Osmosensing histidine kinases

FIELD OF THE INVENTION
The present invention relates to fungal osmosensing histidine kinases. In particular, the present invention is directed to histidine kinases from Candida (e.g, C. albicans) and Neurospora (e.g, N. crassa).
BACKGROUND
Fungal organisms have become increasingly significant pathogens in immunocompromised patients, especially those who because of cancer, organ transplantation, chemotherapy, pregnancy, age, diabetes, complications following extensive surgery, and various immune system dysfunctions, are at risk of experiencing life-threatening diseases caused by organisms which do not ordinarily pose a threat to normal, immunocompetent people. For example, fungal infections have become one of the leading factors contributing to morbidity and mortality in cancer patients, and fungi account for 4-12% of nosocomial (hospital-acquired) pathogens in leukemia patients (E. Anaissie, Clin. Infect. Dis., 14�Suppl.1!:S43 �1992!). The incidence of nosocomial bloodstream infections with fungi such as Candida ("candidemia") has increased in recent years and now accounts for 5.6% of all primary bloodstream infections (Id.). Yeast infections may also be life-threatening in other settings, such as in the case of intravenous drug abusers who use non-sterile substances (lemon juice is commonly used) to dilute drugs prior to injection.
Of the over 100 Candida species, approximately seven are isolated with great frequency from human specimens (T. Mitchell, in Zinsser Microbiology, W. K. Joklik, et al., �eds!, Appleton, Century-Crofts, Norwalk, Conn., pp. 1183-1190 �1984!). A brief taxonomic chart of Candida is shown in Table 1. Some Candida species are related to organisms, such as Saccharomyces in the subclass Hemiascomycetidae, class Ascomycetes, subdivision Ascomycotina, division Ascomycota. Also, some mycologists consider C. stellatoidea to be a variant of C. albicans.
TABLE 1______________________________________TAXONOMY OF THE GENUS CANDIDA______________________________________Kingdom: Mycetae (Fungi)Division: DeuteromycotaSubdivision: DeuteromycotinaForm Class: DeuteromycesForm Subclass: BlastomycetidaeGenus: CandidaSpecies: albicans glabrata guilliermondi krusei lipolytica lusitaniae parapsilosis pseudotropicalis rugosa stellatoidea tropicalis______________________________________
The first exposure to fungi experienced by many humans occurs during the birth process, when C. albicans present in the mother's vaginal canal colonizes the buccal cavity, and portions of the upper and lower gastrointestinal tract of the newborn. This colonization usually results in the establishment of C. albicans as a commensal organism in these areas, for the life of the individual. However, C. albicans is also the most common fungal pathogen of humans, worldwide, with other Candida species becoming increasingly important in fungal disease in humans and other animals.
As a commensal, C. albicans exists as a unicellular yeast; during invasive disease, the organism has a filamentous morphology. When C. albicans is implicated in disease, it may indicate that the patient has a co-existing immune, endocrine or other debilitating disorder that must also be addressed in order to effectively manage the fungal disease. The principal risk factors that predispose individuals to deeply invasive candidiasis include protracted course of broad spectrum antimicrobials, cytotoxic chemotherapy, corticosteroids, and vascular catheters.
Candida Infection and Diagnosis
Because clinical Candida infections and disease may be acute or chronic, superficial or disseminated, the disease syndromes are many and varied. While C. albicans is most commonly implicated, various other Candida species can and do invade most organ systems of the body. For example, C. tropicalis, C. parapsilosis, C. guilliermondi, C. krusei, and C. lusitaniae have emerged as important pathogens in cancer patients (E. Anaissie, supra). Candidiasis due to C. albicans, as well as other Candida species, is the most common opportunistic fungal infection observed (See, Walsh and Dixon, "Spectrum of Mycoses," in Baron (ed.), Medical Microbiology, 4th ed, University of Texas Medical Branch, Galveston, Tex. �1996!, pp. 919-925). Superficial candidiasis may involve the epidermal and mucosal surfaces (e.g., the oral cavity, pharynx, esophagus, intestines, urinary bladder, and vagina). In deep candidiasis, the gastrointestinal tract and intravascular catheters are the two major portals of entry, with the kidneys, liver, spleen, brain, eyes, heart, and other tissues being the major sites involved.
The major difficulties in diagnosis of Candida infections are encountered in cases of systemic disease. Chronic mucocutaneous, pulmonary candidiasis, endocarditis, and fungemia must be diagnosed early and treated promptly with an appropriate antifungal regimen, in order to avoid fatality (W. Chandler, Color Atlas and Text of Histopathology of Mycotic Diseases, p. 44 �1980!). The incidence of candidiasis in certain patient populations is striking. Up to 30% of leukemia patients acquire systemic candidiasis. (E. Anaissie, supra.) This is of great significance, as some reports indicate that the fatality rate for disseminated candidiasis in cancer patients is 80% (F. Meunier, et al., Clin. Infect. Dis., 14�Suppl. 1!:S120 �1992!). Also, fatalities in most organ transplant patients who succumb to infection are most often due to opportunistic organisms, of which Candida is the leading mycotic agent (T. Mitchell, supra).
The probability of postoperative systemic candidiasis is related to the length of operation and may involve contamination with organisms during the surgery or contamination through such diverse postoperative procedures as indwelling catheters or the use of prophylactic antibacterial compounds (Id.). Prosthetic devices, including artificial heart valves or intravenous lines can be colonized and introduce Candida into the patient's bloodstream (Id.).
Significantly, many patients who develop systemic candidiasis were given corticosteroids prior to development of their Candida infection. Corticosteroids are known to depress the immune system and are often used to prevent transplant rejection. Corticosteroids and antibacterials predispose to candidiasis by depressing phagocytic activity and cell-mediated immunity, reducing the bacterial flora and indirectly increasing the Candida population (Id.). Perhaps also importantly, corticosteroids have been hypothesized to directly act on fungi and may contribute to disease progression in patients with systemic candidiasis (See e.g. D. S. Loose et al., J. Gen. Microbiol., 129:2379 �1983!; D. S. Loose and D. Feldman, J. Biol. Chem., 257:4925 �1982!).
Because of the delays necessary in making a definitive diagnosis, physicians usually treat patients empirically. For superficial infections, topical antifungals are often used; the prognosis for most types of these infections is usually quite good. For systemic disease, highly toxic antifungals must often be used. Administration of these compounds requires careful patient monitoring (patients are usually admitted) because of their serious side effects (e.g., the nephrotoxicity, hypokalemia, anemia, fever and other toxic effects associated with the use of amphotericin B).
Fungal Physiology and Treatment of Candida Disease
The development of effective antifungal agents has lagged behind that of antibacterial agents. As bacteria are prokaryotic and offer numerous structural and metabolic targets that differ from humans, we have been more successful in identifying and developing antibacterial agents. In contrast, like humans, fungi are eukaryotic. Thus, most agents toxic to fungi are also toxic to humans. In addition, because fungi generally grow more slowly and in multi-cellular forms in vitro, they are more difficult to quantify than bacteria, complicating experiments designed to evaluate the in vitro and/or in vivo properties of potential antifungals.
Four general groups of antifungals have been developed, including the polyenes (e.g., amphotericin, nystatin, and pimaricin), azoles (e.g., fluconazole, itraconazole, and ketoconazole), allylamines and morpholines (e.g., naftifine and terbinafine), and antimetabolites (e.g., 5-flurocytosine). The site of action for most antifungals is the ergosterol present in the fungal cell membrane, or its biosynthetic pathway. However, other antifungals act at other sites, such as the fungal cell wall.
Fungal Cell Wall
The fungal cell wall is a rigid, stratified structure that consists of chitinous microfibrils encased in a matrix of small polysaccharides, proteins, lipids, inorganic salts, and pigments, that provides support and shape to the cell. The chitin within fungal cell walls is a (.beta.1-4)-linked polymer of N-acetyl glucosamine, produced in the cytosol by chitin synthetase.
The major polysaccharides of the cell wall matrix consist of non-cellulosic glucans, including glycogen-like compounds, mannans (mannose polymers), chitosan (glucosamine polymers), and galactans (galactose polymers). Fucose, rhamnose, xylose, and uronic acids may also be present in small amounts. The term "glucan" is used in reference to a large group of D-glucose polymers with glycosidic bonds. Of these, the most common glucans present in the fungal cell wall are in the .beta.-configuration. Polymers with (.beta.1-3)- and (.beta.1-6)-linked glucosyl units with various proportions of 1-3 and 1-6 linkages being common. Many fungi, and yeasts in particular, have soluble peptidomannans within a matrix of .alpha.- and .beta.-glucans, as part of the outer portion of their cell wall. The fungal cell wall is essential for the viability of the organism, as it prevents osmotic lysis of the cell. Even a small lesion within the cell wall can lead to the extrusion of cytoplasm due to the internal pressure within the cell (See, Cole, "Basic Biology of Fungi, in Baron (ed.), Medical Microbiology, 4th ed., University of Texas Medical Branch, Galveston, Tex. �1996!, pp. 903-911). Indeed, creation of such lesions is the mechanism of action of many antifungals, including amphotericin B.
As C. albicans may be in the form of budding yeast cells, pseudohyphae, germ tubes, true hyphae, and chlamydospores, differences between these forms are of interest in the development of antifungals. In the yeast form, the C. albicans cell wall contains approximately 30-60% glucan, 25-50% mannan (mannoprotein), 1-2% chitin, 2-14% lipid, and 5-15% protein (McGinnis and Tyring, "Introduction to Mycology," in Baron (ed.), Medical Microbiology, 4th ed., University of Texas Medical Branch, Galveston, Tex. �1996!, pp. 893-902). Glucans with (.beta.1-3) and (.beta.1-6)-linked groups comprise approximately a high percentage of the yeast cell wall. These glucans may impede the access of amphotericin B to the plasma membrane (See, McGinnis and Tyring, supra, at p. 896).
Fungal Cell Membrane
The fungal plasma (i.e., cell) membrane is similar to mammalian plasma membranes, with the exception being that fungal plasma membranes contain ergosterol, rather than cholesterol as the principal sterol. The plasma membrane is selectively permeable, and apparently regulates the passage of materials into and out of the cell. Sterols present in the membrane provide structure, modulate membrane fluidity, and may control other physiologic events.
Polyene antifungals (e.g., amphotericin B, nystatin, and pimaricin) bind ergosterol, to form complexes that allow the rapid leakage of cellular potassium, other ions, and small molecules out of affected fungal cells. This results in the inhibition of fungal glycolysis and respiration. Other antifungals such as the azoles (e.g., fluconazole, imidazole, ketoconazole, and itraconazole), and allylamines and morpholines interfere with the ergosterol biosynthesis. Inhibition of ergosterol formation may result in permeability changes in the plasma membrane, inhibits growth, and may lead to excessive chitin production and abnormal fungal growth.
Fungal Microtubules
Fungi also possess microtubules composed of tubulin. These structures are involved in the movement of organelles, chromosomes, nuclei, and Golgi vesicles. Microtubules are the principal components of the spindle fibers that aid movement of the chromosomes during mitosis and meiosis. Exposure to some antifungal agents disrupts the movement of the nuclei, mitochondria, vacuoles, and apical vesicles. In addition, destruction of cytoplasmic microtubules interferes with transport of secretory materials, and may inhibit cell wall synthesis. Griseofulvin, a compound commonly used to treat dermatophytic infections binds with microtubule-associated proteins involved in tubulin assembly, and acts by stopping mitosis at metaphase.
Antifungal Compounds
Despite the identification of cell membrane, cell wall, and microtubule targets for antifungal action, antifungal development has been slow. Amphotericin B remains the treatment mainstay for life-threatening and other mycoses. Discovered in 1956, amphotericin B remains the drug of choice for candidiasis, cryptococcosis, aspergillosis, zygomycosis, coccidioidomycosis, histoplasmosis, blastomycosis, and paracoccidioidomycosis. Amphotericin B must be administered intravenously and is associated with numerous, often serious side effects, including phlebitis at the infusion site, fever, chills, hypokalemia, anemia, and nephrotoxicity). Importantly, fungal resistance to amphotericin B has been reported for various opportunistic fungi, including Pseudallescheria boydii, Fusarium, Trichosporon, and some C. lusitaniae and C. guilliermondii isolates (See, Dixon and Walsh, "Antifungal Agents," in Baron (ed.), Medical Microbiology, 4th ed., University of Texas Medical Branch, Galveston, Tex. �1996!, pp. 926-932).
Nystatin is another broad-spectrum polyene antifungal. However, its toxicity to humans prevents its widespread use. Currently, it is limited to topical applications, where it is effective against yeasts, including C. albicans. Pimaricin (natamycin) is a topical polyene active against yeasts and molds; this compound is used to treat superficial mycotic eye infections.
Ketoconazole was the first antifungal developed that was suitable for oral administration, although it may also be used topically. In non-immunocompromised patients, it may be used to treat histoplasmosis and blastomycosis. It is also used against mucosal candidiasis and various cutaneous mycoses (e.g., dermatophyte infections, pityriasis versicolor, and cutaneous candidiasis). However, it is not useful for treatment of aspergillosis or systemic yeast infections. The triazoles (e.g., fluconazole and itraconazole) have found use in systemic mycoses. Fluconazole is now often used to treat candidemia in non-neutropenic patients, and may be used in cryptococcosis and some cases of coccidioidomycosis. Itraconazole is often effective against histoplasmosis, blastomycosis, sporotrichosis, coccidioidomycosis, and some cases of cryptococcosis and aspergillosis.
Side effects are not as common with the azoles as with amphotericin B, although life-threatening hepatic toxicity may result from long-term use. Other side effects include nausea, vomiting, and drug interactions with such compounds as cyclosporin, antihistamines, anticoagulants, anti-seizure and oral hypoglycemic medications, as well as other compounds, are of potential concern.
Unlike antibacterials, few antimetabolite compounds are useful as antifungals. The most commonly used antifungal is 5-fluorocytosine, a fluorinated analog of cytosine. However, like other antimetabolites, the emergence of drug resistance has become a problem. Thus, it is seldom used alone. Nonetheless, in combination with amphotericin B, it remains the treatment of choice for cryptococcal meningitis, and is effective against some diseases caused by dematiaceous fungi.
Other antifungals include griseofulvin, an antimicrobial produced by Penicillium griseofulvin, that is active against most dermatophytes. Potassium iodide is another compound that is used as an antifungal to enhance transepidermal elimination of fungal organisms in cases of cutaneous and lymphocutaneous sporotrichosis, although it is not effective against Sporothrix schenckii in vitro.
Anti-fungal susceptibility testing is generally not standardized, and the results of in vitro tests do not always correspond to the in vivo results. Thus, preliminary antifungal selection is often made on the basis of the specific organism identified as being involved in the patient's disease. While this approach may be useful in avoiding selection of an antifungal to treat fungi known to exhibit primary resistance to an agent, it is less useful in the selection of antifungals to treat fungi known to develop secondary (i.e., drug-induced) resistance.
Primary, as well as secondary, antifungal resistance has become an increasing problem. For example, with most polyenes, the resistance is almost always primary (i.e., the susceptibility profiles for the species are characteristic, inherent, and rarely change in response to drug exposure). Primary and secondary resistance to azoles has been reported for most medically important yeasts. In view of the development of resistance, as well as the relative lack of variety available in the selection of antifungals, there remains a need for the development of compounds useful for treatment of fungal diseases.
SUMMARY OF THE INVENTION
The present invention relates to osmosensing histidine kinases and methods for their use in screening antifungal compounds for their activity against fungal organisms, as well as for the development of antifungal compounds.
In one embodiment, the present invention provides a purified and isolated nucleic acid sequence encoding at least a portion of an osmosensing histidine kinase, wherein the sequence is selected from the group consisting of SEQ ID NO:1, 3, 5, and 17, and their complementary sequences. In one preferred embodiment, the nucleic acid sequence is from Neurospora. In alternative embodiments, the present invention provides compositions comprising the nucleic acid sequences selected from the group consisting of SEQ ID NO:1, 3, 5, and 17, and their complementary sequences.
The present invention also provides polynucleotide sequences that hybridize under stringent conditions to the nucleic acid sequence selected from the group consisting of SEQ ID NOS:3, and 17.
The present invention further provides substantially purified proteins comprising the amino acid sequences selected from the group consisting of SEQ ID NOS:2, 4, 6, 11, 12, and 18.
The present invention also provides expression vectors that contain nucleic acid sequences selected from the group consisting of SEQ ID NO:1, 3, 5, and 17, and their complementary sequences. It is contemplated that these sequences may be encoded by one or more expression vectors. It is also contemplated that the expression vectors of the present invention be present within host cells. In one embodiment, the host cell is prokaryotic, while in preferred embodiments, the host cell is eukaryotic. In particularly preferred embodiments, the host cell is a fungal cell. In alternate preferred embodiments the host cell is selected from the group consisting of Neurospora, Candida, Aspergillus, and Saccharomyces. In yet another particularly preferred embodiment, the host cell comprises Candida albicans.
The present invention also provides host cells comprising at least one DNA sequence selected from the group consisting of SEQ ID NOS:1, 3, 5, and 17, or a portion thereof, such that the host cell expresses a fungal histidine kinase or a portion therefore. In one preferred embodiment, the fungal histidine kinase is a Neurospora crassa histidine kinase. In another preferred embodiment, the host cell expresses Candida albicans histidine kinase. In an alternative preferred embodiment, the host cell expresses Saccharomyces histidine kinase.
The present invention provides compositions and methods related to osmosensing fungal histidine kinases. In particular, the present invention provides amino acid and nucleic acid sequences of fungal histidine kinases from organisms such as Candida (e.g., C. albicans) and Neurospora (e.g., N. crassa). The present invention further provides compositions and methods for the development of antifungal compounds.

DESCRIPTION OF THE DRAWINGS
FIG. 1 shows a map of the 12:4D cosmid and its restriction sites, in comparison with pCE1, pMMS100, pMMS108, pCE6, and pCE5.
FIG. 2 is a schematic of the N. crassa os-1 open reading frame.
FIG. 3 is a sequence alignment of OS1p (SEQ ID NO:28), BarA (SEQ ID NO:29), RepA (SEQ ID NO:30), ApdA (SEQ ID NO:31), and Sln1p (SEQ ID NO:32).
FIG. 4 is a map of pSV50.
FIG. 5 is a schematic showing construction of the .DELTA.os-1 mutant by gene replacement by his-2+.
FIG. 6 is a sequence alignment of Cos1p (SEQ ID NO:33), Os1p (SEQ ID NO:34), BarA (SEQ ID NO:35), and Sln1 (SEQ ID NO:36).

DESCRIPTION OF THE INVENTION
The present invention relates to osmosensing histidine kinases and methods for their use in screening antifungal compounds for their activity against fungal organisms, as well as for the development of antifungal compounds. In particular, the present invention provides a new target for antifungals, namely novel histidine kinases involved in cell wall assembly. Importantly for development of antifungals with minimal toxicity, the present invention provides a target that is widespread among diverse fungal species, but is absent from humans and other mammals. The lack of chitin, (1-6) .beta.-glucan and (1-3) .beta.-glucan in mammalian cells makes the pathways for their synthesis attractive targets for antifungal compounds. For example, chitin synthase and (1-3) .beta.-glucan synthase have been considered as targets for antifungal development (See e.g., G. W. Gooday, "Chitin metabolism: A target for antifungal and antiparasitic drugs," in E. Borowski (ed.), Molecular Aspects of Chemotherapy, Perganon Press �1993! pp. 175-185; N. Georgopapadalou and J. Tkacz, "The fungal cell wall as a drug target," Trends Microbiol., 3:98-104 �1995!). Indeed, Pneumocystis carinii pneumonia has been successfully treated with (1-3) .beta.-glucan synthase inhibitors (D. Schmatz et al., Proc. Natl. Acad. Sci., 87:5950-5954 �1982!). However, the present invention provides additional advantages over compounds that target chitin biosynthesis itself, as the critical steps of functional cell wall assembly are targetted by the present invention.
Histidine Kinase Function and Activity
The histidine kinase system is a two-component signal transduction system. These two-component signalling pathways convey a signal generated by an environmental stimulus into the interior of the cell through a series of reversible protein phosphorylation reactions (See e.g., L. A. Alex and M. I. Simon, Trends Genet., 10:133-138 �1994!). Both prokaryotes and eukaryotes have been found to have these two-component systems (See e.g., L. A. Alex and M. I. Simon, supra; R. V. Swanson et al., Trends Biochem. Sci., 19:485-490 �1994!; J. S. Parkinson et al., Ann. Rev. Genet., 26:71-112 �1992!); C. Chang et al., Science 262:539-544 �1993!; J. Hua et al., Science 262:539-544 �1995!; I. M. Ota and A. Varshavsky, Science 262:566-569 �1993!; T. Maeda et al., Nature 369:242-245 �1994!; Schuster et al., EMBO J., 5:3880-3889 �1996!; Wang et al., EMBO J., 5:3890-3898 �1996!; Kakimoto, Science 274:982-985 �1996!; and L. A. Alex et al., Proc. Natl. Acad. Sci., 93:3416-3421 �1996!). However, prior to the development of the present invention, the histidine kinase system of N. crassa and the medically important fungus C. albicans were not known.
In the most simple form of the histidine kinase system, the first component is an autophosphorylating histidine kinase, the activity of which is modulated in response to a specific stimulus; the second component is a response regulator. This response regulator serves as a substrate for the histidine kinase. An aspartate residue of the regulator becomes phosphorylated after phosphoryl transfer from the histidine residue of the kinase. It is the phosphorylation of the response regulator that controls its function. The kinase domain is comprised of a module of approximately 250 amino acids with five sequence blocks that are conserved (H, F, G1, G2, and N). The H box is the site of histidine autophosphorylation, while the F, G1 and G2 boxes are believed to be involved in nucleotide binding; the function of the N box is unknown. The response regulator domain ("response regulator," "D box," or "receiver domain") may be identified from the number and spacing of a module of conserved aspartate, lysine, and hydrophobic residues in a module of approximately 120 amino acids. These two signaling modules (i.e., the histidine kinase and response regulator) may be found in various contexts within more complex signalling proteins.
Fungal Histidine Kinases
With the exception of plants, in eukaryotes examined to date, the histidine kinase and response regulator activities reside in the same protein. Fungal two-component systems have been identified that are sensitive to extracellular osmolarity fluctuations. Under appropriate conditions, an enzymatic cascade is activated and cell wall biosynthesis is stimulated. This response is critical, as fungal cells that are incapable of adjusting to changes in extracellular osmolarity are nonviable (See, L. Alex and M. Simon, Trends Genet., supra; and B. Morgan et al., J. Cell Biol., 5:453-457 �1995!). Fungal pathogens must be able to quickly respond (i.e., via glycerol synthesis and cell wall biosynthesis) to changes in osmolarity found in various tissues.
In S. cerevisiae the Sln1p/Ypd1p/Ssk1p proteins comprise a two-component signal transduction pathway that regulates the Hog1 MAPK cascade (F. Posas et al., Cell 86:865-875 �1996!). The HOG1 pathway is responsible for the control of genes necessary for adaptation to high external osmolarity. The Sln1p/Ypd1/Ssk1 pathway is actually a special form of the two-component system known as a phosphorelay system (See, Appleby et al., Cell 86:845-848 �1996!, for review). Examples of these systems are found in bacteria where they mediate sporulation in Bacillus subtilis (D. Burbulys et al., Cell, 64:545-552 �1991!) and transcription of virulence factors in Bordetella pertussis (M. Uhl and J. Miller, EMBO J., 15:1028-1036 �1996!). The phosphorelay system involves a set of multiple phosphotransfer reactions alternating between histidine and aspartate. For example, autophosphorylation of the histidine kinase occurs (e.g., at the "H1" site) and there is subsequent transfer to an aspartate residue ("D1"). This aspartate can lie in the same protein as the kinase (as in the case of BvgS in B. pertussis) or it can be a separate protein (as in the case of SpoOF in B. subtilis). There is then transfer from the aspartate (D1) to a second histidine residue ("H2"). The H2 site can be within the same protein as the first site (e.g., BvgS) or in a separate protein (e.g., SpoOB). Finally there is transfer from the histidine at H2 to another aspartate residue ("D2"). Generally, D2 is in a separate response regulator that is the protein that has some function such as DNA binding.
In the S. cerevisiae pathway, the Sln1p is an osmosensing transmembrane histidine kinase. Under conditions of low osmolarity, Sln1p first autophosphorylates a histidine residue (H1) and this phosphate is transferred to an internal aspartate residue (D1). Phosphate is then tranferred from the D1 site of Sln1p to a histidine (H2) on a small protein called Ypd1p. Finally, the phosphoryl group is transferred to yet another protein, the response regulator Ssk1p (D2). Phosphorylation of Ssk1p results in a protein that cannot activate the HOG1 pathway (i.e., Sln1p is a negative regulator of the HOG1 pathway). Under conditions of high osmolarity, Sln1p is inhibited, resulting in dephosphorylation of Ssk1p which can now activate the HOG1 cascade to allow activation of multiple osmolarity responses (See, B. Morgan et al., J. Cell. Biol., 5:453-457 �1995!; and F. Posas et al., Cell 86:865-875 �1996!). Mutants with sln1 and hog1 deletions are non-viable under conditions of high osmolarity, while constitutive hog1 mutants are non-viable under conditions of low osmolarity.
The Skn7p is another response regulator found in S. cerevisiae. So far, the cognate histidine kinase for Skn7p has not been found. (Although it is known from the completed genome project of S. cerevisiae, that Sln1p is the only two-component histidine kinase in this organism.) The skn7 gene was isolated as a suppressor of kre9, a mutant defective in (1-6) .beta.-glucan synthesis (See, J. L. Brown et al., EMBO 13:5186-5194 �1994!; and J. L. Brown et al., J. Bacteriol., 175:6908-6915 �1993!). This gene is also known as "pos9 ," identified as a gene important for the adaptation of yeast to oxidative stress (See e.g., B. Krems et al, Curr. Genet., 29:327-334 �1996!). It has also been linked to a potential transcription factor Ask10 (See, Page et al., Yeast 12:267-272). The skn7 protein (skn7p) has been shown to share homology to DNA-binding motifs, sln1p, and a putative receiver domain (See, J. Morgan et al, J. Cell. Biol., 5:453-457 �1995!; J. L. Brown et al, EMBO, supra; and J. L. Brown et al., J. Bacteriol., supra).
In addition, skn7p has been shown to be phosphorylated in vivo, an observation that is consistent with the inclusion of a receiver domain. The role of skn7, hog1, and the histidine kinases that activate them make them attractive targets for anti-fungal compounds. However, prior to the development of the present invention, insufficient information was available regarding the distribution of histidine kinases in fungi of medical significance (e.g., C. albicans), and mammals such as humans.
An alternative osmosensor of the hog1 pathway has also been identified. The gene sho1 (synthetic high osmolarity sensitive) encodes a protein of 367 amino acids with homology to SH3-containing signal transduction proteins (e.g., GRB2, c-scr, and PLC.gamma.). Sho1p is believed to be localized in the plasma membrane, and activates the MAPKK (MAP kinase kinase) pbs2p, by phosphorylation of pbs2p at Ser.sup.514 and Thr.sup.518. However, sho1p appears to have a minor role in the regulation of the hog1 pathways, as sho1p is not able to compensate for sln1p mutations.
N. crassa and C. albicans Histidine Kinase Systems
In a preferred embodiment, the osmotic-1 (cos-1) gene encoding the histidine kinase of C. albicans is provided. In alternative embodiments, the os-1 gene encoding the histidine kinase of N. crassa is provided. However, it is contemplated that other osmosensing fungal, as well as other histidine kinases with homology to the C. albicans histidine kinase can be identified using the sequence information and methods provided herein.
In preliminary experiments during the development of the present invention, N. crassa was used, as it is particularly well-suited to the study of fungal cell wall assembly. This organism has been "domesticated" and methods have been developed to manipulate the organism in the laboratory. N. crassa exhibits both an asexual vegetative and a sexual phase in its life cycle (See e.g, M. L. Springer, BioEssays 15:365-374 �1993!). During vegetative growth, N. crassa forms a branched multicellular network of hyphae (i.e., a mycelium). Hyphae extend from the apical tip and form branches at regular intervals, often fusing with other hyphae. Upon conditions of nutrient deprivation and desiccation, the mycelium sends up aerial hyphae, which then differentiate into conidiophores that, in turn, ultimately produce conidia, which can also function as male gametes during the sexual cycle. N. crassa forms microconidia, as well as macroconidia. The microconidia are uninucleate and may be crossed in such a manner that only monokaryons are involved. The macroconidia are multinucleate, with an average of three nuclei per macroconidium. When placed in a suitable environment, populations of macroconidia proceed synchronously through germination, including the de novo synthesis of cell wall material.
In order to address the suitability of using the fungal histidine kinase pathway as a target for development of antifungals, experiments were conducted to analyze the osmotic sensitivity and other characteristics of N. crassa. Osmotically-sensitive mutants of N. crassa are unable to grow in liquid media supplemented with 4% NaCl. Four osmotic genes (os) within N. crassa have been identified (designated as os-1, os-2, os-4, and os-5). The os-1 strains have altered cell wall compositions containing decreased amounts of alkali-soluble glucose, are morphologically abnormal, and produce few macroconidia.
In addition, N. crassa strains with a temperature-sensitive allele of os-1 form protoplasts (i.e., cells lacking cell walls), when grown in specialized media at non-permissive temperature (e.g., 37.degree. C.). In these cultures, both (1-3).beta.-glucan and chitin biosynthesis occurred, but the polymers were excreted into the medium, rather than being assembled into a cell wall. Thus, os-1 mutants are not defective in (1-3).beta.-glucan or chitin synthases. When the growth temperature is shifted to 25.degree. C. (i.e., a permissive temperature for os-1 function), the cell wall-less (i.e., protoplast) populations regenerate cell walls, and grow in the form of hyphae. Each of the identified os mutant was tested; it was determined that only os-1 strains can form protoplasts that grow and divide. These results indicated that os-1 has a fundamental and essential role in fungal cell wall assembly.
Next, the os-1 gene was localized to a member of the ordered Vollmer-Yanofsky cosmid library (S. Vollmer and C. Yanofsky, Proc. Natl. Acad. Sci., 83:4861 �1986!). The original cosmid clone containing the os-1 gene was then isolated, cloned and sequenced. A single open reading frame (ORF) of approximately 4.3 kb interrupted by four introns was identified. The ORF was found to encode a predicted protein of 1298 amino acids (Alex et al., Proc. Natl. Acad. Sci., 93:3416-3421 �1996!). Gene replacement experiments were used to confirm that the ORF encodes the os-1 protein. In subsequent experiments, the predicted os-1 protein was shown to have significant homology to bacterial and yeast signal transduction two-component histidine kinases (See, FIG. 6). The sequence analysis identified three areas of significant homology corresponding to the H box, ATP-binding site, and D box.
The os-1 cognate of C. albicans (cos-1) was of particular interest. This protein shows 60% identity and 70% similarity with os-1. Indeed, the H box sequence is identical for these proteins.
Experiments were also conducted to determine whether cognates of skn7 are present in pathogenic fungi. In these experiments, PCR was conducted using primers capable of amplifying skn7-specific DNA. DNA from various sources was used as template (e.g., C. albicans, A. fumigatus, and human). The results indicated that cognates of S. cerevisiae are present in C albicans and A. fumigatus, but not in humans.
Utility of Fungal Histidine Kinase Systems
The results obtained during the development of the present invention indicated that the skn7 and os-1 (or cos-1) systems are suitable targets for antifungals. In addition, it was determined that a portion of the skn7p (residues 420-434; based upon the numbering system of J. L. Brown et al, J. Bacteriol., 175:6908-6915 �1993!) was homologous to certain D-box domains of os1p (residues 1129-1143), sln1p (residues 1137-1151), and BarA (residues 711-725). Thus, it is contemplated that compounds based on the skn7p D-box domain have utility in the development of antifungals.
Additional potential targets for development of antifungals include the receiver domains of proteins that receive the phosphoryl group transferred from the phosphorylated aspartate residue of the histidine kinase domain. For example, it is contemplated that peptides that mimic portions of the D-box or receiver domain of ssk1p (See e.g., T. Maeda et al., Nature 369:242-245 �1994!) will find use in methods using the present invention.
