Patent Application
20190338294
This invention relates generally to the field of yeast genetics.
The yeast Saccharomyces cerevisiae is the premiere eukaryote for biotechnology, and the first to be sequenced. The organism benefits from the powerful genetic tools available to reveal gene functions, such as various mutant libraries, including the gene knockout collection and the overexpression collection that utilizes the intrinsic GAL1 promoter (GAL1pr) as a means to individually express genes at a high level. However, the popular GAL1pr has some potential disadvantages because it a) requires a high concentration of galactose to induce expression, b) leads to slow growth relative to glucose medium, and c) may affect fundamental metabolism in a manner unrelated to the overexpressed gene product. Furthermore, being able to regulate different pathways independently in the same cell requires a series of distinct orthogonal promoter systems, each activated or repressed by its own ligand. As such, prior to the invention described herein, there was a pressing need to develop a palette of diverse chemically regulated promoters.
The invention is based, at least in part, on the surprising identification of orthogonal transcriptional switches derived from Tet repressor homologs for Saccharomyces cerevisiae regulated by 2,4-diacetylphloroglucinol (DAPG) and other ligands. Accordingly, described herein is a unique system regulated by DAPG, cumic acid, and other ligands, which systems are orthogonal (i.e., no cross-talk) to previously described Tet and camphor regulated systems.
Provided herein is a system for regulating gene expression in yeast comprising a repressible gene expression construct (e.g., plasmid) comprising a regulator binding sequence and a target gene sequence, wherein the regulator binding sequence comprises a phlO nucleic acid sequence; and a transcriptional activator expression construct (e.g., plasmid) comprising a phlF nucleic acid sequence, wherein the transcriptional activator binds to the regulator binding sequence in the absence of 2,4-diacetylphloroglucinol (DAPG) and wherein binding of the transcriptional activator to the regulator binding sequence is inhibited in the presence of DAPG.
In some cases, binding of the regulator binding sequence to the transcriptional activator in the absence of DAPG results in expression of the target gene sequence downstream from the regulator binding sequence. In this case, the repressible gene expression construct further comprises a transcription terminator sequence. For example, the transcriptional terminator sequence is located upstream of the regulator binding sequence. A person of ordinary skill in the art would recognize that the term “upstream” in this case means that the terminator sequence is placed before the regulator binding sequence. Optionally, the transcriptional terminator sequence comprises a nucleic acid sequence encoding alcohol dehydrogenase 1 (ADH1). In some cases, the regulator binding sequence comprises at least one copy of a nucleic acid sequence of phlO, wherein the sequence of phlO comprises SEQ ID NO: 3, e.g., at least two copies, at least three copies, at least four copies, at least five copies, at least six copies, at least seven copies, at least eight copies, at least nine copies, or at least ten copies of a nucleic acid sequence of phlO. In one aspect, the repressible gene expression construct further comprises a promoter downstream from the regulator binding sequence, i.e., the promoter is placed after the regulator binding sequence. Optionally, the promoter downstream from the regulator binding sequence lacks an upstream activating sequence. For example, the promoter downstream from the regulator binding sequence comprises a cytochrome c isoform 1 (CYC1) promoter.
In one aspect, the transcription enhancer expression construct comprises a nucleic acid sequence encoding PhlF operatively connected to a transcriptional activation domain to form PhlTA. Optionally, the transcriptional activation domain comprises at least one VP16 tandem repeat, e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten VP16 tandem repeats. In some cases, the transcription enhancer expression construct further comprises a nuclear localization signal (NLS). In some cases, the NLS is derived from SV40. In one aspect, the transcription enhancer expression construct further comprises a promoter sequence comprising the human cytomegalovirus promoter (CMV).
In other cases, the binding of the regulator binding sequence to the transcriptional activator in the absence of DAPG results in inhibition of expression of the target gene sequence downstream from the regulator binding sequence. In one aspect, the regulator binding sequence comprises at least one copy of a nucleic acid sequence of phlO, wherein the sequence of phlO comprises SEQ ID NO: 3, e.g., at least two copies, at least three copies, at least four copies, at least five copies, at least six copies, at least seven copies, at least eight copies, at least nine copies, or at least ten copies of a nucleic acid sequence of phlO. Optionally, the repressible gene expression construct further comprises a promoter upstream of the regulator binding sequence. For example, the promoter upstream of the regulator binding sequence comprises an ADH1 promoter (ADH1pr). In some cases, the transcription enhancer expression construct comprises a nucleic acid sequence encoding a PhlF transcription regulator domain operatively linked to a nuclear localization signal (NLS) domain. In one aspect, the transcription enhancer expression construct further comprises a promoter sequence comprising the glyceraldehyde-3-phosphate dehydrogenase 1 promoter (TDH1pr).
Also provided is a recombinantly engineered cell comprising a repressible gene expression construct comprising a regulator binding sequence and a target gene sequence, wherein the regulator binding sequence comprises a phlO nucleic acid sequence; and a transcriptional activator expression construct comprising a phlF nucleic acid sequence. In some cases, the presence of DAPG inhibits expression of the target gene sequence. In other cases, the presence of DAPG induces expression of the target gene sequence. For example, the cell comprises a Saccharomyces cerevisiae cell.
Transcription enhancer expression constructs comprising a nucleic acid sequence encoding a PhlF transcription regulator domain operatively linked to a transcriptional activation domain to form phlTA is also provided. Described herein are recombinantly expressed transcriptional enhancers comprising a PhlF transcription regulator domain and a transcriptional activator domain, wherein the transcriptional activator domain comprises VP16.
An exemplary nucleic acid sequence for the transcription enhancer expression construct for the DAPG-OFF system (PhlTA; PhlF-VP16 in pSIB337) is provided below (1-600, PhlF; 601-726, VP16; 727-729, stop codon; SEQ ID NO: 9):
An exemplary amino acid sequence for the transcription enhancer expression construct for the DAPG-OFF system (PhlTA; PhlF-VP16 in pSIB337) is provided below (SEQ ID NO: 10):
Optionally, the recombinantly expressed transcriptional enhancers further comprise an NLS domain.
Also described herein are transcription enhancer expression constructs comprising a nucleic acid sequence encoding a PhlF transcription regulator domain operatively linked to a nuclear localization signal (NLS) domain.
An exemplary nucleic acid sequence for the transcription enhancer expression construct for the DAPG-ON system (NLS-PhlF in pSIB921) is provided below (1-24, NLS from SV40; 25-621, PhlF; 622-624, STOP codon; SEQ ID NO: 11):
An exemplary amino acid sequence for the transcription enhancer expression construct for the DAPG-ON system (NLS-PhlF in pSIB921) is provided below (SEQ ID NO: 12):
Provided are recombinantly expressed transcriptional enhancers comprising a PhlF transcription regulator domain and an NLS domain.
Also provided are repressible gene expression constructs comprising a regulator binding sequence and a target gene sequence, wherein the regulator binding sequence is capable of binding a PhlF transcriptional regulator in the absence of DAPG. In some cases, binding of the regulator binding sequence to the PhlF transcriptional regulator leads to expression of the target gene downstream from the regulator binding sequence.
