PEPTIDE INHIBITORS AS NOVEL ANTI-HIV THERAPEUTICS

Abstract
The present invention relates to synthetic peptide inhibitors (Seq ID No. 67-71) useful as anti-HIV therapeutics. The invention also relates to a novel screening method for screening anti-HIV molecules. The present invention relates to a synthetic peptide useful as anti-HIV therapeutic. The invention also relates to a novel screening method for screening of anti-HIV therapeutics. In particular, the present invention relates to reporter gene constructs for the detection of the HIV Nef and host ASK1 protein interaction. Furthermore, the invention relates to a functional interaction for Nef-ASK1 proteins prepared in a recombinant manner, a method for identifying of Nef-ASK1 interaction which causes activation of pathway to activate apoptosis presumably causing immune evasion for HIV in infected cells. The reporter gene construct according to the present invention, after it had been introduced into cells, in the presence of HIV Nef and host ASK1 proteins result in the expression of reporter luciferase protein which may be used for quantitative/qualitative interaction of HIV Nef and host ASK1 protein. The both interacting construct cloned in fluorescence expression vector when transfected in eukaryotic cells inhibits ASK1 mediated apoptosis and were reversed by the inhibitors. Furthermore, the invention was used to identify the inhibitor for the interaction of Nef-ASK1 in the cell.
Description
FIELD OF THE INVENTION

The present invention relates to synthetic peptide inhibitors (Seq ID No. 67-71) useful as anti-HIV therapeutics. The invention also relates to a novel screening method for screening anti-HIV molecules. In particular, the invention relates to mammalian two hybrid system and cell based model for physiological response for screening of anti-HIV therapeutics. The present invention further relates to a reporter gene construct for the detection of the Negative factor (Nef)—Apoptosis signal regulating kinasel (ASK1) interaction that is essential for inhibiting apoptosis, resulting immune evasion. The physiological response of Nef-ASK1 constructs that showed interaction in mammalian-two hybrid system said to inhibit apoptosis that is activated by ASK1 was detected in ATCC CRL-1573™ cells. The peptide inhibitor identified, manages to switch from anti-apoptotic signaling to pro-apoptotic signaling in Nef transfected ATCC CRL-1573™ cells. Furthermore, the invention relates to a screening model based on Nef and ASK1 interaction in ATCC CRL-1573™ cells using a mammalian two-hybrid system and cell based model for physiological response to analyze apoptotic activity maintaining this interaction in ATCC CRL-1573™ cells, a method of screening for those inhibitors related to Nef-ASK1 interaction, a method of screening for inhibiting a pathway initiated with Nef-ASK1 interaction which inhibits apoptosis in HIV-1 infected cells causing immune evasion.


BACKGROUND OF THE INVENTION

HIV-I is the most prevalent infectious agent worldwide and a leading causative agent of acquired immuno deficiency syndrome (AIDS). HIV is a retrovirus, which is transmitted through human fluids either through natural interactions like sexual intercourse or through artificial methods like blood transfusions, infected needles used in injections. The 9-10 Kb of HIV-1 genome express viral proteins (categorized in structural, enzymatic and accessory proteins functions), whose function ranges from the successful viral infection in the cell to the complete life cycle for new virions, has been extensively studied. Every viral protein is considered to be a potential target for developing anti-HIV-1 therapy (Greene and Peterlin, 2002; Stevenson 2003).


Further, it was characterized that accessory protein Nef is responsible for HIV-1 pathogenesis (Mellors et. al., 1996) by the experiment where, Nef deleted SlVmac 239 infection in rhesus monkey showed low viral load with normal CD4 counts. These monkeys were found healthy with delayed progression to AIDS (Kestler et. al., 1991). Also, the HIV-1 patients who were long-term non-progressor, with no clinical sign of disease progression and normal CD4 counts, upon characterization of virus revealed that majority of them had Nef gene deleted from their genome (Deacon et. al., 1995, Kirchhoff et. al., 1995,). Interestingly, only expression of Nef gene in mice led to the development of AIDS like phenotype suggesting that it harbors major disease determinant (Hanna et. al., 1998). Nef is deludged with functions involving interaction with different host proteins; however, the individual function required for pathogenesis has not been identified till date.


Nef is a 27kDa protein, expressed in HIV-1 infected cells even before the formation of provirus suggesting that it initiate functions soon after entry of virus in cell. In vitro and in vivo studies show that Nef protein enhances viral infectivity and replication respectively in infected cells. Nef downregulates the MHC classl from cell surface, which primarily presents viral proteins to activate cytotoxic T lymphocytes. Moreover, Nef functions include activation of Pak kinase, activates cascade of events leading to the activation of T cells without engaging T-cell receptor [TCR] and upregulation of Fas/FasL ligand for killing bystander cells, as well as activates anti-apoptotic pathways for the survival of infected cells. All these functions of Nef are carried out in cell after interaction with host proteins.


The one of the possible mechanism of immune evasion by HIV-1 is increase of expression of both Fas and FasL on virally infected cells (1-3). The expression of FasL is induced by the presence of Nef in virally infected cells (Xu, X.N. et al., 1997. Hodge, S.et al.,1998.). Interestingly, both Fas and FasL presence on infected cells, through cis-ligation, also undergo apoptosis in virally infected cells. The Fas and TNFα-R is known as death receptor signaling pathway which converge to a common signaling molecule known as apoptosis signaling Kinase-1(ASK1). Therefore, ASK1 appears to participate as a key signaling intermediate in both as Fas and TNFα-R pathways, that activated two different subgroup of MAP kinases kinases, SEK1 or (MKK4) and MKK3/MAPKK6(MKK5) which inturn activate JNK;c-Jun amino-terminal kinase and p38 subgroup of MAP kinase, respectively(Chang, H. Y et al.,1998). Ichijo, H. et al., 1997. Nishitoh, H. et al. 1998).