It is contemplated that compositions of the present invention can be used in assays to detect compounds of potential use as antifungals. In one embodiment, the assays incorporate target substrates that mimic regions of the H-box and/or D-box domains of the histidine kinase of interest, or the receiver domain (i.e., D-box) of the receiver protein. In particular, the present invention contemplates assays for os1p, its cognates, and other histidine kinases with homologous D-box or H-box domains. Thus, it is not intended that the assay systems be limited to any particular system or fungal species.
It is further contemplated that various assay systems can be used to screen for antifungal compounds, including, but not limited to immunoassays (i.e., radioimmunoassay �RIA!, immunofluorescence �IFA!, enzyme-linked immunosorbent assay �ELISA or EIA!), as well as chemiluminescent, immunohistochemical, and other methods, including precipitation, agglutination, complement fixation, and any other assay system suitable for such use.
It is also contemplated that assays based on molecular biology can be utilized with the present invention. For example, it is intended that assays using reagents such as anti-sense constructs will be used in the development of antifungals (i.e., therapeutics). Thus, it is contemplated that antisense oligonucleotides directed against one or more portion of the histidine kinase domain are useful as antifungals. Such antisense oligonucleotides may be transformed into fungal cells (e.g., C. albicans) to produce cultures that are incapable of growing due to defects in cell wall biosynthesis.
From the previous discussion it is apparent that the present invention solves a need in the art for compositions and methods for development of therapeutics as well as screening methods for identification of useful therapeutics against organisms such as C. albicans, as well as other pathogenic and opportunistic fungi and bacteria.
DEFINITIONS
To facilitate understanding of the invention, a number of terms are defined below.
The term "sample" as used herein refers to any type of material obtained from humans or other animals (e.g., any bodily fluid or tissue), cell or tissue cultures, cell lines, or a culture of microorganisms. "Sample" also encompasses food and feed (whether solid or liquid), media (whether solid or liquid) for the growth and maintenance of microorganisms and cell cultures, equipment and its components (e.g., dialysis, intravenous, and nasogastric tubing), disposable, as well as reusable patient care items (including catheters), environmental surfaces, soil, water and other fluids, and reagents (e.g., buffers).
As used herein, the term "eukaryote" refers to organisms distinguishable from "prokaryotes." It is intended that the term encompass all organisms with cells that exhibit the usual characteristics of eukaryotes, such as the presence of a true nucleus bounded by a nuclear membrane, within which lie the chromosomes, the presence of membrane-bound organelles, and other characteristics commonly observed in eukaryotic organisms. Thus, the term includes, but is not limited to such organisms as fungi, protozoa, and animals (e.g, humans).
As used herein, the term "antimicrobial" is used in reference to any compound which inhibits the growth of, or kills microorganisms, including eukaryotes such as fungi (i.e., it includes antifungals). It is intended that the term be used in its broadest sense, and includes, but is not limited to compounds such as antibiotics which are produced naturally or synthetically. It is also intended that the term includes compounds and elements that are useful for inhibiting the growth of, or killing microorganisms.
As used herein, the term "antimetabolite" refers to any substance with a close structural resemblance to another, essential substance (i.e., metabolite) that is required for normal physiologic function. Typically, antimetabolites exert their effects by interfering with the utilization of the essential metabolite.
As used herein, the term "polyploid" refers to cells or organisms which contain more than two sets of chromosomes.
"Nucleic acid sequence" as used herein refers to an oligonucleotide, nucleotide or polynucleotide, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin which may be single- or double-stranded, and represent the sense or antisense strand. Similarly, "amino acid sequence" as used herein refers to peptide or protein sequence. "Peptide nucleic acid" as used herein refers to an oligomeric molecule in which nucleosides are joined by peptide, rather than phosphodiester, linkages. These small molecules, also designated anti-gene agents, stop transcript elongation by binding to their complementary (template) strand of nucleic acid (Nielsen et al., Anticancer Drug Des., 8:53-63 �1993!).
A "deletion" is defined as a change in either nucleotide or amino acid sequence in which one or more nucleotides or amino acid residues, respectively, are absent.
An "insertion" or "addition" is that change in a nucleotide or amino acid sequence which has resulted in the addition of one or more nucleotides or amino acid residues, respectively, as compared to, naturally occurring sequences.
A "substitution" results from the replacement of one or more nucleotides or amino acids by different nucleotides or amino acids, respectively.
As used herein, the term "purified" or "to purify" refers to the removal of contaminants from a sample. As used herein, the term "substantially purified" refers to molecules, either nucleic or amino acid sequences, that are removed from their natural environment, "isolated" or "separated," and are at least 60% free, preferably 75% free, and most preferably 90% free from other components with which they are naturally associated. An "isolated polynucleotide" is therefore a substantially purified polynucleotide.
As used herein, the term "probe" refers to an oligonucleotide (i.e., a sequence of nucleotides), whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of hybridizing to another oligonucleotide or polynucleotide of interest. Probes are useful in the detection, identification and isolation of particular gene sequences. It is contemplated that any probe used in the present invention will be labelled with any "reporter molecule," so that is detectable in any detection system, including, but not limited to enzyme (e.g., ELISA, as well as enzyme-based histochemical assays), fluorescent, radioactive, and luminescent systems. It is further contemplated that the oligonucleotide of interest (i.e., to be detected) will be labelled with a reporter molecule. It is also contemplated that both the probe and oligonucleotide of interest will be labelled. It is not intended that the present invention be limited to any particular detection system or label.
As used herein, the term "target" refers to the region of nucleic acid bounded by the primers used for polymerase chain reaction. Thus, the "target" is sought to be sorted out from other nucleic acid sequences. A "segment" is defined as a region of nucleic acid within the target sequence.
"Amplification" is defined as the production of additional copies of a nucleic acid sequence and is generally carried out using polymerase chain reaction (PCR) or other technologies well known in the art (e.g., Dieffenbach and Dveksler, PCR Primer, a Laboratory Manual, Cold Spring Harbor Press, Plainview N.Y. �1995!). As used herein, the term "polymerase chain reaction" ("PCR") refers to the method of K. B. Mullis (U.S. Pat. Nos. 4,683,195 and 4,683,202, hereby incorporated by reference), which describe a method for increasing the concentration of a segment of a target sequence in a mixture of genomic DNA without cloning or purification. This process for amplifying the target sequence consists of introducing a large excess of two oligonucleotide primers to the DNA mixture containing the desired target sequence, followed by a precise sequence of thermal cycling in the presence of a DNA polymerase. The two primers are complementary to their respective strands of the double stranded target sequence. To effect amplification, the mixture is denatured and the primers then annealed to their complementary sequences within the target molecule. Following annealing, the primers are extended with a polymerase so as to form a new pair of complementary strands. The steps of denaturation, primer annealing and polymerase extension can be repeated many times (i.e., denaturation, annealing and extension constitute one "cycle"; there can be numerous "cycles") to obtain a high concentration of an amplified segment of the desired target sequence. The length of the amplified segment of the desired target sequence is determined by the relative positions of the primers with respect to each other, and therefore, this length is a controllable parameter. By virtue of the repeating aspect of the process, the method is referred to as the "polymerase chain reaction" (hereinafter "PCR"). Because the desired amplified segments of the target sequence become the predominant sequences (in terms of concentration) in the mixture, they are said to be "PCR amplified".
As used herein, the term "polymerase" refers to any polymerase suitable for use in the amplification of nucleic acids of interest. It is intended that the term encompass such DNA polymerases as Taq DNA polymerase obtained from Thermus aquaticus, although other polymerases, both thermostable and thermolabile are also encompassed by this definition.
With PCR, it is possible to amplify a single copy of a specific target sequence in genomic DNA to a level detectable by several different methodologies (e.g., hybridization with a labeled probe; incorporation of biotinylated primers followed by avidin-enzyme conjugate detection; incorporation of .sup.32 P-labeled deoxynucleotide triphosphates, such as dCTP or dATP, into the amplified segment). In addition to genomic DNA, any oligonucleotide sequence can be amplified with the appropriate set of primer molecules. In particular, the amplified segments created by the PCR process itself are, themselves, efficient templates for subsequent PCR amplifications. Amplified target sequences may be used to obtain segments of DNA (e.g., genes) for insertion into recombinant vectors.
As used herein, the terms "PCR product" and "amplification product" refer to the resultant mixture of compounds after two or more cycles of the PCR steps of denaturation, annealing and extension are complete. These terms encompass the case where there has been amplification of one or more segments of one or more target sequences.
As used herein, the term "nested primers" refers to primers that anneal to the target sequence in an area that is inside the annealing boundaries used to start PCR. (See, K. B. Mullis, et al., Cold Spring Harbor Symposia, Vol. LI, pp. 263-273 �1986!). Because the nested primers anneal to the target inside the annealing boundaries of the starting primers, the predominant PCR-amplified product of the starting primers is necessarily a longer sequence, than that defined by the annealing boundaries of the nested primers. The PCR-amplified product of the nested primers is an amplified segment of the target sequence that cannot, therefore, anneal with the starting primers. As used herein, the term "amplification reagents" refers to those reagents (deoxyribonucleoside triphosphates, buffer, etc.), needed for amplification except for primers, nucleic acid template and the amplification enzyme.
As used herein, the terms "restriction endonucleases" and "restriction enzymes" refer to bacterial enzymes, each of which cut double-stranded DNA at or near a specific nucleotide sequence.
As used herein, the term "recombinant DNA molecule" as used herein refers to a DNA molecule which is comprised of segments of DNA joined together by means of molecular biological techniques.
As used herein, the terms "complementary" or "complementarity" are used in reference to polynucleotides (i.e., a sequence of nucleotides) related by the base-pairing rules. For example, for the sequence "A-G-T," is complementary to the sequence "T-C-A." Complementarity may be "partial," in which only some of the nucleic acids' bases are matched according to the base pairing rules. Or, there may be "complete" or "total" complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as detection methods which depend upon binding between nucleic acids.
The term "homology" refers to a degree of complementarity. There may be partial homology or complete homology (i.e., identity). A partially complementary sequence is one that at least partially inhibits a completely complementary sequence from hybridizing to a target nucleic acid and is referred to using the functional term "substantially homologous." The inhibition of hybridization of the completely complementary sequence to the target sequence may be examined using a hybridization assay (Southern or Northern blot, solution hybridization and the like) under conditions of low stringency. A substantially homologous sequence or probe will compete for and inhibit the binding (i.e., the hybridization) of a completely homologous sequence to a target sequence under conditions of low stringency. This is not to say that conditions of low stringency are such that non-specific binding is permitted; low stringency conditions require that the binding of two sequences to one another be a specific (i.e., selective) interaction. The absence of non-specific binding may be tested by the use of a second target which lacks even a partial degree of complementarity (e.g., less than about 30% identity); in the absence of non-specific binding, the probe will not hybridize to the second non-complementary target.
The art knows well that numerous equivalent conditions may be employed to comprise either low or high stringency conditions; factors such as the length and nature (DNA, RNA, base composition) of the probe and nature of the target (DNA, RNA, base composition, present in solution or immobilized, etc.) and the concentration of the salts and other components (e.g., the presence or absence of formamide, dextran sulfate, polyethylene glycol) are considered and the hybridization solution may be varied to generate conditions of either low or high stringency hybridization different from, but equivalent to, the above listed conditions. The term "hybridization" as used herein includes "any process by which a strand of nucleic acid joins with a complementary strand through base pairing" (Coombs, Dictionary of Biotechnology, Stockton Press, New York N.Y. �1994!.
"Stringency" typically occurs in a range from about T.sub.m -5.degree. C. (i.e., 5.degree. C. below the T.sub.m of the probe) to about 20.degree. C. to 25.degree. C. below T.sub.m. As will be understood by those of skill in the art, a stringent hybridization can be used to identify or detect identical polynucleotide sequences or to identify or detect similar or related polynucleotide sequences.
As used herein, the term "T.sub.m " is used in reference to the "melting temperature." The melting temperature is the temperature at which a population of double-stranded nucleic acid molecules becomes half dissociated into single strands. The equation for calculating the T.sub.m of nucleic acids is well known in the art. As indicated by standard references, a simple estimate of the T.sub.m value may be calculated by the equation: T.sub.m =81.5+0.41(% G+C), when a nucleic acid is in aqueous solution at 1 M NaCl (See e.g., Anderson and Young, Quantitative Filter Hybridisation, in Nucleic Acid Hybridisation �1985!). Other references include more sophisticated computations which take structural as well as sequence characteristics into account for the calculation of T.sub.m.
As used herein the term "hybridization complex" refers to a complex formed between two nucleic acid sequences by virtue of the formation of hydrogen bounds between complementary G and C bases and between complementary A and T bases; these hydrogen bonds may be further stabilized by base stacking interactions. The two complementary nucleic acid sequences hydrogen bond in an antiparallel configuration. A hybridization complex may be formed in solution (e.g., C.sub.0 t or R.sub.0 t analysis) or between one nucleic acid sequence present in solution and another nucleic acid sequence immobilized to a solid support (e.g., a nylon membrane or a nitrocellulose filter as employed in Southern and Northern blotting, dot blotting or a glass slide as employed in in situ hybridization, including FISH �fluorescent in situ hybridization!).
As used herein, the term "antisense" is used in reference to nucleic acid sequences which are complementary to a specific nucleic acid sequence (e.g., mRNA that is complementary to another RNA sequence). Antisense DNA or RNA may be produced by any method, including synthesis by splicing the gene(s) of interest in a reverse orientation to a viral promoter which permits the synthesis of a coding strand. Once an antisense RNA is introduced into a cell, this transcribed strand combines with natural mRNA produced by the cell to form duplexes. These duplexes then block either the further transcription of the mRNA or its translation. In this manner, mutant phenotypes may be generated. The term "antisense strand" is used in reference to a nucleic acid strand that is complementary to the "sense" strand. The designation (-) (i.e., "negative") is sometimes used in reference to the antisense strand, with the designation (+) sometimes used in reference to the sense (i.e., "positive") strand.
As used herein the term "portion" when in reference to a protein (as in "a portion of a given protein") refers to fragments of that protein. The fragments may range in size from four amino acid residues to the entire amino acid sequence minus one amino acid. Thus, a protein "comprising at least a portion of the amino acid sequence of SEQ ID NO:18," encompasses the full-length Candida histidine kinase protein and fragments thereof.
the term "antigenic determinant" as used herein refers to that portion of an antigen that makes contact with a particular antibody (i.e., an epitope). When a protein or fragment of a protein is used to immunize a host animal, numerous regions of the protein may induce the production of antibodies which bind specifically to a given region or three-dimensional structure on the protein; these regions or structures are referred to as antigenic determinants. An antigenic determinant may compete with the intact antigen (i.e., the immunogen used to elicit the immune response) for binding to an antibody.
The terms "specific binding" or specifically binding" when used in reference to the interaction of an antibody and a protein or peptide means that the interaction is dependent upon the presence of a particular structure (i.e., the antigenic determinant or epitope) on the protein; in other words the antibody is recognizing and binding to a specific protein structure rather than to proteins in general. For example, if an antibody is specific for epitope "A", the presence of a protein containing epitope A (or free, unlabelled A) in a reaction containing labelled "A" and the antibody will reduce the amount of labelled A bound to the antibody.
The term "sample" as used herein is used in its broadest sense. A biological sample suspected of containing nucleic acid encoding histidine kinase may comprise a cell, chromosomes isolated from a cell (e.g., a spread of metaphase chromosomes), genomic DNA (in solution or bound to a solid support such as for Southern blot analysis), RNA (in solution or bound to a solid support such as for Northern blot analysis), cDNA (in solution or bound to a solid support) and the like. A sample suspected of containing a protein may comprise a cell, a portion of a tissue, an extract containing one or more proteins and the like.
"Alternations in the polynucleotide" as used herein comprise any alteration in the sequence of polynucleotides encoding histidine kinase, including deletions, insertions, and point mutations that may be detected using hybridization assays. Included within this definition is the detection of alterations to the genomic DNA sequence which encodes histidine kinase (e.g., by alterations in the pattern of restriction enzyme fragments capable of hybridizing to any sequence such as SEQ ID NOS:1, 3, 5, 7-10, or 14-17 �e.g., RFLP analysis!, the inability of a selected fragment of any sequence to hybridize to a sample of genomic DNA �e.g., using allele-specific oligonucleotide probes!, improper or unexpected hybridization, such as hybridization to a locus other than the normal chromosomal locus for the histidine kinase gene (e.g., using FISH with metaphase chromosomes spreads, etc.!).
A "variant" in regard to amino acid sequences is used to indicate an amino acid sequence that differs by one or more amino acids from another, usually related amino acid. The variant may have "conservative" changes, wherein a substituted amino acid has similar structural or chemical properties (e.g., replacement of leucine with isoleucine). More rarely, a variant may have "non-conservative" changes, (e.g., replacement of a glycine with a tryptophan). Similar minor variations may also include amino acid deletions or insertions (i.e., additions), or both. Guidance in determining which and how many amino acid residues may be substituted, inserted or deleted without abolishing biological or immunological activity may be found using computer programs well known in the art, for example, DNAStar software. Thus, it is contemplated that this definition will encompass variants of histidine kinase. Such variants can be tested in functional assays, such as growth inhibition assays.
The term "derivative" as used herein refers to the chemical modification of a nucleic acid encoding histidine kinase structures. Illustrative of such modifications would be replacement of hydrogen by an alkyl, acyl, or amino group. A nucleic acid derivative would encode a polypeptide which retains essential biological characteristics of naturally-occurring histidine kinase.
As used herein, the term "host cell" refers to any cell capable of expressing a functional gene and/or gene product introduced from another cell or organism. This definition includes the S. cerevisiae expression vector used to express C. albicans histidine kinase.
As used herein, the term "antifungal chemotherapeutic" refers to any substance or agent used in the treatment of fungal disease, infection or colonization. It includes fungicidal as well as fungistatic compounds which act on fungi in vitro, as well as in vivo.
As used herein, the term "osmosensing histidine kinase" refers to an enzyme that acts as a signal transduction histidine kinase. In particular, the term refers to histidine kinases that are components in two-component signal transduction systems. It is contemplated that the term encompass histidine kinases that are involved in various cell functions, including but not limited to small and/or large porin synthesis, osmolarity responses, cell wall assembly, etc.
EXPERIMENTAL
The following examples are provided in order to demonstrate and further illustrate certain preferred embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof.
In the following disclosure, the following abbreviations apply: eq (equivalents); M (Molar); .mu.M (micromolar); N (Normal); mol (moles); mmol (millimoles); .mu.mol (micromoles); nmol (nanomoles); g (grams); mg (milligrams); .mu.g (micrograms); ng (nanograms); l or L (liters); ml (milliliters); .mu.l (microliters); cm (centimeters); mm (millimeters); .mu.m (micrometers); nm (nanometers); .degree.MW (molecular weight); .degree.C. (degrees Centigrade); OD (optical density); EDTA (ethylenediamine-tetracetic acid); EGTA (ethyleneglycol-bis-(.beta.-aminoethyl ether)); SDS (sodium dodecyl sulfate); PAGE (polyacrylamide gel electrophoresis); UV (ultraviolet); bp (base pair); kb and kbp (kilobase pairs); YPD (yeast extract, Bacto-peptone and dextrose medium); PTC (40% polyethelene glycol 3300 �Sigma!, 50 mM Tris-HCl pH8.0, and 50 mM CaCl.sub.2); 0.05 M Pipes, pH 6.5 (0.05 sodium phosphate, 0.001 M EDTA, 0.1 M NaCl, 5% NaCl; IETGN buffer (20 mM imidazole-HCl pH 6.8, 1 mM EDTA, 1 mM EGTA, 12 mM monothioglycerol, 20% glycerol, 100 mM sodium chloride); KTED (0.3 M KCl, 0.01 M Tris-HCl, pH 7.4, 0.001 M EDTA, 0.001 M dithiothreitol); .mu.g/ml (microgram per milliliter); mm (millimeter);.times.g (times gravity); HPLC (high pressure liquid chromatography)1; DDT (dithiothreitol); PMSF (phenylmethylsulfonyl fluoride); KGlu (potassium glutamate); SSC (salt and sodium citrate buffer); SDS (sodium dodecyl sulfate); PAGE (polyacrylamide gel electrophoresis); Waters (Waters Corp., Milford, Mass.); Promega (Promega Corp., Madison, Wis.); BioRad (Bio-Rad Laboratories, Hercules, Calif.); NEB (New England Biolabs, Beverly, Mass.); USB (United States Biochemical, Cleveland, Ohio); Quiagen (Quiagen, Inc., Chatsworth, Calif.); Applied Biosystems (Perkin Elmer/Applied Biosystems, Foster City, Calif.); DIFCO or Difco (Difco Laboratories, Detroit, Mich.); GENSET (San Diego, Calif.); Wisconsin Genetics Computer Group (GCG) package; BRL (GIBCO BRL, Gaithersburg, Md.); Kodak (Eastman Kodak, Rochester, N.Y.); FGSC (Fungal Genetics Stock Center, Kansas City, Kans.); Dupont (Dupont, Wilmington, Del.); Fisher (Fisher Scientific, Pittsburg, Pa.); Cornell (Cornell University, Ithaca, N.Y.); Intelligenetics (Intelligenetics, Campbell, Calif.); GCG (Wisconsin Genetics Computer Group, University of Liverpool, U.K.); and Gene Codes (Gene Codes, Ann Arbor, Mich.).
The restriction enzymes used in these experiments are available from various sources, including NEB. Fungal media, such as Sabouraud's dextrose broth and agar are available from suppliers such as Difco.
EXAMPLE 1
In this Example, Neurospora crassa was grown and used as a source of DNA for identification of the histidine kinase gene. The E. coli strains and the plasmids used in subsequent experiments are also described.
A. Fungal and Bacterial Strains
Various N. crassa strains were obtained from FGSC, including wild-type (74-OR8-1a), os-1 (B135), os-1 (P3282), os-1 (UCLA-80), os-4 (NM2010), os-5 (NM2160), and cut (LLMI). In addition, an os-1 (NM233t) nic-1 strain was constructed by crossing a temperature-sensitive osmotic mutant os-1 (NM233t) with nic-1 (S1413a) (See, Selitrennikoff et al., Exp. Mycol., 5:155-161 �1981!). In order to isolate an os-1.sup.+ -containing fragment smaller than 9.3 kb, several DNA fragments were subcloned and assayed for complementation of os-1 (NM233t) nic-1.
The stock strains were grown at 25.degree. C., on solidified Vogel's medium N (See e.g., Davis and deSerres, Meth. Enzymol., 27A:79-143 �1970!), containing sucrose (1.5% w/v) ("VMS" medium). Strains that required nicotinamide were grown on media supplemented with nicotinamide (10 .mu.g/ml)("VMSN mediums). Benomyl (Dupont) was added to cooled (i.e., 45.degree. C.) VMSN medium to a final concentration of 1 .mu.g/ml. Osmotic mutants of N. crassa grown on slants of agar-solidified VMS had altered morphologies, appearing as dense, cropped mycelia, as compared with wild-type. The altered morphology was particularly apparent with the cut mutant. In addition, bright orange spots appearing as pockets of "liquid exudate" (i.e., as described by Grindle and Dolderson, Trans. Brit. Mycol. Soc., 87:457-487 �1986!) were observed with osmotic mutants.
In liquid VMSN, hyphae from each of the os mutants was similar to wild-type. However, when grown in VMSN medium supplemented with 4% (w/v) NaCl, the osmotic mutants had irregularly shaped hyphae compared to wild-type, and some hyphae resembled pseudoconidia. These observations indicated that the osmotic genes are important in the maintenance of normal cell morphology of N. crassa grown in media with high osmolarity levels.
E. coli strains XL-1 Blue and TB-1 (Stratagene) were maintained on LB medium (See e.g., Sambrook et al.,(eds.) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., �1989!).
B. Plasmids
Plasmid (pMO63), containing an allele of tub-2 that confers benomyl resistance as a 3.1 kb HindIII DNA fragment in pUC118 was used. pCE1 was constructed by self-ligation of a 13 kb HindIII DNA fragment of cosmid 12:4 D (Vollmer-Yanofsky genomic library; See, Vollmer and Yanofsky, Proc. Natl. Acad. Sci., 83:4869-4873 �1989!). The 12:4D cosmid contained approximately 35 kb of DNA that functionally complemented an os-1 mutant, as shown in FIG. 1. This cosmid was digested with a variety of restriction enzymes and the digests were used to transform competent os-1 (NM233t) nic-1 cells.
A cosmid vector, pSV50 that confers benomyl resistance was used to construct the N. crassa genomic DNA library (See, FIG. 4; Orbach et al., Mol. Cell. Biol., 6:2452-2461 �1986!; and Vollmer and Yanofsky, supra). pCE1 contained an ampicillin resistance gene, the origin of replication from pSV50 (originally derived from pBR322), and 9.3 kb of genomic N. crassa DNA sequence. A NotI/HindIII deletion of pCE1 ("pCE5") containing a 6.5 kb EcoR1/NotI (the EcoR1 site is in the polylinker of pCE1 adjacent to a Sau3AI site) DNA fragment of pCE1 inserted into a pBluescript SK.sup.- (Stratagene), was created, as well as the plasmid "pCE6." The pCE6 plasmid contained a 2.8 kb NotI/HindIII DNA fragment subcloned from pCE1. Two additional plasmids, were also created. The plasmid "pMMS100" contained a 7.0 kb EcoR1/SmaI DNA fragment subcloned from pCE1 into pBluescriptSK.sup.-, while the plasmid "pMMS108" is a partial XhoI deletion of pMMS100 that contained a 4.6 kb XhoI/SmaI DNA insert in Bluescript SK.sup.-.
EXAMPLE 2
In this Example, competent N. crassa spheroplasts were created from the strains and DNA described in Example 1. First, the os-1 gene was isolated from the Vollmer-Yanofsky N. crassa genomic library by a chromosome walk. (Vollmer and Yanofsky, supra). Cosmid "12:4D" containing approximately 35 kb of DNA functionally complementing an os-1 mutant was identified. Cosmid 12:4D DNA was digested with various restriction enzymes, and these digests were used to produce competent os-1(NM233t) nic-1 cells.
DNA-mediated transformations were accomplished using the method of Selitrennikoff and Sachs (Selitrennikoff and Sachs, Fungal Genet. News1., 38:92 �1991!). In this experiment, competent os-1 (NM233t), nic-1, and os-1 (B135) cells were transformed with the cosmid 12:4D, or co-transformed with subclones of 12:4D and pSV50 or pM063 at a molar ratio of approximately 5:1, respectively. As direct selection of transformants was not possible on 4% (w/v) NaCl medium (VMSN containing 1.5% sucrose) transformant colonies were initially selected for benomyl resistance.
Briefly, the DNA was premixed with heparin (25 .mu.l of a 125 .mu.g solution), to which 0.1 ml of a spheroplast (approximately 5.times.10.sup.7 cells) preparation were added and, the mixtures were incubated on ice for 30 minutes. Lipofectin (3.5 .mu.g/ml) was added, and incubation continued for 15 minutes at room temperature. Then, 1 ml of PTC was added, gently mixed, and the suspensions were incubated 20 minutes at room temperature. The suspensions were added to VMSN media containing benomyl, incubated for 2-3 days, and then transferred to solid VMSN slants containing 4% (w/v) NaCl, and grown for 2-3 days. Control VMSN slants that did not contain NaCl were also inoculated and incubated. Complementation of the os-1 mutant salt-sensitive phenotype was then scored. Transformants of the temperature-sensitive os-1 mutants were grown at 37.degree. C., while transformants of the non-temperature sensitive os-1 mutant were grown at 26.degree. C.
Introduction of a HindIII digest of 12:4D DNA into os-1 (NM233t) nic cells resulted in the production of several transformants that grew in a manner similar to wild-type on NaCl-supplemented media at 37.degree. C., suggesting that HindIII did not cut within the functional os-1.sup.+ gene. Subsequently, a HindIII fragment of 12:4D was subcloned as "pCE1" (described in Example 1). pCE1 contained a 9.3 kb genomic DNA fragment that complemented the os-1 mutant (See, FIG. 1). FIG. 1 illustrates the subcloning of os-1.sup.+ by functional complementation. In this Figure, subclones are indicated as an expanded region of the cosmid 12:4D. FIG. 1 also shows that pCE1 was not able to complement os-1. In addition, a NotI/HindIII DNA deletion of pCE1 (pCE5) was not able to complement os-1. Furthermore, the pCE6 clone (i.e., a cloned NotI/HindIII DNA fragment) did not complement the os-1 mutant, suggesting that the NotI site is within a functional part of the os-1.sup.+ gene. However, a SmaI/HindIII deletion of pCE1 (i.e., "pMMS100") complemented os-1 NM233t) nic-1, whereas a partial XhoI deletion of pMMS100 ("pMMS108") did not complement, suggesting that the os-1.sup.+ gene is contained within the 7.0 kb Sau3A/SmaI genomic DNA fragment of pMMS100. In addition, transformation of a non-temperature sensitive mutant os-1 (B135) with pMMS100 resulted in complementation of the salt-sensitive phenotype.
The results of these experiments indicated that a functional os-1.sup.+ gene was encoded on the genomic fragment contained in pMMS100. In order to provide additional data to support this conclusion, the growth (i.e., the linear growth rate) of pMMS100 transformants, os-1 mutants, and wild-type were quantitated on agar-solidified medium with and without 4% (w/v) NaCl in race tubes (See, Davis and deSerres, Meth. Enzymol., 27A:79-143 �1970!), containing agar-solidified VMSN medium supplemented with 4% (w/v) NaCl as needed. The race tubes were constructed from 25 ml disposable pipets (e.g., Fisher) according to the method of White and Woodward (White and Woodward, Fungal Genet. Newsl., 42:79 �1995!). Growth distances were measured relative to the origin of inoculation after 16, 24, 40, 48, and 64.5 hours of incubation at 37.degree. C. Plots of the linear growth distance showed that the growth rates of wild-type, os-1 mutants, and pMMS100-transformed os-1 mutants were essentially identical on media without NaCl. However, on media supplemented with 4% (w/v) NaCl, pMMS100-transformed os-1 mutants showed a restored osmotolerant phenotype, as evidenced by 18- to 26-fold differences between the growth rates of the recipient strains, os-1 (NM233t) nic-1 and os-1 (B135), and the pMMS100-transformed strains (MMS100t-16 and MMS100b-2). These results indicated that a functional os-1.sup.+ gene was located on the 7 kb genomic fragment of pMMS100.
EXAMPLE 3
In this Example, the DNA sequence of the N. crassa os-1 was determined. Approximately 6.5 kb of the 7.0 kb DNA fragment of pMMS100 was sequenced on both strands from restriction sites BglII to SmaI, as shown in FIG. 2. DNA sequencing and primer syntheses were done by DNA Services (Cornell). Sequence analyses were performed using MacVector.TM. (Kodak), the basic local alignment search tools, BLAST (S. F. Altschul et al., J. Mol. Biol., 215:403-410 �1990!; PROSITE (A. Bairoch, Nucl. Acids Res., 21:3097-3103 �1993!); and P/C Gene (Intelligenetics). The os-1.sup.+ DNA nucleotide and deduced Os1p amino acid sequences have been deposited with GenBank (accession number: U53189)(SEQ ID NOS:1 and 2, respectively).
Nucleotide sequence analysis indicated a predicted open reading frame (ORF) of approximately 4.1 kb, interrupted by four introns as shown in FIG. 2. The os-1 start of translation was identified by sequence similarity to an N. crassa-specific start of translation consensus sequence (i.e., Kozak sequence). Similarly, introns were identified by searching for N. crassa-specific intron consensus sequences (See e.g., J. J. P. Bruchez et al., Fungal Genet. Newsl., 40:89-96 �1993!). The introns ranged in size from 53-66 base pairs. Three sets of sequences that were similar to the N. crassa-specific start of transcription consensus sequence were identified 714-881 base pairs upstream of the predicted start of translation, as indicated by the arrow in FIG. 2. Also in FIG. 2, predicted exons are indicated as large rectangles, while introns are indicated as gaps between the rectangles, the H-box, D-box, and ATP-binding motif are also indicated.