An exemplary nucleic acid sequence for the repressible gene expression construct for the DAPG-OFF system (PhlPr; ADH1tr-phlF operator-CYC1pr in PSIB918) is provided below (1-203, ADH1 transcriptional terminator; 215-494, phlF operator; 507-653, CYC1 promoter; SEQ ID NO: 13):
An exemplary regulator binding sequence (core) bound by PhlTA (PhlF-VP16) placed between the terminator and the UAS-less promoter (e.g., ADH1tr and CYC1pr) is provided below (SEQ ID NO: 14):
In other cases, binding of the regulator binding sequence to the PhlF transcriptional regulator leads to inhibition of expression of the target gene downstream from the regulator binding sequence.
An exemplary nucleic acid sequence for the repressible gene expression construct for the DAPG-ON system (ADHphO2 in pSIB924; ADH1pr-phlF operator double) is provided below (SEQ ID NO: 15):
In one aspect, the regulator binding sequence (core and its flanking region; SEQ ID NO: 16) is doubled in SEQ ID NO: 15, i.e., SEQ ID NO: 15 (positions 693-732) contains double copies of SEQ ID NO: 16. SEQ ID NO: 16 is set forth below:
In one aspect, SEQ ID NO: 15 (amino acid positions 693-732) contains double copies of the regulator binding sequence (core and its flanking region) SEQ ID NO: 16.
Systems for expression control of at least two peptide molecules comprise a first peptide molecule expressed under control of a first repressible promoter; and a second peptide molecule expressed under control of a transcriptional activator comprising a PhlF transcription regulator domain and a transcriptional activation domain, wherein the at least two peptide molecules are capable of being expressed in a eukaryotic cell. For example, the system is expressed in an S. cerevisiae cell.
Systems for regulating gene expression in yeast comprise a repressible gene expression construct (e.g., plasmid) comprising a regulator binding sequence and a target gene sequence, wherein the regulator binding sequence is capable of binding a CymR transcriptional regulator; and a transcriptional activator expression construct (e.g., plasmid) comprising a cymR nucleic acid sequence, wherein the transcriptional activator binds to the regulator binding sequence in the absence of p-comate and wherein transcriptional activator binding to the regulator binding sequence is inhibited in the presence of p-cumate.
An exemplary nucleic acid sequence for the transactivator construct for the cumate-OFF system (cymTA in pSIB470; NLS-CymR-VP16) is provided below (1-24, NLS(SV40); 25-633, CymR; 634-759, VP16; 760-762, Stop codon; SEQ ID NO: 17):
An exemplary amino acid sequence for the transactivator construct for the cumate-OFF system (cymTA in pSIB470; NLS-CymR-VP16) is provided below (SEQ ID NO: 18):
An exemplary nucleic acid sequence for the promoter construct for the cumate-OFF system (cymPR; ADH1tr-cymR operator-CYC1pr) is provided below (1-203, ADH1 transcriptional terminator; 208-417, label=cymR operator; 419-564, CYC1 promoter; SEQ ID NO: 19):
Exemplary regulator binding nucleic acid sequences are provided below (Mullick et al., 2006 BMC Biotechnology, 6:43, incorporated herein by reference):
Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention belongs. The following references provide one of skill with a general definition of many of the terms used in this invention: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, the following terms have the meanings ascribed to them below, unless specified otherwise.
By “alteration” is meant an increase or decrease. An alteration may be by as little as 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, or by 40%, 50%, 60%, or even by as much as 75%, 80%, 90%, or 100%. An alteration may be a change in sequence relative to a reference sequence or a change in expression level, activity, or epigenetic marker.
By “agent” is meant any small molecule chemical compound, antibody, nucleic acid molecule, or polypeptide, or fragments thereof.
By “binding to” a molecule is meant having a physicochemical affinity for that molecule.
The transitional term “comprising,” which is synonymous with “including,” “containing,” or “characterized by,” is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. By contrast, the transitional phrase “consisting of” excludes any element, step, or ingredient not specified in the claim. The transitional phrase “consisting essentially of” limits the scope of a claim to the specified materials or steps “and those that do not materially affect the basic and novel characteristic(s)” of the claimed invention.
By “control” or “reference” is meant a standard of comparison. As used herein, “changed as compared to a control” sample or subject is understood as having a level that is statistically different than a sample from a normal, untreated, or control sample. Control samples include, for example, cells in culture, one or more laboratory test animals, or one or more human subjects. Methods to select and test control samples are within the ability of those in the art. An analyte can be a naturally occurring substance that is characteristically expressed or produced by the cell or organism (e.g., an antibody, a protein) or a substance produced by a reporter construct (e.g, β-galactosidase or luciferase). Depending on the method used for detection, the amount and measurement of the change can vary. Determination of statistical significance is within the ability of those skilled in the art, e.g., the number of standard deviations from the mean that constitute a positive result.
As used herein, “detecting” and “detection” are understood that an assay performed for identification of a specific analyte in a sample, e.g., an antigen in a sample or the level of an antigen in a sample. The amount of analyte or activity detected in the sample can be none or below the level of detection of the assay or method.
By “effective amount” is meant the amount of a required to ameliorate the symptoms of a disease relative to an untreated patient. The effective amount of active compound(s) used to practice the present invention for therapeutic treatment of a disease varies depending upon the manner of administration, the age, body weight, and general health of the subject. Ultimately, the attending physician or veterinarian will decide the appropriate amount and dosage regimen. Such amount is referred to as an “effective” amount.
The term “polynucleotide” or “nucleic acid” as used herein designates mRNA, RNA, cRNA, cDNA or DNA. As used herein, a “nucleic acid encoding a polypeptide” is understood as any possible nucleic acid that upon (transcription and) translation would result in a polypeptide of the desired sequence. The degeneracy of the nucleic acid code is well understood. Further, it is well known that various organisms have preferred codon usage, etc. Determination of a nucleic acid sequence to encode any polypeptide is well within the ability of those of skill in the art.
As used herein, “isolated” or “purified” when used in reference to a polypeptide means that a polypeptide or protein has been removed from its normal physiological environment (e.g., protein isolated from plasma or tissue, optionally bound to another protein) or is synthesized in a non-natural environment (e.g., artificially synthesized in an in vitro translation system or using chemical synthesis). Thus, an “isolated” or “purified” polypeptide can be in a cell-free solution or placed in a different cellular environment (e.g., expressed in a heterologous cell type). The term “purified” does not imply that the polypeptide is the only polypeptide present, but that it is essentially free (about 90-95%, up to 99-100% pure) of cellular or organismal material naturally associated with it, and thus is distinguished from naturally occurring polypeptide. Similarly, an isolated nucleic acid is removed from its normal physiological environment. “Isolated” when used in reference to a cell means the cell is in culture (i.e., not in an animal), either cell culture or organ culture, of a primary cell or cell line. Cells can be isolated from a normal animal, a transgenic animal, an animal having spontaneously occurring genetic changes, and/or an animal having a genetic and/or induced disease or condition. An isolated virus or viral vector is a virus that is removed from the cells, typically in culture, in which the virus was produced. By “isolated nucleic acid” is meant a nucleic acid that is free of the genes which flank it in the naturally-occurring genome of the organism from which the nucleic acid is derived. The term covers, for example: (a) a DNA which is part of a naturally occurring genomic DNA molecule, but is not flanked by both of the nucleic acid sequences that flank that part of the molecule in the genome of the organism in which it naturally occurs; (b) a nucleic acid incorporated into a vector or into the genomic DNA of a prokaryote or eukaryote in a manner, such that the resulting molecule is not identical to any naturally occurring vector or genomic DNA; (c) a separate molecule such as a synthetic cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment; and (d) a recombinant nucleotide sequence that is part of a hybrid gene, i.e., a gene encoding a fusion protein. Isolated nucleic acid molecules according to the present invention further include molecules produced synthetically, as well as any nucleic acids that have been altered chemically and/or that have modified backbones. For example, the isolated nucleic acid is a purified cDNA or RNA polynucleotide. Isolated nucleic acid molecules also include messenger ribonucleic acid (mRNA) molecules.