The unique cis-ligated mediated apoptosis in HIV-1 infected cell is inhibited by the presence of Nef. This protein interacts with ASK1 and inhibits the downstream signaling pathways that induce apoptosis. The molecular mechanism studied is Nef interaction with ASK1 appears by specifically preventing stimulus-coupled release of thioredoxin from ASK1 (Geleziunas. R, Xu et a/.,2001). possibly, inhibition of thioredoxin release could not activate autophosphorylation of ASK1 kinase by phosphorylating 838 threonine in kinase domain. This cannot activate ASK1 mediated phosphorylation of MEKK-SEK1 kinase which activate JNK pathway (Geleziunas. R, Xu et al.,2001.Hayakawa, T.et al., 2006).The death receptor signaling—ASK1-MEKK-SEK1-JNK axis is involved in activating apoptosis in virally infected cells.


Arguably, if Nef-ASK1 interaction is inhibited then the outcome in the virally infected cells would be falling in the line of apoptosis that helps selectively clearance of HIV-1 infected cell.


Understanding the molecular Nef pathways responsible for functions involved with viral persistence, replication and infectivity can be used as target for anti HIV-1 therapy. This can enable us to focus on future therapies where the task of interrupting key interaction between viral and host proteins will serve as potential target. Nef-ASK1 interaction represents a potential target for this approach. Recent approaches towards the development of an alternative model for characterizing specific interactions of Nef with host proteins are either yeast (Rossi et. al., 1996) or mammalian-two-hybrid system (Murakami et. al., 2002). Nef is structurally conserved and the structure function analysis revealed that with maintaining the structure, the accessible Nef conserved domain to host proteins is responsible for the function interaction in the cell (Geyer et. al., 2001).


In the present study, we developed a mammalian-two hybrid model and studied Nef-ASK1 interaction in ATCC CRL-1573™ cells, an early event which inhibits death receptor mediated apoptosis in virally infected cells (Geleziunas et al,2001). Further, the expression of ASK1 fragments showed induction of apoptosis in ATCC TIB-152™/ATCC CRL-1573™. The ASK1 fragment that can induce apoptosis in ATCC TIB-152™/ATCC CRL-1573™ can inhibit apoptosis by the expression of Nef. The molecular mechanism studied showed that the apoptosis was induced by phosphorylation of JNK kinase which was inhibited by the presence of Nef. This model will help to screen the inhibitors designed for this interaction and perhaps, which could be used to develop an alternative therapy.


Mammalian two hybrid models have been used in scientific research in a routine manner (Colas and Brent et al., 1998). The present invention uses this technique to enable the user to establish the Nef-ASK1 interactions in ATCC CRL-1573™ cells. No other group has developed such a model for the evaluation of Nef-ASK1 interactions earlier and the present invention is the first of it's kind. The present invention serves as a novel tool to identify inhibitors of the aforesaid interactions. Inhibitors, which are so identified, will have property to activate apoptosis in cell based system and virally infected cells. There are no known drawbacks to the technique and it is amenable to high-throughput screening. The invention will efficiently allow for the screening of a large number of compounds in a relatively short time period of upto 48 hours. This will also allow for the search of structural analogs of inhibitors identified using the method of the present invention. Inhibitors, which are identified using the present invention, will act through a novel mechanism of inhibiting Nef-ASK1 interaction. This will be an alternate approach for anti-retroviral therapies including but not restricted to the Human immuno deficiency virus (HIV), which causes AIDS.


OBJECTS OF THE INVENTION

The main objective of the present invention is to provide synthetic peptide inhibitor useful as anti- HIV therapeutic.


Another object of the invention provides a novel screening method for screening anti-HIV molecules.


Yet another object of the invention is to develop mammalian two-hybrid model for assessing Nef-ASK1 interaction in ATCC CRL-1573™ cells similar to HIV-I infected cells.


The cell based assay for physiological response of Nef-ASK1 interaction said to inhibit apoptosis that is activated by ASK1 was detected in ATCC CRL-1573™ cells and ATCC TIB-152™


Another object of the invention is to provide a novel screening method to identify the molecules useful for inhibition of Nef-ASK1 interaction in eukaryotic cells.


We have made ASK1 overlapping fragment (FIG. 1A) cloned in pBIND vector of mammalian two hybrid system which make recombinant protein with GAL4 binding domain. HIV-1 Nef gene was cloned in pACT vector of mammalian two hybrid vector which make recombinant protein with activation domain. In the mammalian-based system, reconstituted transcription factor activity comes from two different protein domains that are expressed from two separate vectors. The DNA binding domain of GAL4 protein and the activation domain of herpes simplex virus type 1 VP16 protein provide functional transcriptional activation from RNA polymerase II basal promoters with upstream GAL4 binding sites. In the CheckMate System, five GAL4 binding sites are positioned upstream of the firefly luciferase gene (/uc+) providing a sensitive and quantitative reporter system for functional assessment of reconstituted GAL4:VP16 activity. For a positive control reaction, the pBIND-Id and the pACT-MyoD Control Vectors are co-transfected into ATCC CRL-1573™ cells along with the pG5luc (Seq ID No. 3) Vector (FIG. 1B). Vectors are transfected by Exgen 500 (farmentas). Yet another object of the invention is to define the specific interaction of Nef and ASK1 by scanning of entire ASK1 gene by designing small ASK1 fragments. Yet another object of invention is to define the minimal region of ASK1 gene which interacts with Nef.


