P53-INDUCED APOPTOSIS

Abstract

The most well-documented biochemical property of p53 is its ability to transcriptionally activate genes. Many of the genes which are activated by p53 expression prior to the onset of apoptosis are predicted to encode proteins which could generate or respond to oxidative stress, including one that is implicated in apoptosis within plant meristems. p53 may result in apoptosis through a three-step process: (I) the transcriptional induction of specific redox-related genes; (ii) the formation of reactive oxygen species (ROS); and (iii) the oxidative degradation of mitochondrial components, rapidly leading to cell death. Transcription of other genes is decreased by p53. Examination of the level of transcription of p53-induced or, -repressed genes can be used to determine p53 status, to diagnose cancer, and to evaluate cytotoxicity or carcinogenicity of a test agent.

Description

TECHNICAL FIELD OF THE INVENTION

[0003] This invention is related to genes and proteins involved in cell cycle control and tumorigenesis. These genes can be used diagnostically and therapeutically because of their role in cancers.

BACKGROUND OF THE INVENTION

[0004] The inactivation of the p53 gene in a large fraction of human cancers has inspired an intense search for the encoded protein's physiologic and biologic properties. Expression of p53 induces either a stable growth arrest or programmed cell death (apoptosis). In human colorectal cancers (CRC), the growth arrest is dependent on the transcriptional induction of p21WAF1/CIP1(1), but the biochemical mechanisms underlying the development of p53-dependent apoptosis are largely unknown (2). Thus, there is a continuing need in the art for discovering new genes which are regulated by p53 and genes which are related to cell cycle control and tumorigenesis.

SUMMARY OF THE INVENTION

[0005] It is an object of the present invention to provide methods of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic.

[0006] It is another object of the present invention to provide an isolated and purified nucleic acid molecule which is identified by a SAGE tag.

[0007] It is an object of the present invention to provide an isolated nucleotide probe comprising at least 12 nucleotides of a rat nucleic acid molecule identified by a SAGE tag.

[0008] Another object of the invention is to provide methods and kits for evaluating cytotoxicity or carcinogenicity of an agent.

[0009] It is still another object of the invention to provide a DNA construct useful for screening drugs as anti-neoplastic agents.

[0010] It is even another object of the invention to provide a preparation of antibodies.

[0011] These and other objects of the invention are provided by one or more of the embodiments described below. One embodiment of the invention provides a method of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic. The level of transcription of an RNA transcript in a first sample of a first tissue is compared to the level of transcription of the transcript in a second sample of a second tissue. The first tissue is suspected of being neoplastic and the second tissue is a normal human tissue. The first and second tissue are of the same tissue type. The transcript is identified by a tag selected from the group consisting of SEQ ID NOS:10, 15-22, 26, 27, and 30. The first sample is characterized as neoplastic or as having a mutant p53 when transcription is found to be the same or lower in the first sample than in the second sample.

[0012] Another embodiment of the invention provides a method of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic. The level of transcription of an RNA transcript in a first sample of a first tissue is compared to the level of transcription of the transcript in a second sample of a second tissue. The first tissue is suspected of being neoplastic, and the second tissue is a normal human tissue. The first and second tissue are of the same tissue type. The transcript is identified by a tag selected from the group consisting of SEQ ID NOS:37-67. The first sample is categorized as neoplastic or as having a mutant p53 when transcription is found to be the same or higher in the first sample than in the second sample.

[0013] Yet another embodiment of the invention provides an isolated and purified nucleic acid molecule which comprises a SAGE tag selected from the group consisting of SEQ ID NOS:15, 16, 17, 19, 21, 22, and 30.

[0014] Even another embodiment of the invention provides an isolated nucleotide probe comprising at least 12 contiguous nucleotides of a human nucleic acid molecule. The human nucleic acid molecule comprises a SAGE tag selected from the group consisting of SEQ ID NOS: 15, 16, 17, 19, 21, 22, and 30.

[0015] A further embodiment of the invention provides a kit for evaluating toxicity or carcinogenicity of an agent. The kit comprises at least 2 probes. The probes comprise at least 12 contiguous nucleotides of a human nucleic acid molecule. The human nucleic acid molecule comprises a SAGE tag selected from the group consisting of SEQ ID NOS:15, 16, 17, 19, 21, 22, and 30.

[0016] Another embodiment of the invention provides a kit for evaluating cytotoxicity or carcinogenicity. The kit comprises at least 2 probes. The probes comprise a SAGE tag selected from the group consisting of SEQ ID NOS:15, 16, 17, 19, 21, 22, and 30.

[0017] Even another embodiment of the invention provides a method for evaluating cytotoxicity or carcinogenicity of an agent. A test agent is contacted with a human cell. The level of transcription of a transcript in the human cell after contacting with the agent is determined. An agent which increases the level of a transcript identified by a SAGE tag selected from the group consisting of SEQ ID NOS:10, 15-22, 26, 27, and 30, or an agent which decreases the level of a transcript identified by a SAGE tag selected from the group consisting of SEQ ID NOS:37-67 is a potential cytotoxin or carcinogen.

[0018] Another embodiment of the invention provides a method to determine the neoplastic status or p53 status of a cell. ROS levels in a first sample of a first tissue are compared to ROS levels in a second sample of a second tissue. The first tissue is or is suspected of being neoplastic, and the second tissue is a normal human tissue. Elevated levels of ROS in the first sample indicate expression of p53, and low levels of ROS in the first sample indicate lack of expression of p53. Lack of expression of p53 is an indicator of neoplasia.

[0019] Still another embodiment of the invention provides a DNA construct for screening drugs as anti-neoplastic agents. The DNA construct comprises a reporter gene under the control of a PIG-3 promoter. The reporter gene is 3′ and covalently linked to the PIG-3 promoter. The PIG-3 promoter comprises the sequence CAGCTTGCCCACCCATGCTC (SEQ ID NO: 1).

[0020] A further embodiment of the invention provides a method of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic. Cells of a test sample are treated with a DNA-damaging agent. The level of transcription of an RNA transcript in cells of the sample is compared to the level of transcription of the transcript in cells of the sample which are not subject to said treating. The transcript is identified by a tag selected from the group consisting of SEQ ID NOS: 10, 15-22, 26, 27, and 30. The sample is characterized as neoplastic or as having a mutant p53 when transcription is found to be the same or lower in the treated cells than in the untreated cells.

[0021] Another embodiment of the invention provides a method of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic. Cells of a test sample are treated with a DNA-damaging agent. The level of transcription of an RNA transcript in the cells is compared to the level of transcription of the transcript in cells of the sample which are not subject to said treating. The transcript is identified by a tag selected from the group consisting SEQ ID NOS:37-67. The sample is categorized as neoplastic or as having a mutant p53 when transcription is found to be the same or higher in the treated cells than in the untreated cells.

[0022] Even another embodiment of the invention provides a preparation of antibodies which specifically bind to a PIG protein having an amino acid sequence selected from the group consisting of SEQ ID NOS:81, 83, 84, 86, 87, and 88.

[0023] Still another embodiment of the invention provides a method of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic. The level of a PIG protein having an amino acid sequence selected from the group consisting of SEQ ID NOS:79-88 and the amino acid sequence encoded by SEQ ID NO:72 in a first sample of a first tissue is compared to the level of the PIG protein in a second sample of a second tissue. The first tissue is suspected of being neoplastic, and the second tissue is a normal human tissue. The first and second tissue are of the same tissue type. The first sample is categorized as neoplastic or as having a mutant p53 when the level of the PIG protein is found to be the same or lower in the first sample than in the second sample.

[0024] Yet another embodiment of the invention provides a method of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic. The level of a protein of Table 2 in a first sample of a first tissue is compared to the level of the protein of Table 2 in a second sample of a second tissue. The first tissue is suspected of being neoplastic, and the second tissue is a normal human tissue. The first and second tissue are of the same tissue type. The first sample is categorized as neoplastic or as having a mutant p53 when the level of the protein of Table 2 is found to be the same or higher in the first sample than in the second sample.

[0025] Even another embodiment of the invention provides a kit for evaluating toxicity or carcinogenicity of an agent. The kit comprises at least 2 antibodies which specifically bind to a PIG protein having an amino acid sequence selected from the group consisting of SEQ ID NOS:81, 83, 84, 86, 87, and 88.

[0026] Still another embodiment of the invention provides a method for evaluating cytotoxicity or carcinogenicity of an agent. A test agent is contacted with a human cell. The level of a PIG protein having an amino acid sequence selected from the group consisting of SEQ ID NOS:79-88 and the amino acid sequence encoded by SEQ ID NO:72 or of a protein of Table 2 in the human cell is determined after contacting with the agent. An agent which increases the level of the PIG protein or an agent which decreases the level of the protein of Table 2 is identified as a potential cytotoxin or carcinogen.