As used herein, “kits” are understood to contain at least one non-standard laboratory reagent for use in the methods of the invention in appropriate packaging, optionally containing instructions for use. The kit can further include any other components required to practice the method of the invention, as dry powders, concentrated solutions, or ready to use solutions. In some embodiments, the kit comprises one or more containers that contain reagents for use in the methods of the invention; such containers can be boxes, ampules, bottles, vials, tubes, bags, pouches, blister-packs, or other suitable container forms known in the art. Such containers can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding reagents.
The term “gene” refers to a segment of deoxyribonucleic acid that encodes a polypeptide including the upstream and downstream regulatory sequences. Specifically, the term gene includes the promoter region upstream of the gene.
By “germline nucleic acid residue” is meant the nucleic acid residue that naturally occurs in a germline gene encoding a constant or variable region. “Germline gene” is the DNA found in a germ cell (i.e., a cell destined to become an egg or in the sperm). A “germline mutation” refers to a heritable change in a particular DNA that has occurred in a germ cell or the zygote at the single-cell stage, and when transmitted to offspring, such a mutation is incorporated in every cell of the body. A germline mutation is in contrast to a somatic mutation which is acquired in a single body cell. In some cases, nucleotides in a germline DNA sequence encoding for a variable region are mutated (i.e., a somatic mutation) and replaced with a different nucleotide.
By “fragment” is meant a portion of a polypeptide or nucleic acid molecule. This portion contains, preferably, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the entire length of the reference nucleic acid molecule or polypeptide. For example, a fragment may contain 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides or amino acids. However, the invention also comprises polypeptides and nucleic acid fragments, so long as they exhibit the desired biological activity of the full length polypeptides and nucleic acid, respectively. A nucleic acid fragment of almost any length is employed. For example, illustrative polynucleotide segments with total lengths of about 10,000, about 5000, about 3000, about 2,000, about 1,000, about 500, about 200, about 100, about 50 base pairs in length (including all intermediate lengths) are included in many implementations of this invention. Similarly, a polypeptide fragment of almost any length is employed. For example, illustrative polypeptide segments with total lengths of about 10,000, about 5,000, about 3,000, about 2,000, about 1,000, about 5,000, about 1,000, about 500, about 200, about 100, or about 50 amino acids in length (including all intermediate lengths) are included in many implementations of this invention.
“Obtaining” is understood herein as manufacturing, purchasing, or otherwise coming into possession of.
As used herein, “operably linked” is understood as joined, preferably by a covalent linkage, e.g., joining an amino-terminus of one peptide, e.g., expressing an enzyme, to a carboxy terminus of another peptide, e.g., expressing a signal sequence to target the protein to a specific cellular compartment; joining a promoter sequence with a protein coding sequence, in a manner that the two or more components that are operably linked either retain their original activity, or gain an activity upon joining such that the activity of the operably linked portions can be assayed and have detectable activity, e.g., enzymatic activity, protein expression activity.
The term “promoter” or “promoter region” refers to a minimal sequence sufficient to direct transcription or to render promoter-dependent gene expression that is controllable for cell-type specific or tissue-specific gene expression, or is inducible by external signals or agents. Promoters may be located in the 5′ or 3′ regions of the gene. In general, a promoter includes, at least, 50, 75, 100, 125, 150, 175, 200, 250, 300, 400, 500, 750, 1000, 1500, or 2000 nucleotides upstream of a given coding sequence. One of skill in the art will appreciate that a promoter location may vary outside these parameters for some genes, and also that some genes may comprise more than one promoter (e.g., multiple tissue specific promoters).
As used herein, “plurality” is understood to mean more than one. For example, a plurality refers to at least two, three, four, five, or more.
A “polypeptide” or “peptide” as used herein is understood as two or more independently selected natural or non-natural amino acids joined by a covalent bond (e.g., a peptide bond). A peptide can include 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more natural or non-natural amino acids joined by peptide bonds. Polypeptides as described herein include full length proteins (e.g., fully processed proteins) as well as shorter amino acids sequences (e.g., fragments of naturally occurring proteins or synthetic polypeptide fragments). Optionally the peptide further includes one or more modifications such as modified peptide bonds, i.e., peptide isosteres, and may contain amino acids other than the 20 gene-encoded amino acids. The polypeptides may be modified by either natural processes, such as posttranslational processing, or by chemical modification techniques which are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature. Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide. Also, a given polypeptide may contain many types of modifications. Polypeptides may be branched, for example, as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched, and branched cyclic polypeptides may result from posttranslation natural processes or may be made by synthetic methods. Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formulation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, pegylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination. (See, for instance, Proteins, Structure and Molecular Properties, 2nd ed., T. E. Creighton, W.H. Freeman and Company, New York (1993); Posttranslational Covalent Modification of Proteins, B. C. Johnson, ed., Academic Press, New York, pgs. 1-12 (1983); Seifter et al., Meth. Enzymol 182:626-646 (1990); Rattan et al., Ann. N.Y. Acad. Sci. 663:48-62 (1992)).
A “purified” or “biologically pure” protein is sufficiently free of other materials such that any impurities do not materially affect the biological properties of the protein or cause other adverse consequences. That is, a nucleic acid or peptide of this invention is purified if it is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. Purity and homogeneity are typically determined using analytical chemistry techniques, for example, polyacrylamide gel electrophoresis or high performance liquid chromatography. The term “purified” can denote that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. For a protein that can be subjected to modifications, for example, phosphorylation or glycosylation, different modifications may give rise to different isolated proteins, which can be separately purified.
Similarly, by “substantially pure” is meant a nucleotide or polypeptide that has been separated from the components that naturally accompany it. Typically, the nucleotides and polypeptides are substantially pure when they are at least 60%, 70%, 80%, 90%, 95%, or even 99%, by weight, free from the proteins and naturally-occurring organic molecules with they are naturally associated.
The term “reduce” or “increase” is meant to alter negatively or positively, respectively, by at least 5%. An alteration may be by 5%, 10%, 25%, 30%, 50%, 75%, or even by 100%.