Yet another object of the invention is to define the molecular mechanism of apoptosis induced by ASK1 fragment which is inhibited by interacting with Nef. Yet another object of the invention is to define the molecular mechanism of inhibiting apoptosis by Nef-ASK1 interaction in ATCC TIB-152™/ATCC CRL-1573™ cells. Still another object of the invention is to provide the mammalian two hybrid model as a novel screening/assay system to identify novel molecules for inhibiting viral-host protein interaction.


Still another object of the invention is to provide the cell based model as a novel screening/assay system to identify novel molecules for inhibiting viral-host protein function.


SUMMARY OF THE INVENTION

Accordingly, the present invention provides a synthetic peptide useful as anti-HIV therapeutic having sequence selected from the group consisting of Seq Id No.67-71. The present invention also relates to a method for screening anti-HIV molecules comprising the steps of:

    • a. transfecting constructs of SEQ ID No.1, 3 and 16 respectively into a mammalian cell using 5 μl of a transfection reagent to obtain a transfected cell;
    • b. analyzing the transfected cell as obtained in step (a) for luciferase activity after incubating for a period of 48 hours for demonstrating Nef-ASK1 interaction using dual luciferase kit and luminometer;
    • c. adding the molecule to be screened in the transfected cell of step [a] and incubating for 6 to 24 hours followed by repeating step [b] to assess its inhibitory activity on the Nef-ASK1 interaction; and
    • d. Selecting the molecules which are inhibiting the Nef-ASK1 interaction resulting in no additional luciferase activity with respect to the control as a potential anti-HIV therapeutic.


In an embodiment of the present invention, the construct of SEQ ID No. 1 represents Nefwt gene cloned in VP16pCDNA+pACT vector.


In another embodiment of the present invention, the construct of SEQ ID No. 16 represents ASK1 gene cloned in pBIND vector.


In still another embodiment of the present invention, the construct of SEQ ID No.3 represents the reporter constructs pG5Luc.


In yet another embodiment of the present invention, the mammalian cell is selected from the group consisting of ATCC CRL-1573™ cells, T cell lines, monocytic cell lines and fibroblast cells wherein Nef-ASK1 interaction is established.


In still another embodiment of the present invention, the molecule to be screened is added at a concentration of 5 to 1.25 μm.


In yet another embodiment of the present invention, the molecule screened as a potential anti-HIV therapeutic is a DEVGEANN.


In still another embodiment of the present invention, Use of peptide is for screening Anti-HIV therapeutics.


In yet another embodiment of the present invention, compound comprising peptide or variant or a derivative or pharmaceutically acceptable salt thereof and the compound inhibits the binding of HIV-Nef to human Ask1.


In still another embodiment of the present invention, a pharmaceutical composition comprising a therapeutically effective amount of compound variant or a derivative or pharmaceutically acceptable salt thereof and the compound inhibits the fusion of HIV Nef to human ASK 1, in admixture with a pharmaceutically acceptable excipient. In yet another embodiment of the present invention, a method of treating HIV infection that comprises providing to a recipient a therapeutically effective or a prophylactically effective amount of a pharmaceutical composition comprising a therapeutically effective amount of peptide which inhibits the fusion of HIV-Nef to human ASK1, in admixture with a pharmaceutically acceptable excipient. In still another embodiment of the present invention, the peptide inhibits binding of HIV-Nef to human ASK1.





BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS


FIG. 1: Identification of ASK1 region interacting with Nef: ASK1 fragments interaction with Nef in ATCC CRL-1573™ cells. A) Designing of ASK1 fragments from N to C termination of ASK1 gene, B) MyoD-Id interaction for positive protein-protein interaction, C) ASK1a,b,c,d,e,f, fragments were transfected with Nef wt and showed luciferase activity in ATCC CRL-1573™ cells



FIG. 2: Characterization of minimal ASK1 region interaction with Nef Minimal ASK1 fragments interaction with Nef : A) Designing of ASK1 fragments adding sequence upstream of ASK1a and downstream of ASK1d and adding both ASK1a and ASK1d and deleting both ASK1a and ASK1d, B) ASK1 h,l,j fragments were transfected with Nef wt and showed luciferase activity in ATCC CRL-1573™ cells. C) ASK1g fragment was transfected with Nef wt and showed luciferase activity in ATCC CRL-1573™ cells and MyoD-Id interaction for positive protein-protein interaction.



FIG. 3: To study the biochemical activity of ASK1 fragments: ASK1 fragments were analysed for activating apoptosis: ASK1 g, h,l and j fragments were transfected with and without Nef in ATCC CRL-1573™ cells and after 48 hrs apoptosis was assayed.



FIG. 4: Inhibition of apoptosis by Nef-ASK1g is switched to pro-apoptosis by inhibitors in ATCC CRL-1573™ cells:


Inhibition of apoptosis by Nef is reversed by inhibitors: a) Cells transfected with ASK1, ASK1 and Nef, Nef alone and Nef-ASK1 with peptides in ATCC CRL-1573™ cells were cultured for 48 hrs and analysed for apoptosis; b) crystal structure of Nef depicting tetramer structure.



FIG. 5: Inhibitors reverse JNK phosphorylation inhibited by Nef-ASK1g interaction: ASK1 induced apoptosis by JNK phosphorylation is restored by inhibitors in presence of Nef: Western blot of cell transfected with pACT vector, ASK1g, Nef and ASK1g-Nef together in and ATCC CRL-1573™ cells with or without inhibitors. The blot was probed with phosphorylated JNK antibodies and total antibody. b) Densitometric analysis of the blot was done.



FIG. 6: Schematic representation of construction of mammalian expression vector VP16pcDNA.