[0027] A further embodiment of the invention provides a method of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic. Cells of a test sample are treated with a DNA-damaging agent. The level of a PIG protein having an amino acid sequence selected from the group consisting of SEQ ID NOS:79-88 and the amino acid sequence encoded by SEQ ID NO:72 in cells of the sample is compared to the level of the PIG protein in cells of the sample which are not subject to said treating. The sample is categorized as neoplastic or as having a mutant p53 when the level of the PIG protein is found to be the same or lower in the treated cells than in the untreated cells.

[0028] Even another embodiment of the invention provides a method of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic. Cells of a test sample are treated with a DNA-damaging agent. The level of a protein of Table 2 in cells of the sample is compared to the level of the protein of Table 2 in cells of the sample which are not subject to said treating. The sample is categorized as neoplastic or as having a mutant p53 when the level of the protein of Table 2 is found to be the same or higher in the treated cells than in the untreated cells.

[0029] These and other embodiments of the invention provide the art with tools for assessing p53 status in cells, which can provide diagnostic and prognostic information useful in the evaluation of patients and the management of cancer.

BRIEF DESCRIPTION OF THE DRAWINGS

[0030] FIG. 1A. Summary of SAGE data. For each of 7,202 different transcripts identified, the ratio of their abundances in two libraries is plotted. The y-axis indicates the number of tags expressed at the ratio indicated on the x-axis. Bars representing tags exhibiting less than 5-fold differences in expression are shown in green, and those induced or repressed more than 8-fold are shown in blue and red, respectively. FIG. 1B. Northern blot analysis after Ad-p53 infection. Representative Northern blots are shown for several transcripts identified by SAGE to be expressed at higher levels in p53-expressing cells at the indicated times post infection. Uninfected cells (column marked “0”) and cells infected with Ad-lacZ for 48 hrs (column marked “B”) were included for comparison. EF1 is a control transcript expressed at relatively equal levels in cells 16 hours after infection with Ad-p53 and Ad-lacZ. The SAGE tag abundances (16 hours after infection) are included at the right.

[0031] FIG. 2A. Schematic of PIG3 gene, illustrating intron-exon structure and promoter region. Numbers refer to nucleotides relative to the 5′ end of the cDNA. The fragments used for the luciferase constructs had their distal ends at the Eag I site within exon 1 and their 5′ ends at either the Apa LI or Nsi I sites (FULL and DEL, respectively). The 53-binding site located at nucleotides 328-308 is indicated, with the upper case letters corresponding to the highly conserved residues that were altered in one of the oligonucleotides used for immunoprecipitation. FIG. 2B. p53-induction of the PIG3 promoter. Fragments encompassing 5.6 or 0.7 kb (FULL and DEL, respectively) of the PIG3 gene promoter were cloned upstream of a luciferase reporter and transfected into the indicated cell types in the presence of wt and mutant p53 expression vectors. The levels of luciferase activity were determined in cell lysates 24 hours after transfection. FIG. 2C. In vitro binding assay with end-labeled fragments containing wild type (WT) and mutant (M) p53 binding sites. A fragment containing thirteen copies of a p53 binding site from the WAF1 promoter region 3026 was used as a control (C). The “input” lanes contained 0.5% of the amount of fragment used in the binding assays.

[0032] FIG. 3. Sequences of selected genes identified through SAGE. In each case, the indicated gene is compared to the homologue from the non-human species that revealed a clue to its possible function. The amino acid sequences were aligned using Macaw Version 2.0.3, and the most significant similarities are indicated by shading. With the exception of PIG6, the cloned human sequences appeared to be full length with respect to the coding region. Accession numbers are provided in Table 1.

[0033] FIG. 4. Oxidative stress and mitochondrial damage in p53-mediated apoptosis. FIG. 4A. DLD-1 cells were infected with Ad-p53 or control (Ad-lacZ) viruses and harvested after 27, 35, or 42 hours. Cells were incubated with CM-DCF-DA, a probe of ROS, or NAO, a probe of the mitochondrial membrane cardiolipin, and analyzed by flow cytometry. The mean fluorescence of the control cells is indicated by vertical lines in each box. The pro-oxidant drug menadione was used as a positive control to induce oxidative stress. An increase in ROS and a decrease in cardiolipin concentration could be clearly observed by cytometry at 27 hours and increased as the p53-expressing cells entered apoptosis. FIG. 4B. Time course of apoptosis-related events following p53 expression. Cells were infected with Ad-p53 at 0 hours and PIG3 expression (&Circlesolid;) was quantitated by densitometry of Northern blots. ROS production (◯) was assessed with lucigenin; glutathione depletion exhibited a similar time course (not shown). Cardiolipin concentration (Δ) was assessed with nonyl-acridine orange staining. Caspase activation (▴) was assessed by cleavage of PARP, and chromatin condensation/fragmentation (⋄) was assessed by staining with DAPI.

DETAILED DESCRIPTION

[0034] The most well-documented biochemical property of p53 is its ability to transcriptionally activate genes. Of 7,202 transcripts induced by p53 expression prior to the onset of apoptosis, only 14 (0.19%) are found at markedly higher levels in p53-expressing cells than in control cells. The genes encoding these transcripts are termed PIGS (p53-induced genes). Many of these genes are predicted to encode proteins which could generate or respond to oxidative stress, including one that is implicated in apoptosis within plant meristems. Thus, p53 may result in apoptosis through a three-step process: (I) the transcriptional induction of specific redox-related genes; (ii) the formation of reactive oxygen species (ROS); and (iii) the oxidative degradation of mitochondrial components, rapidly leading to in cell death.

[0035] Using the SAGE tags disclosed in Tables 1 and 2, transcripts can be evaluated for enhanced or reduced expression, respectively. A SAGE tag is a short sequence tag, preferably 10 or 11 base pairs, which is generated from defined positions within each mRNA molecule. Expression patterns are deduced from the abundance of individual tags. The altered expression can provide an indication of the status of the p53 genes in the cells, which themselves reflect the neoplastic status of cells. While the presence of wild-type p53 is not determinative of normalcy, the presence of mutant p53 is an indication of neoplasia.

[0036] The tags which are shown in Table 1 identify transcripts which are enhanced by p53; the tags of Table 2 identify transcripts which are decreased by p53. Wild-type p53 is required for these modulations. Thus failure to so-modulate is an indication of mutant p53 in the cell. Similarly, DNA-damaging agents which cause apoptosis do so via wild-type p53. In the absence of wild-type p53 these agents cannot induce transcription of the Table 1 tag-identified transcripts nor can they decrease transcription of the Table 2 tag-identified transcripts. Thus, analysis of the status of these transcripts can provide an indication of the presence or absence of wild-type p53.

[0037] Cells can be compared from suspect tissues to normal tissues. Similarly, a suspect or test tissue sample can be treated with a DNA-damaging agent and the response of the cells in the tissue assessed. The response assessed is the induction or reduction in the transcripts identified by the tags. Tags “identify” transcripts by hybridization to them. This hybridization can be determined using any method of measuring transcription, including but not limited to Northern blots, quantitative RT PCR, etc. Conditions for optimizing hybridization signals and minimizing background are known in the art and can be selected by the skilled artisan. Preferably an assay is done with at least two, five, or ten of the transcripts which are known to be modulated by p53. More preferably one or more of the tags used is selected from SEQ ID NOS: 15-17, 19, 21, 22, or 30. Suitable DNA-damaging agents include adriamycin, mitomycin, alkylating agents, and γ- and UV-radiation.

[0038] Isolated and purified nucleic acid molecules which include a SAGE tag particularly SEQ ID NOS:15-17, 19, 21, 22, or 30, are also provided. These can be made using the SAGE tags to isolate a full length RNA, which is then reverse transcribed using reverse transcriptase to form cDNA. Alternatively the SAGE tags can be used to identify clones from cDNA libraries using hybridization. The SAGE tags can also be used as primers to generate PCR products which contain the SAGE tags. Any such method known in the art can be used. Isolated and purified nucleic acid molecules are free of other nucleic acid molecules with which they are found in cells. Preferably they are also free of the genes to which they are adjacent in the chromosome.

[0039] Nucleotide probes are typically less than full length genes and can be labeled so that they can be used in hybridization experiments. Such probes are typically at least 12 contiguous nucleotides in length. Probes of the invention can comprise a SAGE tag of Tables 1 and 2, particularly SEQ ID NOS: 15-17, 19, 21, 22, or 30, or can comprise a different portion of a transcript or cDNA molecule identified by such SAGE tags.

