leptothrix sp., comprising: SEQ ID No. 3, SEQ ID No. 4, the complementary sequences thereof or derivatives thereof, wherein the derivative is 5′ and/or 3′ end of the sequence SEQ ID No. 3 or 4 with at least one thymidine residue added or is 5′ and/or 3′ end of the sequence SEQ ID No. 3 or 4 with one or two nucleotides added or deleted and Leptothrix sp. comprises Leptothrix sp. LMG 9068 or Leptothrix sp. LMG 9069.
  • 4. An oligonucleotide sequence for identifying Haliscomenobacter hydrossis, comprising: SEQ ID No. 5, SEQ ID No. 6, the complementary sequences thereof or derivatives thereof, wherein the derivative is 5′ and/or 3′ end of the sequence SEQ ID No. 5 or 6 with at least one thymidine residue added or is 5′ and/or 3′ end of the sequence SEQ ID No. 5 or 6 with one or two nucleotides added or deleted.
  • 5. The oligonucleotide sequence for identifying Haliscomenobacter hydrossis as claimed in claim 4, wherein Haliscomenobacter hydrossis comprises Haliscomenobacter hydrossis DSM 1100.
  • 6. An oligonucleotide sequence for identifying Nocardia sp., comprising: SEQ ID No. 7, SEQ ID No. 8, the complementary sequences thereof or derivatives thereof, wherein the derivative is 5′ and/or 3′ end of the sequence SEQ ID No. 7 or 8 with at least one thymidine residue added or is 5′ and/or 3′ end of the sequence SEQ ID No. 7 or 8 with one or two nucleotides added or deleted and Nocardia sp. comprises Nocardia sp. BCRC 15149, Nocardia sp. BCRC 15708 or Nocardia sp. BCRC 15709.
  • 7. An oligonucleotide sequence for identifying Nocardia amarae, comprising: SEQ ID No. 9, SEQ ID No. 10, the complementary sequences thereof or derivatives thereof, wherein the derivative is 5′ and/or 3′ end of the sequence SEQ ID No. 9 or 10 with at least one thymidine residue added or is 5′ and/or 3′ end of the sequence SEQ ID No. 9 or 10 with one or two nucleotides added or deleted.
  • 8. The oligonucleotide sequence for identifying Nocardia amarae as claimed in claim 7, wherein Nocardia amarae comprises Nocardia amarae BCRC 13728 or Nocardia amarae DSM 43391.
  • 9. An oligonucleotide sequence for identifying Thiothrix sp., comprising: SEQ ID No. 1, SEQ ID No. 12, the complementary sequences thereof or derivatives thereof, wherein the derivative is 5′ and/or 3′ end of the sequence SEQ ID No. 11 or 12 with at least one thymidine residue added or is 5′ and/or 3′ end of the sequence SEQ ID No. 11 or 12 with one or two nucleotides added or deleted and Thiothrix sp. comprises Thiothrix sp. DSM 12730.
  • 10. An oligonucleotide sequence for identifying Thiothrix eikelboomii, comprising: SEQ ID No. 13, SEQ ID No. 14, the complementary sequences thereof or derivatives thereof, wherein the derivative is 5′ and/or 3′ end of the sequence SEQ ID No. 13 or 14 with at least one thymidine residue added or is 5′ and/or 3′ end of the sequence SEQ ID No. 13 or 14 with one or two nucleotides added or deleted.
  • 11. The oligonucleotide sequence for identifying Thiothrix eikelboomii as claimed in claim 10, wherein Thiothrix eikelboomii comprises Thiothrix eikelboomii ATCC 49788.
  • 12. An oligonucleotide sequence for identifying Sphaerotilus nalans, comprising: SEQ ID No. 15, SEQ ID No. 16, the complementary sequences thereof or derivatives thereof, wherein the derivative is 5′ and/or 3′ end of the sequence SEQ ID No. 15 or 16 with at least one thymidine residue added or is 5′ and/or 3′ end of the sequence SEQ ID No. 15 or 16 with one or two nucleotides added or deleted.