FIG. 7: Vector map of fluorescent protein gene (GFP) variants a) pEYFP-N1 and b) pECFP-N1.





DETAILED DESCRIPTION OF THE INVENTION

Definitions


A “fusion protein” refers to a polypeptide formed by the joining of two or more polypeptides through a peptide bond formed between the amino terminus of one polypeptide and the carboxyl terminus of another polypeptide. The fusion protein may be formed by the chemical coupling of the constituent polypeptides or it may be expressed as a single polypeptide from nucleic acid sequence encoding the single contiguous fusion protein. A single chain fusion protein is a fusion protein halving a single contiguous polypeptide backbone.


The term “two-hybrid system” refers to a system comprising two chimeric molecules one of which bears a nucleic acid binding region, the other of which bears an expression control element (e.g. a transactivation or repressor domain). The molecules further a cognate binding pair such that one chimeric molecule is capable of specifically binding to the other chimeric molecule. The two-hybrid system further comprises a nucleic acid encoding a protein binding site that is specifically bound by the protein binding domain on the chimeric molecule thereby anchoring the chimeric molecule to the nucleic acid. The domain of the chimeric molecule recognizes and binds to its cognate binding partner on the second chimeric molecule thereby recruiting that molecule to the nucleic acid whereby the expression control element alters (e.g. activates) expression of a gene or cDNA comprising the underlying nucleic acid.


“Transfection” is used herein to mean the delivery of expressible nucleic acid to a target cell, such that the target cell is rendered capable of expressing said nucleic acid. It will be understood that the term “nucleic acid” includes both DNA and RNA without regard to molecular weight, and the term “expression” means any manifestation of the functional presence of the nucleic acid within the cell, including without limitation, both transient expression and stable expression.


The term “transactivator” refers to a molecule that induces transcription and/or upregulates transcription of a gene or cDNA. The transactivator may be a complete “native” molecule or a domain of a molecule that is capable of inducing and/or upregulating transcription of a gene or cDNA.


“Reporter genes” are genes or cDNAs that express an easily assayable (detectable and/or quantifiable) product. Detection of the assayable product indicates the expression and/or level of expression of the reporter gene. Reporter genes are well known to those of skill in the art. They include, but are not limited to, genes expressing bacterial chloramphenicol acetyl transferase (CAT), beta-galactosidase (.beta.-gal), green fluorescent protein (GFP) and other fluorescent protein, various bacterial luciferase genes, e.g., the luciferase genes encoded by Vibrio harveyi, Vibrio fischeri, and Xenorhabdus luminescens, the firefly luciferase gene Flux, and the like.


The term “transcriptional activators” refers to proteins, which activate transcription in yeast, plant, insect and mammalian cells. These proteins contain two parts: one directs DNA binding and the other, called the activating region, presumably interacts with some component of the transcriptional machinery. Activating regions are typically acidic and require some poorly-understood aspect of structure, probably at least in part an alpha-helix.


Here in the present invention, the “transcriptional activator system” utilized is the one, which is formed by fusing a DNA-binding fragment of the yeast activator GAL4 to a highly acidic portion of the herpes simplex virus protein VP16. VP16 activates transcription of immediate early viral genes by using its amino-terminal sequences to attach to one or more host-encoded proteins that recognize DNA sequences in their promoters.


Amplification of ASK1 gene fragments:


The full length ASK1 cDNA cloned in pCMVsport6 vector (BCO54503) was purchased from SAF labs. We designed the ASK1 (a-f) overlapping fragments of approximately one 1kb covering the entire ASK1 gene (FIG. 1). The forward and reverse primers are designed for amplifying ASK1 fragments as shown in table 1.


Plasmid Constructs—Nef gene was cloned in VP16pcDNA plasmid constructed in lab using pcDNA 3 (Invitrogen) as vector backbone, while the fragment containing the CMV promoter, intron, T7 promoter, nuclear localization signal and multiple cloning region was taken from the mammalian two-hybrid assay vector pACT. The resulting construct thus containing the cloned Nef gene was called VP16pCDNA+pACT (Seq ID No. 1). .


Two sets of constructs were generated from the two vectors, pBIND and VP16pCDNA+pACT:

    • ASK1 fragments ASK1a (Seq ID No. 4), ASK1b (Seq ID No. 6), ASK1c (Seq ID No. 8), ASK1d(Seq ID No. 10), ASK1e(Seq ID No. 12), ASK1f (Seq ID No. 14), ASK1g (Seq ID No. 16), ASK1h (Seq ID No. 18), ASK1i (Seq ID No. 20)and ASK1j (Seq ID No. 22)were cloned in pBIND vector.
    • HIV-1 Nef gene was cloned in VP16pCDNA+pACT PCR was performed for each gene using the appropriate 5′and 3′ primers (as given in Table 1). For cloning of ASK1 fragment in pBIND vector of mammalian two vectors all primer contains BamH1 restriction site in forward primer and Xbal restriction site in reverse primer. All constructs were verified by Sanger sequencing in an ABI Automatic Sequencing System (PerkinElmer Applied Biosystems Inc, Foster City, Calif.). The primers were custom-synthesized by Sigma, Operon and IDT.









TABLE 1







Primers used for Nef cloning and ASK1 for mammalian two hybrid


system










Gene
primer
Primer Sequence (5′ . . . 3′)
Seq. ID No.