[0040] Kits can be formulated for evaluating toxicity or carcinogenicity of test agents. The kits comprise at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 probes which are complementary to the transcripts identified by the SAGE tags of Table 1 and 2. Just as DNA-damaging agents induce apoptosis via p53, which can be measured by measuring the induction or repression of expression of specific transcripts, so can other as yet unknown agents. Such agents which cause DNA damage are likely to be toxic or carcinogenic. Thus, human cells can be contacted with a test agent, and the levels of one or more transcripts identified by a SAGE tag in Table 1 or 2 can be measured. If the agent causes the modulation which is caused by the introduction of wild-type p53 or the modulation which is caused by DNA-damaging agents in wild-type p53-containing cells, then the agent is a suspected carcinogen or toxic agent.

[0041] Reactive Oxygen Species (ROS) production can also be used as an indicator of p53 status and hence neoplasia. Levels of ROS can be determined and compared between cells of a tissue which is suspected of being neoplastic and normal cells. Elevated levels of ROS indicate expression of p53, and low levels indicate lack of p53 expression. These levels can be measured after contacting the cells with an agent which induces DNA damage. Alternatively a test sample can be tested before and after treatment with DNA damaging agents. The ability to induce ROS indicates a wild-type p53. Any method for measuring ROS can be used, including but not limited to carboxymethyl dichlorofluorescein diacetate and flow cytometry, nonylacridine orange as a probe for cardiolipin, lucigenin chemiluminescence, and intracellular glutathione.

[0042] DNA constructs which contain a reporter gene under the transcriptional control of a PIG promoter can be used to test agents for the ability to induce apoptosis. Such agents have potential use as anti-neoplastic agents. One such construct contains the PIG-3 promoter which contains the p53-binding site CAGCTTGCCCACCCATGCTC (SEQ ID NO:1). Other PIG promoters can be used similarly.

[0043] PIG-specific antibodies can be used in assays to determine the status of the p53 gene in cells similar to those described above employing SAGE tags. Proteins or polypeptides encoded by PIGs 1-7 and 9-12 (PIG proteins) can be purified by any method known in the art or produced by recombinant DNA methods or by synthetic chemical methods and used as immunogens, to obtain a preparation of antibodies which specifically bind to a PIG protein, preferably to PIG 3, 6, 7, 10, 11, or 12. The antibodies can be used to detect wild-type PIG proteins in human tissue and fractions thereof

[0044] Preparations of polyclonal or monoclonal PIG antibodies can be made using standard methods known in the art. The antibodies specifically bind to epitopes present in PIG proteins. Preferably, the PIG epitopes are not present in other human proteins. Typically, at least 6, 8, 10, or 12 contiguous amino acids are required to form an epitope. However, epitopes which involve non-contiguous amino acids may require more, e.g., at least 15, 25, or 50 amino acids. Antibodies which specifically bind to PIG proteins provide a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in Western blots or other immunochemical assays. Preferably, antibodies which specifically bind PIG proteins do not detect other proteins in immunochemical assays and can immunoprecipitate PIG proteins from solution.

[0045] Antibodies which specifically bind to PIG proteins, particularly to PIG 3, 6, 7, 10, 11, or 12, can be purified by methods well known in the art. Preferably, the antibodies are affinity purified, by passing antiserum over a column to which a PIG protein or polypeptide is bound. The bound antibodies can then be eluted from the column, for example, using a buffer with a high salt concentration.

[0046] As disclosed above, wild-type p53 is required to modulate the level of transcripts identified in Tables 1 and 2, and the presence of mutant p53 is an indication of neoplasia. For example, wild-type p53 increases transcription of genes shown in Table 1 and decreases transcription of genes shown in Table 2. The status of the p53 gene in a tissue suspected of being neoplastic can be determined by comparing the levels of one or more of the products of genes whose transcription is modulated by wild-type p53 in the suspect tissue with the level of a PIG protein in a tissue which is normal.

[0047] Such comparisons can be made by any methods known in the art. Preferably, antibodies which specifically bind to the protein products of the modulated genes are used, for example in radioimmunoassays or immunocytochemical methods, as is known in the art. Antibodies which specifically bind to the proteins of Table 2 can be used to measure the levels of the proteins of Table 2. Antibodies which specifically bind to PIGs 1-7 and 9-12, particularly those which specifically bind to PIG 3, 6, 7, 10, 11, and 12, can be used to measure the levels of PIG proteins.

[0048] The same or a lower level of a PIG protein in the suspect tissue indicates the presence of mutant p53. Similarly, the same or a higher level of a protein of Table 2 in the suspect tissue indicates the presence of mutant p53. The levels of two, 3, 4, 5, 6, 7, 8, 9, or 10 or more proteins can be compared. Detection of binding of PIG-specific antibodies to PIG proteins, or of antibodies which specifically bind to the proteins of Table 2, can also be used to determine if a suspect tissue contains a wild-type or mutant p53 gene after treatment with DNA-damaging agents.

[0049] Antibodies of the invention which specifically bind to PIG 3, 6, 7, 10, 11, or 12 can be provided in kits, for evaluating cytotoxicity or carcinogenicity of test agents, as described above. A kit can contain one, 2, 3, 4, 5, or 6 of the antibodies of the invention.

[0050] The above disclosure generally describes the present invention. A more complete understanding can be obtained by reference to the following specific examples which are provided herein for purposes of illustration only, and are not intended to limit the scope of the invention. The following methods were used in the examples reported below.

Methods

[0051] Cells and RNA. All cell lines used in this study were obtained from the American Type Culture Collection and were cultured in McCoy's medium supplemented with 10% fetal bovine serum (FBS). Cells were infected with recombinant adenoviruses containing either the p53 gene or the β-galactosidase gene (26) at a multiplicity of infection of 10-100. RNA was purified from cells at various times after infection using the MessageMaker Kit (Gibco/BRL). Northern blot analysis was performed as described (26).

[0052] SAGE. SAGE was performed as previously described (3, 27). Briefly, polyadenylated RNA was converted to double-stranded cDNA with a BRL synthesis kit using the manufacturer's protocol with the inclusion of primer biotin-5′-T18-3′. The cDNA was cleaved with NlaIII, and the 3′-terminal cDNA fragments were bound to streptavidin-coated magnetic beads (Dynal). After ligation of oligonucleotides containing recognition sites for BsmFI, the linkered-cDNA was released from the beads by digestion with BsmFI. The released tags were ligated to one another, concatemerized, and cloned into the Sph I site of pZero 21.0 (Invitrogen). Colonies were screened with PCR using M13 forward and M13 reverse primers. PCR products containing inserts of greater than 300 bp (>20 tags) were sequenced with the TaqFS DyePrimer kit and analyzed using a 377 ABI automated sequencer (Perkin Elmer).

[0053] Statistical analysis. 53,022 and 51,853 tags were identified from DLD-1 cells infected with Ad-p53 and Ad-lacZ, respectively. The two libraries were compared using the SAGE program group (3). Corrections for tags containing linker sequences and other potential artifacts were made as described previously (27). Of 104,875 total tags identified, 3,181 were excluded from analysis on this basis. Monte Carlo simulations revealed that the computational analyses had a >99% probability of detecting a transcript expressed at an abundance of 0.00005 in either RNA sample.

[0054] cDNA clones. Cellular mRNA from Ad-p53-infected cells was used to prepare cDNA as described for the SAGE libraries, except that the 3′ primer contained an additional M13 forward sequence between the olio-DT tract and the biotinylated 5′ residue. To determine the sequence of the transcript from which an individual tag was derived, this cDNA was used as a template for PCR, employing an M13 forward primer and a primer containing the tag sequence. In other cases, mRNA from Ad-p53 -infected cells was used to construct a cDNA library in the ZAP Express vector (Stratagene) and the library was screened by hybridization with oligonucleotides corresponding to tags, as described (3). Of 14 tags identified by SAGE as differentially expressed in p53-expressing cells, 8 corresponding genes could be identified simply by searching public databases, particularly those including expressed sequence tags. In 5 cases, one of the two strategies described above was used to obtain the corresponding PIG. In one of the 14 cases (PIG13), no cDNA clone could be recovered corresponding to the tag sequence.