Translation of the ORF predicted a 1298 amino acid protein (Os1p), with a molecular weight of approximately 142 kDa, and a calculated pI of 5.3. A BLAST comparison of Os1p with protein sequences in several databases indicated similarity with sensor histidine kinases of bacteria and yeast (described in Example 4, below).
FIG. 3 shows an amino acid sequence alignment of Os1p with BarA (bacterial adaptive response) of E. coli (See, Nagasawa et al., Mol. Microbiol., 6:799-807 �1992!), RepA (required from production of extracellular enzymes) of Pseudomonas viridflava (C.-H. Liao et al., Mol. Plant-Microbe Interact., 7:391-400 �1994!), ApdA (antibiotic production) of Pseudomonas fluorescens (N. Corbell and J. E. Loper, J. Bacteriol., 177:6230-6236 �1995!), and Sln1p of Saccharomyces cerevisiae (I. M. Ota and A. Varshavsky, Science 262:566-569 �1993!). In this Figure, the sequence alignments are shown based on data obtained with BLAST, MacVector, and PC/Gene analysis tools. Shaded areas indicate sequence identities; while diamonds (.diamond-solid.) at Os1p His.sup.718 and Asp.sup.1136 indicate the presence of putative phosphoryl group acceptors; underlined sequences indicate hydrophobic regions in Os1p, BarA, ApdA, and Sln1p, filled circles (.circle-solid.) and open triangles(.DELTA.) indicate Os1p h- and c-regions, respectively, of a potential signal sequence. The arrow indicates a potential signal peptidase cleavage site.
As shown, sequence similarity was noted between Os1p and BarA. The overall sequence identity of Os1p with BarA, RepA, and ApdA was found to be approximately 11%, whereas Sln1p shares approximately 7% identity. The following Table provides a comparison of the D-box receiver domains of skn1p, os1p, sln1p, and BarA.
TABLE 2______________________________________Comparison of D-Box Receiver DomainsD-Box Receiver Domain Sequence SEQ ID NO:______________________________________skn7p RYDLVLMDIVMPNLD SEQ ID NO: 24os1p KFDVILMDVQMPIMG SEQ ID NO: 25s1n1p NYNMFIMDVQMPKVD SEQ ID NO: 26BarA PFDLILMDIQMPDMD SEQ ID NO: 27______________________________________
Table 3 shows the regions of homology between the amino acid sequences of Os1p, BarA, RepA, ApdA, and Sln1p.
TABLE 3______________________________________Regions of Protein Sequence HomologyProtein H-Box D-Box ATP-Binding Domain______________________________________Os1p 698-843 1093-1203 870-931BarA 282-427 674-782 451-512RepA 253-398 652-763 422-483ApdA 274-419 673-784 443-504S1n1p 556-703 1081-1207 859-920______________________________________
For the Os1p regions 698-843, 870-931, and 1093-1203, shared amino acid sequence identity with BarA, RepA, and ApdA was found to be 40%, 45%, and 34%, respectively. The Sln1p sequence identity with Os1p in these regions were 27%, 40%, and 22% , respectively. These three domains are characteristic of histidine kinases and aspartate response regulator modules of signal-transduction proteins that couple environmental signals to adaptive responses (See e.g., B. Morgan et al., Trends Cell. Biol., 5:453-457 �1995!; M. Perego and J. Hoch, Trends Genet., 12:97-101 �1996!; and J. B. Stock et al., Nature 344:395-400 �1990!).
Os1p contains amino acid residues that are conserved among histidine kinases, including the presumed phosphoryl group acceptors His.sup.718 and Asp.sup.1136 (See, FIG. 3). As indicated in Table 3, the Os1p region 698 to 843 comprises the H-box domain and the 1093 to 1203 region comprises the D-box domain. Os1p also has a conserved ATP-binding motif that is identical to the motif defined for bacterial and yeast response regulator modules (See, Ota and Varshavsky, supra; Parkinson et al., Ann. Rev. Genet., 26:71-112 �1992!; and Perkins et al., Microbiol. Rev., 46:426-570 �1982!). As described in Examples 6-9 below, the cos-1 gene of C. albicans has a high degree of similarity with os-1.
Sln1p, BarA, RepA, and ApdA each have two hydrophobic regions located near the amino terminus that are potential membrane-spanning domains (See, N. Corbell and J. E. Loper, J. Bacteriol., 177:6230-623 �1995!; C.-H. Liao et al., Mol. Plant-Microbe Interact. 7:391-400 �1994!; S. Nagasawa et al., Mol. Microbiol., 6:799-807 �1992!; and I. M. Ota and A. Varshavsky, Science 262:566-569 �1993!). Os1p differs from these regions by having a hydrophobic region at the amino terminus (See, FIG. 3) characteristic of a signal sequence for selective intracellular distribution to the endoplasmic reticulum or the mitochondrial inner membrane (R. H. Davis and F. J. DeSerres, Meth. Enzymol., 27A:79-143 �1970!; and L. M. Gierasch, Biochem., 28:92 �1989!). In addition, Os1p amino acid residues 4-19 contain the hallmarks of a signal sequence (See, L. M. Gierasch, supra), including a central hydrophobic region ("h-region") and a more polar c-terminal region ("c-region"). Furthermore, between Os1p amino acid residues A.sup.18 and V.sup.19, there is a potential signal peptidase cleavage site (See, FIG. 3), that conforms to the -3,-1 rule (See, Davis and DeSerres, supra; G. von Heijne, Nucleic Acids Res., 14: 4683-4690 �1986!; and K. Larsson et al., Mol. Microbiol. 10:1101-1111 �1993!). These observations suggest that the Os1p amino terminal domain (i.e., residues 4-19) is a signal sequence that may initiate intracellular distribution of Os1p.
Additional protein sequence analysis indicated the potential presence of eight potential N-glycosylation sites, one potential tyrosine kinase phosphorylation site (Tyr.sup.1028), one potential amidation site (Gly.sup.1230), and one potential cell attachment sequence (Arg.sup.196 -Gly.sup.197 -Asp.sup.198). Other sites identified include 18 potential protein kinase C phosphorylation sites, 20 potential casein kinase II phosphorylation sites, and 17 potential myristylation sites.
EXAMPLE 4
In this Example, an alternative method for identification of the N. crassa histidine kinase gene was developed.
In these experiments, the N. crassa strain 74-OR23-1VA (mating type A. 74A; no. 2489) obtained from the FGSC was used as the source for purification of genomic DNA and mRNA unless otherwise noted. Genomic DNA for PCR was prepared from isolated N. crassa nuclei. The N. crassa strain used for electroporation is known as "Stadler" (mating type a; characterized as pdx-1his-2.DELTA.mtr) obtained from D. Stadler (University of Washington). Handling techniques and growth media for N. crassa are described by Davis and deSerres (R. H. Davis and F. J. deSerres, Meth. Enzymol., 17:79-143 �1970!).
In these experiments, all common molecular biological manipulations were carried out according to standard methods (See e.g., F. M. Ausubel, Current Protocols in Molecular Biology, Wiley, N.Y. �1994!). Reverse transcriptase coupled (RT)PCR was performed as described by J. T. Aatsinki et al., (J. T. Aatsinki et al. BioTechn., 16:282-288 �1994!), except that the primer concentrations were increased to 1.5 .mu.M. Sequencing of DNA templates was done with Sequenase (USB), or by Taq cycle sequencing using dye primer or dye terminator chemistry on an automated sequencer (Applied Biosystems model 373) according to the manufacturer's specifications.
Alignment of histidine kinase members was accomplished using the PILEUP program from the Wisconsin Genetics Computer Group (GCG) package. The following primer to the H box (H1A) was made CA(T/C)GAI(A/T/C)TI(C/A)GIACICICC (SEQ ID NO:7), and served as the forward PCR primer. The reverse primers were synthesized to code for the N box: N1A, GT(A/G)AA(T/C)TTIAIIGC(A/G)TT (SEQ ID NO:8): N2A, GC(A/G)TTIC(T/C)IACIA(G/A)(G/A)TT (SEQ ID NO:9). In these sequences, "I" is deoxyinosine). All primers were purified by electrophoresis through an acrylamide gel (20%/7 M urea) followed by purification over a Sep-Pak C.sub.18 column. PCR mixtures contained 2.5 .mu.M each primer, 1.4 .mu.g of genomic DNA, 2.5 mM each dATP, dGTP, dCTP, and dTTP in 10 mM Tris-HCl pH 8.3/50 mM KCl/0.001% gelatin/0.5 unit of AmpliTaq (Perkin-Elmer/Cetus) in a total volume of 100 .mu.l. Primers, buffer, and DNA templates were mixed and heated (95.degree. C. for 10 min) in a Perkin-Elmer/Cetus thermocycler and then cooled to 4.degree. C. Nucleotides and polymerase were added and reactions mixtures were cycled 25-30 times at 94.degree. C. (1 min), 40.degree. C. (1 min), and 72.degree. C. (1 min) followed by a 10-min extension at 70.degree. C. Amplification products were purified by electrophoresis through a 1.5% agarose gel, cloned into a T-vector (Promega), and subsequently sequenced. Sequence analysis was done using Sequencher (version 2.1, Gene Codes) and the GCG package. Homology searches and sequence comparisons were performed using the BLASTX and BESTFIT programs of the GCG package.
Genomic and cDNA Cloning of os-1.sup.+
Approximately 150,000 clones from a .lambda.J1 genomic library (FGSC) were screened with a randomly primed os-1.sup.+ PCR product (Prime-a-gene, Promega) obtained by amplification of N. crassa genomic DNA with the H1A and N2A primers. Positive clones were isolated, digested with BamH1 and grouped by common hybridization patterns. A 5.5-kb BamHI fragment was cloned into BamHI-digested pUC18 to yield pHK1. This clone contained the kinase domain as verified by sequence analysis. pHK1 served as a template for the genomic sequencing of os-1.sup.+, which was accomplished by a combination of primer walking, sequencing small subclones, and sequencing deletion subclones in M13 (R. M. Dale et al., Plasmid 13:31-41 �1985!). The genomic sequence of os-1 is shown in SEQ ID NO:5 and os1p is shown in SEQ ID NO:6, while the cDNA sequence of os-1 is shown in SEQ ID NO:3, and os1p is shown in SEQ ID NO:4.
Approximately 106 clones from the Orbach and Sachs cDNA library (Orbach et al., J. Biol. Chem., 265:10981-10987 �1990!; obtained through FGSC) were screened with the os-1.sup.+ kinase domain PCR product. Two sets of clones were obtained and designated "M1" and "M10," which started at nucleotides 3285 and 3760 of the genomic sequence, respectively. Both strands of these clones were entirely sequenced. RT-PCR was used to walk upstream of the 5' end of M1 and subsequently clone the entire cDNA coding for os-1.sup.+. All RT-PCR products were cloned into a T-vector and sequenced. Primer extension with the oligonucleotide NK45 (GAGAGCTGGCTGATCTGTTG) (SEQ ID NO:10), revealed the transcription start site 969 bases upstream of the initiator AUG of the Os-1 protein (See e.g., SEQ ID NOS:3 and 4; and GenBank U50263).
Analysis of the alignment of several members of the histidine kinase family showed that there is a subclass of kinases that contain both a kinase domain and a response regulator domain, termed "hybrid kinases" (See e.g., L. A. Alex and M. I. Simon, Trends Genet., 10:133-138; R. V. Swanson et al., Trends Biochem. Sci., 19:485-490 �1994!; and J. S. Parkinson and E. C. Kofoid, Ann. Rev. Genet., 26:71-112 �1992!). Two eukaryotic kinases, "ETR1" and "SLN1," are members of this subclass.
Degenerate primers corresponding to the H box consensus (H(E/D)(M/I/L/F)RTP (SEQ ID NO:11) and N box NLV(S/G)NA(I/V)KFT (SEQ ID NO:12) were designed and used to amplify genomic DNA from N. crassa. Two PCR products (designated "nik-1" and "nik-2") were obtained, which upon sequencing were found to encode domains homologous to two-component histidine kinases. Southern blot analysis of genomic DNA from N. crassa with each PCR product showed that each product corresponded to a unique gene. The gene corresponding to the os-1.sup.30 PCR product was cloned and its function in N. crassa determined.
The os-1.sup.+ PCR product was used as a probe to screen N. crassa genomic and cDNA libraries in order to clone the os-1.sup.+ gene (See, FIG. 1). The 5' untranslated region is rich in structure and includes an intron of 100 bp. Also, this region is rich in repetitive nucleotide elements, the first of which is the sequence (AGTC).sub.6 . . . (GATC).sub.6 (SEQ ID NO:13), which has the possibility of forming a stem-loop structure. Next, the repeat "TACC" is present in tandem 10 times followed shortly by two more repeats. This repeat has also been noticed in the 5' untranslated region of the nit-3.sup.+ gene in N. crassa, although its significance remains unknown (See, P. M. Okamoto et al, Mol. Gen. Genet., 227:213-223 �1991!). The TACC repeat is followed by a purine-rich segment. The four introns found in os-1.sup.+ have consensus splice sites that agree with those found in other genes from N. crassa (J. J. P. Bruchez et al., Fungal Genet. Newsl., 40:89-96 �1993!).
Analysis of the predicted amino acid sequence showed that Os1p is a member of the hybrid class of histidine kinases that contain both a kinase and response regulator domain. The starting AUG is contained within the sequence (GCCCACAATCATGAC) (SEQ ID NO:14) consistent with other genes in N. crassa (Bruchez et al., Fungal Genet. Newsl., 40:85-88 �1993!). Os1p is most similar to the kinase and regulator regions (57%) of the BarA protein from Escherichia coli (S. Nagasawa et al, Mol. Microbiol., 6:799-807 �1992!). The function of BarA is not known, but it can apparently act as a multicopy suppressor in a strain that lacks the osmosensor EnvZ (See, S. Nagasawa et al., supra).
The Os1p protein is novel in that the N-terminal end of the polypeptide contains a unique 90-amino acid motif, which is repeated 5 times, followed by a short sixth truncated repeat. The N-terminal repeat region has a high probability of forming a coiled-coil structure when analyzed with the algorithm of Lupas and Stock (A. Lupas et al., Science 252:1162-1164 �1992!). A computer search using the BLAST program revealed that the N-terminal end of Os1p shares homology �P(N), 1.2.times.10.sup.-6 ! with bacterial sensory transducers, most notably Htr1 which functions to couple sensory rhodopsin to a soluble histidine kinase, and thus regulate phototaxis in Halobacterium salinarium (V. J. Yao and J. L. Spudich, Proc. Natl. Acad. Sci., 89:11915-11919 �1992!). Analysis of the distribution of polar and hydrophobic residues in the amino acid sequence of Os1p suggested that the protein is soluble.
EXAMPLE 5
In this Example, the role of os-1.sup.+ in development of N. crassa was investigated.
RNA Preparation
Total RNA was prepared from N. crassa at various stages of development as described by Reinert et al., (W. R. Reinert, Mol. Cell. Biol., 1:829-835 �1981!). For mycelial RNA, cultures were harvested after 8-16 hours of growth in Vogel's 1.times. liquid medium at 30.degree. C., as described by Davis and deSerres (Davis and deSerres �1970!, supra). For germlings, conidia (10 cells per ml) were grown (3 hours at 30.degree. C.) in Vogel's 1.times. liquid medium. Protoperithecia were prepared by inoculation with a drop of conidial suspension onto a cellophane paper placed on the surface of a Westergaard's plate (See e.g., Davis and deSerres �1970!, supra) and growth was allowed to proceed in the light at 25.degree. C., until protoperithecia were visible (approximately 8 days). Cells were scraped from the cellophane and RNA was prepared as described above. All mRNA fractions were purified using Oligotex resin (Qiagen).
Expression of os-1.sup.+ was found to be stage specific as the transcript (5.5 kb by Northern analysis) could be detected by RT-PCR of mRNA only during the vegetative phase of N. crassa life cycle and not after differentiation into the sexual phase.
To determine whether Nik-1 is important for fungal development, a deletion mutant was created by replacing os-1.sup.+ with the his-2.sup.+ gene as illustrated in FIG. 5. FIG. 5 is a schematic representation of the genomic DNA structure of wild-type and .DELTA.os-1.sup.- strains. In this Figure, the restriction sites are indicated as follows: Bg, BglII; B, BamHI; RV, EcoRV; and N, NheI.
In this experiment, the plasmid pKB49 was used. pKB49 contains the his-2.sup.+ gene on a 5-kb HindIII fragment subcloned from a cosmid provided by Dorsey Stuart (University of Hawaii). The his-2.sup.+ marker was isolated as a 5-kb HindIII fragment from pKB49 and the ends were made blunt with Klenow fragment. The fragment of pHK1 from the EcoRV site upstream of the os-1 translational start site to the NheI site was removed and the NheI ends were made blunt with Klenow fragment. The blunt-ended his-2.sup.+ fragment was ligated into the modified pHK1 to yield "pHK1.DELTA.nik-1::his-2.sup.+ ". The BamHI fragment of pHK1.DELTA.os-1::his-2.sup.+ containing the his-2.sup.+ insertion was used to electroporate (15) conidia from the Stadler strain (pdx-1his-2.DELTA.mtr) of N. crassa obtained from David Stadler (University of Washington). Transformants were selected for histidine auxotrophy on minimal sorbose plates with regeneration agar (See e.g., Case et al., Proc. Natl. Acad. Sci., 76:5259-5263 �1979!) containing pyridoxine hydrochloride (pdx) (10 .mu.g/ml). Approximately 50 transformants were picked from plates onto 1.times. Vogel's minimal medium slants containing pdx ("VMpdx").
Genomic DNA was isolated from each of these 50 strains (See, R. L. Metzenberg and J. N. Stevens, Neurospora Newsl., 35:28 �1982!), digested with BglII and EcoRV, and transferred onto nylon. Blots were probed with a PCR product to the upstream region of os-1.sup.+ (i.e., nucleotides 325-615). Clones containing the desired bands were then subjected to three or four rounds of plating to isolate homokaryons, which were identified by Southern blot analysis (not shown) as well as PCR of genomic DNA with nik-1.sup.+ -specific primers NK7 (GTCCTCCAAGTACCCTG) (SEQ ID NO:15) and NK16 (GATCAGCTACGGACTTTC) (SEQ ID NO:16).
The plasmid pKB49 was electroporated into Stadler and clones were subsequently purified in the same manner to yield clone "49-9-5," which served as the wild-type control. DNA from the mutant and wild-type strains were probed with the his-2.sup.+ gene to ensure that multiple copies of the gene were not integrated in the genome.
It was apparent that there were morphological phenotypes associated with the mutant during the vegetative phase. The hyphal structures of .DELTA.os-1 mutant and wild-type cultures were observed microscopically. In the mutant, many of the aerial hyphae became swollen and misshapen and appeared to lyse. Macroscopically, aerial hyphae of the mutant had the appearance of cotton candy, growing as a mass that filled the culture tube, with large areas of lysis visible. Conidia could be formed by the mutant, but they were adherent and not readily disposed in comparison to wild-type conidia. Finally, upon exposure to light, the mutant turned a deep orange or flame color when grown on small agar slants, whereas the wild type was normally peach colored. Therefore, loss of os-1.sup.+ function apparently impaired normal vegetative development in N. crassa.
The sexual phase of the growth cycle was examined by placing the mutant on Westergaard's medium in slants. Protoperithecia became visible and these could differentiate into perithecia upon fertilization with conidia from a wild-type strain, 74A. Spores could be obtained from this cross but at reduced numbers, which may be due to inactivation of the his-2 marker by the process of repeat induced point mutation in N. crassa (E. U. Selker, Ann. Rev. Genet., 24:579-613 �1990!). The ability of .DELTA.os-1 mutants to be fertilized is consistent with the expression pattern of the gene during development.
EXAMPLE 6
In this Example, the osmosensitivity of os-1 mutants was investigated.
The characteristics of the .DELTA.os-1 mutant resembled those of osmosensitive N. crassa mutants whose morphologies are drastically affected by humidity (See e.g., D. D. Perkins et al, Microbiol. Rev., 46:426-570 �1982!). The morphology of the .DELTA.os-1 mutant appeared to be more similar to that of wild type when cultures were grown in large flasks or slants as opposed to small slants. Thus, the tolerance of the .DELTA.os-1 mutant to different osmolytes was tested. Growth of the mutant and wild type cultures were the same on Vogel's minimal medium plates. However, growth on 1 M sorbitol/0.7 M NaCl, (or 1 M KCl) resulted in restricted colonial growth. In addition, the hyphae were excessively branched and bumpy, and aerial hyphae were nonexistent, resulting in a subsequent abrogation of conidia formation. Therefore, it was apparent that the os-1.sup.+ deletion manifested itself dramatically under conditions of high osmostress.
The growth response of the mutant in shaking liquid culture was also monitored. Normally, N. crassa can grow as a mycelium in submerged shaking liquid culture although it does not conidiate (M. L. Springer, supra). While wild type cultures grow as a mycelium with the addition of 1 M sorbitol, NaCl, or KCl to the medium, the growth of the mutant was significantly impaired; it tended to form small clumps of irregular-shaped hyphae that were hyper-branched and swollen. These results indicated that the mutant is unable to form a well-defined mycelium under conditions of high osmotic stress
EXAMPLE 7
In this Example, C. albicans was grown and used as the source for genomic DNA in subsequent experiments.
Candida albicans strain 366 (ATCC 56884) was obtained from the ATCC, and grown in PYG. An aliquot of actively growing culture was added to Manning and Mitchell's basic salts medium (0.5% w/v (NH.sub.4).sub.2 SO4, 0.02% w/v MgSO.sub.4 .smallcircle. 7H.sub.2 O, 1.4% K.sub.2 HPO.sub.4, 0.6% w/v KH.sub.2 PO.sub.4, 0.5% w/v NaCl, 1.25% w/v glucose, and 1.times.10.sup.-4 % w/v biotin), mixed, and incubated with shaking (180 rpm), at 37.degree. C. for approximately 30 hours to mid-log phase, as described by Manning et al. (Manning and Mitchell, J. Bacteriol., 142:714-719 �1980!).
C. albicans DNA was prepared using the method of Scherer and Stevens (Scherer and Stevens, Proc. Natl. Acad. Sci., 85:1452-1456 �1988!). Briefly, exponentially growing cells were washed with 1 M sorbitol. Protoplasts were prepared by resuspending the cells 10-fold concentrated in 1 M sorbitol/50 mM potassium phsophate, pH 7.4, 14 mM 2-mercaptoethanol, and 100 .mu.g zymolyase 100T (Miles) per ml, and incubated for 30 minutes at 30.degree. C. The protoplasts were pelleted and resuspended in 50 mM Na.sub.3, 0.2% SDS (NaDodSO.sub.4) with 100 .mu.g of proteinase K per ml. This was incubated for 3 hours, at 50.degree. C. The DNA was then extracted three times with phenol:chloroform (1:1), and precipitated with 2 volumes of ethanol. The DNA was resusupended in 10 mM Tris HCl, pH 7.5, 1 mM Na.sub.3 EDTA (TE buffer) with 10 .mu.g RNase A per ml. After overnight (i.e., approximately 18-24 hours), at 4.degree. C., the DNA was precipitated with 2 volumes of 2-propanol, and resuspended in TE buffer.
EXAMPLE 8
In this Example, the C. albicans cos-1 gene was amplified by PCR, and then sequenced compared with other histidine kinase genes in subsequent Examples. C. albicans (ATCC #36801) was grown as described below. Briefly, cells were grown overnight at 30.degree. C. with shaking in YPD (1% yeast extract, 2% peptone, 2% glucose). The culture was harvested and resuspended in 5 ml lysis buffer (50 mM citrate/phosphate, pH 5.6, 40 mM EDTA and 1.2 M sorbitol). Zymolyase was added (15 mg) and the suspension incubated at 37.degree. C. for 60 minutes. After centrifugation (3000 rpm for 5 minutes) the pellet was resuspended in 5.times. TE 15 ml. To the resuspended pellet, 1.5 ml of SDS (10%) was added and incubation continued for 5 minutes at 65.degree. C. Then, the mixture was incubated on ice (30 min) following the addition of 5 ml potassium acetate (5 M). The mixture was then centrifuged (5000 rpm for 15 min) and the supernatant filtered through cheesecloth. The clarified supernatant was then preciptated with isopropanol, resuspended in 5.times. TE, and incubated with RNase. Then, the DNA was phenol extracted, EtOH precipitated, and resuspended in water, as described by Moreno et al., Meth. Enzymol., 194:795-823 �1991!).
PCR was then conducted on the DNA samples. The following primer to the H box was made with the sequence CA(T/C)GAI(A/T/C)TI(C/A)GIACICICC (SEQ ID NO:7) and served as the forward PCR primer. The reverse primers were synthesized to code for the N box: for N1A, the sequence was GT(A/G)AA(T/C)TTIAIIGC(A/G)TT (SEQ ID NO:8); while for N2A, the sequence was GC(A/G)TTIC(T/C)IACIA(G/A)TT(I)(SEQ ID NO:9). All primers were purified by electrophoresis through an acrylamide gel (20%/7 M urea) followed by purification over a Sep-Pak C18 column (Waters).
PCR mixtures contained 2.5 mM of each primer, 1.4 .mu.g of genomic C. albicans DNA, 2.5 mM each dATP, dGTP, dCTP and dTTP, 10 mM Tris HCl pH 8.3, 50 mM KCl, 0.001% gelatin, and 0.5 unit of AmpliTaq (Perkin-Elmer/Cetus) in a total volume of 100 .mu.l. Primers, buffer, and DNA templates were mixed and heated (95.degree. C. for 10 min) in a thermocycler (Perkin-Elmer/Cetus), and then cooled to 4.degree. C. Nucleotides and polymerase were added and reactions mixtures were cycled 25-30 times at 94.degree. C. (1 min), 40.degree. C. (1 min) and 72.degree. C. (1 min), followed by a 10 minute incubation at 70.degree. C. The samples were then electrophoresed in a 1.5% agarose gel, cloned into a T-vector (Promega) and subsequently sequenced.
Alignment of histidine kinase members was accomplished using the PILEUP program from the Wisconsin Genetics Computer Group (GCG).
EXAMPLE 9
In this Example, a genomic DNA library of C. albicans was constructed by digesting total genomic C. albicans DNA with HindIII (NEB). The DNA was size-fractionated on a 0.8% (w/v) agarose gel, fragments between 8 and 10 kb were eluted and ligated with a HindIII-digested calf intestinal alkaline phosphatase-treated pUC21 (GenBank accession #M74307; See, Vierra and Messing, Gene 100:189-194 �1991!; SEQ ID NO:23) for 20 h at 12.degree. C. The ligation mixture was used to transform competent E. coli DH5.alpha. cells (BRL), and 9,000 transformants were screened with the PCR product pC1-3 (the DNA sequence of pC1-3 is shown in SEQ ID NO:21, and the amino acid sequence is shown in SEQ ID NO:22)
One positive clone designated as "pMC1" was identified and its 9.0 kb HindIII insert was sequenced using methods known in the art. Briefly, the 9.0 kb HindIII fragment was sequenced by the DNA services at the University of Colorado Health Sciences Center and the California Institute of Technology by primer walking. Primers were synthesized by GENSET, and the California Institute of Technology. The DNA sequences were analyzed using MacVector.TM. (Eastman Kodak, Rochester, N.Y.), the basic local alignment search tool (BLAST) and PC/Gene analysis tools. The cos-1 DNA nucleotide and deduced amino acid sequences were deposited with Genbank (Accession number: U67785)(SEQ ID NOS:17 and 18). In SEQ ID NO:17, the coding region begins at nucleotide 433 (i.e., the first residue in the ATG start codon), corresponding to the methionine at position 145 in the complete amino acid sequence. The coding region of SEQ ID NO:17 ends at nucleotide 3776 (i.e., the first residue in the stop region). SEQ ID NO:18 provides the amino acid sequence of the coding region.
EXAMPLE 10
In this Example, PCR was used to determine whether cognates of skn7 are present in humans and medically important fungi. In these experiments, primers capable of amplifying skn7-specific DNA were prepared and used in PCR with template DNAs from various sources (e.g., human, C. albicans, and A. fumigatus). The forward primer was 5-CCACCATAAATAGCAACGTC-3' (SEQ ID NO:19), and the reverse primer was 5'-GGACTCTAAATTCTGGATGC-3' (SEQ ID NO:20). The PCR mixtures contained 2.5 .mu.M of each primer, 50 ng of genomic DNA, 10 mM dNTP, and polymerase buffer (total volume of 50 .mu.l). Primers, buffers, and nucleotides were mixed and heated at 94.degree. C. for 5 minutes in a thermocycler and then cooled to 40.degree. C. for 5 minutes. Taq polymerase (0.5 units) was added to the mixtures, and the reactions were cycled 30 times at 94.degree. C. (1 minute), 40.degree. C(1 minute) and 72.degree. C. (2 minutes), followed by a 7 minute extension at 72.degree. C. The reaction products were separated by agarose gel electrophoresis and stained with ethidium bromide. A duplicate gel was also prepared, and blotted and probed with radiolabelled skn7 DNA.
PCR products were observed for C. albicans and A. fumigatus (as well as the positive control, S. cerevisiae). However, no PCR products were observed in reactions with human DNA as template. These results indicated that cognates of skn7 are present in C. albicans and A. fumigatus, as well as S. cerevisiae. Thus, it is contemplated that skn7 and its cognates will be developed as targets for development of antifungals (i.e., as a screen for inhibitors of these pathways).
All publications and patents mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in molecular biology or related fields are intended to be within the scope of the following claims.