HIV-1nef Gene of
FPN1
5′ CATGGATCCGTGGAGCACTTACAAGCAGCA 3′
Seq ID No


accession no.
RPN1
5′ CATGGATCCTCAGCAGTCTTTGTAATACTCC 3′
35,36


GQ184335





cloned in





VP16pCDNA + pACT








ASK1 gene of
FP1
5′AGCGGATCCGTACGGAGGCGGACGAGGGCATCA3′
Seq ID No


accession
RP1
5′AGCGTCTAGACAAATCAAAGGTTGGCAG3′
37,38


no.BC054503 for





1035 bpASK1(a)





length from N-





terminal gene





cloned in pBIND








ASK1 gene of
FP2
5′AGCGGATCCGTTCCTACAGAGATATCCAGGAC3′
Seq ID No


accession
RP2
5′AGCGTCTAGACAAGTCACTTTCACAGTCTC3
39,40


no.BC054503 for





1051 bp ASK1(b)





length gene cloned





in pBIND








ASK1 gene of
FP3
5′AGCGGATCCGTTCTTCTGTCAGGGGAGTGA3′
Seq ID No


accession
RP3
5′AGCGTCTAGATGGGATCTCAGGGTGGAC3
41,42


no.BC054503 for





892 bp





ASK1(c)length gene





cloned in pBIND








ASK1 gene of
FP4
5′AGCGGATCCGTGCAGCAGACATCTGGTCTC3′
Seq ID No


accession
RP3420
5′AGCGTCTAGAACTCTCAGATGCAAGGCTG3′
43,44


no.BC054503 for





571 bp





ASK1(d)length gene





cloned in pBIND








ASK1 gene of
FP4
5′AGCGGATCCGTGACAGTATCATTCGGAAGGCGG3′
Seq ID No


accession
RP4
5′AGCGTCTAGAGTCAATGATAGCCTTCCACAG3′
45,46


no.BC054503 for





399 bpASK1(e)





length gene cloned





in pBIND








ASK1 gene of
FP5
5′AGCGGATCCGTACGGAGGCGGACGAGGGCATCA3′
Seq ID No


accession
RP5
5′AGCGTCTAGATCGCCTCTCACTGTCCTTCC3′
47,48


no.BC054503 for





ASK1(f)length





cloned in pBIND








ASK1 gene of
FP1
5′AGCGGATCCGTACGGAGGCGGACGAGGGCATCA3′
Seq ID No


accession
RP3420
5′AGCGTCTAGAACTCTCAGATGCAAGGCTG3′
49,50


no.BC054503 for





ASK1(g) length





from N-terminal





gene cloned in





pBIND








ASK1 gene of
FP2
5′AGCGGATCCGTTCCTACAGAGATATCCAGGAC3′
Seq ID No


accession
RP3420
5′AGCGTCTAGAACTCTCAGATGCAAGGCTG3′
51,52


no.BC054503 for





ASK1(h) length





from N-terminal





gene cloned in





pBIND








ASK1 gene of
FP1
5′AGCGGATCCGTACGGAGGCGGACGAGGGCATCA3′
Seq ID No


accession
RP3
5′AGCGTCTAGATGGGATCTCAGGGTGGAC3′
53,54


no.BC054503 for





ASK1(i) length from





N-terminal gene





cloned in pBIND








ASK1 gene of
FP2
5′AGCGGATCCGTTCCTACAGAGATATCCAGGAC3′
Seq ID No


accession
RP3
5′AGCGTCTAGATGGGATCTCAGGGTGGAC3′
55,56


no.BC054503 for





ASK1(j) length from





N-terminal gene





cloned in pBIND









Cloning of ASK1 in pEYFP-N1 Vector


ASK1and HIV-1 Nef (Seq ID No. 25)clones were cloned in pEYFP-N1 (Seq ID No. 24) (clontech #6006-1) vector for detection of apoptosis and c-jun, p38 phosphorylation analysis. Plasmid was constructed by using primer containing Sall and BamHl restriction site in forward and reverse primer respectively for ASK1 clone and HindIII, Sall in forward and reverse primer respectively for HIV-1 Nef clone. Primer sequence are given below in table-2









TABLE-2







primer sequence for cloning of ASK1 fragment in pEYFP-N1 vector













Sequence


Gene
primer
Primer Sequence (5′ . . . 3′)
ID No.





HIV-1 Nef
FP1
5′AGCAAGCTTATGGGGGGCAAGTGGTCAAAA3′
Seq ID


Gene of
RP1
5AGCGTCGACGCGCAGTCTTTGTAAACTCC G 3′
No


accession no.


57,58


GQ184335





Cloned in





pEYFP-N1








ASK1 gene
FP2
5′GTCGA ATGAGCACGGAGGCGACGAGGGCAT3′
Seq ID


of accession
RP2
5′GGATCCCGCCTCTCACTGTCCTTCCTCAGCATG3′
No


no.BC054503


59,60


for ASK1(g)





Cloned in





pEYFP-N1








ASK1 gene
FP3
5′ CGAGCGTCGACATGTCCTAC AGA GAT ATC
Seq ID


of accession
RP3
CAG GAC TAT GA 3′
No


no.BC054503

5′GGATCCCGCCTCTCACTGTCCTTCCTCAGCATG3′
61,62


for ASK1(h)





Cloned in





pEYFP-N1








ASK1 gene
FP4
5′GTCGA ATGAGCACGGAGGCGGACGAGGGCAT3′
Seq ID


of accession
RP4
5′AGCGGATCCTCTGGGATCTCAGGGTGGACTT3′
No


no.BC054503


63,64


for ASK1(h)





Cloned in





pEYFP-N1








ASK1 gene
FP5
5′ CGAGCGTCGACATGTCCTACAGAGATATCCAG
Seq ID


of accession
RP5
GAC TAT GA 3′
No 65,66


no.BC054503

5′ AGCGGATCCTCTGGGATCTCAGGGTGGACTT 3′



for ASK1(j)