[0055] Analysis of PIG3 genomic structure. An arrayed BAC library (Research Genetics) was screened by PCR using the following primers derived from the 5′ end of the PIG3 gene: 5′-GGC-CAG-GAG-TAA-GTA-ACT-3′ (SEQ ID NO:2) and 5′-GCC-CTG-GTC-TGC-CGC-GGA-3′ (SEQ ID NO:3). Eco RI fragments encompassing the PIG3 coding sequences were subcloned into pBR322 and partially sequenced to determine the intron-exon borders. A 6.1 kb Apa LI fragment whose 3′ end was at a Eag I site 308 bp downstream of the transcription start site was then cloned into a promoterless luciferase reporter vector (FIG. 2A). This fragment was completely sequenced by primer walking. Subclones were then generated by restriction endonuclease digestion. Luciferase activity was determined after co-transfection with expression vectors encoding wt or H175R mutant p53. For in vitro p53 binding experiments, oligonucleotides containing two copies of the predicted p53-binding site (FIG. 2A) were subcloned into a modified pBR322 vector, excised as a ˜260 bp restriction fragment, and end-labeled. Immunochemical assays were performed as described previously (28).

[0056] Flow cytometry and other assays. Cells were collected with the aid of trypsin and incubated with CM-H2DCF-DA or NAO (Molecular Probes, Eugene, OR) at concentrations of 10 and 0.4 μM, respectively, for 20 minutes at 37° C. prior to analysis by flow cytometry (14, 15). To determine the fraction of apoptotic cells after various treatments, cells were stained with the DNA-binding dye H33258 and evaluated by fluorescence microscopy or flow cytometry as described (1). Superoxide production was assessed with lucigenin (29). In brief, 4-5×106 cells were collected with rubber policeman and resuspended in 1 ml of Earle's Balanced Salt Solution (Gibco BRL 14015-069, Life Technologies). Dark-adapted lucigenin (bis-N-methulacridinium nitrate, Sigma M8010) was added to the samples to a final concentration of 20 μM. Light emission was detected using a Berthold LB 9505C luminometer for 60 minutes at 37° C. Glutathione concentrations were measured using an assay kit purchased from Oxford Biomedical Res. Inc. according to the manufacturer's instructions. Caspase activation was assessed by cleavage of PARP (polyADP-ribose polymerase). Lysates from cells infected with Ad-p53 were Western blotted with an anti-PARP antibody, and the cleavage fragments were quantitated by densitometry (4).

EXAMPLE 1

[0057] To evaluate the patterns of gene expression following p53 expression, we employed SAGE, a technique which allows the quantitative evaluation of cellular mRNA populations (3). In brief, the method revolves around short sequence “tags” (11 bp), generated from defined positions within each mRNA molecule. Expression patterns are deduced from the abundance of individual tags. To induce apoptosis, the colorectal cancer line DLD-1, containing an inactive endogenous p53 gene, was infected with a replication defective adenovirus encoding p53 (Ad-p53). As previously shown, DLD-1 cells are among the ˜50% of CRC lines that undergo apoptosis in response to p53 (4). RNA was purified from cells 16 hours after infection, at least 8 hours before the onset of morphological signs of apoptosis.

[0058] A total of 101,694 tags were analyzed, approximately half from cells infected with Ad-p53 and half from cells infected with a control virus (Ad-lacZ) encoding β-galactosidase. These tags corresponded to 7,202 different transcripts. Comparison of the two SAGE libraries indicated a remarkable similarity in expression profiles (FIG. 1A). Of the 7,202 transcripts detected, only 14 (0.19%) were expressed at levels more than 10-fold greater in p53-expressing than in control cells; conversely, only 20 transcripts were expressed at levels less than 10-fold lower in the p53-expressing cells.

[0059] As previous data indicated p53-mediated transcriptional activation as the likely basis of p53 action (5), we concentrated on the 14 tags appearing at higher levels in the p53-expressing cells. The mRNA transcripts corresponding to 13 of these tags were successfully identified (Table 1). In each case, the induction was confirmed by Northern blot analysis (examples in FIG. 1B). Only two of these genes (called PIGs, for p53-induced genes) had been implicated as targets of p53-transcriptional activation (1, 2, 5, 6) and seven had not previously been described at all. Other genes previously implicated in p53-mediated responses were induced to lower levels (e.g., MDM2, thrombospondin) or not at all (e.g., bax and cyclin G1) in the human CRC cells studied here (4).

EXAMPLE 2

[0060] PIGs were induced at relatively short times after p53 expression, at least 12 hours prior to any morphological or biochemical signs of apoptosis (FIG. 1B). This time course suggested that PIGs were directly induced by the transcriptional activation properties of p53. To formally test this conjecture in a representative case, we evaluated the genomic structure and sequence of PIG3. By screening a bacterial artificial chromosome (BAC) library, a genomic clone was identified that contained all PIG3 coding sequences. The gene was localized to chromosome 2p (see Methods), and the intron-exon structure and sequence of the promoter region were determined.

[0061] A 6.1 kb ApaLI fragment of genomic DNA containing the presumptive promoter was then cloned upstream of a luciferase reporter gene (FIG. 2A). The resulting construct was transfected into three different human cell lines together with wild type (wt) or mutant p53.

[0062] As shown in FIG. 2B, wt p53 induced substantial activity through the PIG3 promoter in all three lines. Mutant p53 had no transcriptional activation capacity. Analysis of a truncated promoter showed that the p53-responsive elements lay within a fragment containing only 862 bp of sequence upstream of the PIG3 transcription start site (FIG. 2A). Determination of the sequence of this 6.1 kb Apa L1 fragment revealed a single 20 bp sequence predicted to bind p53, located at 308 nt upstream of the transcription start site p53. A DNA fragment containing two copies of this sequence, but not a derivative of this fragment altered at critical residues, was found to bind strongly to p53 in vitro (FIG. 2C).

EXAMPLE 3

[0063] As a further test of the p53-dependency of PIG3 induction, we determined whether PIG3 could be induced by endogenous p53 rather than through the exogenous Ad-p53 source. Six CRC cancer cell lines were each treated with adriamycin, a DNA-damaging and apoptotic-inducing agent known to increase endogenous p53 levels. PIG3, like p21, was found to be strongly induced in the three lines with wild-type p53 genes, but not in the three lines with mutant p53 genes.

EXAMPLE 4

[0064] The sequences of the PIGs provided important clues to their potential functions (Table 1). In particular, several were predicted to encode proteins with activities related to the redox status of cells. PIG12 is a novel member of the microsomal glutathione transferase family of genes (FIG. 3A). PIG8 is the human homologue of a mouse gene (Ei24) whose expression is induced in a p53-dependent manner by etoposide, a quinone known to generate reactive oxygen species (ROS) (6) (FIG. 3C). PIG6 is a homolog of proline oxidoreductase (FIG. 3D), a mitochondrial enzyme that catalyzes the first step in the conversion of proline to glutamate (7). Glutamate is one of the three amino acids required for formation of glutathione, a major regulator of cellular redox status. The p21 gene, which can also be considered a PIG, can be induced by ROS, independently of p53 (8). PIG4 encodes a serum amyloid protein that can be induced by oxidative stress (9). PIG1 belongs to the galectin family, members of which can stimulate superoxide production (10). PIG7 has been shown to be induced by TNF-β, a known inducer of oxidative stress. PIG3 is a novel gene that is highly related to TED2, a plant NADPH oxidoreductase (11) (FIG. 3B). Interestingly, TED2 is one of the few genes implicated in the apoptotic process necessary for the formation of plant meristems (11). The closest relative of PIG3 in mammals is an NADPH-quinone oxidoreductase which has been shown to be a potent generator of ROS (12).

[0065] Previous studies have shown that ROS are powerful inducers of apoptosis (13). The SAGE-based characterization of p53-induced genes suggested that p53 might induce apoptosis by stimulating the production of ROS. To test this hypothesis, the production of ROS was measured in p53-expressing cells using carboxy-methyl dichlorofluorescein (DCF-diacetate (CM-DCF-DA) and flow cytometry (14). This analysis showed that ROS were induced following Ad-p53 infection and that ROS continued to increase as apoptosis progressed (FIG. 4A). The magnitude of the increase in ROS, as assessed by DCF fluorescence, was similar in p53-expressing cells to that observed in cells treated with the powerful oxidant menadione (FIG. 4A). No change in DCF fluorescence was observed following infection with a control adenovirus (FIG. 4A).

[0066] As an assay for the functional consequences of ROS production, we examined the cellular content of cardiolipin, a major component of the mitochondrial membrane which is especially sensitive to cellular oxidation (15). Using nonyl-acridine orange (NAO) as a probe, cardiolipin was found to decrease soon after p53-induced ROS was detected (FIG. 4A), demonstrating significant injury to a major mitochondrial component.