__________________________________________________________________________# SEQUENCE LISTING- (1) GENERAL INFORMATION:- (iii) NUMBER OF SEQUENCES: 36- (2) INFORMATION FOR SEQ ID NO:1:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 6545 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:- AGATCTTGGT CATGAACGTG GACGGCTCGA TGTGAGAAGT GAAACCCAAG AT - #ATAATGCT 60- CAAAGGGTTC CATACATACG CAGTACTGCG TAGTGTACAT CAAGTCATAC GC - #GCAGAGCA 120- CAGACCACCC ATACAATATC AACCCTCAGG TCCCAAGGGG CCAAGCACGG CA - #GCACCACA 180- AGCAAGAGGA AGCAACCAAG AAGCCCGAGT TCAGTTCATT GCCTGCCTTG CC - #GTGCAGGA 240- AGCGCAGCCA GCGCTGATCC CTCCCTTACT CGGCGCACTC GGCCGGCAAA CA - #ACCCCACC 300- AGCCCACCCC CATCCCGTTT CTGCGGCCTC TCGTCTCTCT TCCTGCGCGG CT - #GTGAAGCA 360- TGGAAATCAA CTGGAGAGCC AAAGGGGAAG ACCTGAAGAC GGGAGATTAC CT - #TAGCAAGC 420- ACTGGAGAGG CTTCGTTCTT CTCTGACTTC CTTTGACCCT GCCTGGTGTT TG - #ACCTCGCC 480- CAGTAACAAC AACAACAACA ACAACAACAA CAACAGACCA CTCCGGGCAA CA - #AGTCTCAG 540- ACCTTGGATC CGCCCTCCAC CCTCGTCGTC CGCGCGCCGC CATTATCCTT GT - #TGGCCATC 600- GTCGGCCCTG TCCCTTTCTC ATCCCATCCG TTTTCCCTTT CAGAATTTCC CC - #ATCCACGT 660- GCCATCCATC TTCTCGACGA AGCCCTTTTC CGCACTTGAT TTACCTGAAC GC - #TCCGTCCA 720- CAGTACACTG TACAAGAGTT CCCCCGTCAA CCTCAACCTC CCTAGGTAGC AA - #CTTGGAAA 780- AGAGGATGAA GAGAGAGTCG ACTGATGGGA TAGGCAAAAC AGTTGGGAGC GA - #AAAAGAAA 840- AGAAACAAAA ACCAAAGCGA CGCTAGGAAG AATCGAGTGC AGTGGTCAAC GG - #CACCAAAA 900- CCATACCCGA TTCATTCAGC CATTCAACGC TCGGCGGGCG CCCCTGTTCC CC - #GTCGCACG 960- GCACTAACAG AACTAGCACT GTGCTCCTCC TCCTCCTCCT CCTCCTCCTC TA - #GCGCTCCG1020- ACGGACTCTG CACCTGGAGT TTACAGACTG ACACTGCACG CAGTGCCCTG CT - #GCGGCCCG1080- GAGGGTCTGT CTTTGGTCTC CAGTCCCGTT CCAGTCCCGT CCATCCAGGA GC - #CAGTGATC1140- TGATCCCATC CAACCCAGTC GACCCAGTCC ACGCCCGCTG CCAGCCAGTC GA - #GTCCAGGC1200- ACCGCTCGAT AACTCTCCTC TTTCTCCGCC TCACTCTCCC AACCACAGTC CA - #CCCACCGA1260- CCGGGCCACC ACCACTCACC ACCACCACCA CGGCCCGGAC TTCTTCAACC GC - #AGCAGCAG1320- CGCAAGGAGC CAGGCCCAGC AACAGATCAG CCAGCTCTCA GCAGCAGCAG CA - #GCAGCAAC1380- AGCAGCAGCA GTGCCAGCCC AGTCCAGTCC AGTCCAGTCC GCAGTCCGCC CG - #CAGTCGTC1440- AACGACTGAC TGACTGACTG AACCTGAGGA CGAGACTAGA CTCGCTACCT AC - #CTCTACCT1500- ACCTACCTAC CTACCTACCT ACCTACCCAC CCACCGCTGT CGCTGTCCCC AG - #TCAATCCT1560- ACTACCTGAC CTACCTTAGC CACGGAGAAA AAGGCGACCA AAACAGGCAA AC - #AAAATCTC1620- CTACTGCCTC CTCGCACCGA GGCGCACGTC GAGTCTCCGA GCCTGAAGCC TC - #CGTCCAGC1680- TCCAGCTCCC GCTCTCCTTT CGCGATACAA TCCTTTTTTG AAAAACACAA TT - #CCCACCCA1740- TCGCGGCGGG ATATCTAGTA CAAACAGTGA GCCCACTCCC CACCAGCACT GT - #TCTTTCGT1800- CTGAAACTGT CAATTATACG CACGCGCTTG CTTTCTTCAC ACCTTTGCTG AC - #GATCCCCT1860- GCTTCAAGAC CACCACAAAC CCGACGCTCT GCATTGCAAT TTCGCAACAT AA - #CCACATCA1920- AGCTACCCAA CCAGCAACAC AGCCCAGAGA CCAGAGATCG ATTACAACGC CG - #CTCCCTAT1980- TCTCTCGAGT CCATCTCCCA TCTCGATTCA ATTGAAACCA ACTTCTTAGA CC - #CGCAAACG2040- CCCATGAAGT CGCAAGAGTC GATTGTTACC CACTAGCTTC CGCGCCTTGC CC - #GACTGCGT2100- TTCCTGCTCT ATTCCGTCCC CAAGGCTCAC GGCGCCAACG GCCGTAGCCC AC - #AATCATGA2160- CTGACGGACC AACTCTCGCA GCTATTGCTG CTCTCGTCAA ATCCCTGGCT GT - #CGACCCGG2220- CCACTACCCA GACCTCTGGA CTTCGCCCAA GCACCCATGT CAGGCTTCCC GG - #TCCGTATA2280- CCCGTGAGAA GGGTGATCTG GAGCGTGAGC TCTCGGCTCT TGTTGTCCGC AT - #AGAGCAGC2340- TGGAGACTGC CGCCATCGCT GCCTCTCCTC CAGCCATGCC CGATACACCA AA - #TGCGCCAA2400- CCGATGCGCT GTTTTCAAAC GGCACCCTTT CGCCATCCTC GGAAACGCCT GA - #TGCCCGCT2460- ACCCCGCTCC GCTACCGCGG AATGGCTTCA TCGACGAGGC CCTTGAGGGT CT - #CCGCGAGC2520- ATGTCGACGA CCAGTCCAAG CTGCTTGACA GCCAGCGTCA GGAGCTTGCT GG - #GGTCAACG2580- CCCAGCTGAT TGAGCAAAAG CAACTTCAGG AAAAGGCTCT GGCTATTATC GA - #ACAGGAAC2640- GGGTTGCTAC CCTTGAGCGG GAACTCTGGA AGCATCAAAA GGCCAACGAG GC - #CTTCCAAA2700- AGGCTCTCCG AGAAATCGGT GAGATTGTCA CTGCCGTCGC CAGGGGTGAT TT - #GTCCAAAA2760- AGGTCCGGAT GAACTCGGTG GAAATGGACC CGGAAATCAC CACCTTCAAG CG - #TACGATAA2820- ACACAATGAT GGACCAGTTG CAAGTCTTCT CCAGCGAAGT CTCGCGTGTC GC - #TCGTGAAG2880- TCGGAACCGA GGGTATTCTC GGTGGCCAAG CTCAGATCGA AGGCGTTGAC GG - #CACCTGGA2940- AGGAACTCAC AGACAACGGT ATGTTTGATC CCATCTTGAC AGCCGCAGCC GT - #AGTGGCCT3000- ATGTGTACTG ATCATATCAT CTAGTCAACG TCATGGCCCA GAATCTTACC GA - #CCAAGTGC3060- GAGAGATTGC TTCCGTAACG ACTGCTGTCG CTCATGGCGA TCTTACCAAG AA - #AATCGAGC3120- GTCCCGCCAA GGGAGAAATA CTTCAACTTC AACAAACCAT CAACACAATG GT - #GGATCAGC3180- TACGGACTTT CGCCTCTGAA GTTACACGTG TCGCCAGAGA TGTCGGTACC GA - #GGGTATCC3240- TCGGTGGTCA AGCCGACGTT GAAGGAGTCC AGGGCATGTG GAACGAACTT AC - #GGTTAATG3300- TGAACGCCAT GGCCAACAAT CTAACAACCC AAGTCAGAGA TATCATCAAG GT - #TACTACCG3360- CTGTCGCCAA GGGTGACCTT ACTCAAAAAG TACAAGCTGA ATGCCGCGGT GA - #GATTTTCG3420- AACTGAAGAA GACTATCAAC TCTATGGTGG ACCAACTACA ACAATTTGCT CG - #GGAAGTCA3480- CAAAGATCGC CAGGGAAGTC GGAACCGAAG GAAGGCTCGG TGGGCAGGCC AC - #TGTTCACG3540- ATGTTCAGGG TACTTGGAGG GACCTCACCG AAAACGTCAA CGGCATGGCC AT - #GAACTTGA3600- CCACACAGGT GCGAGAAATC GCAAAGGTTA CTACAGCCGT CGCCAAGGGT GA - #TTTGACCA3660- AGAAGATTGG GGTCGAGGTT CAGGGTGAGA TCCTGGATTT GAAGAACACC AT - #CAACACCA3720- TGGTTGACCG TCTTGGTACT TTCGCTTTCG AGGTCAGCAA GGTCGCCAGG GA - #AGTCGGCA3780- CCGATGGTAC CTTGGGTGGT CAGGCACAGG TTGATAATGT GGAGGGCAAG TG - #GAAGGATC3840- TCACAGAGAA CGTCAACACC ATGGCCAGCA ACCTTACATC TCAGGTAAGC TG - #CTCCTAGA3900- TGATCCTTTG CGGCATGCAC TGTTTGCTAA CTTTTCACAG GTCCGTGGGA TC - #TCTACCGT3960- CACACAAGCC ATTGCCAATG GTGATATGAG CCGCAAGATT GAAGTTGAAG CC - #AAGGGAGA4020- GATACTCATA CTCAAGGAGA CTATCAACAA CATGGTTGAC CGACTCTCCA TT - #TTCTGTAA4080- TGAGGTGCAG AGAGTCGCCA AGGATGTCGG TGTCGATGGT ATCATGGGAG GA - #CAAGCCGA4140- TGTTGCTGGC CTGAAGGGCA GGTGGAAGGA AATTACCACC GATGTCAACA CA - #ATGGCGAA4200- TAACTTGGTA TGTCTCGCCG CCGCCAGCAC CCTTGAACAG CACCCCTTTT TG - #CTAATGCC4260- TTTTACAGAC GGCTCAAGTG AGAGCGTTCG GCGACATCAC AAATGCAGCA AC - #AGACGGGG4320- ACTTTACAAA ACTCGTCGAG GTAGAAGCCT CGGGCGAGAT GGACGAACTC AA - #AAAGAAGA4380- TCAATCAGAT GGTCTACAAT TTGAGGGACA GTATTCAACG TAATACCCAG GC - #CAGGGAAG4440- CCGCCGAACT GGCCAATAAG ACCAAGTCCG AGTTTTTGGC GAACATGTCC CA - #CGAAATAC4500- GCACACCCAT GAACGGCATT ATCGGCATGA CACAACTTAC TCTCGATACT GA - #CCTGACAC4560- AGTATCAGAG AGAAATGCTC AACATTGTCA ACTCCCTGGC CAACAGCTTA CT - #GACCATCA4620- TCGACGACAT TTTGGATCTG TCCAAGATCG AAGCTAGGCG TATGGTCATC GA - #AGAGATTC4680- CTTATACGTT GCGTGGCACC GTCTTCAACG CGCTCAAGAC TCTTGCCGTC AA - #GGCAAACG4740- AGAAGTTTCT GGATCTTACC TATCGTGTCG ACCATTCTGT ACCCGACCAC GT - #CGTCGGAG4800- ACTCCTTCAG GTTGCGCCAG ATTATTCTTA ACCTTGTTGG CAACGCTATC AA - #GTTCACCG4860- AGCATGGTGA AGTCAGTCTT ACCATCCAGA AGGCCTCTTC AGTACAGTGC AG - #CACCGAAG4920- AGTACGCTAT CGAGTTTGTC GTTTCCGACA CTGGTATCGG TATTCCGGCG GA - #CAAGCTGG4980- ATCTCATCTT CGACACTTTC CAGCAGGCCG ATGGTTCAAT GACTCGCAAG TT - #TGGCGGTA5040- CTGGTCTCGG TCTCTCCATT TCCAAGCGTC TTGTCAACCT CATGGGTGGT GA - #CGTGTGGG5100- TGAAGAGTGA GTATGGTAAG GGTAGCAAGT TCTTCTTCAC CTGCGTGGTC CG - #CTTGGCCA5160- ACGACGATAT TTCGTTGATC GCCAAGCAGC TCAACCCTTA CAAGAGTCAC CA - #GGTCCTGT5220- TCATCGACAA GGGCCGCACC GGACATGGAC CGGAGATCGC CAAGATGCTC CA - #CGGCTTGG5280- GCCTCGTTCC CATCGTCGTC GACTCGGAGA GGAATCCTGC GCTCGAGAAG GC - #CAGAGCTG5340- CCGGCCAGGC GCCCTACGAC GTCATCATTG TGGACTCGAT CGAGGATGCA AG - #GCGCTTGC5400- GGTCTGTTGA CGACTTTAAG TACCTTCCCA TCGTATTGCT AGCACCAGTC GT - #TCACGTCT5460- CGCTAAAGTC TTGCCTTGAC TTGGGTATCA CGTCGTACAT GACGACGCCT TG - #TCAACTCA5520- TTGACCTCGG TAACGGCATG GTCCCTGCTC TCGAAAATAG GGCTACGCCG TC - #GCTGGCGG5580- ACAACACCAA ATCTTTTGAG ATCCTGCTTG CCGAAGACAA CACGGTCAAC CA - #GAGGCTCG5640- CGGTCAAGAT CCTGGAGAAG TATCACCACG TCGTCACCGT TGTTGGAAAC GG - #TGAAGAGG5700- CTGTTGAGGC CGTCAAGAGG AAAAAGTTCG ATGTCATTCT TATGGACGTC CA - #GATGCCTA5760- TTATGGTGAG TCAAAGCTGT TTTTCAAACC AAGAAGCCGA TGCTAACAAT TT - #TCATAGGG5820- CGGTTTCGAA GCTACGGCCA AGATTCGCGA GTACGAGCGC AGCCTCGGCA GC - #CAGCGCAC5880- ACCCATCATC GCCCTCACGG CGCATGCCAT GATGGGTGAC AGGGAAAAGT GT - #ATCCAGGC5940- ACAGATGGAC GAGTATCTCT CCAAGCCGCT GCAGCAGAAC CATCTAATCC AG - #ACCATACT6000- CAAGTGTGCG ACGCTCGGCG GGCAACTACT CGAGAAGAAC CGGGAGCGCG AG - #CTGACCCG6060- TGCTGCCGAT GCCGTCACAG GCGGCCGCCG CGACAACGGC ATGTACTCTG CC - #AGCCAAGC6120- CGCGCAGCAC GCTGCGCTCC GCCCACCCCT CGCCACCAGG GGCCTCACTG CC - #GCCGACAG6180- CCTCGTCTCC GGCTTGGAGA GCCCATCCAT CGTGACGGCG GATAAGGAGG AT - #CCTCTGAG6240- CAGGGCACGT GCAAGCCTCT CCGAACCCAA CATCCATAAA GCAAGCTAAC CG - #TGTGGATG6300- GGTCAATTCT GACTTTTATT GGAGGAATTT AGCTGGTCAT ACGAGCACAT AC - #TACTCTTT6360- GATCAACATC GCGTGCGATA CACCAAGCAA CCAACGGCCA CGCCAACTTA AA - #GTGGAAGA6420- AGTTTTTATG AGATGGGATG GAAGGAAAAA GAAACGAAGA GAGAAAGGGA AG - #AAGAAAGG6480- ATGGAAAGTG GATGGAGTCC GTGTTGTCTT TATCGTGTTG TGTGTTTCTC TG - #TCCGGTAC6540# 6545- (2) INFORMATION FOR SEQ ID NO:2:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 1298 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:- Met Thr Asp Gly Pro Thr Leu Ala Ala Ile Al - #a Ala Leu Val Lys Ser# 15- Leu Ala Val Asp Pro Ala Thr Thr Gln Thr Se - #r Gly Leu Arg Pro Ser# 30- Thr His Val Arg Leu Pro Gly Pro Tyr Thr Ar - #g Glu Lys Gly Asp Leu# 45- Glu Arg Glu Leu Ser Ala Leu Val Val Arg Il - #e Glu Gln Leu Glu Thr# 60- Ala Ala Ile Ala Ala Ser Pro Pro Ala Met Pr - #o Asp Thr Pro Asn Ala#80- Pro Thr Asp Ala Leu Phe Ser Asn Gly Thr Le - #u Ser Pro Ser Ser Glu# 95- Thr Pro Asp Ala Arg Tyr Pro Ala Pro Leu Pr - #o Arg Asn Gly Phe Ile# 110- Asp Glu Ala Leu Glu Gly Leu Arg Glu His Va - #l Asp Asp Gln Ser Lys# 125- Leu Leu Asp Ser Gln Arg Gln Glu Leu Ala Gl - #y Val Asn Ala Gln Leu# 140- Ile Glu Gln Lys Gln Leu Gln Glu Lys Ala Le - #u Ala Ile Ile Glu Gln145 1 - #50 1 - #55 1 -#60- Glu Arg Val Ala Thr Leu Glu Arg Glu Leu Tr - #p Lys His Gln Lys Ala# 175- Asn Glu Ala Phe Gln Lys Ala Leu Arg Glu Il - #e Gly Glu Ile Val Thr# 190- Ala Val Ala Arg Gly Asp Leu Ser Lys Lys Va - #l Arg Met Asn Ser Val# 205- Glu Met Asp Pro Glu Ile Thr Thr Phe Lys Ar - #g Thr Ile Asn Thr Met# 220- Met Asp Gln Leu Gln Val Phe Ser Ser Glu Va - #l Ser Arg Val Ala Arg225 2 - #30 2 - #35 2 -#40- Glu Val Gly Thr Glu Gly Ile Leu Gly Gly Gl - #n Ala Gln Ile Glu Gly# 255- Val Asp Gly Thr Trp Lys Glu Leu Thr Asp As - #n Val Asn Val Met Ala# 270- Gln Asn Leu Thr Asp Gln Val Arg Glu Ile Al - #a Ser Val Thr Thr Ala# 285- Val Ala His Gly Asp Leu Thr Lys Lys Ile Gl - #u Arg Pro Ala Lys Gly# 300- Glu Ile Leu Gln Leu Gln Gln Thr Ile Asn Th - #r Met Val Asp Gln Leu305 3 - #10 3 - #15 3 -#20- Arg Thr Phe Ala Ser Glu Val Thr Arg Val Al - #a Arg Asp Val Gly Thr# 335- Glu Gly Ile Leu Gly Gly Gln Ala Asp Val Gl - #u Gly Val Gln Gly Met# 350- Trp Asn Glu Leu Thr Val Asn Val Asn Ala Me - #t Ala Asn Asn Leu Thr# 365- Thr Gln Val Arg Asp Ile Ile Lys Val Thr Th - #r Ala Val Ala Lys Gly# 380- Asp Leu Thr Gln Lys Val Gln Ala Glu Cys Ar - #g Gly Glu Ile Phe Glu385 3 - #90 3 - #95 4 -#00- Leu Lys Lys Thr Ile Asn Ser Met Val Asp Gl - #n Leu Gln Gln Phe Ala# 415- Arg Glu Val Thr Lys Ile Ala Arg Glu Val Gl - #y Thr Glu Gly Arg Leu# 430- Gly Gly Gln Ala Thr Val His Asp Val Gln Gl - #y Thr Trp Arg Asp Leu# 445- Thr Glu Asn Val Asn Gly Met Ala Met Asn Le - #u Thr Thr Gln Val Arg# 460- Glu Ile Ala Lys Val Thr Thr Ala Val Ala Ly - #s Gly Asp Leu Thr Lys465 4 - #70 4 - #75 4 -#80- Lys Ile Gly Val Glu Val Gln Gly Glu Ile Le - #u Asp Leu Lys Asn Thr# 495- Ile Asn Thr Met Val Asp Arg Leu Gly Thr Ph - #e Ala Phe Glu Val Ser# 510- Lys Val Ala Arg Glu Val Gly Thr Asp Gly Th - #r Leu Gly Gly Gln Ala# 525- Gln Val Asp Asn Val Glu Gly Lys Trp Lys As - #p Leu Thr Glu Asn Val# 540- Asn Thr Met Ala Ser Asn Leu Thr Ser Gln Va - #l Arg Gly Ile Ser Thr545 5 - #50 5 - #55 5 -#60- Val Thr Gln Ala Ile Ala Asn Gly Asp Met Se - #r Arg Lys Ile Glu Val# 575- Glu Ala Lys Gly Glu Ile Leu Ile Leu Lys Gl - #u Thr Ile Asn Asn Met# 590- Val Asp Arg Leu Ser Ile Phe Cys Asn Glu Va - #l Gln Arg Val Ala Lys# 605- Asp Val Gly Val Asp Gly Ile Met Gly Gly Gl - #n Ala Asp Val Ala Gly# 620- Leu Lys Gly Arg Trp Lys Glu Ile Thr Thr As - #p Val Asn Thr Met Ala625 6 - #30 6 - #35 6 -#40- Asn Asn Leu Thr Ala Gln Val Arg Ala Phe Gl - #y Asp Ile Thr Asn Ala# 655- Ala Thr Asp Gly Asp Phe Thr Lys Leu Val Gl - #u Val Glu Ala Ser Gly# 670- Glu Met Asp Glu Leu Lys Lys Lys Ile Asn Gl - #n Met Val Tyr Asn Leu# 685- Arg Asp Ser Ile Gln Arg Asn Thr Gln Ala Ar - #g Glu Ala Ala Glu Leu# 700- Ala Asn Lys Thr Lys Ser Glu Phe Leu Ala As - #n Met Ser His Glu Ile705 7 - #10 7 - #15 7 -#20- Arg Thr Pro Met Asn Gly Ile Ile Gly Met Th - #r Gln Leu Thr Leu Asp# 735- Thr Asp Leu Thr Gln Tyr Gln Arg Glu Met Le - #u Asn Ile Val Asn Ser# 750- Leu Ala Asn Ser Leu Leu Thr Ile Ile Asp As - #p Ile Leu Asp Leu Ser# 765- Lys Ile Glu Ala Arg Arg Met Val Ile Glu Gl - #u Ile Pro Tyr Thr Leu# 780- Arg Gly Thr Val Phe Asn Ala Leu Lys Thr Le - #u Ala Val Lys Ala Asn785 7 - #90 7 - #95 8 -#00- Glu Lys Phe Leu Asp Leu Thr Tyr Arg Val As - #p His Ser Val Pro Asp# 815- His Val Val Gly Asp Ser Phe Arg Leu Arg Gl - #n Ile Ile Leu Asn Leu# 830- Val Gly Asn Ala Ile Lys Phe Thr Glu His Gl - #y Glu Val Ser Leu Thr# 845- Ile Gln Lys Ala Ser Ser Val Gln Cys Ser Th - #r Glu Glu Tyr Ala Ile# 860- Glu Phe Val Val Ser Asp Thr Gly Ile Gly Il - #e Pro Ala Asp Lys Leu865 8 - #70 8 - #75 8 -#80- Asp Leu Ile Phe Asp Thr Phe Gln Gln Ala As - #p Gly Ser Met Thr Arg# 895- Lys Phe Gly Gly Thr Gly Leu Gly Leu Ser Il - #e Ser Lys Arg Leu Val# 910- Asn Leu Met Gly Gly Asp Val Trp Val Lys Se - #r Glu Tyr Gly Lys Gly# 925- Ser Lys Phe Phe Phe Thr Cys Val Val Arg Le - #u Ala Asn Asp Asp Ile# 940- Ser Leu Ile Ala Lys Gln Leu Asn Pro Tyr Ly - #s Ser His Gln Val Leu945 9 - #50 9 - #55 9 -#60- Phe Ile Asp Lys Gly Arg Thr Gly His Gly Pr - #o Glu Ile Ala Lys Met# 975- Leu His Gly Leu Gly Leu Val Pro Ile Val Va - #l Asp Ser Glu Arg Asn# 990- Pro Ala Leu Glu Lys Ala Arg Ala Ala Gly Gl - #n Ala Pro Tyr Asp Val# 10050- Ile Ile Val Asp Ser Ile Glu Asp Ala Arg Ar - #g Leu Arg Ser Val Asp# 10205- Asp Phe Lys Tyr Leu Pro Ile Val Leu Leu Al - #a Pro Val Val His Val# 10401030 - # 1035- Ser Leu Lys Ser Cys Leu Asp Leu Gly Ile Th - #r Ser Tyr Met Thr Thr# 10550- Pro Cys Gln Leu Ile Asp Leu Gly Asn Gly Me - #t Val Pro Ala Leu Glu# 10705- Asn Arg Ala Thr Pro Ser Leu Ala Asp Asn Th - #r Lys Ser Phe Glu Ile# 10850- Leu Leu Ala Glu Asp Asn Thr Val Asn Gln Ar - #g Leu Ala Val Lys Ile# 11005- Leu Glu Lys Tyr His His Val Val Thr Val Va - #l Gly Asn Gly Glu Glu# 11201110 - # 1115- Ala Val Glu Ala Val Lys Arg Lys Lys Phe As - #p Val Ile Leu Met Asp# 11350- Val Gln Met Pro Ile Met Gly Gly Phe Glu Al - #a Thr Ala Lys Ile Arg# 11505- Glu Tyr Glu Arg Ser Leu Gly Ser Gln Arg Th - #r Pro Ile Ile Ala Leu# 11650- Thr Ala His Ala Met Met Gly Asp Arg Glu Ly - #s Cys Ile Gln Ala Gln# 11805- Met Asp Glu Tyr Leu Ser Lys Pro Leu Gln Gl - #n Asn His Leu Ile Gln# 12001190 - # 1195- Thr Ile Leu Lys Cys Ala Thr Leu Gly Gly Gl - #n Leu Leu Glu Lys Asn# 12150- Arg Glu Arg Glu Leu Thr Arg Ala Ala Asp Al - #a Val Thr Gly Gly Arg# 12305- Arg Asp Asn Gly Met Tyr Ser Ala Ser Gln Al - #a Ala Gln His Ala Ala# 12450- Leu Arg Pro Pro Leu Ala Thr Arg Gly Leu Th - #r Ala Ala Asp Ser Leu# 12605- Val Ser Gly Leu Glu Ser Pro Ser Ile Val Th - #r Ala Asp Lys Glu Asp# 12801270 - # 1275- Pro Leu Ser Arg Ala Arg Ala Ser Leu Ser Gl - #u Pro Asn Ile His Lys# 12950- Ala Ser- (2) INFORMATION FOR SEQ ID NO:3:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 5175 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:- GTCCAGGCAC CGCTCGATAA CTCTCCTCTT TCTCCGCCTC ACTCTCCCAA CC - #ACAGTCCA 60- CCCACCGACC GGGCCACCAC CACTCACCAC CACCACCACG GCCCGGACTT CT - #TCAACCGC 120- AGCAGCAGCG CAAGGAGCCA GGCCCAGCAA CAGATCAGCC AGCTCTCAGC AG - #CAGCAGCA 180- GCAGCAACAG CAGCAGCAGT GCCAGCCCAG TCCAGTCCAG TCCAGTCCGC AG - #TCCGCCCG 240- CAGTCGTCAA CGACTGACTG ACTGACTGAA CCTGAGGACG AGACTAGACT CG - #CTACCTAC 300- CTCTACCTAC CTACCTACCT ACCTACCTAC CTACCCACCC ACCGGTGGCG GT - #GTCCCCAG 360- TACAAATCCT ACTACCTGAC CTACCTTAGC CACGGAGAAA AAGGGGAACA AA - #AACGGGCA 420- AAACAAAATC TCCTACTGCC TCCTGCGCAC CGAGGCGCAC GTCGAGTCTC CG - #AGCCTGAA 480- GCCTCCGTCC AGCTCCACGT CCCGCTCTCC TTTCGCGATA CAATCCTTTT TT - #GAAAAACA 540- CAATTCCCAC CCATCGCGGC GGGATATCTA GTACAAACAA CCACCACAAA CC - #CGACGCTC 600- TGCATGTGCA ATTTCGCAAC ATAACCACAT CAAGCTACCC AACCAGCAAC AC - #AGCCCAGA 660- GACCAGAGAT CGATTACAAC GCCGCTCCCT ATTCTCTCGA GTCCATCTCC CA - #TCTCGATT 720- CAATTGAAAC CAACTTCTTA GACCCGCAAA CGCCCATGAA GTCGCAAGAG TC - #GATTGTTA 780- CCCACTAGCT TCCGCGCCTT GCCCGACTGC GTTTCCTGCT CTATTCCGTC CC - #CAAGGCTC 840- ACGGCGCCAA CGGCCGTAGC CCACAATCAT GACTGACGGA CCAACTCTCG CA - #GCTATTGC 900- TGCTCTCGTC AAATCCCTGG CTGTCGACCC GGCCACTACC CAGACCTCTG GA - #CTTCGCCC 960- AAGCACCCAT GTCAGGCTTC CCGGTCCGTA TACCCGTGAG AAGGGTGATC TG - #GAGCGTGA1020- GCTCTCGGCT CTTGTTGTCC GCATAGAGCA GCTGGAGACT GCCGCCATCG CT - #GCCTCTCC1080- TCCAGCCATG CCCGATACAC CAAATGCGCC AACCGATGCG CTGTTTTCAA AC - #GGCACCCT1140- TTCGCCATCC TCGGAAACGC CTGATGCCCG CTACCCCGCT CCGCTACCGC GA - #AATGGCTT1200- CATCGACGAG GCCCTTGAGG GTCTCCGCGA GCATGTCGAC GACCAGTCCA AG - #CTGCTTGA1260- CAGCCAGCGT CAGGAGCTTG CTGGGGTCAA CGCCCAGCTG ATTGAGCAAA AG - #CAACTTCA1320- GGAAAAGGCT CTGGCTATTA TCGAACAGGA ACGGGTTGCT ACCCTTGAGC GG - #GAACTCTG1380- GAAGCATCAA AAGGCCAACG AGGCCTTCCA AAAGGCTCTC CGAGAAATCG GT - #GAGATTGT1440- CACTGCCGTC GCCAGGGGTG ATTTGTCCAA AAAGGTCCGG ATGAACTCGG TG - #GAAATGGA1500- CCCGGAAATC ACCACCTTCA AGCGTACGAT AAACACAATG ATGGACCAGT TG - #CAAGTCTT1560- CTCCAGCGAA GTCTCGCGTG TCGCTCGTGA AGTCGGAACC GAGGGTATTC TC - #GGTGGCCA1620- AGCTCAGATC GAAGGCGTTG ACGGCACCTG GAAGGAACTC ACAGACAACG TC - #AACGTCAT1680- GGCCCAGAAT CTTACCGACC AAGTGCGAGA GATTGCTTCC GTAACGACTG CT - #GTCGCTCA1740- TGGCGATCTT ACCAAGAAAA TCGAGCGTCC CGCCAAGGGA GAAATACTTC AA - #CTTCAACA1800- AACCATCAAC ACAATGGTGG ATCAGCTACG GACTTTCGCC TCTGAAGTTA CA - #CGTGTCGC1860- CAGAGATGTC GGTACCGAGG GTATCCTCGG TGGTCAAGCC GACGTTGAAG GA - #GTCCAGGG1920- CATGTGGAAC GAACTTACGG TTAATGTGAA CGCCATGGCC AACAATCTAA CA - #ACCCAAGT1980- CAGAGATATC ATCAAGGTTA CTACCGCTGT CGCCAAGGGT GACCTTACTC AA - #AAAGTACA2040- AGCTGAATGC CGCGGTGAGA TTTTCGAACT GAAGAAGACT ATCAACTCTA TG - #GTGGACCA2100- ACTACAACAA TTTGCTCGGG AAGTCACAAA GATCGCCAGG GAAGTCGGAA CC - #GAAGGAAG2160- GCTCGGTGGG CAGGCCACTG TTCACGATGT TCAGGGTACT TGGAGGGACC TC - #ACCGAAAA2220- CGTCAACGGC ATGGCCATGA ACTTGACCAC ACAGGTGCGA GAAATCGCAA AG - #GTTACTAC2280- AGCCGTCGCC AAGGGTGATT TGACCAAGAA GATTGGGGTC GAGGTTCAGG GT - #GAGATCCT2340- GGATTTGAAG AACACCATCA ACACCATGGT TGACCGTCTT GGTACTTTCG CT - #TTCGAGGT2400- CAGCAAGGTC GCCAGGGAAG TCGGCACCGA TGGTACCTTG GGTGGTCAGG CA - #CAGGTTGA2460- TAATGTGGAG GGCAAGTGGA AGGATCTCAC AGAGAACGTC AACACCATGG CC - #AGCAACCT2520- TACATCTCAG GTCCGTGGGA TCTCTACCGT CACACAAGCC ATTGCCAATG GT - #GATATGAG2580- CCGCAAGATT GAAGTTGAAG CCAAGGGAGA GATACTCATA CTCAAGGAGA CT - #ATCAACAA2640- CATGGTTGAC CGACTCTCCA TTTTCTGTAA TGAGGTGCAG AGAGTCGCCA AG - #GATGTCGG2700- TGTCGATGGT ATCATGGGAG GACAAGCCGA TGTTGCTGGC CTGAAGGGCA GG - #TGGAAGGA2760- AATTACCACC GATGTCAACA CAATGGCGAA TAACTTGACG GCTCAAGTGA GA - #GCGTTCGG2820- CGACATCACA AATGCAGCAA CAGACGGGGA CTTTACAAAA CTCGTCGAGG TA - #GAAGCCTC2880- GGGCGAGATG GACGAACTCA AAAAGAAGAT CAATCAGATG GTCTACAATT TG - #AGGGACAG2940- TATTCAACGT AATACCCAGG CCAGGGAAGC CGCCGAACTG GCCAATAAGA CC - #AAGTCCGA3000- GTTTTTGGCG AACATGTCCC ACGAAATACG CACACCCATG AACGGCATTA TC - #GGCATGAC3060- ACAACTTACT CTCGATACTG ACCTGACACA GTATCAGAGA GAAATGCTCA AC - #ATTGTCAA3120- CTCCCTGGCC AACAGCTTAC TGACCATCAT CGACGACATT TTGGATCTGT CC - #AAGATCGA3180- AGCTAGGCGT ATGGTCATCG AAGAGATTCC TTATACGTTG CGTGGCACCG TC - #TTCAACGC3240- GCTCAAGACT CTTGCCGTCA AGGAAACCGA GAAGTTTCTG GATCTTACCT AT - #CGTGTCGA3300- CCATTCTGTA CCCGACCACG TCGTCGGAGA CTCCTTCAGG TTGCGCCAGA TT - #ATTCTTAA3360- CCTTGTTGGC AACGCTATCA AGTTCACCGA GCATGGTGAA GTCAGTCTTA CC - #ATCCAGAA3420- GGCCTCTTCA GTACAGTGCA GCACCGAAGA GTACGCTATC GAGTTTGTCG TT - #TCCGACAC3480- TGGTATCGGT ATTCCGGCGG ACAAGCTGGA TCTCATCTTC GACACTTTCC AG - #CAGGCCGA3540- TGGTTCAATG ACTCGCAAGT TTGGCGGTAC TGGTCTCGGT CTCTCCATTT CC - #AAGCGTCT3600- TGTCAACCTC ATGGGTGGTG ACGTTTGGGT GAAGAGTGAG TATGGTAAGG GT - #AGCAAGTT3660- CTTCTTCACC TGCGTGGTCC GCTTGGCCAA CGACGATATT TCGTTGATCG CC - #AAGCAGCT3720- CAACCCTTAC AAGAGTCACC AGGTCCTGTT CATCGACAAG GGCCGCACCG GA - #CATGGACC3780- GGAGATCGCC AAGATGCTCC ACGGCTTGGG CCTCGTTCCC ATCGTCGTCG AC - #TCGGAGAG3840- GAATCCTGCG CTCGAGAAGG CCAGAGCTGC CGGCCAGGCG CCCTACGACG TC - #ATCATTGT3900- GGACTCGATC GAGGATGCAA GGCGCTTGCG GTCTGTTGAC GACTTTAAGT AC - #CTTCCCAT3960- CGTATTGCTA GCACCAGTCG TTCACGTCTC GCTAAAGTCT TGCCTTGACT TG - #GGTATCAC4020- GTCGTACATG ACGACGCCTT GTCAACTCAT TGACCTCGGT AACGGCATGG TC - #CCTGCTCT4080- CGAAAATAGG GCTACGCCGT CGCTGGCGGA CAACACCAAA TCTTTTGAGA TC - #CTGCTTGC4140- CGAAGACAAC ACGGTCAACC AGAGGCTCGC GGTCAAGATC CTGGAGAAGT AT - #CACCACGT4200- CGTCACCGTT GTTGGAAACG GTGAAGAGGC TGTTGAGGCC GTCAAGAGGA AA - #AAGTTCGA4260- TGTCATTCTT ATGGACGTCC AGATGCCTAT TATGGGCGGT TTCGAAGCTA CG - #GCCAAGAT4320- TCGCGAGTAC GAGCGCAGCC TCGGCAGCCA GCGCACACCC ATCATCGCCC TC - #ACGGCGCA4380- TGCCATGATG GGTGACAGGG AAAAGTGTAT CCAGGCACAG ATGGACGAGT AT - #CTCTCCAA4440- GCCGCTGCAG CAGAACCATC TAATCCAGAC CATACTCAAG TGTGCGACGC TC - #GGCGGGCA4500- ACTACTCGAG AAGAACCGGG AGCGCGAGCT GACCCGTGCT GCCGATGCCG TT - #ACAGGCGG4560- CCGCCGCGAC AACGGCATGT ACTCTGCCAG CCAAGCCGCG CAGCACGCTG CG - #CTCCGCCC4620- ACCCCTCGCC ACCAGGGGCC TCACTGCCGC CGACAGCCTC GTCTCCGGCT TG - #GAGAGCCC4680- ATCCATCGTG ACGGCGGATA AGGAGGATCC TCTGAGCAGG GCACGTGCAA GC - #CTCTCCGA4740- ACCCAACATC CATAAAGCAA GCTAACCGTG TGGATGGGTC AATTCTGACT TT - #TATTGGAG4800- GAATTTAGCT GGTCATACGA GCACATACTA CTCTTTGATC AACATCGCGT GC - #GATACACC4860- AAGCAACCAA CGGCCACGCC AACTTAAAGT GGAAGAAGGT TTTTATGAGA TG - #GGATGGAA4920- GGAAAAAGAA ACGAGGAGAG AAAGGGAGGA AGAAAGGATG GAAAGTGGAT GG - #AGTCCGTG4980- TTGTCTTTAT CGTGTTGTGT GTTTTCTCTG TCCGGTACCC GGGTTCAAAA TC - #AGGTTTTT5040- AAGGTCCAAA GGCGGTTTCT GTTATCAACA AGGCATTGAA ATTATTACTT GC - #GGCTGGTT5100- TGCTAGTTTT CAATTTTGGA TGTCTTGTTC CTCTGTCTCG TGTCTCTCTC GT - #ATTTACTG5160# 5175- (2) INFORMATION FOR SEQ ID NO:4:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 1298 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:- Met Thr Asp Gly Pro Thr Leu Ala Ala Ile Al - #a Ala Leu Val Lys Ser# 15- Leu Ala Val Asp Pro Ala Thr Thr Gln Thr Se - #r Gly Leu Arg Pro Ser# 30- Thr His Val Arg Leu Pro Gly Pro Tyr Thr Ar - #g Glu Lys Gly Asp Leu# 45- Glu Arg Glu Leu Ser Ala Leu Val Val Arg Il - #e Glu Gln Leu Glu Thr# 60- Ala Ala Ile Ala Ala Ser Pro Pro Ala Met Pr - #o Asp Thr Pro Asn Ala#80- Pro Thr Asp Ala Leu Phe Ser Asn Gly Thr Le - #u Ser Pro Ser Ser Glu# 95- Thr Pro Asp Ala Arg Tyr Pro Ala Pro Leu Pr - #o Arg Asn Gly Phe Ile# 110- Asp Glu Ala Leu Glu Gly Leu Arg Glu His Va - #l Asp Asp Gln Ser Lys# 125- Leu Leu Asp Ser Gln Arg Gln Glu Leu Ala Gl - #y Val Asn Ala Gln Leu# 140- Ile Glu Gln Lys Gln Leu Gln Glu Lys Ala Le - #u Ala Ile Ile Glu Gln145 1 - #50 1 - #55 1 -#60- Glu Arg Val Ala Thr Leu Glu Arg Glu Leu Tr - #p Lys His Gln Lys Ala# 175- Asn Glu Ala Phe Gln Lys Ala Leu Arg Glu Il - #e Gly Glu Ile Val Thr# 190- Ala Val Ala Arg Gly Asp Leu Ser Lys Lys Va - #l Arg Met Asn Ser Val# 205- Glu Met Asp Pro Glu Ile Thr Thr Phe Lys Ar - #g Thr Ile Asn Thr Met# 220- Met Asp Gln Leu Gln Val Phe Ser Ser Glu Va - #l Ser Arg Val Ala Arg225 2 - #30 2 - #35 2 -#40- Glu Val Gly Thr Glu Gly Ile Leu Gly Gly Gl - #n Ala Gln Ile Glu Gly# 255- Val Asp Gly Thr Trp Lys Glu Leu Thr Asp As - #n Val Asn Val Met Ala# 270- Gln Asn Leu Thr Asp Gln Val Arg Glu Ile Al - #a Ser Val Thr Thr Ala# 285- Val Ala His Gly Asp Leu Thr Lys Lys Ile Gl - #u Arg Pro Ala Lys Gly# 300- Glu Ile Leu Gln Leu Gln Gln Thr Ile Asn Th - #r Met Val Asp Gln Leu305 3 - #10 3 - #15 3 -#20- Arg Thr Phe Ala Ser Glu Val Thr Arg Val Al - #a Arg Asp Val Gly Thr# 335- Glu Gly Ile Leu Gly Gly Gln Ala Asp Val Gl - #u Gly Val Gln Gly Met# 350- Trp Asn Glu Leu Thr Val Asn Val Asn Ala Me - #t Ala Asn Asn Leu Thr# 365- Thr Gln Val Arg Asp Ile Ile Lys Val Thr Th - #r Ala Val Ala Lys Gly# 380- Asp Leu Thr Gln Lys Val Gln Ala Glu Cys Ar - #g Gly Glu Ile Phe Glu385 3 - #90 3 - #95 4 -#00- Leu Lys Lys Thr Ile Asn Ser Met Val Asp Gl - #n Leu Gln Gln Phe Ala# 415- Arg Glu Val Thr Lys Ile Ala Arg Glu Val Gl - #y Thr Glu Gly Arg Leu# 430- Gly Gly Gln Ala Thr Val His Asp Val Gln Gl - #y Thr Trp Arg Asp Leu# 445- Thr Glu Asn Val Asn Gly Met Ala Met Asn Le - #u Thr Thr Gln Val Arg# 460- Glu Ile Ala Lys Val Thr Thr Ala Val Ala Ly - #s Gly Asp Leu Thr Lys465 4 - #70 4 - #75 4 -#80- Lys Ile Gly Val Glu Val Gln Gly Glu Ile Le - #u Asp Leu Lys Asn Thr# 495- Ile Asn Thr Met Val Asp Arg Leu Gly Thr Ph - #e Ala Phe Glu Val Ser# 510- Lys Val Ala Arg Glu Val Gly Thr Asp Gly Th - #r Leu Gly Gly Gln Ala# 525- Gln Val Asp Asn Val Glu Gly Lys Trp Lys As - #p Leu Thr Glu Asn Val# 540- Asn Thr Met Ala Ser Asn Leu Thr Ser Gln Va - #l Arg Gly Ile Ser Thr545 5 - #50 5 - #55 5 -#60- Val Thr Gln Ala Ile Ala Asn Gly Asp Met Se - #r Arg Lys Ile Glu Val# 575- Glu Ala Lys Gly Glu Ile Leu Ile Leu Lys Gl - #u Thr Ile Asn Asn Met# 590- Val Asp Arg Leu Ser Ile Phe Cys Asn Glu Va - #l Gln Arg Val Ala Lys# 605- Asp Val Gly Val Asp Gly Ile Met Gly Gly Gl - #n Ala Asp Val Ala Gly# 620- Leu Lys Gly Arg Trp Lys Glu Ile Thr Thr As - #p Val Asn Thr Met Ala625 6 - #30 6 - #35 6 -#40- Asn Asn Leu Thr Ala Gln Val Arg Ala Phe Gl - #y Asp Ile Thr Asn Ala# 655- Ala Thr Asp Gly Asp Phe Thr Lys Leu Val Gl - #u Val Glu Ala Ser Gly# 670- Glu Met Asp Glu Leu Lys Lys Lys Ile Asn Gl - #n Met Val Tyr Asn Leu# 685- Arg Asp Ser Ile Gln Arg Asn Thr Gln Ala Ar - #g Glu Ala Ala Glu Leu# 700- Ala Asn Lys Thr Lys Ser Glu Phe Leu Ala As - #n Met Ser His Glu Ile705 7 - #10 7 - #15 7 -#20- Arg Thr Pro Met Asn Gly Ile Ile Gly Met Th - #r Gln Leu Thr Leu Asp# 735- Thr Asp Leu Thr Gln Tyr Gln Arg Glu Met Le - #u Asn Ile Val Asn Ser# 750- Leu Ala Asn Ser Leu Leu Thr Ile Ile Asp As - #p Ile Leu Asp Leu Ser# 765- Lys Ile Glu Ala Arg Arg Met Val Ile Glu Gl - #u Ile Pro Tyr Thr Leu# 780- Arg Gly Thr Val Phe Asn Ala Leu Lys Thr Le - #u Ala Val Lys Glu Thr785 7 - #90 7 - #95 8 -#00- Glu Lys Phe Leu Asp Leu Thr Tyr Arg Val As - #p His Ser Val Pro Asp# 815- His Val Val Gly Asp Ser Phe Arg Leu Arg Gl - #n Ile Ile Leu Asn Leu# 830- Val Gly Asn Ala Ile Lys Phe Thr Glu His Gl - #y Glu Val Ser Leu Thr# 845- Ile Gln Lys Ala Ser Ser Val Gln Cys Ser Th - #r Glu Glu Tyr Ala Ile# 860- Glu Phe Val Val Ser Asp Thr Gly Ile Gly Il - #e Pro Ala Asp Lys Leu865 8 - #70 8 - #75 8 -#80- Asp Leu Ile Phe Asp Thr Phe Gln Gln Ala As - #p Gly Ser Met Thr Arg# 895- Lys Phe Gly Gly Thr Gly Leu Gly Leu Ser Il - #e Ser Lys Arg Leu Val# 910- Asn Leu Met Gly Gly Asp Val Trp Val Lys Se - #r Glu Tyr Gly Lys Gly# 925- Ser Lys Phe Phe Phe Thr Cys Val Val Arg Le - #u Ala Asn Asp Asp Ile# 940- Ser Leu Ile Ala Lys Gln Leu Asn Pro Tyr Ly - #s Ser His Gln Val Leu945 9 - #50 9 - #55 9 -#60- Phe Ile Asp Lys Gly Arg Thr Gly His Gly Pr - #o Glu Ile Ala Lys Met# 975- Leu His Gly Leu Gly Leu Val Pro Ile Val Va - #l Asp Ser Glu Arg Asn# 990- Pro Ala Leu Glu Lys Ala Arg Ala Ala Gly Gl - #n Ala Pro Tyr Asp Val# 10050- Ile Ile Val Asp Ser Ile Glu Asp Ala Arg Ar - #g Leu Arg Ser Val Asp# 10205- Asp Phe Lys Tyr Leu Pro Ile Val Leu Leu Al - #a Pro Val Val His Val# 10401030 - # 1035- Ser Leu Lys Ser Cys Leu Asp Leu Gly Ile Th - #r Ser Tyr Met Thr Thr# 10550- Pro Cys Gln Leu Ile Asp Leu Gly Asn Gly Me - #t Val Pro Ala Leu Glu# 10705- Asn Arg Ala Thr Pro Ser Leu Ala Asp Asn Th - #r Lys Ser Phe Glu Ile# 10850- Leu Leu Ala Glu Asp Asn Thr Val Asn Gln Ar - #g Leu Ala Val Lys Ile# 11005- Leu Glu Lys Tyr His His Val Val Thr Val Va - #l Gly Asn Gly Glu Glu# 11201110 - # 1115- Ala Val Glu Ala Val Lys Arg Lys Lys Phe As - #p Val Ile Leu Met Asp# 11350- Val Gln Met Pro Ile Met Gly Gly Phe Glu Al - #a Thr Ala Lys Ile Arg# 11505- Glu Tyr Glu Arg Ser Leu Gly Ser Gln Arg Th - #r Pro Ile Ile Ala Leu# 11650- Thr Ala His Ala Met Met Gly Asp Arg Glu Ly - #s Cys Ile Gln Ala Gln# 11805- Met Asp Glu Tyr Leu Ser Lys Pro Leu Gln Gl - #n Asn His Leu Ile Gln# 12001190 - # 1195- Thr Ile Leu Lys Cys Ala Thr Leu Gly Gly Gl - #n Leu Leu Glu Lys Asn# 12150- Arg Glu Arg Glu Leu Thr Arg Ala Ala Asp Al - #a Val Thr Gly Gly Arg# 12305- Arg Asp Asn Gly Met Tyr Ser Ala Ser Gln Al - #a Ala Gln His Ala Ala# 12450- Leu Arg Pro Pro Leu Ala Thr Arg Gly Leu Th - #r Ala Ala Asp Ser Leu# 12605- Val Ser Gly Leu Glu Ser Pro Ser Ile Val Th - #r Ala Asp Lys Glu Asp# 12801270 - # 1275- Pro Leu Ser Arg Ala Arg Ala Ser Leu Ser Gl - #u Pro Asn Ile His Lys# 12950- Ala Ser- (2) INFORMATION FOR SEQ ID NO:5:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 5697 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:- GGATCCGCCC TCCACCCTCG TCGTCCGCGC GCCGCCATTA TCCTTGTTGG CC - #ATCGTCGG 60- CCCTGTCCCT TTCTCATCCC ATCCGTTTTC CCTTTCAGAA TTTCCCCATC CA - #CGTGCCAT 120- CCATCTTCTC GACGAAGCCC TTTTCCGCAC TTGATTTACC TGAACGCTCC GT - #CCACAGTA 180- CACTGTACAA GAGTTCCCCC GTCAACCTCA ACCTCCCTAG GTAGCAACTT GG - #AAAAGAGG 240- ATGAAGAGAG AGTCGACTGA TGGGATAGGC AAAACAGTTG GGAGCGAAAA AG - #AAAAGAAA 300- CAAAAACCAA AGCGACGCTA GGAAGAATCG AGTGCAGTGG TCAACGGCAC CA - #AAACCATA 360- CCCGATTCAT TCAGCCATTC AACGCTCGGC GGGCGCCCCT GTTCCCCGTC GC - #ACGGCACT 420- AACAGAACTA GCACTGTGCT CCTCCTCCTC CTCCTCCTCC TCCTCTAGCG CT - #CCGACGGA 480- CTCTGCACCT GGAGTTTACA GACTGACACT GCACGCAGTG CCCTGCTGCG GC - #CCCGACGA 540- GTCTGTCTTT GGTCTCCAGT CCCGTTCCAG TCCCGTCCAT CCAGGAGCCA GT - #GATCTGAT 600- CCCATCCAAC CCAGTCGACC CAGTCCACGC CCGCTGCCAG CCAGTCGAGT CC - #AGGCACCG 660- CTCGATAACT CTCCTCTTTC TCCGCCTCAC TCTCCCAACC ACAGTCCACC CA - #CCGACCGG 720- GCCACCACCA CTCACCACCA CCACCACGGC CCGGACTTCT TCAACCGCAG CA - #GCAGCGCA 780- AGGAGCCAGG CCCAGCAACA GATCAGCCAG CTCTCAGCAG CAGCAGCAGC AG - #CAACAGCA 840- GCAGCAGTGC CAGCCCAGTC CAGTCCAGTC CAGTCCGCAG TCCGCCCGCA GT - #CGTCAACG 900- ACTGACTGAC TGACTGAACC TGAGGACGAG ACTAGACTCG CTACCTACCT CT - #ACCTACCT 960- ACCTACCTAC CTACCTACCT ACCCACCCAC CGGTGGCGGT GTCCCCAGTA CA - #AATCCTAC1020- TACCTGACCT ACCTTAGCCA CGGAGAAAAA GGGGAACAAA AACGGGCAAA AC - #AAAATCTC1080- CTACTGCCTC CTGCGCACCG AGGCGCACGT CGAGTCTCCG AGCCTGAAGC CT - #CCGTCCAG1140- CTCCACGTCC CGCTCTCCTT TCGCGATACA ATCCTTTTTT GAAAAACACA AT - #TCCCACCC1200- ATCGCGGCGG GATATCTAGT ACAAACAGTG AGCCCACTCC CCACCAGCAC TG - #TTCTTTCG1260- TCTGAAACTG TCAATTATAC GCACGCGCTT GCTTTCTTCA CACCTTTGCT GA - #CGATCCCC1320- TGCTTCAAGA CCACCACAAA CCCGACGCTC TGCATGTGCA ATTTCGCAAC AT - #AACCACAT1380- CAAGCTACCC AACCAGCAAC ACAGCCCAGA GACCAGAGAT CGATTACAAC GC - #CGCTCCCT1440- ATTCTCTCGA GTCCATCTCC CATCTCGATT CAATTGAAAC CAACTTCTTA GA - #CCCGCAAA1500- CGCCCATGAA GTCGCAAGAG TCGATTGTTA CCCACTAGCT TCCGCGCCTT GC - #CCGACTGC1560- GTTTCCTGCT CTATTCCGTC CCCAAGGCTC ACGGCGCCAA CGGCCGTAGC CC - #ACAATCAT1620- GACTGACGGA CCAACTCTCG CAGCTATTGC TGCTCTCGTC AAATCCCTGG CT - #GTCGACCC1680- GGCCACTACC CAGACCTCTG GACTTCGCCC AAGCACCCAT GTCAGGCTTC CC - #GGTCCGTA1740- TACCCGTGAG AAGGGTGATC TGGAGCGTGA GCTCTCGGCT CTTGTTGTCC GC - #ATAGAGCA1800- GCTGGAGACT GCCGCCATCG CTGCCTCTCC TCCAGCCATG CCCGATACAC CA - #AATGCGCC1860- AACCGATGCG CTGTTTTCAA ACGGCACCCT TTCGCCATCC TCGGAAACGC CT - #GATGCCCG1920- CTACCCCGCT CCGCTACCGC GAAATGGCTT CATCGACGAG GCCCTTGAGG GT - #CTCCGCGA1980- GCATGTCGAC GACCAGTCCA AGCTGCTTGA CAGCCAGCGT CAGGAGCTTG CT - #GGGGTCAA2040- CGCCCAGCTG ATTGAGCAAA AGCAACTTCA GGAAAAGGCT CTGGCTATTA TC - #GAACAGGA2100- ACGGGTTGCT ACCCTTGAGC GGGAACTCTG GAAGCATCAA AAGGCCAACG AG - #GCCTTCCA2160- AAAGGCTCTC CGAGAAATCG GTGAGATTGT CACTGCCGTC GCCAGGGGTG AT - #TTGTCCAA2220- AAAGGTCCGG ATGAACTCGG TGGAAATGGA CCCGGAAATC ACCACCTTCA AG - #CGTACGAT2280- AAACACAATG ATGGACCAGT TGCAAGTCTT CTCCAGCGAA GTCTCGCGTG TC - #GCTCGTGA2340- AGTCGGAACC GAGGGTATTC TCGGTGGCCA AGCTCAGATC GAAGGCGTTG AC - #GGCACCTG2400- GAAGGAACTC ACAGACAACG GTATGTTTGA TCCCATCTTG ACAGCCGCAG GC - #CGTAGTGG2460- CCTATGTGTA CTGATCATAT CATCTAGTCA ACGTCATGGC CCAGAATCTT AC - #CGACCAAG2520- TGCGAGAGAT TGCTTCCGTA ACGACTGCTG TCGCTCATGG CGATCTTACC AA - #GAAAATCG2580- AGCGTCCCGC CAAGGGAGAA ATACTTCAAC TTCAACAAAC CATCAACACA AT - #GGTGGATC2640- AGCTACGGAC TTTCGCCTCT GAAGTTACAC GTGTCGCCAG AGATGTCGGT AC - #CGAGGGTA2700- TCCTCGGTGG TCAAGCCGAC GTTGAAGGAG TCCAGGGCAT GTGGAACGAA CT - #TACGGTTA2760- ATGTGAACGC CATGGCCAAC AATCTAACAA CCCAAGTCAG AGATATCATC AA - #GGTTACTA2820- CCGCTGTCGC CAAGGGTGAC CTTACTCAAA AAGTACAAGC TGAATGCCGC GG - #TGAGATTT2880- TCGAACTGAA GAAGACTATC AACTCTATGG TGGACCAACT ACAACAATTT GC - #TCGGGAAG2940- TCACAAAGAT CGCCAGGGAA GTCGGAACCG AAGGAAGGCT CGGTGGGCAG GC - #CACTGTTC3000- ACGATGTTCA GGGTACTTGG AGGGACCTCA CCGAAAACGT CAACGGCATG GC - #CATGAACT3060- TGACCACACA GGTGCGAGAA ATCGCAAAGG TTACTACAGC CGTCGCCAAG GG - #TGATTTGA3120- CCAAGAAGAT TGGGGTCGAG GTTCAGGGTG AGATCCTGGA TTTGAAGAAC AC - #CATCAACA3180- CCATGGTTGA CCGTCTTGGT ACTTTCGCTT TCGAGGTCAG CAAGGTCGCC AG - #GGAAGTCG3240- GCACCGATGG TACCTTGGGT GGTCAGGCAC AGGTTGATAA TGTGGAGGGC AA - #GTGGAAGG3300- ATCTCACAGA GAACGTCAAC ACCATGGCCA GCAACCTTAC ATCTCAGGTA AG - #CTGCTCCT3360- AGATGATCCT TTGCGGCATG CACTGTTTGC TAACTTTTCA CAGGTCCGTG GG - #ATCTCTAC3420- CGTCACACAA GCCATTGCCA ATGGTGATAT GAGCCGCAAG ATTGAAGTTG AA - #GCCAAGGG3480- AGAGATACTC ATACTCAAGG AGACTATCAA CAACATGGTT GACCGACTCT CC - #ATTTTCTG3540- TAATGAGGTG CAGAGAGTCG CCAAGGATGT CGGTGTCGAT GGTATCATGG GA - #GGACAAGC3600- CGATGTTGCT GGCCTGAAGG GCAGGTGGAA GGAAATTACC ACCGATGTCA AC - #ACAATGGC3660- GAATAACTTG GTATGTCTCG CCGCCGCCAG CACCCTTGAA CAGCACCCCT TT - #TTGCTAAT3720- GCCTTTTACA GACGGCTCAA GTGAGAGCGT TCGGCGACAT CACAAATGCA GC - #AACAGACG3780- GGGACTTTAC AAAACTCGTC GAGGTAGAAG CCTCGGGCGA GATGGACGAA CT - #CAAAAAGA3840- AGATCAATCA GATGGTCTAC AATTTGAGGG ACAGTATTCA ACGTAATACC CA - #GGCCAGGG3900- AAGCCGCCGA ACTGGCCAAT AAGACCAAGT CCGAGTTTTT GGCGAACATG TC - #CCACGAAA3960- TACGCACACC CATGAACGGC ATTATCGGCA TGACACAACT TACTCTCGAT AC - #TGACCTGA4020- CACAGTATCA GAGAGAAATG CTCAACATTG TCAACTCCCT GGCCAACAGC TT - #ACTGACCA4080- TCATCGACGA CATTTTGGAT CTGTCCAAGA TCGAAGCTAG GCGTATGGTC AT - #CGAAGAGA4140- TTCCTTATAC GTTGCGTGGC ACCGTCTTCA ACGCGCTCAA GACTCTTGCC GT - #CAAGGAAA4200- CCGAGAAGTT TCTGGATCTT ACCTATCGTG TCGACCATTC TGTACCCGAC CA - #CGTCGTCG4260- GAGACTCCTT CAGGTTGCGC CAGATTATTC TTAACCTTGT TGGCAACGCT AT - #CAAGTTCA4320- CCGAGCATGG TGAAGTCAGT CTTACCATCC AGAAGGCCTC TTCAGTACAG TG - #CAGCACCG4380- AAGAGTACGC TATCGAGTTT GTCGTTTCCG ACACTGGTAT CGGTATTCCG GC - #GGACAAGC4440- TGGATCTCAT CTTCGACACT TTCCAGCAGG CCGATGGTTC AATGACTCGC AA - #GTTTGGCG4500- GTACTGGTCT CGGTCTCTCC ATTTCCAAGC GTCTTGTCAA CCTCATGGGT GG - #TGACGTTT4560- GGGTGAAGAG TGAGTATGGT AAGGGTAGCA AGTTCTTCTT CACCTGCGTG GT - #CCGCTTGG4620- CCAACGACGA TATTTCGTTG ATCGCCAAGC AGCTCAACCC TTACAAGAGT CA - #CCAGGTCC4680- TGTTCATCGA CAAGGGCCGC ACCGGACATG GACCGGAGAT CGCCAAGATG CT - #CCACGGCT4740- TGGGCCTCGT TCCCATCGTC GTCGACTCGG AGAGGAATCC TGCGCTCGAG AA - #GGCCAGAG4800- CTGCCGGCCA GGCGCCCTAC GACGTCATCA TTGTGGACTC GATCGAGGAT GC - #AAGGCGCT4860- TGCGGTCTGT TGACGACTTT AAGTACCTTC CCATCGTATT GCTAGCACCA GT - #CGTTCACG4920- TCTCGCTAAA GTCTTGCCTT GACTTGGGTA TCACGTCGTA CATGACGACG CC - #TTGTCAAC4980- TCATTGACCT CGGTAACGGC ATGGTCCCTG CTCTCGAAAA TAGGGCTACG CC - #GTCGCTGG5040- CGGACAACAC CAAATCTTTT GAGATCCTGC TTGCCGAAGA CAACACGGTC AA - #CCAGAGGC5100- TCGCGGTCAA GATCCTGGAG AAGTATCACC ACGTCGTCAC CGTTGTTGGA AA - #CGGTGAAG5160- AGGCTGTTGA GGCCGTCAAG AGGAAAAAGT TCGATGTCAT TCTTATGGAC GT - #CCAGATGC5220- CTATTATGGT GAGTCAAAGC TGTTTTTCAA ACCAAGAAGC CGATGCTAAC AA - #TTTTCATA5280- GGGCGGTTTC GAAGCTACGG CCAAGATTCG CGAGTACGAG CGCAGCCTCG GC - #AGCCAGCG5340- CACACCCATC ATCGCCCTCA CGGCGCATGC CATGATGGGT GACAGGGAAA AG - #TGTATCCA5400- GGCACAGATG GACGAGTATC TCTCCAAGCC GCTGCAGCAG AACCATCTAA TC - #CAGACCAT5460- ACTCAAGTGT GCGACGCTCG GCGGGCAACT ACTCGAGAAG AACCGGGAGC GC - #GAGCTGAC5520- CCGTGCTGCC GATGCCGTTA CAGGCGGCCG CCGCGACAAC GGCATGTACT CT - #GCCAGCCA5580- AGCCGCGCAG CACGCTGCGC TCCGCCCACC CCTCGCCACC AGGGGCCTCA CT - #GCCGCCGA5640- CAGCCTCGTC TCCGGCTTGG AGAGCCCATC CATCGTGACG GCGGATAAGG AG - #GATCC5697- (2) INFORMATION FOR SEQ ID NO:6:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 1281 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:- Met Thr Asp Gly Pro Thr Leu Ala Ala Ile Al - #a Ala Leu Val Lys Ser# 15- Leu Ala Val Asp Pro Ala Thr Thr Gln Thr Se - #r Gly Leu Arg Pro Ser# 30- Thr His Val Arg Leu Pro Gly Pro Tyr Thr Ar - #g Glu Lys Gly Asp Leu# 45- Glu Arg Glu Leu Ser Ala Leu Val Val Arg Il - #e Glu Gln Leu Glu Thr# 60- Ala Ala Ile Ala Ala Ser Pro Pro Ala Met Pr - #o Asp Thr Pro Asn Ala#80- Pro Thr Asp Ala Leu Phe Ser Asn Gly Thr Le - #u Ser Pro Ser Ser Glu# 95- Thr Pro Asp Ala Arg Tyr Pro Ala Pro Leu Pr - #o Arg Asn Gly Phe Ile# 110- Asp Glu Ala Leu Glu Gly Leu Arg Glu His Va - #l Asp Asp Gln Ser Lys# 125- Leu Leu Asp Ser Gln Arg Gln Glu Leu Ala Gl - #y Val Asn Ala Gln Leu# 140- Ile Glu Gln Lys Gln Leu Gln Glu Lys Ala Le - #u Ala Ile Ile Glu Gln145 1 - #50 1 - #55 1 -#60- Glu Arg Val Ala Thr Leu Glu Arg Glu Leu Tr - #p Lys His Gln Lys Ala# 175- Asn Glu Ala Phe Gln Lys Ala Leu Arg Glu Il - #e Gly Glu Ile Val Thr# 190- Ala Val Ala Arg Gly Asp Leu Ser Lys Lys Va - #l Arg Met Asn Ser Val# 205- Glu Met Asp Pro Glu Ile Thr Thr Phe Lys Ar - #g Thr Ile Asn Thr Met# 220- Met Asp Gln Leu Gln Val Phe Ser Ser Glu Va - #l Ser Arg Val Ala Arg225 2 - #30 2 - #35 2 -#40- Glu Val Gly Thr Glu Gly Ile Leu Gly Gly Gl - #n Ala Gln Ile Glu Gly# 255- Val Asp Gly Thr Trp Lys Glu Leu Thr Asp As - #n Val Asn Val Met Ala# 270- Gln Asn Leu Thr Asp Gln Val Arg Glu Ile Al - #a Ser Val Thr Thr Ala# 285- Val Ala His Gly Asp Leu Thr Lys Lys Ile Gl - #u Arg Pro Ala Lys Gly# 300- Glu Ile Leu Gln Leu Gln Gln Thr Ile Asn Th - #r Met Val Asp Gln Leu305 3 - #10 3 - #15 3 -#20- Arg Thr Phe Ala Ser Glu Val Thr Arg Val Al - #a Arg Asp Val Gly Thr# 335- Glu Gly Ile Leu Gly Gly Gln Ala Asp Val Gl - #u Gly Val Gln Gly Met# 350- Trp Asn Glu Leu Thr Val Asn Val Asn Ala Me - #t Ala Asn Asn Leu Thr# 365- Thr Gln Val Arg Asp Ile Ile Lys Val Thr Th - #r Ala Val Ala Lys Gly# 380- Asp Leu Thr Gln Lys Val Gln Ala Glu Cys Ar - #g Gly Glu Ile Phe Glu385 3 - #90 3 - #95 4 -#00- Leu Lys Lys Thr Ile Asn Ser Met Val Asp Gl - #n Leu Gln Gln Phe Ala# 415- Arg Glu Val Thr Lys Ile Ala Arg Glu Val Gl - #y Thr Glu Gly Arg Leu# 430- Gly Gly Gln Ala Thr Val His Asp Val Gln Gl - #y Thr Trp Arg Asp Leu# 445- Thr Glu Asn Val Asn Gly Met Ala Met Asn Le - #u Thr Thr Gln Val Arg# 460- Glu Ile Ala Lys Val Thr Thr Ala Val Ala Ly - #s Gly Asp Leu Thr Lys465 4 - #70 4 - #75 4 -#80- Lys Ile Gly Val Glu Val Gln Gly Glu Ile Le - #u Asp Leu Lys Asn Thr# 495- Ile Asn Thr Met Val Asp Arg Leu Gly Thr Ph - #e Ala Phe Glu Val Ser# 510- Lys Val Ala Arg Glu Val Gly Thr Asp Gly Th - #r Leu Gly Gly Gln Ala# 525- Gln Val Asp Asn Val Glu Gly Lys Trp Lys As - #p Leu Thr Glu Asn Val# 540- Asn Thr Met Ala Ser Asn Leu Thr Ser Gln Va - #l Arg Gly Ile Ser Thr545 5 - #50 5 - #55 5 -#60- Val Thr Gln Ala Ile Ala Asn Gly Asp Met Se - #r Arg Lys Ile Glu Val# 575- Glu Ala Lys Gly Glu Ile Leu Ile Leu Lys Gl - #u Thr Ile Asn Asn Met# 590- Val Asp Arg Leu Ser Ile Phe Cys Asn Glu Va - #l Gln Arg Val Ala Lys# 605- Asp Val Gly Val Asp Gly Ile Met Gly Gly Gl - #n Ala Asp Val Ala Gly# 620- Leu Lys Gly Arg Trp Lys Glu Ile Thr Thr As - #p Val Asn Thr Met Ala625 6 - #30 6 - #35 6 -#40- Asn Asn Leu Thr Ala Gln Val Arg Ala Phe Gl - #y Asp Ile Thr Asn Ala# 655- Ala Thr Asp Gly Asp Phe Thr Lys Leu Val Gl - #u Val Glu Ala Ser Gly# 670- Glu Met Asp Glu Leu Lys Lys Lys Ile Asn Gl - #n Met Val Tyr Asn Leu# 685- Arg Asp Ser Ile Gln Arg Asn Thr Gln Ala Ar - #g Glu Ala Ala Glu Leu# 700- Ala Asn Lys Thr Lys Ser Glu Phe