Cloned in





pEYFP-N1









Tissue Culture and Transfections—HEK 293 cells were grown in Minimal Essential medium (low glucose, Sigma) supplemented with 10% fetal bovine serum, penicillin (100 units/ml), streptomycin (100 μg/ml) and Gentamycin (50 μg/ml) at 37° C. with 5% CO2. 1×105 cells were seeded per well in twenty four well plates, one day before transfection. Using commercially available ExGen 500 (fermentas) transfection reagent, all the required endotoxin free plasmid constructs were co-transfected into HEK 293 cells. 0.75 microgram of each plasmid and 5.0 micro liters per well ExGen 500 reagent were used. 48 h post transfection the cells were harvested and Luciferase activity was monitored using the Dual-Luciferase® Reporter assay kit (Promega). The data for basal control were used for the conversion of Luciferase activity to fold activation. As a positive control, the protein-protein interaction vectors pACTMyoD and pBIND-ID encoding the MyoD and ID control proteins, provided with the kit were used.


Luciferase Assay—The transfected cells were lysed in 1× Passive Lysis Buffer (PLB) provided with the kit, and the cell extracts (containing Luciferase enzyme) were added to the luminometer tubes and the Luciferase and Renilla RLU were measured on Berthold luminometer using the respective substrates for 10s along with 2s delay time.


EXAMPLE

The following examples are given by way of illustration and therefore should not be construed to limit the scope of the invention.


Example 1

To identify the region(s) in ASK1 interacting with Nef using mammalian two-hybrid model


The ASK1 interacts with Nef and inhibits apoptosis (Geleziunas et al 2001), however, the region of ASK1 that is interacting with Nef is not known. To identify which region it is interacting, the ASK1 gene approximately 4.1 Kb, was divided in overlapping fragments of approximately 1Kb from N-terminal to cover entire ASK1 gene. These fragments were cloned in pBIND mammalian two-hybrid vector, which has GAL4 DNA binding domain. The ASK1 fragment cloned in pBIND were; ASK1a (1-1035), ASK1b (959-2010), ASK1c (1820-2712), ASK1d (2581-3152), ASK1e (3153-3552) and ASK1 f(3478-4100), as shown in figure(1a). The full length Nef gene was cloned in pACT mammalian two hybrid vector, which has all the interacting domains (Accession no.GQ184335). The mammalian two-hybrid vectors cloned with or without Nef and ASK1 fragments were co-transfected along with G5Luc (luciferase) vector in ATCC CRL-1573™ cells. The reporter luciferase expression was measured after 48 hours of transfection. Among the ASK1 fragments, ASK1a, ASK1b and ASK1d showed 2.28, 1.10 and 2.89 fold, respectively, luciferase activity compared to negative control pACT-pBIND. ASK1c, ASK1d and ASK1f showed no luciferase activity compared to control, as shown in fig-1(b). The MyoD-Id protein was taken as positive control for showing interaction of proteins in mammalian-teo hybrid model, as shown in FIG. 1c). In this model the set of vectors which is expressing luciferase gene in cells are considered to be interacting with each other. Our results show that ASK1a, ASK1b and ASK1d fragment in presence of Nef express luciferase gene which shows that they interact with Nef where as other fragments of ASK1 does not show any tendency for interaction with Nef.


Example-2

Characterization of Minimal ASK1 Region Interacting with Nef:


In mammalian two-hybrid model, ASK1a, ASK1b and ASK1d fragments showed interaction with Nef which indicate that these fragments may have tendency in ASK1 for its interaction ability. We characterized the ASK1a downstream sequence and ASK1d upstream sequence in context to Nef interaction. Constructs were made based by adding upstream and downstream sequences of ASK1a and ASK1d respectively. Larger constructs which were made are ASK1g (contain both ASK1a, ASK1d and in between sequence), ASK1h (Contain ASK1d and upstream sequence), ASK1i (contain ASK1a and downstream sequence) and ASK1j (contain in between ASK1a and ASK1d fragment), as shown in FIG. 2a. All the ASK1 constructs were cloned in pBIND mammalian two-hybrid vectors. The ASK1 fragments and Nef were co-transfected along with G5Luc vector, in ATCC CRL-1573™ cells and luciferase activity was measured 48 hrs post transfection.


The ASK1g fragment showed maximum luciferase activity 154 fold times compared to negative control pACT-pBIND, as shown in FIG. 2c. The ASK1i and ASK1h showed luciferase activity 2.72 and 8.41 fold respectively as compared to negative control, as shown in FIG. 2b. In ASK1h having both ASK1a and ASK1b fragments showed synergistic effect. The ASK1j showed no luciferase activity 0.5 fold same as negative control was found (FIG. 2b).


These results showed that ASK1g is the minimal region of ASK1 required for interaction with Nef, deletion of either ASK1a or ASK1d reduced substantially interaction with Nef and loss of both fragments from ASK1g leads to complete loss of interaction. These results indicate that ASK1g fragment interacts with Nef through ASK1a and ASK1d regions.


Example-3

To study the effect of ASK1g,h,l,j fragments in inducing apoptosis and its inhibition by Nef:


ASK1 expression either by external stress stimuli or over expression of ASK1 gene activates apoptosis in cells. ASK1 is active in oligomeric state. The N and C region have oligomerization sequence. ASK1 is oligomerized with C region coiled coil region and at N-region after release of thioredoxin protein. ASK1 catalytic domain (670-940) forms a tight dimmer interacting in a head-to-tail fashion (Bunkoczi. et al 2007, Structurel5, 1215-1226). The oligomerization activates self phosphorylation of 838 Threonine residue in the kinase domain. Nef inhibits apoptosis by interacting with ASK1.