EXAMPLE 5

[0067] To determine the specificity of PIG expression for the p53-dependent apoptotic process, we performed experiments with other inducers of ROS or apoptosis. We found that PIGs were not expressed simply as a result of ROS production, as none were induced following treatment with menadione and only p21 was induced by hydrogen peroxide in DLD-1 cells. Similarly, the specificity of PIG induction for p53-dependent apoptosis was confirmed by the demonstration that other inducers of apoptosis (indomethacin or ceramide) did not result in the expression of any PIG, despite extensive cell death.

EXAMPLE 6

[0068] To clarify the relationship between p53 expression, PIG activation, ROS production, and apoptosis, we carried out more detailed time course experiments. PIG induction began within six hours after Ad-53 infection (FIG. 1B and FIG. 4B), while intracellular ROS production, as assessed with lucigenin chemiluminescence, could first be observed at 18 hours (FIG. 4B). This ROS production led to oxidative stress, as evidenced by a 48+/−12% decrease in intracellular glutathione concentration at 21 hours. Mitochondrial lipid degradation (NAO) was not observed until three to six hours after the onset of a measurable ROS increase and was accompanied by morphologic (chromatin condensation and fragmentation) and biochemical (caspase-mediated degradation of PARP) signs of apoptosis (FIG. 4B). These observations are consistent with previous studies showing that mitochondrial damage is rapidly followed by classic signs of programmed cell death (13).

[0069] The time courses illustrated in FIG. 4B suggest a cascade wherein p53 transcriptionally induces redox-controlling genes resulting in the production of ROS, in turn leading to oxidative damage to mitochondria and apoptosis. To determine whether these steps were causally associated, we inhibited each step with specific pharmacologic agents and determined the effect of this inhibition on other components of the pathway.

[0070] First, cells were treated with the transcriptional inhibitor 5,6-dichlorobenimidizole riboside (DRB) at 8 hours following Ad-p53 infection (16). Though p53 expression was already near maximal at this time, DRB was found to block apoptosis at 24 hours by 83+/−3% as well as to inhibit the expression of PIGs. The translational inhibitor cycloheximide, when given up to 8 hours following Ad-p53 infection, was found to similarly block apoptosis (by 79% at 24 hours). Thus both transcription and translation were required for p53-induced apoptosis in CRC cells, as observed in some other systems (2, 5) and as expected for classic programmed cell death (2, 5).

[0071] Second, p53-expressing cells were treated with pyrrolidine dithiocarbamate (PDTC), an anti-oxidant which has been shown to block ROS-associated apoptosis (17). PDTC was indeed able to block the apoptosis elicited by p53. However, PDTC inhibits many enzymes, and its specificity is questionable (17). We therefore treated cells with diphenyleneiodonium chloride (DPI), a specific inhibitor of flavin-dependent oxidoreductases which has been used to block production of ROS in a variety of systems (18). Cells were treated with DPI 12 hours after Ad-p53 infection, when PIG production was already underway. PIG3 expression, apoptosis, and ROS production were measured 12 hours later. DPI (25 μM) did not inhibit PIG3 production but did inhibit ROS production by 71-85% and inhibited apoptosis by 73-77% in three independent experiments.

[0072] Finally, we treated cells with bongkrekic acid (BA), a specific inhibitor of mitochondrial ATP translocase which can block the mitochondrial permeability transition pore opening thought to be required for ROS-dependent forms of apoptosis (13). When cells were treated 12 hours after Ad-p53 infection, BA was found to inhibit neither PIG3 expression nor ROS production, but inhibited subsequent apoptosis by 86-93%. BA was non-toxic at the dose used (100 μM). While BA inhibited the p53-apoptotic process dependent on ROS production, it had no effect on the p53-mediated growth arrest dependent on p21 as assessed by flow cytometry.

[0073] The gene expression profile, time courses, and pharmacologic inhibition studies reported above strongly support a three step model underlying p53's induction of apoptosis. We propose that p53 transcriptionally activates a specific subset of genes, including oxidoreductases, long before any morphological or biochemical evidence of cell death (Table 1 and FIG. 4B). The proteins encoded by these genes then collectively increase the content of ROS, which in turn damage mitochondria. Leakage of calcium and proteinaceous components from damaged mitochondria then stimulate the caspases that are ubiquitously activated during the apoptotic process. (19-22).

[0074] Data from several experimental systems are consistent with this model. For example, apoptosis induced by irradiation, which is dependent on p53 in certain cell types, has been suggested to proceed through a process involving ROS and mitochondrial damage (23). Additionally, an SV40 large T antigen mutant, which binds p53 only at the permissive temperature, was shown to induce apoptosis at the non-permissive temperature through a ROS-related mechanism (24). More recently, it was shown that p53-induced apoptosis in smooth muscle cells is ROS-dependent (25). Though the basis for ROS production and the involvement of mitochondria were not investigated in these previous studies, they suggest that the events we observed in CRC cells are unlikely to be cell-type or species specific and may often underlie p53-associated apoptotic processes. The fact that one of the PIGs is highly related to Ted2, an oxidoreductase implicated in plant cell apoptosis (11), and that apoptosis in plants may also proceed through a ROS-directed pathway (11), adds further interest to this model.

[0075] Though observations by us and others are consistent with this model, they raise several unanswered questions. For example, we do not yet know which of the PIGs, are primarily responsible for the induction of ROS. We suspect that their combination, rather than any single one, is necessary for ROS generation. This conjecture is supported by preliminary experiments which demonstrate that PIG3 alone does not induce apoptosis when overexpressed. Though we have concentrated on the most highly induced PIGs, the SAGE analysis revealed at least 26 other genes which were induced by p53 to significant but lower levels than p21 and PIG1 -PIG13. Some of these genes may play a role in redox regulation.

[0076] It is also not known why some cells enter into apoptosis following p53 expression while others undergo a prolonged growth arrest (4). The possibility that PIGs are only induced in the former has been excluded by examination of PIG expression in such lines; most PIGs were induced by p53 in each of ten CRC lines tested, regardless of whether the cells underwent apoptosis or growth arrest. A more likely possibility is that different cells have different capacities to cope with generators of oxidative stress and that cells with a low capacity succumb to apoptosis. This possibility is supported by numerous studies which show that the response to ROS varies significantly with cell type and growth conditions (13). Hopefully, the experiments and genes reported here will open a new window into the p53 apoptotic process that will facilitate inquiry into these issues.

References

[0077] 1. Waldman, T., Kinzler, K. W. & Vogelstein, B. p21 is necessary for the p53-mediated G1 arrest in human cancer cells. Cancer Res. 55, 5187-5190 (1995).

[0078] 2. Oren, M. Relationship of p53 to the control of apoptotic cell death. Semin. Cancer Biol. 5, 221-227 (1994).

[0079] 3. Velculescu, V. E., Zhang, L., Vogelstein, B. & Kinzler, K. W. Serial Analysis Of Gene Expression. Science 270, 484-487 (1995).

[0080] 4. Polyak, K., Waldman, T., He, T.-C., Kinzler, K. W. & Vogelstein, B. Genetic determinants of p53 induced apoptosis and growth arrest. Genes & Dev. 10, 1945-1952 (1996).

[0081] 5. Levine, A. J. p53, the cellular gatekeeper for growth and division. Cell 88, 323-331 (1997).

[0082] 6. Lehar, S. M., et al. Identification and cloning of Ei24, a gene induced by p53 in etoposide-treated cells. Oncogene 12, 1181-1187 (1996).

[0083] 7. Hayward, D. C., et al. The sluggish-A gene of Drosophila melanogaster is expressed in the nervous system and encodes proline oxidase, a mitochondrial enzyme involved in glutamate biosynthesis. Proc. Natl. Acad. Sci. U.S.A. 90, 2979-2983 (1993).

[0084] 8. Russo, T., et al. A p53-independent pathway for activation of WAF1/CIP1 expression following oxidative stress. J. Biol. Chem. 270, 29386-29391 (1995).

[0085] 9. Rienhoff, H. Y., Jr., Huang, J. H., Li, X. X. & Liao, W. S. Molecular and cellular biology of serum amyloid A. Mol. Biol. Med. 7, 287-298 (1990).

[0086] 10. Yamaoka, A., Kuwabara, I., Frigeri, I. G. & Liu, F. T. A human lectin, galectin-3 (epsilon bp/Mac-2) stimulates superoxide production by neutrophils. J. Immunol. 154, 3479-3487 (1995).