Leu Ala As - #n Met Ser His Glu Ile705 7 - #10 7 - #15 7 -#20- Arg Thr Pro Met Asn Gly Ile Ile Gly Met Th - #r Gln Leu Thr Leu Asp# 735- Thr Asp Leu Thr Gln Tyr Gln Arg Glu Met Le - #u Asn Ile Val Asn Ser# 750- Leu Ala Asn Ser Leu Leu Thr Ile Ile Asp As - #p Ile Leu Asp Leu Ser# 765- Lys Ile Glu Ala Arg Arg Met Val Ile Glu Gl - #u Ile Pro Tyr Thr Leu# 780- Arg Gly Thr Val Phe Asn Ala Leu Lys Thr Le - #u Ala Val Lys Glu Thr785 7 - #90 7 - #95 8 -#00- Glu Lys Phe Leu Asp Leu Thr Tyr Arg Val As - #p His Ser Val Pro Asp# 815- His Val Val Gly Asp Ser Phe Arg Leu Arg Gl - #n Ile Ile Leu Asn Leu# 830- Val Gly Asn Ala Ile Lys Phe Thr Glu His Gl - #y Glu Val Ser Leu Thr# 845- Ile Gln Lys Ala Ser Ser Val Gln Cys Ser Th - #r Glu Glu Tyr Ala Ile# 860- Glu Phe Val Val Ser Asp Thr Gly Ile Gly Il - #e Pro Ala Asp Lys Leu865 8 - #70 8 - #75 8 -#80- Asp Leu Ile Phe Asp Thr Phe Gln Gln Ala As - #p Gly Ser Met Thr Arg# 895- Lys Phe Gly Gly Thr Gly Leu Gly Leu Ser Il - #e Ser Lys Arg Leu Val# 910- Asn Leu Met Gly Gly Asp Val Trp Val Lys Se - #r Glu Tyr Gly Lys Gly# 925- Ser Lys Phe Phe Phe Thr Cys Val Val Arg Le - #u Ala Asn Asp Asp Ile# 940- Ser Leu Ile Ala Lys Gln Leu Asn Pro Tyr Ly - #s Ser His Gln Val Leu945 9 - #50 9 - #55 9 -#60- Phe Ile Asp Lys Gly Arg Thr Gly His Gly Pr - #o Glu Ile Ala Lys Met# 975- Leu His Gly Leu Gly Leu Val Pro Ile Val Va - #l Asp Ser Glu Arg Asn# 990- Pro Ala Leu Glu Lys Ala Arg Ala Ala Gly Gl - #n Ala Pro Tyr Asp Val# 10050- Ile Ile Val Asp Ser Ile Glu Asp Ala Arg Ar - #g Leu Arg Ser Val Asp# 10205- Asp Phe Lys Tyr Leu Pro Ile Val Leu Leu Al - #a Pro Val Val His Val# 10401030 - # 1035- Ser Leu Lys Ser Cys Leu Asp Leu Gly Ile Th - #r Ser Tyr Met Thr Thr# 10550- Pro Cys Gln Leu Ile Asp Leu Gly Asn Gly Me - #t Val Pro Ala Leu Glu# 10705- Asn Arg Ala Thr Pro Ser Leu Ala Asp Asn Th - #r Lys Ser Phe Glu Ile# 10850- Leu Leu Ala Glu Asp Asn Thr Val Asn Gln Ar - #g Leu Ala Val Lys Ile# 11005- Leu Glu Lys Tyr His His Val Val Thr Val Va - #l Gly Asn Gly Glu Glu# 11201110 - # 1115- Ala Val Glu Ala Val Lys Arg Lys Lys Phe As - #p Val Ile Leu Met Asp# 11350- Val Gln Met Pro Ile Met Gly Gly Phe Glu Al - #a Thr Ala Lys Ile Arg# 11505- Glu Tyr Glu Arg Ser Leu Gly Ser Gln Arg Th - #r Pro Ile Ile Ala Leu# 11650- Thr Ala His Ala Met Met Gly Asp Arg Glu Ly - #s Cys Ile Gln Ala Gln# 11805- Met Asp Glu Tyr Leu Ser Lys Pro Leu Gln Gl - #n Asn His Leu Ile Gln# 12001190 - # 1195- Thr Ile Leu Lys Cys Ala Thr Leu Gly Gly Gl - #n Leu Leu Glu Lys Asn# 12150- Arg Glu Arg Glu Leu Thr Arg Ala Ala Asp Al - #a Val Thr Gly Gly Arg# 12305- Arg Asp Asn Gly Met Tyr Ser Ala Ser Gln Al - #a Ala Gln His Ala Ala# 12450- Leu Arg Pro Pro Leu Ala Thr Arg Gly Leu Th - #r Ala Ala Asp Ser Leu# 12605- Val Ser Gly Leu Glu Ser Pro Ser Ile Val Th - #r Ala Asp Lys Glu Asp# 12801270 - # 1275- Pro- (2) INFORMATION FOR SEQ ID NO:7:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 19 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "DNA" (A) DESCRIPTION: /desc- (ix) FEATURE: (A) NAME/KEY: modified.sub.-- - #base (B) LOCATION: 6#/mod.sub.-- base= OTHERRMATION:#"The residue at this position is deoxyinosine."- (ix) FEATURE: (A) NAME/KEY: modified.sub.-- - #base (B) LOCATION: 9#/mod.sub.-- base= OTHERRMATION:#"The residue at this position is deoxyinosine."- (ix) FEATURE: (A) NAME/KEY: modified.sub.-- - #base (B) LOCATION: 12#/mod.sub.-- base= OTHERRMATION:#"The residue at this position is deoxyinosine."- (ix) FEATURE: (A) NAME/KEY: modified.sub.-- - #base (B) LOCATION: 15#/mod.sub.-- base= OTHERRMATION:#"The residue at this position is deoxyinosine."- (ix) FEATURE: (A) NAME/KEY: modified.sub.-- - #base (B) LOCATION: 17#/mod.sub.-- base= OTHERRMATION:#"The residue at this position is deoxyinosine."- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:# 19 NCC- (2) INFORMATION FOR SEQ ID NO:8:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "DNA" (A) DESCRIPTION: /desc- (ix) FEATURE: (A) NAME/KEY: modified.sub.-- - #base (B) LOCATION: 9#/mod.sub.-- base= OTHERRMATION:#"The residue at this position is deoxyinosine."- (ix) FEATURE: (A) NAME/KEY: modified.sub.-- - #base (B) LOCATION: 11..12#/mod.sub.-- base= OTHERRMATION:#"The residue at this position is deoxyinosine."- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:# 17 T- (2) INFORMATION FOR SEQ ID NO:9:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "DNA" (A) DESCRIPTION: /desc- (ix) FEATURE: (A) NAME/KEY: modified.sub.-- - #base (B) LOCATION: 6#/mod.sub.-- base= OTHERRMATION:#"The residue at this position is deoxyinosine."- (ix) FEATURE: (A) NAME/KEY: modified.sub.-- - #base (B) LOCATION: 9#/mod.sub.-- base= OTHERRMATION:#"The residue at this position is deoxyinosine."- (ix) FEATURE: (A) NAME/KEY: modified.sub.-- - #base (B) LOCATION: 12#/mod.sub.-- base= OTHERRMATION:#"The residue at this position is deoxyinosine."- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:# 17 T- (2) INFORMATION FOR SEQ ID NO:10:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "DNA" (A) DESCRIPTION: /desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:# 20 GTTG- (2) INFORMATION FOR SEQ ID NO:11:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 6 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 2#/product= "OTHER"R INFORMATION:#"The amino acid at this position can be eith - #er#Acid or Aspartic Acid."- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 3#/product= "OTHER"R INFORMATION:#"The amino acid at this position can be eith - #er#Isoleucine, Leucine or Phenylalanine."- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:- His Xaa Xaa Arg Thr Pro1 5- (2) INFORMATION FOR SEQ ID NO:12:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 10 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 4#/product= "OTHER"R INFORMATION:#"The amino acid at this position can be eith - #er Serine or - # Glycine."- (ix) FEATURE: (A) NAME/KEY: Modified-sit - #e (B) LOCATION: 7#/product= "OTHER"R INFORMATION:#"The amino acid at this position can be eith - #er#or Valine." Isoleucine- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:- Asn Leu Val Xaa Asn Ala Xaa Lys Phe Thr# 10- (2) INFORMATION FOR SEQ ID NO:13:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 48 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "DNA" (A) DESCRIPTION: /desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:# 48AGTC AGTCGATCGA TCGATCGATC GATCGATC- (2) INFORMATION FOR SEQ ID NO:14:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 15 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "DNA" (A) DESCRIPTION: /desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:# 15- (2) INFORMATION FOR SEQ ID NO:15:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "DNA" (A) DESCRIPTION: /desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:# 17 G- (2) INFORMATION FOR SEQ ID NO:16:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "DNA" (A) DESCRIPTION: /desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:# 18 TC- (2) INFORMATION FOR SEQ ID NO:17:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 4453 base (B) TYPE: nucleic acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: Not Relev - #ant- (ii) MOLECULE TYPE: DNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:- GTGGAGGTGA TGGGTGGTTG ATGAAGAGGA AGAGGAGTTA TGAAAGTTGT GG - #GCACACGC 60- GTTTTTTTTT TTTTTTTGCT TCTTCCTTTT TTTAGGTCGC GCACCAATTA CT - #AATTAGAT 120- TATTTTTGCT ATTACTGGGC AAATTGGATG TGGCAGATAT CTGCAACACA GT - #ATCCGGAT 180- ATTAGTCATG GGGCATGTCA GATACTAGTA GGGTATGGCA GTTGGATGCG TG - #TAGGGGTA 240- CTGGGCAGGG CCCGGTAAAG GAAACTAAAC ATGTTAGCCA GGGAGTGAGG TC - #CTACGGGG 300- GGGAGCATAG TACACCAGTA GTAGGACCTC CTTTGTTGGT CGTGTGTGGT GG - #CAATATAC 360- AAAGCCCCCC CTTACATCAA CAAAAAATTT TTCCTCTCTG TTGTTTATCT CG - #AGTTTCTC 420- CCTCTCTCTC CAATGAACCC CACTAAAAAA CCACGGTTAT CACCAATGCA GC - #CCTCTGTT 480- TTTGAAATAC TCAACGACCC TGAGCTTTAT AGTCAGCACT GTCATAGCCT TA - #GGGAAACA 540- CTTCTTGATC ATTTCAACCA TCAAGCTACA CTTATCGACA CTTATGAACA TG - #AACTAGAA 600- AAATCCAAAA ATGCCAACAA AGCGTTCCAA CAAGCACTTA GTGAAATAGG TA - #CAGTTGTT 660- ATATCTGTTG CCATGGGAGA CTTGTCCAAA AAAGTTGAGA TTCACACAGT AG - #AAAATGAC 720- CCTGAGATTT TAAAAGTCAA AATCACCATC AACACCATGA TGGATCAATT AC - #AGACATTT 780- GCTAATGAGG TTACAAAAGT CGCCACCGAA GTCGCAAATG GTGAACTAGG TG - #GACAAGCG 840- AAAAATGATG GATCTGTTGG TATTTGGAGA TCACTTACAG ACAATGTTAA TA - #TTATGGCT 900- CTTAATTTAA CTAACCAAGT GCGAGAAATT GCTGATGTCA CACGTGCTGT TG - #CCAAGGGG 960- GACTTGTCAC GTAAAATTAA TGTACACGCC CAGGGTGAAA TCCTTCAACT TC - #AACGTACA1020- ATAAACACCA TGGTGGATCA GTTACGAACG TTTGCATTCG AAGTATCTAA AG - #TTGCTAGA1080- GATGTTGGTG TGCTTGGTAT ATTAGGAGGA CAAGCGTTGA TTGAAAATGT TG - #AAGGTATT1140- TGGGAAGAGT TGACTGATAA TGTCAATGCT ATGGCTCTTA ATTTGACTAC AC - #AAGTGAGA1200- AATATTGCCA ATGTCACCAC TGCCGTTGCC AAGGGGGATT TGTCGAAAAA AG - #TCACTGCT1260- GATTGTAAGG GAGAAATTCT TGATTTGAAA CTTACTATTA ATCAAATGGT GG - #ACCGATTA1320- CAGAATTTTG CTCTTGCGGT GACGACATTG TCGAGAGAGG TTGGTACTTT GG - #GTATTTTG1380- GGTGGACAAG CTAACGTACA GGATGTTGAA GGTGCTTGGA AACAGGTTAC AG - #AAAATGTC1440- AACCTAATGG CTACTAATTT AACTAACCAA GTGAGATCTA TTGCTACAGT TA - #CTACTGCA1500- GTTGCGCATG GTGATTTGTC GCAAAAGATT GATGTTCATG CCCAGGGAGA GA - #TTTTACAA1560- TTGAAAAATA CAATCAACAA GATGGTGGAC TCTTTGCAGT TGTTTGCATC AG - #AAGTGTCG1620- AAAGTGGCAC AAGATGTTGG TATTAATGGA AAATTAGGTA TTCAAGCACA AG - #TTAGTGAT1680- GTTGATGGAT TATGGAAGGA AATTACGTCT AATGTAAATA CCATGGCTTC AA - #ATTTAACT1740- TCGCAAGTGA GAGCTTTTGC ACAGATTACT GCTGCTGCTA CTGATGGGGA TT - #TCACTAGA1800- TTTATTACTG TTGAAGCACT GGGAGAGATG GATGCGTTGA AAACAAAGAT TA - #ATCAAATG1860- GTGTTTAACT TAAGGGAATC GCTTCAAAGG AATACTGCGG CTAGAGAAGC TG - #CTGAGTTG1920- GCCAATAGTG CGAAATCCGA GTTTTTAGCA AACATGTCGC ATGAGATTAG AA - #CACCATTG1980- AATGGGATTA TTGGTATGAC TCAGTTGTCG CTTGATACAG AGTTGACACA GT - #ACCAACGA2040- GAGATGTTGT CGATTGTGCA TAACTTGGCA AATTCCTTGT TGACCATTAT AG - #ACGATATA2100- TTGGATATTT CTAAGATTGA GGCGAATAGA ATGACGGTGG AACAGATTGA TT - #TTTCATTA2160- AGAGGGACAG TGTTTGGTGC ATTGAAAACG TTAGCCGTCA AAGCTATTGA AA - #AAAACCTA2220- GACTTGACCT ATCAATGTGA TTCATCGTTT CCAGATAATC TTATTGGAGA TA - #GTTTTAGA2280- TTACGACAAG TTATTCTTAA CTTGGCTGGT AATGCTATTA AGTTTACTAA AG - #AGGGGAAA2340- GTTAGTGTTA GTGTGAAAAA GTCTGATAAA ATGGTGTTAG ATAGTAAGTT GT - #TGTTAGAG2400- GTTTGTGTTA GCGACACGGG AATAGGTATA GAGAAAGACA AATTGGGATT GA - #TTTTCGAT2460- ACCTTCTGTC AAGCTGATGG TTCTACTACA AGAAAGTTTG GTGGTACAGG TT - #TAGGGTTG2520- TCAATTTCCA AACAGTTGAT ACATTTAATG GGTGGAGAGA TATGGGTTAC CT - #CGGAGTAT2580- GGATCCGGGT CAAACTTTTA TTTTACGGTG TGCGTGTCGC CATCTAATAT TA - #GATATACT2640- CGACAAACCG AACAATTGTT ACCATTTAGT TCCCATTATG TGTTATTTGT AT - #CGACTGAG2700- CATACTCAAG AAGAACTTGA TGTGTTGAGA GATGGAATTA TAGAACTTGG AT - #TGATACCT2760- ATAATTGTGA GAAATATTGA AGATGCAACA TTGACTGAGC CGGTGAAATA TG - #ATATAATT2820- ATGATTGATT CGATAGAGAT TGCCAAAAAG TTGAGGTTGT TATCAGAGGT TA - #AATATATT2880- CCGTTGGTTT TGGTCCATCA TTCTATTCCA CAGTTGAATA TGAGAGTATG TA - #TTGATTTG2940- GGGATATCTT CCTATGCAAA TACGCCATGT TCGATCACGG ACTTGGCCAG TG - #CGATTATA3000- CCAGCGTTGG AGTCGAGATC TATATCACAG AACTCAGACG AGTCGGTGAG GT - #ACAAAATA3060- TTACTAGCAG AGGACAACCT CGTCAATCAG AAACTTGCAG TTAGGATATT AG - #AAAAGCAA3120- GGGCATCTGG TGGAAGTAGT TGAGAACGGA CTCGAGGCGT ACGAAGCGAT TA - #AGAGGAAT3180- AAATATGATG TGGTGTTGAT GGATGTGCAA ATGCCTGTAA TGGGTGGGTT TG - #AAGCTACG3240- GAGAAGATTC GACAATGGGA GAAAAAGTCT AACCCAATTG ACTCGTTGAC GT - #TTAGGACT3300- CCAATTATTG CCCTCACTGC ACACGCCATG TTAGGTGATA GAGAAAAGTC AT - #TGGCCAAG3360- GGGATGGACG ATTATGTGAG TAAGCCATTG AAGCCGAAAT TGTTAATGCA GA - #CGATAAAC3420- AAGTGTATTC ATAATATTAA CCAGTTGAAA GAATTGTCGA GAAATAGTAG AG - #GTAGCGAT3480- TTTGCAAAGA AGATGACCCG AAACACACCT GGAAGCACGA CCCGTCAGGG GA - #GTGATGAG3540- GGGAGTGTAG AGGACATGAT TGGGGACACT CCCCGTCAAG GGAGTGTTGA GG - #GAGGGGGT3600- ACAAGTAGTA GACCAGTACA GAGAAGGTCT GCCACAGAGG GGTCGATCAC TA - #CAATTAGT3660- GAACAAATCG ACCGTTAGCT AACGACTCAA GCGTCAGCTT GAGTCAAAGC TA - #CAAATATT3720- TAGCCAATTG TATACTTAGA TAAATAAAAT ACAAGTAAAC CATTGTTGTG TT - #TAGATCAA3780- TAATTGAAAA ATAAACAAGA TTACTAAAAA TATCAAGCCA AATTGTTGTG TA - #GGAACTGG3840- GGTTTTTTTT TTGGGGTAAA CTTTTTTACC AAAAAATGGA TAAAAAAGGG GA - #TGTGGTCC3900- CAGTAGTAAC TTTAGTGACT GTTTAGGTTA CTTGAGCTAT CCAAGTAGAA TG - #TCAGCCCC3960- CGCAGTAAGT TTGGTCTTAT TGTTTACGGA AAAATAAGAA CCTTAGCCCT GA - #ACTAGCCC4020- CTACCTAGTT TTGATGTGAA AAATTTTTTT TTTTTTTTTA TTGACGTTCT CC - #CCCCCTAG4080- ACCAATCGAA AGCCGTGGTA TTATTCCGGG CTTTGAAGAA AAGTCTTTCT TT - #TTTTCTTT4140- TTTTTTGTAT GGGCGCCACA GTTTATGCAA CATCACGTGA CCTTCTCTCA GC - #AAAAAAAA4200- ACCATTTATA TATTCCTTCT CATCCTCGCA GATGAGAGAC AAAAAACAAA CA - #AAAAAAAA4260- AAAATCTTTT TTTTTCGCCA CGCACACTAC CATGTCGCAA CAACCACATT TA - #CGTCTCGG4320- ATCTACCGCA CCTGATTTCA AAGCTGATAC AACTAACGGG CCTATTCTGT TT - #CACGAAAT4380- ACATTGGTGA TAGCTGGGCT ATCTTGTTCT CACATCCCGC CGCTCGAACC AT - #GTGTGTAC4440# 4453- (2) INFORMATION FOR SEQ ID NO:18:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 1081 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: Not Relev - #ant- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:- Met Asn Pro Thr Lys Lys Pro Arg Leu Ser Pr - #o Met Gln Pro Ser Val# 15- Phe Glu Ile Leu Asn Asp Pro Glu Leu Tyr Se - #r Gln His Cys His Ser# 30- Leu Arg Glu Thr Leu Leu Asp His Phe Asn Hi - #s Gln Ala Thr Leu Ile# 45- Asp Thr Tyr Glu His Glu Leu Glu Lys Ser Ly - #s Asn Ala Asn Lys Ala# 60- Phe Gln Gln Ala Leu Ser Glu Ile Gly Thr Va - #l Val Ile Ser Val Ala#80- Met Gly Asp Leu Ser Lys Lys Val Glu Ile Hi - #s Thr Val Glu Asn Asp# 95- Pro Glu Ile Leu Lys Val Lys Ile Thr Ile As - #n Thr Met Met Asp Gln# 110- Leu Gln Thr Phe Ala Asn Glu Val Thr Lys Va - #l Ala Thr Glu Val Ala# 125- Asn Gly Glu Leu Gly Gly Gln Ala Lys Asn As - #p Gly Ser Val Gly Ile# 140- Trp Arg Ser Leu Thr Asp Asn Val Asn Ile Me - #t Ala Leu Asn Leu Thr145 1 - #50 1 - #55 1 -#60- Asn Gln Val Arg Glu Ile Ala Asp Val Thr Ar - #g Ala Val Ala Lys Gly# 175- Asp Leu Ser Arg Lys Ile Asn Val His Ala Gl - #n Gly Glu Ile Leu Gln# 190- Leu Gln Arg Thr Ile Asn Thr Met Val Asp Gl - #n Leu Arg Thr Phe Ala# 205- Phe Glu Val Ser Lys Val Ala Arg Asp Val Gl - #y Val Leu Gly Ile Leu# 220- Gly Gly Gln Ala Leu Ile Glu Asn Val Glu Gl - #y Ile Trp Glu Glu Leu225 2 - #30 2 - #35 2 -#40- Thr Asp Asn Val Asn Ala Met Ala Leu Asn Le - #u Thr Thr Gln Val Arg# 255- Asn Ile Ala Asn Val Thr Thr Ala Val Ala Ly - #s Gly Asp Leu Ser Lys# 270- Lys Val Thr Ala Asp Cys Lys Gly Glu Ile Le - #u Asp Leu Lys Leu Thr# 285- Ile Asn Gln Met Val Asp Arg Leu Gln Asn Ph - #e Ala Leu Ala Val Thr# 300- Thr Leu Ser Arg Glu Val Gly Thr Leu Gly Il - #e Leu Gly Gly Gln Ala305 3 - #10 3 - #15 3 -#20- Asn Val Gln Asp Val Glu Gly Ala Trp Lys Gl - #n Val Thr Glu Asn Val# 335- Asn Leu Met Ala Thr Asn Leu Thr Asn Gln Va - #l Arg Ser Ile Ala Thr# 350- Val Thr Thr Ala Val Ala His Gly Asp Leu Se - #r Gln Lys Ile Asp Val# 365- His Ala Gln Gly Glu Ile Leu Gln Leu Lys As - #n Thr Ile Asn Lys Met# 380- Val Asp Ser Leu Gln Leu Phe Ala Ser Glu Va - #l Ser Lys Val Ala Gln385 3 - #90 3 - #95 4 -#00- Asp Val Gly Ile Asn Gly Lys Leu Gly Ile Gl - #n Ala Gln Val Ser Asp# 415- Val Asp Gly Leu Trp Lys Glu Ile Thr Ser As - #n Val Asn Thr Met Ala# 430- Ser Asn Leu Thr Ser Gln Val Arg Ala Phe Al - #a Gln Ile Thr Ala Ala# 445- Ala Thr Asp Gly Asp Phe Thr Arg Phe Ile Th - #r Val Glu Ala Leu Gly# 460- Glu Met Asp Ala Leu Lys Thr Lys Ile Asn Gl - #n Met Val Phe Asn Leu465 4 - #70 4 - #75 4 -#80- Arg Glu Ser Leu Gln Arg Asn Thr Ala Ala Ar - #g Glu Ala Ala Glu Leu# 495- Ala Asn Ser Ala Lys Ser Glu Phe Leu Ala As - #n Met Ser His Glu Ile# 510- Arg Thr Pro Leu Asn Gly Ile Ile Gly Met Th - #r Gln Leu Ser Leu Asp# 525- Thr Glu Leu Thr Gln Tyr Gln Arg Glu Met Le - #u Ser Ile Val His Asn# 540- Leu Ala Asn Ser Leu Leu Thr Ile Ile Asp As - #p Ile Leu Asp Ile Ser545 5 - #50 5 - #55 5 -#60- Lys Ile Glu Ala Asn Arg Met Thr Val Glu Gl - #n Ile Asp Phe Ser Leu# 575- Arg Gly Thr Val Phe Gly Ala Leu Lys Thr Le - #u Ala Val Lys Ala Ile# 590- Glu Lys Asn Leu Asp Leu Thr Tyr Gln Cys As - #p Ser Ser Phe Pro Asp# 605- Asn Leu Ile Gly Asp Ser Phe Arg Leu Arg Gl - #n Val Ile Leu Asn Leu# 620- Ala Gly Asn Ala Ile Lys Phe Thr Lys Glu Gl - #y Lys Val Ser Val Ser625 6 - #30 6 - #35 6 -#40- Val Lys Lys Ser Asp Lys Met Val Leu Asp Se - #r Lys Leu Leu Leu Glu# 655- Val Cys Val Ser Asp Thr Gly Ile Gly Ile Gl - #u Lys Asp Lys Leu Gly# 670- Leu Ile Phe Asp Thr Phe Cys Gln Ala Asp Gl - #y Ser Thr Thr Arg Lys# 685- Phe Gly Gly Thr Gly Leu Gly Leu Ser Ile Se - #r Lys Gln Leu Ile His# 700- Leu Met Gly Gly Glu Ile Trp Val Thr Ser Gl - #u Tyr Gly Ser Gly Ser705 7 - #10 7 - #15 7 -#20- Asn Phe Tyr Phe Thr Val Cys Val Ser Pro Se - #r Asn Ile Arg Tyr Thr# 735- Arg Gln Thr Glu Gln Leu Leu Pro Phe Ser Se - #r His Tyr Val Leu Phe# 750- Val Ser Thr Glu His Thr Gln Glu Glu Leu As - #p Val Leu Arg Asp Gly# 765- Ile Ile Glu Leu Gly Leu Ile Pro Ile Ile Va - #l Arg Asn Ile Glu Asp# 780- Ala Thr Leu Thr Glu Pro Val Lys Tyr Asp Il - #e Ile Met Ile Asp Ser785 7 - #90 7 - #95 8 -#00- Ile Glu Ile Ala Lys Lys Leu Arg Leu Leu Se - #r Glu Val Lys Tyr Ile# 815- Pro Leu Val Leu Val His His Ser Ile Pro Gl - #n Leu Asn Met Arg Val# 830- Cys Ile Asp Leu Gly Ile Ser Ser Tyr Ala As - #n Thr Pro Cys Ser Ile# 845- Thr Asp Leu Ala Ser Ala Ile Ile Pro Ala Le - #u Glu Ser Arg Ser Ile# 860- Ser Gln Asn Ser Asp Glu Ser Val Arg Tyr Ly - #s Ile Leu Leu Ala Glu865 8 - #70 8 - #75 8 -#80- Asp Asn Leu Val Asn Gln Lys Leu Ala Val Ar - #g Ile Leu Glu Lys Gln# 895- Gly His Leu Val Glu Val Val Glu Asn Gly Le - #u Glu Ala Tyr Glu Ala# 910- Ile Lys Arg Asn Lys Tyr Asp Val Val Leu Me - #t Asp Val Gln Met Pro# 925- Val Met Gly Gly Phe Glu Ala Thr Glu Lys Il - #e Arg Gln Trp Glu Lys# 940- Lys Ser Asn Pro Ile Asp Ser Leu Thr Phe Ar - #g Thr Pro Ile Ile Ala945 9 - #50 9 - #55 9 -#60- Leu Thr Ala His Ala Met Leu Gly Asp Arg Gl - #u Lys Ser Leu Ala Lys# 975- Gly Met Asp Asp Tyr Val Ser Lys Pro Leu Ly - #s Pro Lys Leu Leu Met# 990- Gln Thr Ile Asn Lys Cys Ile His Asn Ile As - #n Gln Leu Lys Glu Leu# 10050- Ser Arg Asn Ser Arg Gly Ser Asp Phe Ala Ly - #s Lys Met Thr Arg Asn# 10205- Thr Pro Gly Ser Thr Thr Arg Gln Gly Ser As - #p Glu Gly Ser Val Glu# 10401030 - # 1035- Asp Met Ile Gly Asp Thr Pro Arg Gln Gly Se - #r Val Glu Gly Gly Gly# 10550- Thr Ser Ser Arg Pro Val Gln Arg Arg Ser Al - #a Thr Glu Gly Ser Ile# 10705- Thr Thr Ile Ser Glu Gln Ile Asp Arg# 1080- (2) INFORMATION FOR SEQ ID NO:19:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "DNA" (A) DESCRIPTION: /desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:# 20 CGTC- (2) INFORMATION FOR SEQ ID NO:20:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid#= "DNA" (A) DESCRIPTION: /desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:# 20 ATGC- (2) INFORMATION FOR SEQ ID NO:21:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 368 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: Not Relev - #ant- (ii) MOLECULE TYPE: other nucleic acid#= "DNA" (A) DESCRIPTION: /desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:- CACGAGATGA GGACGCCATT GAATGGGATT ATTGGTATGA CTCAGTTGTC GC - #TTGATACA 60- GAGTTGACAC AGTACCAACG AGAGATGTTG TCGATTGTGC ATAACTTGGC AA - #ATTCCTTG 120- TTGACCATTA TAGACGATAT ATTGGATATT TCTAAGATTG AGGCGAATAG AA - #TGACGGTG 180- GAACAGATTG ATTTTTCATT AAGAGGGACA GTGTTTGGTG CATTGAAAAC GT - #TAGCCGTC 240- AAAGCTATTG AAAAAAACCT AGACTTGACC TATCAATGTG ATTCATCGTT TC - #CAGATAAT 300- CTTATTGGAG ATAGTTTTAG ATTACGACAA GTTATTCTTA ACTTGGCTGG TA - #ATGCCCTC 360# 368- (2) INFORMATION FOR SEQ ID NO:22:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 