The ASK1g, h, i, j fragments showing interactions in mammalian two-hybrid model were studied for its function to induce apoptosis in ATCC CRL-1573™ cells and its inhibition by Nef.


The ASK1g, h, i,j fragments alone and with Nef were transfected in ATCC CRL-1573™ cells. The transfected cells were cultured for 48 hours and were labeled with AnnexinV and PI staining for analyzing aspoptosis.


The ASK1g,h,l, fragments induces apoptosis in ATCC CRL-1573™ cells and percentage positive cells for annexinV staining were 42, 42 and 45% respectively compared to control cells. The Nef co-transfected with ASK1g, ASK1h and ASK1i showed 20%,38% and 26% respectively annexin V stained cells that show inhibition of apoptosis by 52%, 10% and 42% respectively. The ASK1j has 28% annexin V stained cells compared to Nef control 20% and after Nef co-transfection there is no reduction in apoptosis compared to ASK1j, as shown in (FIG. 3).


These results showed that all fragments of ASK1g, h,i,j induces apoptosis in ATCC CRL-1573™ cells but the apoptosis is inhibited substantially by Nef with the ASK1g and ASK1i fragment.


Example-4

Inhibitor Reversing Nef-ASK1 Effect in ATCC CRL-1573™ Cells:


Inhibitors were designed from the crystal structure of Nef solved in our laboratory (Pankaj et al., 2011) The inhibitors were cultured with cells transfected will Nef, ASK1g and co-transfected with Nef-ASK1g. The cells after 48 hours were analysed for apoptosis using annexin V and PI staining. The results show that the Nef-ASK1 expression in ATCC CRL-1573™ cells inhibited apoptosis by 50% compared to ASK1 alone. The inhibitors reversed the effect of Nef-ASK1 interaction that is inhibition of apoptosis by increasing annexin V stained cells same to ASK1 cells FIG. 4.


This result suggests that Nef-ASK1 co-transfected in cells show inhibition of apoptosis and is reversed by inhibitors.




















Seq
% of Annexin



S.
Peptide
Peptide
ID
V cells means


No
seq.
No
No.
apoptotic cells
Remarks




















1
TPGPGVRYP
Peptide-1
57
22.45
Same as







background


2
GENNCLLH
Peptide-2
58
24.96
Same as







background


3
DEVGEANN
Peptide-3
59
40.37
Active







Reversing







interaction


4
LHGMEDPE
Peptide-4
60
23.0
Same as







background


5
PVRPQVPLRP
Peptide-5
61
22.45
Same as







background


6
ASK-1


43.15
ASK-1







protein affect


7
ASK-1 +


22.15
Interaction



Nef



(Background)


8
Control


11.0









Example-5

Effect of Inhibitors in Restoring Apoptosis by Reversing JNK Phosphorylation Inhibited by Nef-ASK1g Interaction in ATCC CRL-1573™ Cells:


ASK1 MAPKKK induces apoptosis by JNK and p38 pathway. To identify that the minimal ASK1g fragment can activate JNK and p38 pathway to induce apoptosis and the presence of Nef can affect this pathway.


The ASK1 g and Nef were transfected alone and co-transfected in ATCC CRL-1573™ cells. The JNK and p38 pathways were detected by analyzing phosphorylation of JNK or p38 kinases by using phosphorylated antibodies. The results showed that ASK1g fragment activated JNK pathway by phosphorylated JNK kinase where as late effect was seen in p38 kinase (data not shown). Further in co-transfected cell with Nef, inhibits the phosphorylation of JNK kinase whereas In presence of peptide the JNK phosphorylation is reversed, same as ASK-1, inhibited by Nef-ASK-1 interaction(FIG. 5). Densitometry analysis showed that Nef decrease phosphorylation of JNK kinase 2 fold compare to ASK1g transfected cells (FIG. 5).


Nef alone transfected cell show no phosphorylation of JNK kinase compared to control. These results suggest that ASK1g activates apoptosis by JNK pathway and this pathway is inhibited with the presence of Nef in ATCC CRL-1573™ cells and is reversed in presence of inhibitor.


Advantages of the Invention





    • The reporter gene construct is simple to use and does not involve human or animal models of testing.

    • This method is amenable to screening a large number of compounds in a relatively short time when coupled with high-throughput technologies or as a stand-alone assay procedure.

    • Rapid inhibitor optimization is facilitated by quick screening procedure.

    • The present inhibitor(s) will be a novel therapeutic and will overcome HIV-I resistance issues.





REFERENCES

Chang, H. Y., Nishitoh, H., Yang, X., Ichijo, H. & Baltimore, D. Activation of apoptosis signalregulating kinase 1 (ASK1) by the adapter protein Daxx. Science 281, 1860-1863(1998) .


Colas,P and Brent,R. The impact of two-hybrid and related methods on biotechnology. TIBTECH 16, 355-363.1998.


Deacon, N. J., Tsykin, A., Solomon, A., Smith, K., Ludford, M. M., Hooker, D. J., McPhee, D. A.,Greenway, A. L., Ellett, A., Chatfield, C., and et, a. I. (1995). Genomic structure of an attenuated quasi species of HIV-1 from a blood transfusion donor and recipients [see comments]. Science 270,988-91.


Fackler, O., Moris, A., Tibroni, N., Giese, S., Glass, B., Schwartz, O. and Kräusslich, H. G. Functional characterization of HIV-1 Nef mutants in the context of viral infection. Virology 351:332-339. (2006).


Geleziunas. R, Xu. W, Takeda. K, Ichijo. H & Greene. W. C. HIV-1 Nef inhibits ASK1-dependent death signalling providing a potential mechanism for protecting the infected host cell. Nature, VOL 410, 834. (2001).