[0087] 11. Greenberg, J. T. Programmed cell death: A way of life for plants. Proc. Natl. Acad. Sci. U.S.A. 93, 12094-12097 (1996).

[0088] 12. Rao, P. V., Krishna, C. M. & Zigler, J. S., Jr. Identification and characterization of the enzymatic activity of zeta-crystallin from guinea PIG lens. A novel NADPH:quinone oxidoreductase. J. Biol. Chem. 267, 96-102 (1992).

[0089] 13. Kroemer, G., Zamzami, N. & Susin, S. A. Mitochondrial control of apoptosis. Immun. Today 18, 45-51 (1997).

[0090] 14. Zamzami, N., et al. Reduction in mitochondrial potential constitutes an early irreversible step of programmed lymphocyte death in vivo. J. Exp. Med. 181, 1661-1672 (1995).

[0091] 15. Petit, P. X., et al. Alterations in mitochondrial structure and function are early events of dexamethasone-induced thymocyte apoptosis. J. Cell. Biol. 130, 157-167 (1995).

[0092] 16. Tamm, I. & Sehgal, P. B. Halobenzimidazole ribosides and RNA synthesis of cells and viruses. Adv. Virus Res. 22, 187-258 (1978).

[0093] 17. Orrenius, S., Nobel, C. S. I., van den Dobbelsteen, D. J., Burkitt, M. J. & Slater, A. F. G. Dithiocarbamates and the redox regulation of cell death. Biochem. Soc. Transact. 24, 1032-1038 (1996).

[0094] 18. Holland, P. C., Clark, M. G., Bloxham, D. P. &Lardy, H. A. Mechanism of action of the hypoglycemic agent diphenyleneiodonium. J. Biol. Chem. 248, 6050-6056 (1973).

[0095] 19. Korsmeyer, S. J. Regulators of cell death. Trends Gen. 11, 101-105.

[0096] 20. Susin, S. A., et al. Bc1-2 inhibits the mitochondrial release of an apoptogenic protease. J. Exp. Med. 184, 1331-1341 (1996).

[0097] 21. Yang, J., et al. Prevention of apoptosis by Bcl-2: release of cytochrome c from mitochondria blocked. Science 275, 1129-1132 (1997).

[0098] 22. Kluck, R. M., Bossy-Wetzel, E., Green, D. R. & Newmeyer, D. D. The release of cytochrome c from mitochondria: a primary site for Bc1-2 regulation of apoptosis. Science 275, 1132-1136 (1997).

[0099] 23. Borek, C. Radiation and chemically induced transformation: free radicals, antioxidants and cancer. Br. J. Cancer Suppl. 8, 74-86 (1987).

[0100] 24. Vayssiere, J. L., Petit, P. X., Risler, Y. & Mignotte, B. Commitment to apoptosis is associated with changes in mitochondrial biogenesis and activity in cell lines conditionally immortalized with simian virus 40. Proc. Natl. Acad. Sci. U. S. A. 91, 11752-11756 (1994).

[0101] 25. Johnson, T. M., Yu, Z. -X., Ferrans, V. J., Lowenstein, R. A. & Finkel, T. Reactive oxygen species are downstream mediators of p53-dependent apoptosis. Proc. Natl. Acad. Sci. U. S. A. 93, 11848-11852 (1996).

[0102] 26. El-Deiry, W. S., Tokino, T., Velculescu, V. E., Levy, D. B., Parsons, R., Trent, J. M., Lin, D., Mercer, W. E., Kinzler, K. W. & Vogelstein, B. WAF1, a potential mediator of p53 tumor supression. Cell 75, 817-825 (1993).

[0103] 27. Velculescu, V. E., et al. Characterization of the yeast transcriptome. Cell 88 (1997).

[0104] 28. El-Deiry, W. S., Kern, S. E., Pietenpol, J. A., Kinzler, K. W. & Vogelstein, B. Definition of a consensus binding site for p53. Nature Gen. 1, 45-49 (1992).

[0105] 29. Faulkner, K. & Fridovich, I. Luminol and lucigenin as detectors for O2.-.Free Rad. Biol.&Med. 15, 447-451 (1993).

TABLE 11
SEQ
ID		ACCES-
NO:	SAGE TAG	SION	DESCRIPTION
4	CCCGCCTCTT	D38112	mitochondrial 16S rRNA
4	CCCGCCTCTT	T10098	seq816 human cDNA clone
			b4HB3MA-COT8-HAP-Ft
4	CCCGCCTCTT	T10208	seq907 human cDNA clone
			b4HB3MA-COT8-HAP-Ft
4	CCCGCCTCTT	T26521	AB291H2F human cDNA clone
			LLAB291H2 3′.
4	CCCGCCTCTT	W27281	28g3 human retina cDNA
			randomly primed sublibrary
4	CCCGCCTCTT	T17062	NIB250 human cDNA 3′end
			similar to human mitochondrial
			mRNA
5	AATCTGCGCC	M13755	human interferon-induced
			17-kDa/15-kDa protein mRNA*
5	AATCTGCGCC	M21786	human interferon-induced
			15-Kd protein (ISG) gene*
6	GTGACCACGG	K03432	18S rRNA
7	TTTCCTCTCA	X57348	human mRNA (clone 9112).
8	TGCCTGCACC	X61683	human gene for cystatin C
			exon 3
8	TGCCTGCACC	X05607	human mRNA for cysteine
			proteinase inhibitor precursor
9	TCACCCACAC	R01174	ye77b03.s1 human cDNA clone
			123725 3′
9	TCACCCACAC	N95827	zb66e05.s1 human cDNA clone
			308576 3′
10	TAAACCTGCT	U06643	PIG1, human keratinocyte
			lectin 14 (HKL-14) mRNA*
10	TAAACCTGCT	L07769	PIG1, human galectin-7
			mRNA, complete CDs.*
11	CCCAAGCTAG	X54079	human mRNA for heat shock
			protein HSP27
12	AGCCCGCCGC	AF001294	human IPL (IPL) mRNA
12	AGCCCGCCGC	N29541	yw89f12.s1 human cDNA clone
			259439 3′
13	GACATCAAGT	Y00503	human mRNA for keratin 19.
13	GACATCAAGT	J03607	human 40-kDa keratin inter-
			mediate filament precursor
14	TGTCCTGGTT	U03106	human wild-type p53 activated
			fragment-1 (WAF1)*
14	TGTCCTGGTT	U09579	human melanoma differentiation
			associated (mda-6)*
14	TGTCCTGGTT	L26165	human DNA synthesis inhibitor
			mRNA, complete CDs.*
14	TGTCCTGGTT	L25610	human cyclin-dependent kinase
			inhibitor mRNA*
15	AGCTCACTCC	AF010314	PIG10, homologous to none*
16	AGGCTGTCCA	AF010315	PIG11, homologous to none*
17	TGAGTCCCTG	AF010316	PIG12, microsomal GST
			homolog*
18	CCCTCCTCCG	F19653	PIG2, human EST sequence
			(011-X4-27) from skeletal
			muscle*
18	CCCTCCTCCG	Z49878	PIG2, Guanidinoacetate
			N-methyltransferase*
19	GAGGCCAACA	AF010309	PIG3, quinone oxidoreductase
			homologue
19	GAGGCCAACA	H42923	yo10e11.s1 human cDNA clone
			177548 3′.
19	GAGGCCAACA	W07320	za94c09.r1 Soares fetal lung
			NbHL19W human
20	TGGGGCCGCA	U33271	PIG5, human normal
			keratinocyte mRNA, clone B4,
			partial*
21	TCCTTGGACC	AF010311	PIG6, homologous to Drosophila
			PUT1, partial*
22	CTGGGCCTGA	AF010312	PIG7*
23	AGCTGGTTTCC	AF010313	PIG8, human homolog of mouse
			EI24*
24	GAGGTGCCGG	J00277	human (genomic clones
		J00206	lambda-[SK2-T2, HS578T];
		J00276	cDNA clones RS-[3,4, 6])
		K00954	c-Ha-ras1 proto-oncogene,
			complete coding sequence
24	GAGGTGCCGG	W25059	zb67e08.r1 Soares fetal
			lung NbHL19W human
25	ACAACGTCCA	T16546	NIB1466 human cDNA 3′end
25	ACAACGTCCA	D85815	human DNA for rhoHP1
26	GTGCGGAGGA	X56653	PIG4, human SAA2 alpha gene,
			exon 3 and exon 4*
26	GTGCGGAGGA	X51439	PIG4, human mRNA for serum
			amyloid A (SAA) protein
			partial*
26	GTGCGGAGGA	X51441	PIG4, human mRNA for serum
			amyloid A (SAA) protein
			partial*
26	GTGCGGAGGA	X51442	PIG4, human mRNA for serum
			amyloid A (SAA) protein
			partial*
26	GTGCGGAGGA	X51445	PIG4, human mRNA for serum
			amyloid A (SAA) protein
			partial*
26	GTGCGGAGGA	M23698	PIG4, human serum amyloid
			A1 (SAA1) mRNA, complete*
26	GTGCGGAGGA	M23699	PIG4, human serum amyloid
			A2-alpha (SAA2) mRNA*
26	GTGCGGAGGA	M26152	PIG4, human serum amyloid
			A (SAA) mRNA, complete*
26	GTGCGGAGGA	M10906	PIG4, human serum amyloid
			A (SAA) mRNA*
26	GTGCGGAGGA	H45773	PIG4, yp23c09.r1 human cDNA
			clone 188272 5′ simil*
26	GTGCGGAGGA	T28677	PIG4, EST51616 human cDNA
			5′ end similar to serum*
27	CGTCCCGGAG	U33822	PIG9, human tax1-binding
			protein TXBP181 mRNA,
			complete*
27	CGTCCCGGAG	D52048	PIG9, human fetal brain cDNA
			5′-end GEN-064D09*
28	GTGCTCATTC	AB000584	human mRNA for TGF-beta
			superfamily protein
29	GCTGACTCAG	M99425	human thrombospondin mRNA,
			3′ end.
30	AGATGCTGCA		PIG13
31	CTCAGACAGT	AA046881	EST homologous to 40S
			ribosomal protein
32	TCCGGCCGCG		NO MATCH
33	AGCCACTGCA		Alu repeat
34	GCTTTTAAGG	L06498	human ribosomal protein S20
			(RPS20) mRNA
35	GGGCCAATAA	D29121	human keratinocyte cDNA,
			clone 142
35	GGGCCAATAA	AA178918	human cDNA clone 612020
36	AAGGGCTCTT	M20560	human lipocortin-III mRNA
36	AAGGGCTCTT	M63310	human 1,2-cyclic-inositol-
			phosphate phosphodiesterase
			(ANX3) mRNA
1Gene assignments were based on the following list of GenBank sequences (GenBank Release 94). In each case, tentative assignments were based on the identification of a 10 bp SAGE tag adjacent to a NlaIII site. The final assignment was further refined by using an 11 bp SAGE tag and elimination of non 3′ end NlaIII sites and genomic sequences. In some cases, the assignment was confirmed by Northern blot analysis as indicated by the asterisk following
#the description. In other cases, a single assignment could not be made, and more than one gene is listed.