122 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:- His Glu Met Arg Thr Pro Leu Asn Gly Ile Il - #e Gly Met Thr Gln Leu# 15- Ser Leu Asp Thr Glu Leu Thr Gln Tyr Gln Ar - #g Glu Met Leu Ser Ile# 30- Val His Asn Leu Ala Asn Ser Leu Leu Thr Il - #e Ile Asp Asp Ile Leu# 45- Asp Ile Ser Lys Ile Glu Ala Asn Arg Met Th - #r Val Glu Gln Ile Asp# 60- Phe Ser Leu Arg Gly Thr Val Phe Gly Ala Le - #u Lys Thr Leu Ala Val#80- Lys Ala Ile Glu Lys Asn Leu Asp Leu Thr Ty - #r Gln Cys Asp Ser Ser# 95- Phe Pro Asp Asn Leu Ile Gly Asp Ser Phe Ar - #g Leu Arg Gln Val Ile# 110- Leu Asn Leu Ala Gly Asn Ala Leu Lys Phe# 120- (2) INFORMATION FOR SEQ ID NO:23:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 144 base (B) TYPE: nucleic acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: Not Relev - #ant- (ii) MOLECULE TYPE: other nucleic acid#= "DNA" (A) DESCRIPTION: /desc- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:- ATGACCATGA TTACGCCACT AGTCCGAGGC CTCGAGATCT ATCGATGCAT GC - #CATGGTAC 60- CCGGGAGCTC GAATTCGAAG CTTCTGCAGA CGCGTCGACG TCATATGGAT CC - #GATATCGC 120# 144GAAC TAGT- (2) INFORMATION FOR SEQ ID NO:24:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 15 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: Not Relev - #ant- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:- Arg Tyr Asp Leu Val Leu Met Asp Ile Val Me - #t Pro Asn Leu Asp# 15- (2) INFORMATION FOR SEQ ID NO:25:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 15 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: Not Relev - #ant- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:- Lys Phe Asp Val Ile Leu Met Asp Val Gln Me - #t Pro Ile Met Gly# 15- (2) INFORMATION FOR SEQ ID NO:26:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 15 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: Not Relev - #ant- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:- Asn Tyr Asn Met Phe Ile Met Asp Val Gln Me - #t Pro Lys Val Asp# 15- (2) INFORMATION FOR SEQ ID NO:27:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 15 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: Not Relev - #ant- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:- Pro Phe Asp Leu Ile Leu Met Asp Ile Gln Me - #t Pro Asp Met Asp# 15- (2) INFORMATION FOR SEQ ID NO:28:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 732 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: Not Relev - #ant- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:- Met Thr Asp Gly Pro Thr Leu Ala Ala Ile Al - #a Ala Leu Val Lys Ser# 15- Leu Ala Val Asp Pro Ala Thr Thr Gln Thr Se - #r Gly Leu Arg Pro Ser# 30- Thr His Val Arg Leu Pro Gly Pro Tyr Thr Ar - #g Glu Lys Gly Asp Val# 45- Val Arg Ile Glu Gln Leu Glu Thr Ala Ala Il - #e Ala Ala Ser Pro Pro# 60- Ala Met Pro Asp Thr Pro Asn Ala Pro Thr As - #p Ala Leu Phe Ser Asn#80- Gly Thr Leu Ser Pro Ser Ser Glu Thr Pro As - #p Ala Arg Tyr Phe Ile# 95- Asp Glu Ala Leu Glu Gly Leu Arg Glu His Va - #l Asp Asp Gln Ser Lys# 110- Leu Leu Asp Ser Gln Arg Gln Glu Leu Ala Gl - #y Val Asn Ala Gln Leu# 125- Ile Glu Gln Lys Gln Leu Gln Glu Lys Ala Le - #u Ala Ile Leu Glu Arg# 140- Glu Leu Trp Lys His Gln Lys Ala Asn Glu Al - #a Phe Gln Lys Ala Leu145 1 - #50 1 - #55 1 -#60- Arg Glu Ile Gly Glu Ile Val Thr Ala Val Al - #a Arg Gly Asp Leu Ser# 175- Lys Lys Val Arg Met Asn Ser Val Glu Met As - #p Pro Ile Asn Thr Met# 190- Met Asp Gln Leu Gln Val Phe Ser Ser Glu Va - #l Ser Arg Val Ala Arg# 205- Glu Val Gly Thr Glu Gly Ile Leu Gly Gly Gl - #n Ala Gln Ile Glu Gly# 220- Val Asp Gly Thr Trp Lys Glu Leu Thr Asp As - #n Thr Asp Gln Val Arg225 2 - #30 2 - #35 2 -#40- Glu Ile Ala Ser Val Thr Thr Ala Val Ala Hi - #s Gly Asp Leu Thr Lys# 255- Lys Ile Glu Arg Pro Ala Lys Gly Glu Ile Le - #u Gln Leu Gln Gln Thr# 270- Ile Asn Thr Met Val Asp Gln Leu Arg Thr Al - #a Arg Asp Val Gly Thr# 285- Glu Gly Ile Leu Gly Gly Gln Ala Asp Val Gl - #u Gly Val Gln Gly Met# 300- Trp Asn Glu Leu Thr Val Asn Val Asn Ala Me - #t Ala Asn Asn Leu Thr305 3 - #10 3 - #15 3 -#20- Thr Gln Val Arg Asp Ile Ile Lys Val Leu Th - #r Gln Lys Val Gln Ala# 335- Glu Cys Arg Gly Glu Ile Phe Glu Leu Lys Ly - #s Thr Ile Asn Ser Met# 350- Val Asp Gln Leu Gln Gln Phe Ala Arg Glu Va - #l Thr Lys Ile Ala Arg# 365- Glu Val Gly Thr Glu Gly Arg Leu Val Gln Gl - #y Thr Trp Arg Asp Leu# 380- Thr Glu Asn Val Asn Gly Met Ala Met Asn Le - #u Thr Thr Gln Val Arg385 3 - #90 3 - #95 4 -#00- Glu Ile Ala Lys Val Thr Thr Ala Val Ala Ly - #s Gly Asp Leu Thr Lys# 415- Lys Ile Gly Val Glu Val Gln Ile Glu Ala Ar - #g Arg Met Val Ile Glu# 430- Glu Ile Pro Tyr Thr Leu Arg Gly Thr Val Ph - #e Asn Ala Leu Lys Thr# 445- Leu Ala Val Lys Ala Asn Glu Lys Phe Leu As - #p Leu Thr Tyr Arg Val# 460- Asp His Ser Val Phe Arg Leu Arg Gln Ile Il - #e Leu Asn Leu Val Gly465 4 - #70 4 - #75 4 -#80- Asn Ala Ile Lys Phe Thr Glu His Gly Glu Va - #l Ser Leu Thr Ile Gln# 495- Lys Ala Ser Ser Val Gln Cys Ser Thr Glu Gl - #u Tyr Ala Ile Glu Phe# 510- Val Val Ser Asp Thr Gly Ile Gly Ile Pro Al - #a Asp Lys Leu Asp Leu# 525- Ile Phe Asp Thr Phe Gln Gln Ala Asp Gly Se - #r Met Thr Arg Lys Phe# 540- Gly Gly Thr Gly Leu Gly Leu Leu Met Gly Gl - #y Asp Val Trp Val Lys545 5 - #50 5 - #55 5 -#60- Ser Glu Tyr Gly Lys Gly Ser Lys Phe Phe Ph - #e Thr Cys Val Val Arg# 575- Leu Ala Asn Asp Asp Ile Ser Leu Ile Ala Ly - #s Gln Leu Asn Pro Tyr# 590- Lys Ser His Gln Val Leu His Gly Pro Glu Il - #e Ala Lys Met Leu His# 605- Gly Leu Gly Leu Val Pro Ile Val Val Asp Se - #r Glu Arg Asn Pro Ala# 620- Leu Glu Lys Ala Arg Ala Ala Gly Gln Ala Pr - #o Tyr Asp Val Ile Ile625 6 - #30 6 - #35 6 -#40- Val Asp Ser Ile Ser Val Asp Asp Phe Lys Ty - #r Leu Pro Ile Val Leu# 655- Leu Ala Pro Val Val His Val Ser Leu Lys Se - #r Cys Leu Asp Leu Gly# 670- Ile Thr Ser Tyr Met Thr Thr Pro Cys Gln Le - #u Ile Asp Leu Gly Asn# 685- Gly Met Thr Pro Ser Leu Ala Asp Asn Thr Ly - #s Ser Phe Glu Ile Leu# 700- Leu Ala Glu Asp Asn Thr Val Asn Gln Arg Le - #u Ala Val Lys Ile Leu705 7 - #10 7 - #15 7 -#20- Glu Lys Tyr His His Val Val Thr Val Val Gl - #y Asn# 730- (2) INFORMATION FOR SEQ ID NO:29:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 335 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: Not Relev - #ant- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:- Met Thr Asn Tyr Ser Leu Arg Ala Arg Met Me - #t Ile Leu Ile Leu Ala# 15- Pro Thr Val Leu Ile Gly Leu Leu Leu Ser Il - #e Phe Phe Val Leu Glu# 30- Ala Gly Lys Leu Ile Leu Glu Ser Ile Pro Ph - #e Pro Leu Arg Ser Thr# 45- Leu Asp Glu Val Val Thr Leu Leu Ala His Se - #r Ser His Asp Lys Gly# 60- Leu Glu Leu Thr Leu Asn Ile Lys Ser Asp Va - #l Leu Arg Leu Gln Gln#80- Ile Ile Thr Asn Leu Val Gly Asn Ala Ile Ly - #s Phe Thr Glu Asn Gly# 95- Asn Ile Asp Ile Leu Val Glu Lys Arg Ala Le - #u Ser Asn Thr Lys Val# 110- Gln Ile Glu Val Gln Ile Arg Asp Thr Gly Il - #e Gly Ile Pro Glu Arg# 125- Asp Gln Ser Arg Leu Phe Gln Ala Phe Arg Gl - #n Ala Asp Ala Ser Ile# 140- Ser Arg Arg His Gly Gly Thr Gly Leu Gly Le - #u Glu Met Gly Gly Asp145 1 - #50 1 - #55 1 -#60- Ile Ser Phe His Ser Gln Pro Asn Arg Gly Se - #r Thr Phe Trp Phe His# 175- Ile Asn Leu Asp Leu Asn Pro Asn Ile Ile Il - #e Glu Gly Pro Ser Thr# 190- Gln Cys Leu Ala Gly Lys Arg Leu Ala Ala Gl - #n Cys Thr Leu Asp Ile# 205- Leu Ser Glu Thr Pro Leu Glu Val Val Tyr Se - #r Pro Thr Phe Ser Ala# 220- Leu Pro Pro Ala His Tyr Asp Met Met Leu Le - #u Gly Ile Ala Val Thr225 2 - #30 2 - #35 2 -#40- Phe Arg Glu Pro Leu Lys Ala Val Ser Met Th - #r Asp Phe Leu Met Leu# 255- Ala Leu Pro Cys His Ala Gln Val Asn Ala Gl - #u Lys Leu Lys Gln Asp# 270- Gly Ile Gly Ala Cys Leu Leu Lys Pro Leu Th - #r Pro Thr Arg Leu Leu# 285- Pro Ala Leu Thr Leu Leu Pro Val Thr Asp Gl - #u Ser Lys Leu Ala Met# 300- Thr Val Met Ala Val Asp Asp Asn Pro Ala As - #n Leu Lys Leu Ile Gly305 3 - #10 3 - #15 3 -#20- Ala Leu Leu Glu Asp Met Val Gln His Val Gl - #u Leu Cys Asp Ser# 335- (2) INFORMATION FOR SEQ ID NO:30:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 354 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: Not Relev - #ant- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:- Asn Arg Arg Thr Asp Thr Gly Cys Trp Arg Ly - #s Ser Val Leu Asn Lys# 15- Leu Gly Ile Lys Gly Arg Val Leu Leu Leu Th - #r Ile Leu Pro Ala Ser# 30- Leu Met Ala Ala Val Leu Gly Gly Tyr Phe Il - #e Glu Ala Gly Lys Leu# 45- Val Leu Asp Asn Ile Pro Phe Asn Leu Arg As - #p Leu Leu Gln Asp Thr# 60- Leu Thr Ile Leu Ala Pro Ala Ala His Ala Ly - #s Gln Leu Glu Leu Val#80- Ser Leu Val Tyr Arg Asp Thr Leu Arg Leu Ar - #g Gln Ile Leu Thr Asn# 95- Leu Val Ser Asn Ala Ile Lys Phe Thr Arg Gl - #n Gly Thr Ile Val Ala# 110- Arg Ala Met Leu Glu Asp Glu Thr Glu Glu Hi - #s Ala Gln Leu Arg Ile# 125- Ser Val Gln Asp Thr Gly Ile Gly Leu Ser Se - #r Gln Asp Val Arg Ala# 140- Leu Phe Gln Ala Phe Ser Gln Ala Asp Asn Se - #r Ile Ser Arg Gln Pro145 1 - #50 1 - #55 1 -#60- Gly Gly Thr Gly Leu Gly Leu Gln Met Gly Gl - #y Glu Ile Gly Val Asp# 175- Ser Thr Pro Gly Glu Gly Ser Glu Phe Trp Il - #e Ser Leu Asn Leu Pro# 190- Lys Ala Arg Glu Asp Arg Glu Glu Thr Ala As - #n Gln Ala Leu Glu Gly# 205- Leu Arg Ala Ala Val Leu Ala Leu Glu His Gl - #n Leu Glu Asp Cys Gly# 220- Leu Gln Thr Val Val Phe Thr Asn Leu Glu As - #n Leu Leu Asn Gly Val225 2 - #30 2 - #35 2 -#40- Thr Ala Ala His Glu Thr Pro Gln Ala Ile As - #p Leu Val Val Leu Gly# 255- Val Thr Ala Leu His Ile Trp Asp Leu Glu As - #n Leu Asn Cys Lys Val# 270- Met Val Leu Cys Pro Thr Thr Glu His Ala Le - #u Phe Gln Met Ser Val# 285- His Asp Val Tyr Thr Gln Leu Gln Ala Lys Pr - #o Ala Cys Asn Arg Lys# 300- Leu Gln Lys Arg Ala Val Arg Thr Asp Val Al - #a Leu Pro Leu Ser Ser305 3 - #10 3 - #15 3 -#20- Arg Ala Pro Arg Val Leu Cys Val Asp Asp As - #n Pro Ala Asn Leu Leu# 335- Leu Val Gln Thr Leu Leu Glu Asp Met Gly Al - #a Glu Val Val Ala Val# 350- Asp Gly- (2) INFORMATION FOR SEQ ID NO:31:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 351 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: Not Relev - #ant- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:- Met Leu Lys Lys Leu Gly Ile Lys Gly Arg Va - #l Leu Leu Leu Thr Leu# 15- Leu Pro Thr Ser Leu Met Ala Leu Val Leu Gl - #y Gly Tyr Phe Ile Glu# 30- Ala Gly Lys Leu Val Leu Asp Ser Ile Pro Ph - #e Asn Leu Arg Asp Leu# 45- Leu Gln Asp Thr Leu Thr Ile Leu Ala Pro Al - #a Ala His Ala Lys Gln# 60- Leu Glu Leu Val Ser Leu Val Tyr Arg Asp Th - #r Pro Leu Ser Leu Val#80- Gly Asp Pro Leu Arg Leu Lys Gln Ile Leu Th - #r Asn Leu Val Ser Asn# 95- Ala Ile Lys Phe Thr Arg Glu Gly Thr Ile Va - #l Ala Arg Ala Met Leu# 110- Glu Glu Glu His Glu Asp Ser Val Gln Leu Ar - #g Ile Ser Ile Gln Asp# 125- Thr Gly Ile Gly Leu Ser Asn Gln Asp Val Ar - #g Ala Leu Phe Gln Ala# 140- Phe Ser Gln Ala Asp Asn Ser Leu Ser Arg Gl - #n Pro Gly Gly Thr Gly145 1 - #50 1 - #55 1 -#60- Leu Gly Leu Gln Met Gly Gly Glu Ile Gly Va - #l Asp Ser Thr Pro Gly# 175- Glu Gly Ser Glu Phe Trp Ile Ser Leu Asn Le - #u Pro Lys Thr Arg Asp# 190- Asp Ala Glu Asp Leu Pro Gly Pro Pro Leu Le - #u Gly Arg Arg Val Ala# 205- Val Leu Ala Leu Gln His Gln Leu Glu Asp Cy - #s Gly Leu Glu Val Thr# 220- Pro Phe Asn Thr Leu Glu Ala Leu Thr Asn Gl - #y Ile Thr Gly Val His225 2 - #30 2 - #35 2 -#40- Gln Ser Glu Gln Ala Ile Asp Leu Ala Val Le - #u Gly Ile Thr Thr Asn# 255- Asp His Ile Trp Asp Leu Glu His Leu Gly Cy - #s Lys Val Leu Val Leu# 270- Cys Pro Thr Thr Glu Gln Thr Leu Phe His Le - #u Ser Val Pro Asn Pro# 285- His Ser Gln Leu Gln Ala Lys Pro Ala Cys Th - #r Arg Lys Leu Arg Arg# 300- Arg Arg Ala Arg Ser Glu Pro Glu Glu Thr Le - #u Ser Ser Arg Ala Pro305 3 - #10 3 - #15 3 -#20- Arg Val Leu Cys Val Asp Asp Asn Pro Ala As - #n Leu Leu Leu Ile Gln# 335- Thr Leu Leu Glu Asp Met Gly Ala Lys Val Le - #u Ala Val Asp Asn# 350- (2) INFORMATION FOR SEQ ID NO:32:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 751 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: Not Relev - #ant- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:- Met Arg Phe Gly Leu Pro Ser Lys Leu Glu Le - #u Thr Pro Pro Phe Arg# 15- Ile Gly Ile Arg Thr Gln Leu Thr Ala Leu Va - #l Ser Ile Val Ala Leu# 30- Gly Ser Leu Ile Ile Leu Ala Val Thr Thr Gl - #y Val Tyr Phe Thr Asp# 45- Arg Leu Tyr Ile Ala Ala Gln Leu Lys Ser Se - #r Gln Ile Asp Gln Thr# 60- Leu Asn Tyr Leu Tyr Tyr Gln Ala Tyr Tyr Le - #u Ala Ser Arg Asp Ala#80- Leu Gln Ser Ser Leu Thr Ser Tyr Val Ala Gl - #y Asn Lys Ser Ser Val# 95- Ile Gln Lys Phe Leu Ser Ser Ser Asn Leu Ph - #e Tyr Val Ala Lys Val# 110- Tyr Asp Ser Ser Phe Asn Ala Val Leu Asn Al - #a Thr Asn Asn Gly Thr# 125- Gly Asp Leu Ile Pro Glu Asp Val Leu Asp Se - #r Leu Phe Pro Ser Ser# 140- Leu Glu Thr Ile Gly Ile Leu Thr Asp Pro Va - #l Leu Asn Ser Thr Asp145 1 - #50 1 - #55 1 -#60- Tyr Leu Met Ser Met Ser Leu Pro Ile Phe Al - #a Asn Pro Ser Ile Ile# 175- Leu Thr Asp Ser Arg Val Tyr Gly Tyr Ile Th - #r Ile Ser Val Phe Asn# 190- Asp Thr Thr Ala Leu Glu His Ser Thr Ile Al - #a Ile Ile Ser Ala Val# 205- Tyr Asn Ser Gln Gly Lys Ala Ser Gly Tyr Hi - #s Phe Val Phe Pro Pro# 220- Tyr Gly Ser Arg Ser Asp Leu Pro Gln Lys Va - #l Ile Ser Ser Ala Phe225 2 - #30 2 - #35 2 -#40- Arg Asn Gly Lys Gly Gly Ser Leu Lys Gln Th - #r Asn Ile Leu Ser Thr# 255- Arg Asn Thr Ala Leu Gly Tyr Ser Pro Cys Se - #r Phe Asn Leu Val Asn# 270- Trp Val Ala Ile Val Ser Gln Pro Glu Ser Le - #u Ala Lys Ile Ile Thr# 285- Gly Thr Val Ile Ala Ile Gly Val Phe Val Il - #e Leu Leu Thr Leu Pro# 300- Leu Ala His Trp Ala Val Gln Pro Ile Val Ar - #g Leu Gln Lys Ala Thr305 3 - #10 3 - #15 3 -#20- Glu Leu Ile Thr Glu Gly Arg Gly Leu Ser Ar - #g Ala Ser Ser Phe Lys# 335- Arg Gly Phe Ser Ser Gly Phe Ala Val Pro Se - #r Ser Leu Leu Gln Phe# 350- Asn Thr Ala Glu Ala Gly Ser Thr Thr Ser Va - #l Ser Gly His Gly Gly# 365- Ser Gly His Gly Ser Gly Ala Ala Asn Val Le - #u Gln Arg Thr Lys Leu# 380- Glu Lys Arg Asp Phe Cys Ile Thr Asp Val Al - #a Leu Gln Ile Lys Ser385 3 - #90 3 - #95 4 -#00- Ile Phe Gly Lys Val Ala Lys Asp Gln Arg Va - #l Arg Leu Ser Ile Ser# 415- Leu Phe Pro Asn Leu Ile Arg Asn Arg Ile Il - #e Gln Ile Val Met Asn# 430- Leu Val Ser Asn Ala Leu Lys Phe Thr Pro Va - #l Asp Gly Thr Val Asp# 445- Val Arg Met Lys Leu Leu Gly Glu Tyr Asp Ly - #s Glu Leu Ser Glu Lys# 460- Lys Gln Tyr Lys Glu Val Thr Glu Asn Leu Gl - #u Thr Thr Asp Lys Tyr465 4 - #70 4 - #75 4 -#80- Asp Leu Pro Thr Leu Ser Asn His Arg Lys Se - #r Val Asp Leu Glu Ser# 495- Ser Ala Thr Ser Leu Gly Ser Asn Arg Asp Th - #r Ser Thr Ile Gln Glu# 510- Glu Ile Thr Lys Arg Tyr Lys Lys Val Asn As - #p Arg Glu Lys Ala Ser# 525- Asn Asp Asp Val Ser Ser Ile Val Ser Thr Th - #r Thr Ser Ser Tyr Asp# 540- Asn Ala Ile Phe Asn Ser Gln Phe Asn Lys Al - #a Pro Gly Ser Asp Asp545 5 - #50 5 - #55 5 -#60- Glu Glu Gly Pro Lys Thr Trp Val Ile Ser Il - #e Glu Val Glu Asp Thr# 575- Gly Pro Gly Ile Asp Pro Ser Leu Gln Glu Se - #r Val Phe His Pro Phe# 590- Val Gln Gly Asp Gln Thr Leu Ser Arg Gln Ty - #r Gly Gly Thr Gly Leu# 605- Gly Leu Ser Met Met His Gly Thr Met Lys Le - #u Glu Ser Lys Val Gly# 620- Val Gly Ser Lys Phe Thr Phe Thr Leu Pro Le - #u Asn Gln Thr Lys Glu625 6 - #30 6 - #35 6 -#40- Ile Ser Phe Ala Asp Met Glu Phe Pro Phe Gl - #u Asp Glu Phe Asn Pro# 655- Glu Ser Ser Val Ala Lys Ser Ile Lys Ser Ar - #g Gln Ser Thr Ser Ser# 670- Val Ala Thr Pro Ala Thr Asn Arg Ser Ser Le - #u Thr Asn Asp Val Leu# 685- Pro Glu Val Arg Ser Lys Gly Lys His Glu Th - #r Lys Asp Val Gly Asn# 700- Asp Asn Gly Gly Leu Glu Gln Leu Gln Glu Ly - #s Asn Ile Lys Pro Ser705 7 - #10 7 - #15 7 -#20- Ile Cys Leu Thr Gly Ala Glu Val Asn Glu Gl - #n Asn Ser Leu Ser Ser# 735- Lys His Arg Ser Arg His Glu Gly Leu Gly Se - #r Val Asn Leu Asp# 750- (2) INFORMATION FOR SEQ ID NO:33:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 1117 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: Not Relev - #ant- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:- Asp Leu Leu Cys Trp Ser Cys Val Val Ala Il - #e Tyr Lys Ala Pro Pro# 15- Tyr Ile Asn Lys Lys Phe Phe Leu Ser Val Va - #l Tyr Leu Glu Phe Leu# 30- Pro Leu Ser Pro Met Asn Pro Thr Lys Lys Pr - #o Arg Leu Ser Pro Met# 45- Gln Pro Ser Val Phe Glu Ile Leu Asn Asp Pr - #o Glu Leu Tyr Ser Gln# 60- His Cys His Ser Leu Arg Glu Thr Leu Leu As - #p His Phe Asn His Gln#80- Ala Thr Leu Ile Asp Thr Tyr Glu His Glu Le - #u Glu Lys Ser Lys Asn# 95- Ala Asn Lys Ala Phe Gln Gln Ala Leu Ser Gl - #u Ile Gly Thr Val Val# 110- Ile Ser Val Ala Met Gly Asp Leu Ser Lys Ly - #s Val Glu Ile His Thr# 125- Val Glu Asn Asp Pro Glu Ile Leu Lys Val Ly - #s Ile Thr Ile Asn Thr# 140- Met Met Asp Gln Leu Gln Thr Phe Ala Asn Gl - #u Val Thr Lys Val Ala145 1 - #50 1 - #55 1 -#60- Thr Glu Val Ala Asn Gly Glu Leu Gly Gly Gl - #n Ala Lys Asn Asp Gly# 175- Ser Val Gly Ile Trp Arg Ser Leu Thr Asp As - #n Val Asn Ile Met Ala# 190- Leu Asn Leu Thr Asn Gln Val Arg Glu Ile Al - #a Asp Val Thr Arg Ala# 205- Val Ala Lys Gly Asp Leu Ser Arg Lys Ile As - #n Val His Ala Gln Gly# 220- Glu Ile Leu Gln Leu Gln Arg Thr Ile Asn Th - #r Met Val Asp Gln Leu225 2 - #30 2 - #35 2 -#40- Arg Thr Phe Ala Phe Glu Val Ser Lys Val Al - #a Arg Asp Val Gly Val# 255- Leu Gly Ile Leu Gly Gly Gln Ala Leu Ile Gl - #u Asn Val Glu Gly Ile# 270- Trp Glu Glu Leu Thr Asp Asn Val Asn Ala Me - #t Ala Leu Asn Leu Thr# 285- Thr Gln Val Arg Asn Ile Ala Asn Val Thr Th - #r Ala Val Ala Lys Gly# 300- Asp Leu Ser Lys Lys Val Thr Ala Asp Cys Ly - #s Gly Glu Ile Leu Asp305 3 - #10 3 - #15 3 -#20- Leu Lys Leu Thr Ile Asn Gln Met Val Asp Ar - #g Leu Gln Asn Phe Ala# 335- Leu Ala Val Thr Thr Leu Ser Arg Glu Val Gl - #y Thr Leu Gly Ile Leu# 350- Gly Gly Gln Ala Asn Val Gln Asp Val Glu Gl - #y Ala Trp Lys Gln Val# 365- Thr Glu Asn Val Asn Leu Met Ala Thr Asn Le - #u Thr Asn Gln Val Arg# 380- Ser Ile Ala Thr Val Thr Thr Ala Val Ala Hi - #s Gly Asp Leu Ser Gln385 3 - #90 3 - #95 4 -#00- Lys Ile Asp Val His Ala Gln Gly Glu Ile Le - #u Gln Leu Lys Asn Thr# 415- Ile Asn Lys Met Val Asp Ser Leu Gln Leu Ph - #e Ala Ser Glu Val Ser# 430- Lys Val Ala Gln Asp Val Gly Ile Asn Gly Ly - #s Leu Gly Ile Gln Ala# 445- Gln Val Ser Asp Val Asp Gly Leu Trp Lys Gl - #u Ile Thr Ser Asn Val# 460- Asn Thr Met Ala Ser Asn Leu Thr Ser Gln Va - #l Arg Ala Phe Ala Gln465 4 - #70 4 - #75 4 -#80- Ile Thr Ala Ala Ala Thr Asp Gly Asp Phe Th - #r Arg Phe Ile Thr Val# 495- Glu Ala Leu Gly Glu Met Asp Ala Leu Lys Th - #r Lys Ile Asn Gln Met# 510- Val Phe Asn Leu Arg Glu Ser Leu Gln Arg As - #n Thr Ala Ala Arg Glu# 525- Ala Ala Glu Leu Ala Asn Ser Ala Lys Ser Gl - #u Phe Leu Ala Asn Met# 540- Ser His Glu Ile Arg Thr Pro Leu Asn Gly Il - #e Ile Gly Met Thr Gln545 5 - #50 5 - #55 5 -#60- Leu Ser Leu Asp Thr Glu Leu Thr Gln Tyr Gl - #n Arg Glu Met Leu Ser# 575- Ile Val His Asn Leu Ala Asn Ser Leu Leu Th - #r Ile Ile Asp Asp Ile# 590- Leu Asp Ile Ser Lys Ile Glu Ala Asn Arg Me - #t Thr Val Glu Gln Ile# 605- Asp Phe Ser Leu Arg Gly Thr Val Phe Gly Al - #a Leu Lys Thr Leu Ala# 620- Val Lys Ala Ile Glu Lys Asn Leu Asp Leu Th - #r Tyr Gln Cys Asp Ser625 6 - #30 6 - #35 6 -#40- Ser Phe Pro Asp Asn Leu Ile Gly Asp Ser Ph - #e Arg Leu Arg Gln Val# 655- Ile Leu Asn Leu Ala Gly Asn Ala Ile Lys Ph - #e Thr Lys Glu Gly Lys# 670- Val Ser Val Ser Val Lys Lys Ser Asp Lys Me - #t Val Leu Asp Ser Lys# 685- Leu Leu Leu Glu Val Cys Val Ser Asp Thr Gl - #y Ile Gly Ile Glu Lys# 700- Asp Lys Leu Gly Leu Ile Phe Asp Thr Phe Cy - #s Gln Ala Asp Gly Ser705 7 - #10 7 - #15 7 -#20- Thr Thr Arg Lys Phe Gly Gly Thr Gly Leu Gl - #y Leu Ser Ile Ser Lys# 735- Gln Leu Ile His Leu Met Gly Gly Glu Ile Tr - #p Val Thr Ser Glu Tyr# 750- Gly Ser Gly Ser Asn Phe Tyr Phe Thr Val Cy - #s Val