A “sample” as used herein refers to a biological material that is isolated from its environment (e.g., blood or tissue from an animal, cells, or conditioned media from tissue culture) and is suspected of containing, or known to contain an analyte, such as a protein. A sample can also be a partially purified fraction of a tissue or bodily fluid. A reference sample can be a “normal” sample, from a donor not having the disease or condition fluid, or from a normal tissue in a subject having the disease or condition. A reference sample can also be from an untreated donor or cell culture not treated with an active agent (e.g., no treatment or administration of vehicle only). A reference sample can also be taken at a “zero time point” prior to contacting the cell or subject with the agent or therapeutic intervention to be tested or at the start of a prospective study.
A “subject” as used herein refers to an organism. In certain embodiments, the organism is an animal. In certain embodiments, the subject is a living organism. In certain embodiments, the subject is a cadaver organism. In certain preferred embodiments, the subject is a mammal, including, but not limited to, a human or non-human mammal. In certain embodiments, the subject is a domesticated mammal or a primate including a non-human primate. Examples of subjects include humans, monkeys, dogs, cats, mice, rats, cows, horses, goats, and sheep. A human subject may also be referred to as a patient.
A “subject sample” can be a sample obtained from any subject, typically a blood or serum sample, however the method contemplates the use of any body fluid or tissue from a subject. The sample may be obtained, for example, for diagnosis of a specific individual for the presence or absence of a particular disease or condition.
Ranges provided herein are understood to be shorthand for all of the values within the range.
By “reduces” is meant a negative alteration of at least 5%, 10%, 25%, 50%, 75%, or 100%.
Sequence identity is typically measured using sequence analysis software (for example, Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, BLAST, BESTFIT, GAP, or PILEUP/PRETTYBOX programs). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and/or other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. In an exemplary approach to determining the degree of identity, a BLAST program may be used, with a probability score between e−3 and e−100 indicating a closely related sequence.
By “substantially identical” is meant a polypeptide or nucleic acid molecule exhibiting at least 50% identity to a reference amino acid sequence (for example, any one of the amino acid sequences described herein) or nucleic acid sequence (for example, any one of the nucleic acid sequences described herein). Preferably, such a sequence is at least 60%, at least 70%, at least 75%, more preferably 80% or 85%, and more preferably 90%, 95% or even 99% identical to the amino acid or nucleic acid sequence used for comparison.
Unless specifically stated or obvious from context, as used herein, the term “about” is understood as within a range of normal tolerance in the art, for example within 2 standard deviations of the mean. About can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise clear from context, all numerical values provided herein can be modified by the term about.
The recitation of a listing of chemical groups in any definition of a variable herein includes definitions of that variable as any single group or combination of listed groups. The recitation of an embodiment for a variable or aspect herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.
Any compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein.
Unless specifically stated or obvious from context, as used herein, the term “or” is understood to be inclusive. Unless specifically stated or obvious from context, as used herein, the terms “a”, “an”, and “the” are understood to be singular or plural.
The term “vector” is used to describe a nucleic acid molecule capable of expressing a desired peptide or protein construct in a given organism. A recombinant “vector” brings together various elements of the peptide or protein to be expressed, which provides the properties described in this application. In general, vectors used in recombinant DNA techniques arc referred to as “plasmids” or double stranded DNA molecules that arc capable of replicating and utilize the cellular machinery of their host to express their particular target peptide or protein. In some instances, plasmids are used to incorporate a desired gene sequence in a particular site of a chromosome of a eukaryotic cell, such as a S. cerevisiae cell.
Other features and advantages of the invention will be apparent from the following description of the preferred embodiments thereof, and from the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All published foreign patents and patent applications cited herein are incorporated herein by reference. Genbank and NCBI submissions indicated by accession number cited herein are incorporated herein by reference. All other published references, documents, manuscripts and scientific literature cited herein are incorporated herein by reference. In the case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
The invention is based, at least in part, on the surprising identification of a unique promoter regulated by DAPG, cumic acid, and other ligands, which are orthogonal (i.e., no cross talk) to previously described Tet and camphor regulated systems. Accordingly, described herein are orthogonal transcriptional switches derived from Tet repressor homologs for Saccharomyces cerevisiae regulated by 2,4-diacetylphloroglucinol (DAPG) and other ligands.
The yeast Saccharomyces cerevisiae is the premiere eukaryote for biotechnology, and the first to be sequenced (Goffeau et al., 1996 Science, (274)546: 563-567). More recently, the first synthetic eukaryotic chromosomes and chromosome fragments of S. cerevisiae chromosome
synIXR, semi-synVIL, synIII were built through a synthetic yeast genome project, Sc2.0 (Annaluru et al., 2014 Science, 344: 55-58; Dymond et al., 2011 Nature, 477: 471-476). The organism benefits from the powerful genetic tools available to reveal gene functions, such as various mutant libraries, including the gene knockout collection (Giaever et al., 2002 Nature, 418: 387-391) and the overexpression collection that utilizes the intrinsic GAL1 promoter (GAL1pr) as a means to individually express genes at a high level (Gelperin et al., 2005 Genes Dev, 19: 2816-2826). However, the popular GAL1pr has some potential disadvantages because it a) requires a high concentration of galactose to induce expression, b) leads to slow growth relative to glucose medium, and c) may affect fundamental metabolism in a manner unrelated to the overexpressed gene product. Furthermore, being able to regulate different pathways independently in the same cell requires a series of distinct orthogonal promoter systems, each activated or repressed by its own ligand. Thus, as described herein, it is highly desirable to have a palette of diverse chemically regulated promoters.
Another option for regulated expression of genes of interest is to use a synthetic promoter comprised of functional units from other species. The Tet-Off and -On systems are among the most popular expression switches that take advantage of the synthetic promoter. The Tet system is originally from Escherichia coli, in which the transcriptional regulator TetR binds to its operator sequence (tetO) only in the absence of its ligands, such as tetracycline and doxycycline (Ramos et al., 2005 Microbiol. Mol. Biol. Rev., 69: 326-356). Notably, the Tet system can be applied to various species, such as mammalian cells and yeast (Gari et al., 1997 Yeast, 13: 837-848; Lewandoski, M. 2001 Nat. Rev. Genet., 2: 743-755; Urlinger et al., 2000 Proceedings of the National Academy of Sciences U.S.A., 97: 7963-7968). With respect to the key component TetR, there are a vast number of TetR homologs in bacteria and metagenomic samples (Ramos et al., 2005 Microbiol. Mol. Biol. Rev., 69: 326-356; Stanton et al., 2014 Nat. Chem. Biol., 10: 99-105), some of which have well-known operators and ligands. Recently, it was reported that one
of the TetR homologs Pseudomonas putida CamR was utilized for the development of the camphor-Off switch in yeast, analogous to the Tet-Off switch (Ikushima et al., 2015 G3 (Bethesda) 5, 1983-1990). Camphor, the ligand for CamR, prevents binding between CamR and its operator (camO), resulting in camphor-dependent expression of reporter genes under the control of the camO-containing promoter. Moreover, camphor was found to have little impact on yeast growth. On the other hand, an IPTG-On switch is available, and exploits another E. coli repressor, Lad, in yeast (Grilly et al., 2007 Mol. Syst. Biol., 3: 127). Using this system, a reporter gene was activated only in the presence of the Lad ligand IPTG (Isopropyl β-
Similar to the research in yeast, TetR homologs have been developed as switches in heterologous organisms other than yeast. One of them is a 2,4-diacetylphloroglucinol (DAPG)-based switch using phlF gene in bacteria and mammalian cells (Stanton et al., 2014 ACS Synth. Biol., 3: 880-891). The transcriptional repressor PhlF from Pseudomonas fluorescens and related species, known to be a distant homolog of TetR, regulates expression of the DAPG biosynthetic gene phlA in a DAPG-dependent manner (Abbas et al., 2002 J Bacteriol., 184: 3008-3016; Ramette et al., 2011 Appl. Microbiol., 34: 180-188; Schnider-Keel et al., 2000 J Bacteriol, 182: 1215-1225). Besides, other TetR homologs, namely EthR and CymR, have been applied as expression switches in heterologous organisms other than yeast (Eaton, R. W. 1997 J Bacteriol, 179: 3171-3180; Mullick et al., 2006 BMC Biotechnol., 6: 43; Weber et al., 2008 Proceedings of the National Academy of Sciences U.S.A., 105: 9994-9998; Kaczmarczyk et al., 2013 Appl. Environ. Microbiol., 79: 6795-6802).