[0106]

TABLE 22
SEQ		ACCES-
ID		SION
NO:	SAGE TAG	NUMBER	DESCRIPTION
37	GTAAGTGTAC	J01415	12S rRNA
38	TGTACCTGTA	K00558	human alpha-tubulin mRNA
39	AACGACCTCG	V00599	human mRNA fragment
			encoding beta-tubulin
40	AGTTTGTTAG	M33011	human carcinoma-associated
			antigen GA733-2 mRNA
41	GACTCGCCCA	M98326	human P1-Cdc46 mRNA
42	GGGCCAATAA	D29121	human keratinocyte cDNA,
			clone 142
42	GGGCCAATAA	AA178918	human cDNA clone 612020
43	GGGTTTTTAT	L28809	human dbpB-like protein mRNA
44	AGAAATACCA	AA455253	human cDNA clone 814816 3′
45	TACCATCAAT	J02642	human glyceraldehyde 3-phos-
			phate dehydrogenase mRNA
46	GGATTGTCTG	M34081	human small nuclear ribonucleo-
			protein particle SmB mRNA
47	TACTAGTCCT	X15183	human mRNA for 90-kDa
			heat-shock protein
48	AATATTGAGA	U62962	human Int-6 mRNA,
			complete CDs
49	GAGGGAGTTT	U14968	human ribosomal protein L27a
			mRNA
50	AAGGGCGCGG	M20560	human lipocortin-III mRNA
50	AAGGGCGCGG	M63310	human 1,2-cyclic-inositol-
			phosphate phosphodiesterase
			(ANX3) mRNA
51	TTCACAAAGG	X61970	human mRNA for macropain
			subunit zeta
52	CTGCACTTAC	D28480	human mRNA for hMCM2
53	GATCCCAACT	V00594	human mRNA for
			metallothionein from
			cadmium-treated cells
54	GGGAAGCAGA	X77770	mitochondrial mRNA
55	GCTTTCTCAC	K00365	human mitochondrial Ser-tRNA
56	TTCATTATAA	M26708	human prothymosin alpha
			mRNA
57	TAAGGAGCTG	X77770	human RPS26 mRNA
58	TGAGGGAATA	M10036	human triosephosphate
			isomerase mRNA
59	GGGATGGCAG	M98326	human transfer valyl-tRNA
			synthetase mRNA
60	TCTTCTCTG		NO MATCH
61	GCACCTTATT		NO MATCH
62	ACTTTAAACT		NO MATCH
63	CCATTCCACT		NO MATCH
64	TCAAATGCAT	M16342	human small nuclear ribonucleo-
			protein (hnRNP) C protein
			mRNA
65	GAAAAATGGT	X61156	human mRNA for laminin-
			binding protein
66	ACTAACACCC	U18810	human PACAP type-e/VIP
			type-2 receptor mRNA
67	TTGGGGTTTC	M12937	human ferritin heavy subunit
			mRNA
2 Gene assignments were based on the following list of GenBank sequences (GenBank Release 94). In each case, tentative assignments were based on the identification of a 10 bp SAGE tag adjacent to a NlaIII site. The final assignment was further refined by using an 11 bp SAGE tag and elimination of non 3′ end NlaIII sites and genomic sequences.

[0107]

Claims

1. A method of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic, comprising the steps of: comparing the level of transcription of an RNA transcript in a first sample of a first tissue to the level of transcription of the transcript in a second sample of a second tissue, wherein the first tissue is suspected of being neoplastic and the second tissue is a normal human tissue, wherein the first and second tissue are of the same tissue type, and wherein the transcript is identified by a tag selected from the group consisting of SEQ ID NOS:10, 15-22, 26, 27, and 30; categorizing the first sample as neoplastic or as having a mutant p53 when transcription is found to be the same or lower in the first sample than in the second sample.

2. A method of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic, comprising the steps of: comparing the level of transcription of an RNA transcript in a first sample of a first tissue to the level of transcription of the transcript in a second sample of a second tissue, wherein the first tissue is suspected of being neoplastic and the second tissue is a normal human tissue, wherein the first and second tissue are of the same tissue type, and wherein the transcript is identified by a tag selected from the group consisting SEQ ID NOS:37-67; categorizing the first sample as neoplastic or as having a mutant p53 when transcription is found to be the same or higher in the first sample than in the second sample.

3. The method of claim 1 wherein a comparison of at least two of the transcripts is performed.

4. The method of claim 2 wherein a comparison of at least two of the transcripts is performed.

5. The method of claim 1 wherein a comparison of at least five of the transcripts is performed.

6. The method of claim 2 wherein a comparison of at least five of the transcripts is performed.

7. The method of claim 1 wherein a comparison of at least ten of the transcripts is performed.

8. The method of claim 2 wherein a comparison of at least ten of the transcripts is performed.

9. The method of claim 1 wherein at least one tag is selected from the group consisting of SEQ ID NOS:15, 16, 17, 19, 21, 22, and 30.

10. An isolated and purified nucleic acid molecule which comprises a SAGE tag selected from the group consisting of SEQ ID NOS:15, 16, 17, 19, 21, 22, and 30.

11. The nucleic acid molecule of claim 10 which is a cDNA molecule.

12. The nucleic acid molecule of claim 10 wherein the SAGE tag is located at the 3′ end of the molecule.

13. An isolated nucleotide probe comprising at least 12 contiguous nucleotides of a human nucleic acid molecule, wherein the human nucleic acid molecule comprises a SAGE tag selected from the group consisting of SEQ ID NOS:15, 16, 17, 19, 21, 22, and 30.