  • 13. The oligonucleotide sequence for identifying Sphaerotilus natans as claimed in claim 10, wherein Sphaerotilus nalans comprises Sphaerotilus nalans DSM 565, Sphaerotilus natans DSM 5675 or Sphaerotilus natans BCRC 10775.
  • 14. A DNA chip for identifying filamentous microorganisms, including a substrate and a plurality of probes, wherein the probe comprises SEQ ID No. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, complementary sequences thereof, derivatives thereof or combinations thereof. The derivative is 5′ and/or 3′ end of the sequence SEQ ID No. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 with at least one thymidine residue or added is 5′ and/or 3′ end of the sequence SEQ ID No. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 with one or two nucleotides added or deleted.
  • 15. The DNA chip for identifying filamentous microorganisms as claimed in claim 14, wherein a number of the thymidine residue is 5-15.
  • 16. The DNA chip for identifying filamentous microorganisms as claimed in claim 14, wherein SEQ ID No. 1, SEQ ID No. 2, the complementary sequences thereof and/or derivatives thereof are/is for identifying Leucothrix mucor.
  • 17. The DNA chip for identifying filamentous microorganisms as claimed in claim 14, wherein SEQ ID No. 3, SEQ ID No. 4, the complementary sequences thereof and/or derivatives thereof are/is for identifying Leucothrix sp. and Leucothrix sp. comprises Leptothrix sp. LMG 9068 and Leptothrix sp. LMG 9069.
  • 18. The DNA chip for identifying filamentous microorganisms as claimed in claim 14, wherein SEQ ID No. 5, SEQ ID No. 6, the complementary sequences thereof and/or derivatives thereof are/is for identifying Haliscomenobacter hydrossis.
  • 19. The DNA chip for identifying filamentous microorganisms as claimed in claim 14, wherein SEQ ID No. 7, SEQ ID No. 8, the complementary sequences thereof and/or derivatives thereof are/is for identifying Nocardia sp. and Nocardia sp. comprises Nocardia sp. BCRC 15149, Nocardia sp. BCRC 15708 and Nocardia sp. BCRC 15709.
  • 20. The DNA chip for identifying filamentous microorganisms as claimed in claim 14, wherein SEQ ID No. 9, SEQ ID No. 10, the complementary sequences thereof and/or derivatives thereof are/is for identifying Nocardia amarae.
  • 21. The DNA chip for identifying filamentous microorganisms as claimed in claim 14, wherein SEQ ID No. 11, SEQ ID No. 12, the complementary sequences thereof and/or derivatives thereof are/is for identifying Thiothrix sp. and Thiothrix sp. comprises Thiothrix sp. DSM 12730.
  • 22. The DNA chip for identifying filamentous microorganisms as claimed in claim 14, wherein SEQ ID No. 13, SEQ ID No. 14, the complementary sequences thereof and/or derivatives thereof are/is for identifying Thiothrix eikelboomii.
  • 23. The DNA chip for identifying filamentous microorganisms as claimed in claim 14, wherein SEQ ID No. 15, SEQ ID No. 16, the complementary sequences thereof and/or derivatives thereof are/is for identifying Sphaerotilus natans.
  • 24. The DNA chip for identifying filamentous microorganisms as claimed in claim 14, wherein the substrate comprises nylon membrane, glass, cellulose nitrate membrane or plastic.
  • 25. A method for identifying filamentous microorganisms causing sludge bulking, comprising: (a) extracting a DNA having a 16S-23S ribosomal DNA intergenic spacer region sequence of a filamentous microorganism which is to be identified;(b) amplifying the 16S-23S ribosomal DNA intergenic spacer region sequence by a pair of universal primers(c) letting the 16S-23S ribosomal DNA intergenic spacer region sequence amplified in step (b) hybridize with the DNA chip for identifying filamentous microorganisms claimed in claim 14; and(d) observing which probe of the DNA chip the 16S-23S ribosomal DNA intergenic spacer region sequence amplified in step (b) is hybridized with to identify the microorganism which is to be identified.
Priority Claims (1)
Number Date Country Kind
96150262 Dec 2007 TW national