As described in detail below, TetR homologs were engineered to develop expression switches in yeast. Specifically, described herein are well-behaved switches that depend on DAPG (both off and on) and p-cumate (off). In particular, DAPG showed little effect on yeast growth at working concentrations for the system. Also described herein is the possibility and challenges of developing additional ligand-regulated TetR homolog-based expression switches in yeast.
Accordingly, described herein is the development of tightly regulated expression switches in yeast, by engineering distant homologs of Escherichia coli TetR, including the transcriptional regulator PhlF from Pseudomonas and others. Previous studies demonstrated that the PhlF protein bound its operator sequence (phlO) in the absence of 2,4-diacetylphloroglucinol (DAPG) but dissociated from phlO in the presence of DAPG. Thus, described in detail below is the development of a DAPG-Off system in which expression of a gene preceded by the phlO-embedded promoter was activated by a fusion of PhlF to a multimerized viral activator protein (VP16) domain in a DAPG-free environment but repressed when DAPG was added to growth medium. In addition, a DAPG-On system with the opposite behavior of the DAPG-Off system was constructed, i.e., DAPG triggers the expression of a reporter gene. Exposure of DAPG to yeast cells did not cause any serious deleterious effect on yeast physiology in terms of growth. Efforts to engineer additional Tet repressor homologs were partially successful and a known mammalian switch, the p-cumate switch based on CymR from Pseudomonas, was found to function in yeast. Orthogonality between the TetR (doxycycline), CamR (D-camphor), PhlF (DAPG), and CymR (p-cumate)-based Off switches was demonstrated by evaluating all 4 ligands against suitably engineered yeast strains. This study expands the toolbox of “On-” and “Off-” switches for yeast biotechnology.
The invention provides kits. In one embodiment, the kit includes one or more of the plasmids/constructs described herein, along with any of the ligands described herein, e.g., DAPG. In some embodiments, the kit comprises a sterile container; such containers can be boxes, ampules, bottles, vials, tubes, bags, pouches, blister-packs, or other suitable container forms known in the art. Such containers can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding medicaments.
The instructions may be printed directly on the container (when present), or as a label applied to the container, or as a separate sheet, pamphlet, card, or folder supplied in or with the container.
The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are well within the purview of the skilled artisan. Such techniques are explained fully in the literature, such as, “Molecular Cloning: A Laboratory Manual”, second edition (Sambrook, 1989); “Oligonucleotide Synthesis” (Gait, 1984); “Animal Cell Culture” (Freshney, 1987); “Methods in Enzymology” “Handbook of Experimental Immunology” (Weir, 1996); “Gene Transfer Vectors for Mammalian Cells” (Miller and Calos, 1987); “Current Protocols in Molecular Biology” (Ausubel, 1987); “PCR: The Polymerase Chain Reaction”, (Mullis, 1994); “Current Protocols in Immunology” (Coligan, 1991). These techniques are applicable to the production of the polynucleotides and polypeptides of the invention, and, as such, may be considered in making and practicing the invention. Particularly useful techniques for particular embodiments will be discussed in the sections that follow.
The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the assay, screening, and therapeutic methods of the invention, and are not intended to limit the scope of what the inventors regard as their invention.
The following materials and methods were utilized in the examples described herein.
Yeast strains were cultured in YPD or SD-based medium supplemented with needed nutrients. SC is a fully supplemented medium of SD, and SC lacking three components, such as leucine, histidine, and adenine, is referred to as SC-Leu-His-Ade. The following drugs added to yeast media were purchased from Santa Cruz Biotechnology (Dallas, Tex.); 2,4-diacetylphloroglucinol (DAPG), coumesterol, and gentamicin. The drugs virginiamycin 51, quercetin, 2-benzyl acetate, D-camphor, and G418, were bought from Sigma-Aldrich (St. Louis, Mo.). Doxycycline, p-cumate (p-isopropylbenzoate), and fisetin were purchased from Clontech laboratories (Mountain View, Calif.), System Biosciences (Mountain View, Calif.), and Fisher Scientific (Pittsburgh, Pa.), respectively.
Escherichia coli cells were grown in Luria Broth (LB) medium. Carbenicillin (Sigma-Aldrich), kanamycin (Sigma-Aldrich), chloramphenicol (Sigma-Aldrich), or zeocin (Life Technologies, Carlsbad, Calif.) were used to select bacterial strains that had drug-resistant genes at final concentrations of 75 μg/ml, 50 μg/ml, 20 μg/ml, and 25 μg/ml respectively. Agar was added to 2% for petri plates.
The TOP10 strain of E. coli (F− mcAΔ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(araleu) 7697 galUgalKrpsL (StrR) endA1 nupG) was used for the construction and amplification of plasmids. In this study, plasmids were constructed with previously described methods (Ikushima et al., 2015 G3 (Bethesda) 5, 1983-1990; Agmon et al., 2015 ACS Synth. Biol., 4: 853-859; Mitchell et al., 2013 ACS Synth. Biol., 2: 473-477). The yeast GoldenGate (yGG) assembly method enabled “one-pot” plasmid construction because restriction enzymes and DNA ligase could be combined in a single reaction. The Type IIS restriction enzymes BsaI and BsmBI, were used to yield nonpalindromic sticky ends that ligate with one another in a predetermined order and directionality. The standard overhangs flanked by outward facing BsaI sites of the rfp gene were CAGT or TTTT in acceptor vectors unless otherwise described (Agmon et al., 2015 ACS Synth. Biol., 4: 853-859).