Greene, W. O and Peterlin, B. M. Charting HIV's remarkable voyage through the cell: Basic science as a passport for future therapy. Nature medicine 8, 673-680. (2002).


Geyer M, Fackler O T, Peterlin B M 2001Structure--function relationships in HIV-1 Nef. Hanna Z, Kay D G, Rebai N, Guimond A, Jothy S and Jolicoeur P 1998 Nef harbors a major determinant of pathogenicity for an AIDS-like disease induced by HIV-1 in transgenic mice; Cell 95 163-175


Hayakawa, T., Matsuzawa, A., Noguchi, T., Takeda, K., and Ichijo, H. (2006). The ASK1-MAP kinase pathways in immune and stress responses. Microbes Infect. 8, 1098-1107.


Hodge, S., Novembre, F. J., Whetter, L., Gelbard, H. A. & Dewhurst, S. Induction of fas ligand expression by an acutely lethal simian immunodeficiency virus, SIVsmmPBj14. Virology 252, 354-363 (1998).


Ichijo, H. et al. Induction of apoptosis by ASK1, a mammalian MAPKKK that activates SAPK/JNK and p38 signaling pathways. Science 275, 90-94 (1997).


Kirchhoff F, Greenough T C, Brettler D B, Sullivan J L and Desrosiers R C 1995 Brief report: absence of intact nef sequences in a long-term survivor with nonprogressive HIV-1 infection [see comments]; N. Engl. J. Med. 332 228-232


Katsikis, P. D., Wunderlich, E. S., Smith, C. A. & Herzenberg, L. A. Fas antigen stimulation induces marked apoptosis of T lymphocytes in human immunode®ciency virus-infected individuals. J. Exp. Med. 181, 2029-2036 (1995).


Kestier, H. W., Ringler, D. J., Mori, K., Panicali, D. L., Sehgal, P. K., Daniel, M. D. and Desrosiers, R.C. Importance of the nef gene for maintenance of high virus loads and for development of AIDS. Cell 65:651-662 (1991).


Nishitoh, H. et al. ASK1 is essential for JNK/SAPK activation by TRAF2. Mol.Cell biology 2, 389-395 (1998).


Singh P, Yadav G P, Gupta S, Tripathi A K, Ramachandran R, and Tripathi R K (2011) A novel dimer-tetramer transition captured by the crystal structure of the HIV-1 Nef. PLoS One, 6, e26629.


Rossi, F., Gallina, A., & Milanesi, G. (1996) Virology 217, 397-403.

Claims
  • 1. A synthetic peptide useful as anti-HIV therapeutic having sequence selected from the group consisting of Seq Id No.67-71.
  • 2. A method for screening anti-HIV molecules comprising the steps of: a. transfecting constructs of SEQ ID No.1, 3 and 16 respectively into a mammalian cell using 5 pl of a transfection reagent to obtain a transfected cell;b. analyzing the transfected cell as obtained in step (a) for luciferase activity after incubating for a period of 48 hours for demonstrating Nef-ASK1 interaction using dual luciferase kit and luminometer;c. adding the molecule to be screened in the transfected cell of step [a] and incubating for 6 to 24 hours followed by repeating step [b] to assess its inhibitory activity on the Nef-ASK1 interaction;d. Selecting the molecules which are inhibiting the Nef-ASK1 interaction resulting in no additional luciferase activity with respect to the control as a potential anti-HIV therapeutic.
  • 3. The method as claimed in claim 2 wherein the construct of SEQ ID No. 1 represents Nefwt gene cloned in VP16pCDNA+pACT vector.
  • 4. The method as claimed in claim 2 wherein the construct of SEQ ID No. 16 represents ASK1 gene cloned in pBIND vector.
  • 5. The method as claimed in claim 2 wherein the construct of SEQ ID No.3 represents the reporter constructs pG5Luc.
  • 6. The method as claimed in claim 2 wherein the mammalian cell is selected from the group consisting of ATCC CRL-1573TM cells, T cell lines, monocytic cell lines and fibroblast cells wherein Nef-ASK1 interaction is established.
  • 7. The method as claimed in claim 2 wherein the molecule to be screened is added at a concentration of 5 to 1.25 μm.
  • 8. The method as claimed in claim 2 wherein the molecule screened as a potential anti-HIV therapeutic is a DEVGEANN.
  • 9. Use of peptide as claimed in claim 1 for screening Anti-HIV therapeutics.
  • 10. A compound, comprising peptide as claimed in claim 1 or variant or a derivative or pharmaceutically acceptable salt thereof, wherein said compound inhibits the binding of HIV-Nef to human Ask1.
  • 11. A pharmaceutical composition comprising a therapeutically effective amount of compound as claimed in claim 3 or variant or a derivative or pharmaceutically acceptable salt thereof, wherein said compound inhibits the fusion of HIV Nef to human ASK 1, in admixture with a pharmaceutically acceptable excipient.
  • 12. A method of treating HIV infection that comprises providing to a recipient a therapeutically effective or a prophylactically effective amount of a pharmaceutical composition comprising a therapeutically effective amount of peptide as claimed in claim 1 or a variant or a derivative or pharmaceutically acceptable salt thereof, wherein said peptide inhibits the fusion of HIV-Nef to human ASK1, in admixture with a pharmaceutically acceptable excipient.
  • 13. The use of claim 1, wherein the peptide inhibits binding of HIV-Nef to human ASK1.
Priority Claims (1)
Number Date Country Kind
0594/DEL/2012 Mar 2012 IN national
PCT Information
Filing Document Filing Date Country Kind
PCT/IB2013/051641 3/1/2013 WO 00