14. The probe of claim 13 which comprises the selected SAGE tag.

15. A kit for evaluating toxicity or carcinogenicity of an agent, comprising at least 2 probes according to claim 13.

16. The kit of claim 15 which comprises at least 5 of said probes.

17. The kit of claim 15 which comprises at least 10 of said probes.

18. The kit of claim 15 which comprises at least 20 of said probes.

19. The kit of claim 15 which comprises at least 30 of said probes.

20. A kit for evaluating cytotoxicity or carcinogenicity, comprising at least 2 probes according to claim 14.

21. A method for evaluating cytotoxicity or carcinogenicity of an agent, comprising the steps of: contacting a test agent with a human cell; determining the level of transcription of a transcript in the human cell after contacting with the agent; wherein an agent which increases the level of a transcript identified by a SAGE tag selected from the group consisting of SEQ ID NOS:10, 15-22, 26, 27, and 30, or an agent which decreases the level of a transcript identified by a SAGE tag selected from the group consisting of SEQ ID NOS:37-67 is a potential cytotoxin or carcinogen.

22. A method to determine the neoplastic status or p53 status of a cell comprising: comparing ROS levels in a first sample of a first tissue to the level in a second sample of a second tissue, wherein the first tissue is or is suspected of being neoplastic and the second tissue is a normal human tissue; wherein elevated levels of ROS in the first sample indicate expression of p53 and low levels of ROS indicate lack of expression of p53, wherein lack of expression of p53 is an indicator of neoplasia.

23. A DNA construct for screening drugs as anti-neoplastic agents comprising: a reporter gene under the control of a PIG-3 promoter, wherein the reporter gene is 3′ and covalently linked to the PIG-3 promoter, wherein the PIG-3 promoter comprises the sequence CAGCTTGCCCACCCATGCTC (SEQ ID NO:1).

24. A method of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic, comprising the steps of; treating cells of a test sample with a DNA-damaging agent; comparing the level of transcription of an RNA transcript in cells of the sample to the level of transcription of the transcript in cells of the sample which are not subject to said treating, wherein the transcript is identified by a tag selected from the group consisting of SEQ ID NOS:10, 15-22, 26, 27, and 30; categorizing the sample as neoplastic or as having a mutant p53 when transcription is found to be the same or lower in the treated cells than in the untreated cells.

25. A method of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic, comprising the steps of: treating cells of a test sample with a DNA-damaging agent; comparing the level of transcription of an RNA transcript in the cells to the level of transcription of the transcript in cells of the sample which are not subject to said treating, wherein the transcript is identified by a tag selected from the group consisting of SEQ ID NOS:37-67; categorizing the sample as neoplastic or as having a mutant p53 when transcription is found to be the same or higher in the treated cells than in the untreated cells.

26. The method of claim 24 wherein a comparison of at least two of the transcripts is performed.

27. The method of claim 25 wherein a comparison of at least two of the transcripts is performed.

28. The method of claim 24 wherein a comparison of at least five of the transcripts is performed.

29. The method of claim 25 wherein a comparison of at least five of the transcripts is performed.

30. The method of claim 24 wherein a comparison of at least ten of the transcripts is performed.

31. The method of claim 25 wherein a comparison of at least ten of the transcripts is performed.

32. The method of claim 24 wherein at least one tag is selected from the group consisting of SEQ ID NOS:15-17, 19, 21, 22, and 30.

33. The method of claim 1 wherein the first and second samples are treated with a DNA-damaging agent prior to said step of comparing.

34. The method of claim 2 wherein the first and second samples are treated with a DNA-damaging agent prior to said step of comparing.

35. A preparation of antibodies which specifically bind to a PIG protein having an amino acid sequence selected from the group consisting of SEQ ID NOS:81, 83, 84, 86, 87, and 88.

36. The preparation of antibodies of claim 35 wherein the antibodies are monoclonal.

37. The preparation of antibodies of claim 35 wherein the antibodies are polyclonal.

38. The preparation of antibodies of claim 35 wherein the antibodies are affinity purified.

39. A method of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic, comprising the steps of: comparing the level of a PIG protein having an amino acid sequence selected from the group consisting of SEQ ID NOS:79-88 and the amino acid sequence encoded by SEQ ID NO:72 in a first sample of a first tissue to the level of the PIG protein in a second sample of a second tissue, wherein the first tissue is suspected of being neoplastic and the second tissue is a normal human tissue, wherein the first and second tissue are of the same tissue type; and categorizing the first sample as neoplastic or as having a mutant p53 when the level of the PIG protein is found to be the same or lower in the first sample than in the second sample.

40. A method of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic, comprising the steps of: comparing the level of a protein of Table 2 in a first sample of a first tissue to the level of the protein of Table 2 in a second sample of a second tissue, wherein the first tissue is suspected of being neoplastic and the second tissue is a normal human tissue, wherein the first and second tissue are of the same tissue type; and categorizing the first sample as neoplastic or as having a mutant p53 when the level of the protein of Table 2 is found to be the same or higher in the first sample than in the second sample.

41. The method of claim 39 wherein the level of the PIG protein is measured using an antibody which specifically binds to a PIG protein having an amino acid sequence selected from the group consisting of SEQ ID NOS:79-88 and the amino acid sequence encoded by SEQ ID NO:72.

42. The method of claim 40 wherein the level of the protein is measuring using an antibody which specifically binds to a protein selected from the group of proteins shown in Table 2.

43. The method of claim 39 wherein a comparison of the levels of at least two PIG proteins is performed.

44. The method of claim 40 wherein a comparison of the levels of at least two proteins of Table 2 is performed.

45. The method of claim 39 wherein a comparison of the levels of at least five PIG proteins is performed.

46. The method of claim 40 wherein a comparison of the levels of at least five proteins of Table 2 is performed.

47. The method of claim 39 wherein a comparison of the levels of at least at least ten PIG proteins is performed.

48. The method of claim 40 wherein a comparison of the levels of at least ten proteins of Table 2 is performed.

49. The method of claim 39 wherein the first and second samples are treated with a DNA-damaging agent prior to said step of comparing.

50. The method of claim 40 wherein the first and second samples are treated with a DNA-damaging agent prior to said step of comparing.

51. A kit for evaluating toxicity or carcinogenicity of an agent, comprising at least 2 antibodies according to claim 35.

52. A method for evaluating cytotoxicity or carcinogenicity of an agent, comprising the steps of: contacting a test agent with a human cell; determining the level of a PIG protein having an amino acid sequence selected from the group consisting of SEQ ID NOS:79-88 and the amino acid sequence encoded by SEQ ID NO:72 or of a protein of Table 2 in the human cell after contacting with the agent; wherein an agent which increases the level of the PIG protein, or an agent which decreases the level of the protein of Table 2 is identified as a potential cytotoxin or carcinogen.

53. The method of claim 52 wherein the level of the PIG protein is measuring using an antibody which specifically binds to a protein having an amino acid sequence selected from the group consisting of SEQ ID NOS:79-88 and the amino acid sequence encoded by SEQ ID NO:72.

54. A method of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic, comprising the steps of: treating cells of a test sample with a DNA-damaging agent; comparing the level of a PIG protein having an amino acid sequence selected from the group consisting of SEQ ID NOS:79-88 and the amino acid sequence encoded by SEQ ID NO:72 in cells of the sample to the level of the PIG protein in cells of the sample which are not subject to said treating; and categorizing the sample as neoplastic or as having a mutant p53 when the level of the PIG protein is found to be the same or lower in the treated cells than in the untreated cells.

55. A method of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic, comprising the steps of: treating cells of a test sample with a DNA-damaging agent; comparing the level of a protein of Table 2 in cells of the sample to the level of the protein of Table 2 in cells of the sample which are not subject to said treating; and categorizing the sample as neoplastic or as having a mutant p53 when the level of the protein of Table 2 is found to be the same or higher in the treated cells than in the untreated cells.

56. The method of claim 54 wherein the level of the PIG protein is measured using an antibody which specifically binds to a protein having an amino acid sequence selected from the group consisting of SEQ ID NOS:81, 83, 84, 86, 87, and 88.

57. The method of claim 55 wherein the level of the protein of Table 2 is measured using an antibody which specifically binds to a protein selected from the group consisting of the proteins shown in Table 2.

58. The method of claim 54 wherein a comparison of the levels of at least two PIG proteins is performed.

59. The method of claim 55 wherein a comparison of the levels of at least two proteins of Table 2 is performed.

60. The method of claim 54 wherein a comparison of the levels of at least five PIG proteins is performed.

61. The method of claim 55 wherein a comparison of the levels of at least five proteins of Table 2 is performed.

62. The method of claim 54 wherein a comparison of the levels of at least ten PIG proteins is performed.

63. The method of claim 55 wherein a comparison of the levels of at least ten proteins of Table 2 is performed.

64. The method of claim 54 wherein at least one antibody is an antibody which specifically binds to a protein having an amino acid sequence selected from the group consisting of SEQ ID NOS:81, 83, 84, 86, 87, and 88.