Plasmids used in the study are shown in Table 1. In addition to yGG plasmids of pSIB055, pSIB604, pLM270, and pSIB233 (Ikushima et al., 2015 G3 (Bethesda) 5, 1983-1990; Agmon et al., 2015 ACS Synth. Biol., 4: 853-859), three yGG acceptor vectors were newly constructed as follows. Vectors pSIB230 and pSIB270 are convertible plasmids that can be used as either a centromeric plasmid or an integrative plasmid directed into yeast chromosomes VI or XI. Each has a yeast selection marker of KlURA3 and LEU2, respectively. Plasmid pSIB024 is a centromeric acceptor vector that confers phenotypes of uracil prototrophy (URA3) and resistance to G418. In the yGG assembly, the plasmids above were used with the following yGG components: two promoters, TDH1pr and CMVpr from human cytomegalovirus; three coding sequences (CDS), gfp, ADE2, and the rfp gene that turned the host E. coli cells bright red; two terminators, STR1tr and GSH1tr. All these parts were described previously (Ikushima et al., 2015 G3 (Bethesda) 5, 1983-1990).
In particular, a specialized acceptor vector pSIB918, which is “yGG-ready” for putting any gene under the control of the DAPG-Off system in an integrated state at YKL162c gene with a single transformation, was constructed as follows. First, the rfp gene in the acceptor vector pSIB604 was replaced with the CMVpr, phlTA CDS, and the STR1tr. The resultant plasmid harbored a pair of BsmBI sites at the 5′-side of the CMVpr part to accommodate a second transcription unit cassette, and three DNA fragments, phlPr, rfp, and GSH1tr were ligated in the BsmBI gap to generate pSIB918. Plasmid pSIB927 was built by replacing rfp of pSIB918 with the gfp gene.
A plasmid, pSIB883 was constructed by inserting phlPr, ADE2, and GSH1tr in yGG acceptor vector pSIB230. In order to build pSIB337, the rfp gene in pSIB233 was replaced with the CMVpr, CDS for phlTA, and the STR1tr.
The three parts, a promoter ADHphlO1, ADE2, and GSH1tr, were cloned as a transcription unit into pSIB230 to yield pSIB833. A related plasmid, pSIB924, contains the promoter ADHphlO2 instead of ADHphlO1 of pSIB833. The 2μ plasmid pSIB628 was used as an acceptor vector to build pSIB726, harboring a transcriptional unit consisting of TDH1pr, a nuclear localization signal (NLS)-fused PhlF and the STR1tr.
Two other sets of plasmids were constructed. One set has a promoter corresponding to each of the tetR-homologs' operator in a minimal promoter fragment fused to gfp as a reporter. The other is a group of vectors that constitutively express a transactivator consisting of the TetR homolog and VP16. The DNA sequences for TetR homologs were codon-optimized using GeneDesign (Richardson et al., 2006 Genome Res., 16, 550-556) for expression in yeast.
Yeast strains are listed in Table 2. Strain BY-ADE was constructed by transforming ade2-deficient BY11204 with a PCR fragment containing the wild-type ADE2 amplified with primers SI-589 (5′-TCCACAATCAATTGCGAGAAGC (SEQ ID NO: 1)) and SI-590 (5′-CATTTGTTGGAGGAAAGTTGTCC (SEQ ID NO: 2)) using BY4741 genomic DNA as template, followed by selection of an adenine prototrophic phenotype. The other transformations to integrate the expression cassettes were conducted using DNA fragments prepared from the aforementioned pSIB-series of plasmids, previously digested with NotI.
Cellular fluorescence from GFP was determined by flow-cytometric analysis with a previously described method (Ikushima et al., 2015 G3 (Bethesda) 5, 1983-1990).
One of the TetR homologs, a PhlF-based transcriptional activator, named phlTA, was constructed by fusing Pseudomonas PhlF (GenBank AAF20928.1) to three tandem repeats of a VP16 transcriptional activation domain derived from herpes simplex virus Type 1 (Baron et al., 1997 Nucleic Acids Res., 25: 2723-2729). Here, the CMVpr from human cytomegalovirus was used to drive the appropriate level of phlTA expression.
The promoter used for phlF-dependent expression of a reporter gene was built by embedding seven repeats of the phlF operator sequence (phlO) between the alcohol dehydrogenase ADH1 terminator and a CYC1 (cytochrome c) promoter from which the endogenous UAS (upstream activating sequence) had been removed. The resulting promoter was named phlPr, the architecture of which was analogous to a promoter used in yeast Tet- and Camphor-Off systems (Gari et al., 1997 Yeast, 13: 837-848; Ikushima et al., 2015 G3 (Bethesda) 5, 1983-1990. The unit of the phlF operator used was 5′-TATGTATGATACGAAACGTACCGTATCGTTAAGGTAGCGT (SEQ ID NO: 3; Abbas et al., 2002 J Bacteriol., 184: 3008-3016).
As described herein, the PhlF-derived transcriptional activator, phlTA, binds phlPr to activate transcription of a reporter gene only in the absence of DAPG, the ligand of PhlF, and DAPG ligand binding is predicted to eliminate reporter expression in the presence of DAPG (
The performance of the DAPG-Off system was examined using GFP as a reporter. A yeast transformant, DapG-TA (SIY1001), which had phlTA and the phlPr-gfp reporter, was constructed by integrating plasmid pSIB918 in BY4741 (Table 1 and Table 2). The DapG-TA strain showed significant expression of GFP in the absence of DAPG, unlike control strain BY4741 (
With regards to effects of DAPG on growth, the results presented herein showed that there was little difference in the number of colonies formed in three media types: (a) SC with 24-μM (5-μg/ml) DAPG; (b) SC with 48-μM (10-μg/ml) DAPG; (c) SC without DAPG (
A second reporter gene was used to further assess the performance of the DAPG-Off switch. Here, it was examined whether the ADE2 gene under the control of phlPr complements the adenine-auxotrophy of strain BY11204 in a DAPG-dependent manner (
This study assessed other TetR homologs' ligands and operators previously reported (Table 3): varR (Namwat et al., 2001 J. Bacteriol., 183: 2025-2031), lmrA (Yoshida et al., 2004 J. Bacteriol., 186: 5640-5648; Hirooka et al., 2007 J. Bacteriol., 189: 5170-5182), icaR (Jeng et al., Nucleic Acids Res., 36: 1567-1577), yxaF (Yoshida et al., 2004 J. Bacteriol., 186: 5640-5648; Hirooka et al., 2007 J. Bacteriol., 189: 5170-5182), dhaR (Poelarends et al., 2000 J. Bacteriol., 182: 2191-2199), ethR (Weber et al., 2008 Proceedings of the National Academy of Sciences U.S.A., 105: 9994-9998), and cymR (Eaton, R. W. 1997 J Bacteriol, 179: 3171-3180; Mullick et al., 2006 BMC Biotechnol., 6: 43; Kaczmarczyk et al., 2013 Appl. Environ. Microbiol., 79: 6795-6802). The scheme to evaluate the switch candidates was similar to the DAPG-Off switch. A transcriptional activation domain of VP16 was added to the TetR homologs (transactivator), and operator sequences of them were interposed between the ADH1 terminator and UAS-less CYC1 promoter, followed by the gfp reporter. First, it was observed that all strains which had only the gfp reporter did not express GFP; the strains were then transformed with plasmids to express the corresponding transactivators and expression was evaluated.