Ser Pro Ser Asn# 765- Ile Arg Tyr Thr Arg Gln Thr Glu Gln Leu Le - #u Pro Phe Ser Ser His# 780- Tyr Val Leu Phe Val Ser Thr Glu His Thr Gl - #n Glu Glu Leu Asp Val785 7 - #90 7 - #95 8 -#00- Leu Arg Asp Gly Ile Ile Glu Leu Gly Leu Il - #e Pro Ile Ile Val Arg# 815- Asn Ile Glu Asp Ala Thr Leu Thr Glu Pro Va - #l Lys Tyr Asp Ile Ile# 830- Met Ile Asp Ser Ile Glu Ile Ala Lys Lys Le - #u Arg Leu Leu Ser Glu# 845- Val Lys Tyr Ile Pro Leu Val Leu Val His Hi - #s Ser Ile Pro Gln Leu# 860- Asn Met Arg Val Cys Ile Asp Leu Gly Ile Se - #r Ser Tyr Ala Asn Thr865 8 - #70 8 - #75 8 -#80- Pro Cys Ser Ile Thr Asp Leu Ala Ser Ala Il - #e Ile Pro Ala Leu Glu# 895- Ser Arg Ser Ile Ser Gln Asn Ser Asp Glu Se - #r Val Arg Tyr Lys Ile# 910- Leu Leu Ala Glu Asp Asn Leu Val Asn Gln Ly - #s Leu Ala Val Arg Ile# 925- Leu Glu Lys Gln Gly His Leu Val Glu Val Va - #l Glu Asn Gly Leu Glu# 940- Ala Tyr Glu Ala Ile Lys Arg Asn Lys Tyr As - #p Val Val Leu Met Asp945 9 - #50 9 - #55 9 -#60- Val Gln Met Pro Val Met Gly Gly Phe Glu Al - #a Thr Glu Lys Ile Arg# 975- Gln Trp Glu Lys Lys Ser Asn Pro Ile Asp Se - #r Leu Thr Phe Arg Thr# 990- Pro Ile Ile Ala Leu Thr Ala His Ala Met Le - #u Gly Asp Arg Glu Lys# 10050- Ser Leu Ala Lys Gly Met Asp Asp Tyr Val Se - #r Lys Pro Leu Lys Pro# 10205- Lys Leu Leu Met Gln Thr Ile Asn Lys Cys Il - #e His Asn Ile Asn Gln# 10401030 - # 1035- Leu Lys Glu Leu Ser Arg Asn Ser Arg Gly Se - #r Asp Phe Ala Lys Lys# 10550- Met Thr Arg Asn Thr Pro Gly Ser Thr Thr Ar - #g Gln Gly Ser Asp Glu# 10705- Gly Ser Val Glu Asp Met Ile Gly Asp Thr Pr - #o Arg Gln Gly Ser Val# 10850- Glu Gly Gly Gly Thr Ser Ser Arg Pro Val Gl - #n Arg Arg Ser Ala Thr# 11005- Glu Gly Ser Ile Thr Thr Ile Ser Glu Gln Il - #e Asp Arg1105 1110 - # 1115- (2) INFORMATION FOR SEQ ID NO:34:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 1298 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: Not Relev - #ant- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:- Met Thr Asp Gly Pro Thr Leu Ala Ala Ile Al - #a Ala Leu Val Lys Ser# 15- Leu Ala Val Asp Pro Ala Thr Thr Gln Thr Se - #r Gly Leu Arg Pro Ser# 30- Thr His Val Arg Leu Pro Gly Pro Tyr Thr Ar - #g Glu Lys Gly Asp Leu# 45- Glu Arg Glu Leu Ser Ala Leu Val Val Arg Il - #e Glu Gln Leu Glu Thr# 60- Ala Ala Ile Ala Ala Ser Pro Pro Ala Met Pr - #o Asp Thr Pro Asn Ala#80- Pro Thr Asp Ala Leu Phe Ser Asn Gly Thr Le - #u Ser Pro Ser Ser Glu# 95- Thr Pro Asp Ala Arg Tyr Pro Ala Pro Leu Pr - #o Arg Asn Gly Phe Ile# 110- Asp Glu Ala Leu Glu Gly Leu Arg Glu His Va - #l Asp Asp Gln Ser Lys# 125- Leu Leu Asp Ser Gln Arg Gln Glu Leu Ala Gl - #y Val Asn Ala Gln Leu# 140- Ile Glu Gln Lys Gln Leu Gln Glu Lys Ala Le - #u Ala Ile Ile Glu Gln145 1 - #50 1 - #55 1 -#60- Glu Arg Val Ala Thr Leu Glu Arg Glu Leu Tr - #p Lys His Gln Lys Ala# 175- Asn Glu Ala Phe Gln Lys Ala Leu Arg Glu Il - #e Gly Glu Ile Val Thr# 190- Ala Val Ala Arg Gly Asp Leu Ser Lys Lys Va - #l Arg Met Asn Ser Val# 205- Glu Met Asp Pro Glu Ile Thr Thr Phe Lys Ar - #g Thr Ile Asn Thr Met# 220- Met Asp Gln Leu Gln Val Phe Ser Ser Glu Va - #l Ser Arg Val Ala Arg225 2 - #30 2 - #35 2 -#40- Glu Val Gly Thr Glu Gly Ile Leu Gly Gly Gl - #n Ala Gln Ile Glu Gly# 255- Val Asp Gly Thr Trp Lys Glu Leu Thr Asp As - #n Val Asn Val Met Ala# 270- Gln Asn Leu Thr Asp Gln Val Arg Glu Ile Al - #a Ser Val Thr Thr Ala# 285- Val Ala His Gly Asp Leu Thr Lys Lys Ile Gl - #u Arg Pro Ala Lys Gly# 300- Glu Ile Leu Gln Leu Gln Gln Thr Ile Asn Th - #r Met Val Asp Gln Leu305 3 - #10 3 - #15 3 -#20- Arg Thr Phe Ala Ser Glu Val Thr Arg Val Al - #a Arg Asp Val Gly Thr# 335- Glu Gly Ile Leu Gly Gly Gln Ala Asp Val Gl - #u Gly Val Gln Gly Met# 350- Trp Asn Glu Leu Thr Val Asn Val Asn Ala Me - #t Ala Asn Asn Leu Thr# 365- Thr Gln Val Arg Asp Ile Ile Lys Val Thr Th - #r Ala Val Ala Lys Gly# 380- Asp Leu Thr Gln Lys Val Gln Ala Glu Cys Ar - #g Gly Glu Ile Phe Glu385 3 - #90 3 - #95 4 -#00- Leu Lys Lys Thr Ile Asn Ser Met Val Asp Gl - #n Leu Gln Gln Phe Ala# 415- Arg Glu Val Thr Lys Ile Ala Arg Glu Val Gl - #y Thr Glu Gly Arg Leu# 430- Gly Gly Gln Ala Thr Val His Asp Val Gln Gl - #y Thr Trp Arg Asp Leu# 445- Thr Glu Asn Val Asn Gly Met Ala Met Asn Le - #u Thr Thr Gln Val Arg# 460- Glu Ile Ala Lys Val Thr Thr Ala Val Ala Ly - #s Gly Asp Leu Thr Lys465 4 - #70 4 - #75 4 -#80- Lys Ile Gly Val Glu Val Gln Gly Glu Ile Le - #u Asp Leu Lys Asn Thr# 495- Ile Asn Thr Met Val Asp Arg Leu Gly Thr Ph - #e Ala Phe Glu Val Ser# 510- Lys Val Ala Arg Glu Val Gly Thr Asp Gly Th - #r Leu Gly Gly Gln Ala# 525- Gln Val Asp Asn Val Glu Gly Lys Trp Lys As - #p Leu Thr Glu Asn Val# 540- Asn Thr Met Ala Ser Asn Leu Thr Ser Gln Va - #l Arg Gly Ile Ser Thr545 5 - #50 5 - #55 5 -#60- Val Thr Gln Ala Ile Ala Asn Gly Asp Met Se - #r Arg Lys Ile Glu Val# 575- Glu Ala Lys Gly Glu Ile Leu Ile Leu Lys Gl - #u Thr Ile Asn Asn Met# 590- Val Asp Arg Leu Ser Ile Phe Cys Asn Glu Va - #l Gln Arg Val Ala Lys# 605- Asp Val Gly Val Asp Gly Ile Met Gly Gly Gl - #n Ala Asp Val Ala Gly# 620- Leu Lys Gly Arg Trp Lys Glu Ile Thr Thr As - #p Val Asn Thr Met Ala625 6 - #30 6 - #35 6 -#40- Asn Asn Leu Thr Ala Gln Val Arg Ala Phe Gl - #y Asp Ile Thr Asn Ala# 655- Ala Thr Asp Gly Asp Phe Thr Lys Leu Val Gl - #u Val Glu Ala Ser Gly# 670- Glu Met Asp Glu Leu Lys Lys Lys Ile Asn Gl - #n Met Val Tyr Asn Leu# 685- Arg Asp Ser Ile Gln Arg Asn Thr Gln Ala Ar - #g Glu Ala Ala Glu Leu# 700- Ala Asn Lys Thr Lys Ser Glu Phe Leu Ala As - #n Met Ser His Glu Ile705 7 - #10 7 - #15 7 -#20- Arg Thr Pro Met Asn Gly Ile Ile Gly Met Th - #r Gln Leu Thr Leu Asp# 735- Thr Asp Leu Thr Gln Tyr Gln Arg Glu Met Le - #u Asn Ile Val Asn Ser# 750- Leu Ala Asn Ser Leu Leu Thr Ile Ile Asp As - #p Ile Leu Asp Leu Ser# 765- Lys Ile Glu Ala Arg Arg Met Val Ile Glu Gl - #u Ile Pro Tyr Thr Leu# 780- Arg Gly Thr Val Phe Asn Ala Leu Lys Thr Le - #u Ala Val Lys Ala Asn785 7 - #90 7 - #95 8 -#00- Glu Lys Phe Leu Asp Leu Thr Tyr Arg Val As - #p His Ser Val Pro Asp# 815- His Val Val Gly Asp Ser Phe Arg Leu Arg Gl - #n Ile Ile Leu Asn Leu# 830- Val Gly Asn Ala Ile Lys Phe Thr Glu His Gl - #y Glu Val Ser Leu Thr# 845- Ile Gln Lys Ala Ser Ser Val Gln Cys Ser Th - #r Glu Glu Tyr Ala Ile# 860- Glu Phe Val Val Ser Asp Thr Gly Ile Gly Il - #e Pro Ala Asp Lys Leu865 8 - #70 8 - #75 8 -#80- Asp Leu Ile Phe Asp Thr Phe Gln Gln Ala As - #p Gly Ser Met Thr Arg# 895- Lys Phe Gly Gly Thr Gly Leu Gly Leu Ser Il - #e Ser Lys Arg Leu Val# 910- Asn Leu Met Gly Gly Asp Val Trp Val Lys Se - #r Glu Tyr Gly Lys Gly# 925- Ser Lys Phe Phe Phe Thr Cys Val Val Arg Le - #u Ala Asn Asp Asp Ile# 940- Ser Leu Ile Ala Lys Gln Leu Asn Pro Tyr Ly - #s Ser His Gln Val Leu945 9 - #50 9 - #55 9 -#60- Phe Ile Asp Lys Gly Arg Thr Gly His Gly Pr - #o Glu Ile Ala Lys Met# 975- Leu His Gly Leu Gly Leu Val Pro Ile Val Va - #l Asp Ser Glu Arg Asn# 990- Pro Ala Leu Glu Lys Ala Arg Ala Ala Gly Gl - #n Ala Pro Tyr Asp Val# 10050- Ile Ile Val Asp Ser Ile Glu Asp Ala Arg Ar - #g Leu Arg Ser Val Asp# 10205- Asp Phe Lys Tyr Leu Pro Ile Val Leu Leu Al - #a Pro Val Val His Val# 10401030 - # 1035- Ser Leu Lys Ser Cys Leu Asp Leu Gly Ile Th - #r Ser Tyr Met Thr Thr# 10550- Pro Cys Gln Leu Ile Asp Leu Gly Asn Gly Me - #t Val Pro Ala Leu Glu# 10705- Asn Arg Ala Thr Pro Ser Leu Ala Asp Asn Th - #r Lys Ser Phe Glu Ile# 10850- Leu Leu Ala Glu Asp Asn Thr Val Asn Gln Ar - #g Leu Ala Val Lys Ile# 11005- Leu Glu Lys Tyr His His Val Val Thr Val Va - #l Gly Asn Gly Glu Glu# 11201110 - # 1115- Ala Val Glu Ala Val Lys Arg Lys Lys Phe As - #p Val Ile Leu Met Asp# 11350- Val Gln Met Pro Ile Met Gly Gly Phe Glu Al - #a Thr Ala Lys Ile Arg# 11505- Glu Tyr Glu Arg Ser Leu Gly Ser Gln Arg Th - #r Pro Ile Ile Ala Leu# 11650- Thr Ala His Ala Met Met Gly Asp Arg Glu Ly - #s Cys Ile Gln Ala Gln# 11805- Met Asp Glu Tyr Leu Ser Lys Pro Leu Gln Gl - #n Asn His Leu Ile Gln# 12001190 - # 1195- Thr Ile Leu Lys Cys Ala Thr Leu Gly Gly Gl - #n Leu Leu Glu Lys Asn# 12150- Arg Glu Arg Glu Leu Thr Arg Ala Ala Asp Al - #a Val Thr Gly Gly Arg# 12305- Arg Asp Asn Gly Met Tyr Ser Ala Ser Gln Al - #a Ala Gln His Ala Ala# 12450- Leu Arg Pro Pro Leu Ala Thr Arg Gly Leu Th - #r Ala Ala Asp Ser Leu# 12605- Val Ser Gly Leu Glu Ser Pro Ser Ile Val Th - #r Ala Asp Lys Glu Asp# 12801270 - # 1275- Pro Leu Ser Arg Ala Arg Ala Ser Leu Ser Gl - #u Pro Asn Ile His Lys# 12950- Ala Ser- (2) INFORMATION FOR SEQ ID NO:35:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 918 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: Not Relev - #ant- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:- Met Thr Asn Tyr Ser Leu Arg Ala Arg Met Me - #t Ile Leu Ile Leu Ala# 15- Pro Thr Val Leu Ile Gly Leu Leu Leu Ser Il - #e Phe Phe Val Val His# 30- Arg Tyr Asn Asp Leu Gln Arg Gln Leu Glu As - #p Ala Gly Ala Ser Ile# 45- Ile Glu Pro Leu Ala Val Ser Thr Glu Tyr Gl - #y Met Ser Leu Gln Asn# 60- Arg Glu Ser Ile Gly Gln Leu Ile Ser Val Le - #u His Arg Arg His Ser#80- Asp Ile Val Arg Ala Ile Ser Val Tyr Asp Gl - #u Asn Asn Arg Leu Phe# 95- Val Thr Ser Asn Phe His Leu Asp Pro Ser Se - #r Met Gln Leu Gly Ser# 110- Asn Val Pro Phe Pro Arg Gln Leu Thr Val Th - #r Arg Asp Gly Asp Ile# 125- Met Ile Leu Arg Thr Pro Ile Ile Ser Glu Se - #r Tyr Ser Pro Asp Glu# 140- Ser Pro Ser Ser Asp Ala Lys Asn Ser Gln As - #n Met Leu Gly Tyr Ile145 1 - #50 1 - #55 1 -#60- Ala Leu Glu Leu Asp Leu Lys Ser Val Arg Le - #u Gln Gln Tyr Lys Glu# 175- Ile Phe Ile Ser Ser Val Met Met Leu Phe Cy - #s Ile Gly Ile Ala Leu# 190- Ile Phe Gly Trp Arg Leu Met Arg Asp Val Th - #r Gly Pro Ile Arg Asn# 205- Met Val Asn Thr Val Asp Arg Ile Arg Arg Gl - #y Gln Leu Asp Ser Arg# 220- Val Glu Gly Phe Met Leu Gly Glu Leu Asp Me - #t Leu Lys Asn Gly Ile225 2 - #30 2 - #35 2 -#40- Asn Ser Met Ala Met Ser Leu Ala Ala Tyr Hi - #s Glu Glu Met Gln His# 255- Asn Ile Asp Gln Ala Thr Ser Asp Leu Arg Gl - #u Thr Leu Glu Gln Met# 270- Glu Ile Gln Asn Val Glu Leu Asp Leu Ala Ly - #s Lys Arg Ala Gln Glu# 285- Ala Ala Arg Ile Lys Ser Glu Phe Leu Ala As - #n Met Ser His Glu Leu# 300- Arg Thr Pro Leu Asn Gly Val Ile Gly Phe Th - #r Arg Leu Thr Leu Lys305 3 - #10 3 - #15 3 -#20- Thr Glu Leu Thr Pro Thr Gln Arg Asp His Le - #u Asn Thr Ile Glu Arg# 335- Ser Ala Asn Asn Leu Leu Ala Ile Ile Asn As - #p Val Leu Asp Phe Ser# 350- Lys Leu Glu Ala Gly Lys Leu Ile Leu Glu Se - #r Ile Pro Phe Pro Leu# 365- Arg Ser Thr Leu Asp Glu Val Val Thr Leu Le - #u Ala His Ser Ser His# 380- Asp Lys Gly Leu Glu Leu Thr Leu Asn Ile Ly - #s Ser Asp Val Pro Asp385 3 - #90 3 - #95 4 -#00- Asn Val Ile Gly Asp Pro Leu Arg Leu Gln Gl - #n Ile Ile Thr Asn Leu# 415- Val Gly Asn Ala Ile Lys Phe Thr Glu Asn Gl - #y Asn Ile Asp Ile Leu# 430- Val Glu Lys Arg Ala Leu Ser Asn Thr Lys Va - #l Gln Ile Glu Val Gln# 445- Ile Arg Asp Thr Gly Ile Gly Ile Pro Glu Ar - #g Asp Gln Ser Arg Leu# 460- Phe Gln Ala Phe Arg Gln Ala Asp Ala Ser Il - #e Ser Arg Arg His Gly465 4 - #70 4 - #75 4 -#80- Gly Thr Gly Leu Gly Leu Val Ile Thr Gln Ly - #s Leu Val Asn Glu Met# 495- Gly Gly Asp Ile Ser Phe His Ser Gln Pro As - #n Arg Gly Ser Thr Phe# 510- Trp Phe His Ile Asn Leu Asp Leu Asn Pro As - #n Ile Ile Ile Glu Gly# 525- Pro Ser Thr Gln Cys Leu Ala Gly Lys Arg Le - #u Ala Tyr Val Glu Pro# 540- Asn Ser Ala Ala Ala Gln Cys Thr Leu Asp Il - #e Leu Ser Glu Thr Pro545 5 - #50 5 - #55 5 -#60- Leu Glu Val Val Tyr Ser Pro Thr Phe Ser Al - #a Leu Pro Pro Ala His# 575- Tyr Asp Met Met Leu Leu Gly Ile Ala Val Th - #r Phe Arg Glu Pro Leu# 590- Thr Met Gln His Glu Arg Leu Ala Lys Ala Va - #l Ser Met Thr Asp Phe# 605- Leu Met Leu Ala Leu Pro Cys His Ala Gln Va - #l Asn Ala Glu Lys Leu# 620- Lys Gln Asp Gly Ile Gly Ala Cys Leu Leu Ly - #s Pro Leu Thr Pro Thr625 6 - #30 6 - #35 6 -#40- Arg Leu Leu Pro Ala Leu Thr Glu Phe Cys Hi - #s His Lys Gln Asn Thr# 655- Leu Leu Pro Val Thr Asp Glu Ser Lys Leu Al - #a Met Thr Val Met Ala# 670- Val Asp Asp Asn Pro Ala Asn Leu Lys Leu Il - #e Gly Ala Leu Leu Glu# 685- Asp Met Val Gln His Val Glu Leu Cys Asp Se - #r Gly His Gln Ala Val# 700- Glu Arg Ala Lys Gln Met Pro Phe Asp Leu Il - #e Leu Met Asp Ile Gln705 7 - #10 7 - #15 7 -#20- Met Pro Asp Met Asp Gly Ile Arg Ala Cys Gl - #u Leu Ile His Gln Leu# 735- Pro His Gln Gln Gln Thr Pro Val Ile Ala Va - #l Thr Ala His Ala Met# 750- Ala Gly Gln Lys Glu Lys Leu Leu Gly Ala Gl - #y Met Ser Asp Tyr Leu# 765- Ala Lys Pro Ile Glu Glu Glu Arg Leu His As - #n Leu Leu Leu Arg Tyr# 780- Lys Pro Gly Ser Gly Ile Ser Ser Arg Val Va - #l Thr Pro Glu Val Asn785 7 - #90 7 - #95 8 -#00- Glu Ile Val Val Asn Pro Asn Ala Thr Leu As - #p Trp Gln Leu Ala Leu# 815- Arg Gln Ala Ala Gly Lys Thr Asp Leu Ala Ar - #g Asp Met Leu Gln Met# 830- Leu Leu Asp Phe Leu Pro Glu Val Arg Asn Ly - #s Val Glu Glu Gln Leu# 845- Val Gly Glu Asn Pro Glu Gly Leu Val Asp Le - #u Ile His Lys Leu His# 860- Gly Ser Cys Gly Tyr Ser Gly Val Pro Arg Me - #t Lys Asn Leu Cys Gln865 8 - #70 8 - #75 8 -#80- Leu Ile Glu Gln Gln Leu Arg Ser Gly Thr Ly - #s Glu Glu Asp Leu Glu# 895- Pro Glu Leu Leu Glu Leu Leu Asp Glu Met As - #p Asn Val Ala Arg Glu# 910- Ala Ser Lys Ile Leu Gly 915- (2) INFORMATION FOR SEQ ID NO:36:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 1220 amino (B) TYPE: amino acid (C) STRANDEDNESS: Not R - #elevant (D) TOPOLOGY: Not Relev - #ant- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:- Met Arg Phe Gly Leu Pro Ser Lys Leu Glu Le - #u Thr Pro Pro Phe Arg# 15- Ile Gly Ile Arg Thr Gln Leu Thr Ala Leu Va - #l Ser Ile Val Ala Leu# 30- Gly Ser Leu Ile Ile Leu Ala Val Thr Thr Gl - #y Val Tyr Phe Thr Ser# 45- Asn Tyr Lys Asn Leu Arg Ser Asp Arg Leu Ty - #r Ile Ala Ala Gln Leu# 60- Lys Ser Ser Gln Ile Asp Gln Thr Leu Asn Ty - #r Leu Tyr Tyr Gln Ala#80- Tyr Tyr Leu Ala Ser Arg Asp Ala Leu Gln Se - #r Ser Leu Thr Ser Tyr# 95- Val Ala Gly Asn Lys Ser Ala Asp Asn Trp Va - #l Asp Ser Leu Ser Val# 110- Ile Gln Lys Phe Leu Ser Ser Ser Asn Leu Ph - #e Tyr Val Ala Lys Val# 125- Tyr Asp Ser Ser Phe Asn Ala Val Leu Asn Al - #a Thr Asn Asn Gly Thr# 140- Gly Asp Leu Ile Pro Glu Asp Val Leu Asp Se - #r Leu Phe Pro Leu Ser145 1 - #50 1 - #55 1 -#60- Thr Asp Thr Pro Leu Pro Ser Ser Leu Glu Th - #r Ile Gly Ile Leu Thr# 175- Asp Pro Val Leu Asn Ser Thr Asp Tyr Leu Me - #t Ser Met Ser Leu Pro# 190- Ile Phe Ala Asn Pro Ser Ile Ile Leu Thr As - #p Ser Arg Val Tyr Gly# 205- Tyr Ile Thr Ile Ile Met Ser Ala Glu Gly Le - #u Lys Ser Val Phe Asn# 220- Asp Thr Thr Ala Leu Glu His Ser Thr Ile Al - #a Ile Ile Ser Ala Val225 2 - #30 2 - #35 2 -#40- Tyr Asn Ser Gln Gly Lys Ala Ser Gly Tyr Hi - #s Phe Val Phe Pro Pro# 255- Tyr Gly Ser Arg Ser Asp Leu Pro Gln Lys Va - #l Phe Ser Ile Lys Asn# 270- Asp Thr Phe Ile Ser Ser Ala Phe Arg Asn Gl - #y Lys Gly Gly Ser Leu# 285- Lys Gln Thr Asn Ile Leu Ser Thr Arg Asn Th - #r Ala Leu Gly Tyr Ser# 300- Pro Cys Ser Phe Asn Leu Val Asn Trp Val Al - #a Ile Val Ser Gln Pro305 3 - #10 3 - #15 3 -#20- Glu Ser Val Phe Leu Ser Pro Ala Thr Lys Le - #u Ala Lys Ile Ile Thr# 335- Gly Thr Val Ile Ala Ile Gly Val Phe Val Il - #e Leu Leu Thr Leu Pro# 350- Leu Ala His Trp Ala Val Gln Pro Ile Val Ar - #g Leu Gln Lys Ala Thr# 365- Glu Leu Ile Thr Glu Gly Arg Gly Leu Arg Pr - #o Ser Thr Pro Arg Thr# 380- Ile Ser Arg Ala Ser Ser Phe Lys Arg Gly Ph - #e Ser Ser Gly Phe Ala385 3 - #90 3 - #95 4 -#00- Val Pro Ser Ser Leu Leu Gln Phe Asn Thr Al - #a Glu Ala Gly Ser Thr# 415- Thr Ser Val Ser Gly His Gly Gly Ser Gly Hi - #s Gly Ser Gly Ala Ala# 430- Phe Ser Ala Asn Ser Ser Met Lys Ser Ala Il - #e Asn Leu Gly Asn Glu# 445- Lys Met Ser Pro Pro Glu Glu Glu Asn Lys Il - #e Pro Asn Asn His Thr# 460- Asp Ala Lys Ile Ser Met Asp Gly Ser Leu As - #n His Asp Leu Leu Gly465 4 - #70 4 - #75 4 -#80- Pro His Ser Leu Arg His Asn Asp Thr Asp Ar - #g Ser Ser Asn Arg Ser# 495- His Ile Leu Thr Thr Ser Ala Asn Leu Thr Gl - #u Ala Arg Leu Pro Asp# 510- Tyr Arg Arg Leu Phe Ser Asp Glu Leu Ser As - #p Leu Thr Glu Thr Phe# 525- Asn Thr Met Thr Asp Ala Leu Asp Gln His Ty - #r Ala Leu Leu Glu Glu# 540- Arg Val Arg Ala Arg Thr Lys Gln Leu Glu Al - #a Ala Lys Ile Glu Ala545 5 - #50 5 - #55 5 -#60- Glu Ala Ala Asn Glu Ala Lys Thr Val Phe Il - #e Ala Asn Ile Ser His# 575- Glu Leu Arg Thr Pro Leu Asn Gly Ile Leu Gl - #y Met Thr Ala Ile Ser# 590- Met Glu Glu Thr Asp Val Asn Lys Ile Arg As - #n Ser Leu Lys Leu Ile# 605- Phe Arg Ser Gly Glu Leu Leu Leu His Ile Le - #u Thr Glu Leu Leu Thr# 620- Phe Ser Lys Asn Val Leu Gln Arg Thr Lys Le - #u Glu Lys Arg Asp Phe625 6 - #30 6 - #35 6 -#40- Cys Ile Thr Asp Val Ala Leu Gln Ile Lys Se - #r Ile Phe Gly Lys Val# 655- Ala Lys Asp Gln Arg Val Arg Leu Ser Ile Se - #r Leu Phe Pro Asn Leu# 670- Ile Arg Thr Met Val Leu Trp Gly Asp Ser As - #n Arg Ile Ile Gln Ile# 685- Val Met Asn Leu Val Ser Asn Ala Leu Lys Ph - #e Thr Pro Val Asp Gly# 700- Thr Val Asp Val Arg Met Lys Leu Leu Gly Gl - #u Tyr Asp Lys Glu Leu705 7 - #10 7 - #15 7 -#20- Ser Glu Lys Lys Gln Tyr Lys Glu Val Tyr Il - #e Lys Lys Gly Thr Glu# 735- Val Thr Glu Asn Leu Glu Thr Thr Asp Lys Ty - #r Asp Leu Pro Thr Leu# 750- Ser Asn His Arg Lys Ser Val Asp Leu Glu Se - #r Ser Ala Thr Ser Leu# 765- Gly Ser Asn Arg Asp Thr Ser Thr Ile Gln Gl - #u Glu Ile Thr Lys Arg# 780- Asn Thr Val Ala Asn Glu Ser Ile Tyr Lys Ly - #s Val Asn Asp Arg Glu785 7 - #90 7 - #95 8 -#00- Lys Ala Ser Asn Asp Asp Val Ser Ser Ile Va - #l Ser Thr Thr Thr Ser# 815- Ser Tyr Asp Asn Ala Ile Phe Asn Ser Gln Ph - #e Asn Lys Ala Pro Gly# 830- Ser Asp Asp Glu Glu Gly Gly Asn Leu Gly Ar - #g Pro Ile Glu Asn Pro# 845- Lys Thr Trp Val Ile Ser Ile Glu Val Glu As - #p Thr Gly Pro Gly Ile# 860- Asp Pro Ser Leu Gln Glu Ser Val Phe His Pr - #o Phe Val Gln Gly Asp865 8 - #70 8 - #75 8 -#80- Gln Thr Leu Ser Arg Gln Tyr Gly Gly Thr Gl - #y Leu Gly Leu Ser Ile# 895- Cys Arg Gln Leu Ala Asn Met Met His Gly Th - #r Met Lys Leu Glu Ser# 910- Lys Val Gly Val Gly Ser Lys Phe Thr Phe Th - #r Leu Pro Leu Asn Gln# 925- Thr Lys Glu Ile Ser Phe Ala Asp Met Glu Ph - #e Pro Phe Glu Asp Glu# 940- Phe Asn Pro Glu Ser Arg Lys Asn Arg Arg Va - #l Lys Phe Ser Val Ala945 9 - #50 9 - #55 9 -#60- Lys Ser Ile Lys Ser Arg Gln Ser Thr Ser Se - #r Val Ala Thr Pro Ala# 975- Thr Asn Arg Ser Ser Leu Thr Asn Asp Val Le - #u Pro Glu Val Arg Ser# 990- Lys Gly Lys His Glu Thr Lys Asp Val Gly As - #n Pro Asn Met Gly Arg# 10050- Glu Glu Lys Asn Asp Asn Gly Gly Leu Glu Gl - #n Leu Gln Glu Lys Asn# 10205- Ile Lys Pro Ser Ile Cys Leu Thr Gly Ala Gl - #u Val Asn Glu Gln Asn# 10401030 - # 1035- Ser Leu Ser Ser Lys His Arg Ser Arg His Gl - #u Gly Leu Gly Ser Val# 10550- Asn Leu Asp Arg Pro Phe Leu Gln Ser Thr Gl - #y Thr Ala Thr Ser Ser# 10705- Arg Asn Ile Pro Thr Val Lys Asp Asp Asp Ly - #s Asn Glu Thr Ser Val# 10850- Lys Ile Leu Val Val Glu Asp Asn His Val As - #n Gln Glu Val Ile Lys# 11005- Arg Met Leu Asn Leu Glu Gly Ile Glu Asn Il - #e Glu Leu Ala Cys Asp# 11201110 - # 1115- Gly Gln Glu Ala Phe Asp Lys Val Lys Glu Le - #u Thr Ser Lys Gly Glu# 11350- Asn Tyr Asn Met Ile Phe Met Asp Val Gln Me - #t Pro Lys Val Asp Gly# 11505- Leu Leu Ser Thr Lys Met Ile Arg Arg Asp Le - #u Gly Tyr Thr Ser Pro# 11650- Ile Val Ala Leu Thr Ala Phe Ala Asp Asp Se - #r Asn Ile Lys Glu Cys# 11805- Leu Glu Ser Gly Met Asn Gly Phe Leu Ser Ly - #s Pro Ile Lys Arg Pro# 12001190 - # 1195- Lys Leu Lys Thr Ile Leu Thr Glu Phe Cys Al - #a Ala Tyr Gln Gly Lys# 12150- Lys Asn Asn Lys 1220__________________________________________________________________________

Number	Name	Date	Kind
4683195	Mullis et al.	Jul 1987
4683202	Mullis	Jul 1987

Osmosensing histidine kinases

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

US Referenced Citations (2)

Non-Patent Literature Citations (92)