Streptomyces
virginae
Bacillus subtilis
Bacillus subtilis
Staphylococcus
epidermidis
Mycobacterium
tuberculosis
Bacillus subtilis
Mycobacterium
Pseudomonas
putida
a)TGTCACTTGTACATCGTATAACTCTCATATACGTTGTAGAACAGTTC (SEQ ID NO: 4) (4 repeats)
b)CTTTCTCCTACAATTATATAGAACGGTCTAGACAAATGAATGATAATATATAGACTGGTCTAAATTGGAGGAAGCGATA (SEQ ID NO: 5)(3 repeats)
c)ACAACCTAACTAACGAAAGGTAGGTGAA (SEQ ID NO: 6) (6 repeats)
d)GTGTCGATAGTGTCGACATCTCGTTGACGGCCTCGACATTACGTTGATAGCGTGG (SEQ ID NO: 7) (5 repeats)
e)AAGATGACCGGTCACCTT (7 repeats)
f)AAGAAAGAAACAAACCAACCTGTCTGTATTATCTC (SEQ ID NO: 8)(6 repeats)
Streptomyces virginiae antibiotic resistance regulator VarR tagged with VP16 induced strong GFP expression both in the absence and presence of the ligand virginiamycin S. This result suggested the hybrid transactivator is active, but virginiamycin may not be stably taken up in yeast cells. On the other hand, expressing a transactivator based on LmrA and VP16 gave rise to no gfp activity in the presence or absence of ligand. Since the fusion protein must enter the nucleus for expression in yeast, a nuclear localization signal (NLS) from SV40 (Kalderon et al., 1984 Cell, 39: 499-509) was added to LmrTA, resulting in strong expression of GFP; however, as in the case of VarR-TA, it was not ligand (quercetin)-responsive. Differently from TetR and PhlF in the Tet- and DAPG-Off systems, these results show that some TetR homologs require an NLS in order to activate transcription while others do not. The TetR homologs IcaR and EthR also showed solid ligand-independent GFP fluorescence with gentamicin and 2-benzyl acetate respectively. EthR was previously reported as a useful switch in mammalian cells (Weber et al., 2008 Proceedings of the National Academy of Sciences U.S.A., 105: 9994-9998), but tight regulation of the switch could not be achieved in yeast. The reason behind residual gfp expression in the presence of the ligands remains unclear, but the amount of ligand able to penetrate yeast cell envelopes may not be sufficient to thoroughly prevent transactivator from binding to the operators. Potentially, the use of pdr5 mutants or other drug-sensitized strains might confer responsiveness to such switches. By contrast, YxaF and DhaR did not confer detectable GFP expression even in the absence of their ligands, even though a NLS was appended. Possible reasons are that either amount of the transactivator expression, or alternatively, the affinity between the transactivators and the operator sequences chosen might be insufficient to induce reporter expression. Finally, CymR, a repressor involved in the p-cymene catabolic pathway in Pseudomonas putida did result in the expected expression profile of the relevant GFP reporter with p-cumate. Thus, one additional off-switch was obtained for yeast; the strain with the appropriate reporter and activator is called CymG-TA.
A series of switches anticipated for use together must be evaluated for orthogonality to maximize their utility. Thereby, four switches of the Tet-Off, Camphor-Off, DAPG-Off, and Cumate-Off systems were evaluated. When four strains that contained the switches independently were cultured in the absence and presence of the four ligands (doxycycline, camphor, DAPG, cumate), the intensity of reporter GFP fluorescence decreased to the background level only in the presence of the appropriate ligands, whereas in the presence of the inappropriate ligands, a strong GFP signal was observed, similar to that observed in the absence of any ligands (
Next, On-switches that make it possible to induce expression of a gene of interest by ligand treatment were developed. In particular, a DAPG-On system based on the native transcriptional regulator and a phlO-containing promoter was developed. Here, a single and double repeat of phlO sequences were embedded downstream of the ADH1 promoter (ADH1pr) to build ADHphlO1 and ADHphlO2, leading to constitutive reporter expression in the absence of the transcriptional regulator. The two promoters were analogous in design to the ADHi promoter, which carries a single copy of the lac operator downstream of the ADH1pr (Grilly et al., 2007 Mol. Syst. Biol., 3: 127). Next, a transcriptional regulator consisting of NLS and PhlF was constructed. As shown in
The performance of the DAPG-On system was assessed using ADE2 as a reporter in the ade2Δ BY11204 strain. When PhlF was not expressed in a strain that had the ADHphlOx-ADE2 cassette, the strain, named AphOx-2μEmV, grew in adenine-deficient medium irrespective of DAPG addition as well as in adenine-containing medium (
Expression switches that can be regulated with small compounds are widely used in biology-related studies. The Tet-Off and -On systems are among the most popular switches because of their advantages, e.g., tight regulation and ease of handling, but the number of such ligand regulated switches is very limited. Thus, more and better switches would enable more options to control gene expression.
Described herein is the assessment of seven TetR homologs to develop transcription switches in yeast, resulting in switches based on two TetR homologs, PhlF and CymR. They were named DAPG-Off, DAPG-On, and Cumate-Off switches in which DAPG or p-cumate prevented or triggered the expression of a reporter gene such as gfp and ADE2 at a concentration. As described herein, the Cumate-Off switch is further evaluated for reversion and performance with an auxotrophic reporter. However, most importantly, the two switches showed robust orthogonality to other useful switches such as the Tet- and camphor switches. These switches expand the repertoire of regulated gene expression in yeast (Table 4). On the other hand, this study did not yield controllable switches in the case of five other TetR homologs including EthR, which has been shown to work as a switch in mammalian cells. Thus, not all TetR homologs are directly applicable for use as a high performing expression switch in yeast.
In the development of the DAPG-On switch, it was speculated that a DAPG-On switch could be constructed by mutating phlTA, fusion of PhlF and triple repeats of VP16, because the transactivators of the Tet-On and Cumate-On switches (named rev-tTA) could be isolated from multiple missense mutants of the transactivators used in the Tet-Off and Cumate-Off systems, VP16-tethered TetR or CymR, respectively. In fact, it was confirmed that the Tet-On switch a transactivator based on the 5-amino acid residue TetR variant named rtTA-M2 (Urlinger et al., 2000 Proceedings of the National Academy of Sciences U.S.A., 97: 7963-7968) showed doxycycline-dependent GFP expression in the opposite manner to the Tet-Off system in yeast. However, such a mutant with opposite behavior to the DAPG-Off system was not isolated. In this study, another way to develop the DAPG-On system was developed in which the binding of PhlF to the operator could sterically prevent the transcription of a reporter gene, resulting in relatively tight regulation of the ADE2 reporter (
As an alternative strategy, other sources are identified for constructing a Compound-On switch. Notably, in natural environments, there is another type of TetR homolog that binds to an operator preferentially in the presence of a specific ligand. As described herein, those proteins are made use of as a kind of “natural” rev-tTA. Many quorum-sensing (QS) molecules that function as transcriptional regulators are known (Safari et al., 2014 Appl. Microbiol. Biotechnol., 98: 3401-3412). Interestingly, the binding of a TetR homolog, such as LuxR and TraR, to an operator sequence is triggered with a QS molecule. Prior to the invention described herein, a functional switch has not been obtained using the QS-related transactivators. However, a QS molecule-On switch is constructed from a number of QS-related TetR homologs. Additional transcriptional switches are developed using TetR homologs as a great tool in biotechnology.
An additional description of plasmids listed in Table 4 is provided below.
DAPG-Off System: pSIB918, pSIB289, and pSIB153
All three plasmids were constructed in this study: pSIB918 was referred to in Table 1. pSIB289 and pSIB153 were used to build pSIB918. The sequences for the DAPG-Off system are provided above.
Tet-Off System: pSIB498, pSIB009, and pSIB022
Plasmids pSIB009 and pSIB022 provided elements of the “transactivator” and “operator-embedded promoter” to construct pSIB498, and all three plasmids were prepared previously but the names were not mentioned as such (Ikushima et al., 2015 G3 (Bethesda), Vol. 5 (10), 1983-1990, incorporated herein by reference). In particular, pSIB498 is the most generally useful yeast GoldenGate-ready acceptor vector carrying the Tet-Off switch. Plasmid pSIB527 shown in the article was constructed by replacing rfp gene of pSIB498 with gfp gene.
An exemplary nucleic acid sequence for tTA (tetR-VP16) in pSIB498 for the Tet-Off system is provided below (1-618, label=TetR; 619-744, VP16; 745-747, Stop codon; SEQ ID NO: 22):
An exemplary amino acid sequence for tTA (tetR-VP16) in pSIB498 for the Tet-Off system is provided below (SEQ ID NO: 23):
An exemplary nucleic acid sequence for tetOpr (ADH1tr-tetO operator-CYC1pr) in pSIB498 for the Tet-Off system is provided below (1-203, ADH1 transcriptional terminator; 216-508, tetR operator; 521-667, CYC1 promoter; SEQ ID NO: 24):
Camphor-Off System: pSIB859, pSIB477, and pSIB396
As was the case with the Tet-Off switch plasmids above, pSIB477 and pSIB396 provided elements of “transactivator” and “operator-embedded promoter” parts for pSIB859, and all the three plasmids were prepared previously (Ikushima et al., 2015 G3 (Bethesda), Vol. 5 (10), 1983-1990, incorporated herein by reference). Particularly, pSIB859 is the most generally useful yeast GoldenGate-ready acceptor vector carrying the Camphor-Off switch. Accordingly, this plasmid was used to construct pSIB872 described herein.
An exemplary nucleic acid sequence for camTA (camR-VP16-NLS) in pSIB859 for the Camphor-Off system is provided below (1-558, CamR (Pseudomonas putida); 559-684, VP16; 685-708, NLS (SV40); 709-711, Stop codon; SEQ ID NO: 25):
An exemplary amino acid sequence for camTA (camR-VP16-NLS) in pSIB859 for the Camphor-Off system is provided below (SEQ ID NO: 26):
An exemplary nucleic acid sequence for camPR (ADH1tr-camR operator-CYC1pr) for the Camphor-Off system is provided below (1-203, ADH1 transcriptional terminator; 208-430, camR operator; 432-574, CYC1 promoter; SEQ ID NO: 27):
Cumate-Off System: pSIB665 and pSIB795
Plasmids pSIB665 and pSIB795 were constructed herein. They provided the “transactivator” and “operator-embedded promoter” parts for pSIB470 and pSIB803, respectively.
DAPG-on System: pSIB199 and pSIB916
Plasmids pSIB199 and pSIB916 were constructed herein. They provided “transactivator” and “operator-embedded promoter” parts for pSIB470 and pSIB803, respectively.
Tet-on System: pSIB499, pSIB010, and pSIB022
Plasmids pSIB010 and pSIB022 provided “transactivator” and “operator-embedded promoter” parts for pSIB499. Specifically, pSIB499 is the most generally useful yeast GoldenGate-ready acceptor vector specialized for the Tet-On system in which the transactivator is the TetR variant with alteration of 5-amino acids (S12G E19G A56P D148E H179R), known as “rtTA-M2” (Urlinger et al., 2000 Proc. Natl. Acad. Sci. USA., Vol. 97 (14), 7963-7968, incorporated herein by reference).
The rtTA acts in the opposite manner against tTA of the Tet-Off system. The present study yielded BY4741-derived transformants with a plasmid that harbored gfp gene in the position of rfp of pSIB499. Only background GFP fluorescence was observed in the absence of doxycycline, while GFP significantly expressed in the presence of more than 10-μM doxycycline.
An exemplary nucleic acid sequence for rtTA (tetR mutant-VP16) in pSIB499 for the Tet-On system is provided below (1-618, mutated TetR; 619-744, VP16; 745-747, Stop codon; SEQ ID NO: 28):
An exemplary amino acid sequence for rtTA (tetR-VP16) in pSIB499 for the Tet-On system is provided below (SEQ ID NO: 29):
The tetOpr (ADH1tr-teto operator CYC1pr) in pSI499 is identical to tetOpr (ADH1tr-tetO operator-CYC1pr) in pSIB498 above.
Common parts for yGG include the following. An exemplary nucleic acid sequence for yGG-TDH1pr in pSIB027 is provided below (12-871, TDH1 promoter; SEQ ID NO: 30):
An exemplary nucleic acid sequence for yGG-mutated CMVpr in pSIB237 is provided below (12-781, mutated CMV promoter; SEQ ID NO: 31):
An exemplary nucleic acid sequence for yGG-ScGSH1tr in pSIB031 is provided below (12-718, GSH1 terminator; SEQ ID NO: 32):
An exemplary nucleic acid sequence for yGG-mutaed STR1tr in pSIB206 is provided below (12-741, mutated STR1; SEQ ID NO: 33):
An exemplary nucleic acid sequence for yGG-SOL3tr in pSIB639 is provided below (12-562, SOL3 terminator; SEQ ID NO: 34):
Common Parts for yGG: pSIB027, pSIB237, pSIB031, pSIB206, and pSIB639
These parts were described previously Ikushima et al., 2015 G3 (Bethesda), Vol. 5 (10), 1983-1990, incorporated herein by reference) and represent “promoter” or “terminator” parts for acceptor vectors in yeast GoldenGate assembly.
Described below are select annotated sequences for the constructs provided herein.
While the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
The patent and scientific literature referred to herein establishes the knowledge that is available to those with skill in the art. All United States patents and published or unpublished United States patent applications cited herein are incorporated by reference. All published foreign patents and patent applications cited herein are hereby incorporated by reference. Genbank and NCBI submissions indicated by accession number cited herein are hereby incorporated by reference. All other published references, documents, manuscripts and scientific literature cited herein are hereby incorporated by reference.
While this invention has been particularly shown and described with references to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims.
The present application claims the benefit of U.S. Provisional Application No. 62/431,170 filed Dec. 7, 2016, which is incorporated herein by reference in its entirety.
This invention was made with government support under grant number N66001-12-C-4020 awarded by the Defense Advanced Research Projects Agency. The government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US17/65067 | 12/7/2017 | WO | 00 |
| Number | Date | Country | |
|---|---|---|---|
| 62431170 | Dec 2016 | US |
