Peptides and DNA encoding the peptides useful for immunizations against Coccidioides spp. infections

Abstract

The present invention provides compositions of peptides and polynucleotides encoding the peptides, which peptides are useful for generating an immunological response in an individual and in therapeutic and diagnostic applications of infections due to pathogenic Coccidioides spp. fungi, such as C. immitis or C. posadasii.

Description

FIELD OF THE INVENTION

[0003] The present invention relates generally to the fields of pathogenic fungi and immunology. More particularly, the present invention provides compositions of Coccidioides spp. peptides and polynucleotides encoding the peptides, which peptides are useful for generating or detecting an immunological response in an individual and in vaccines and therapeutic applications of infections due to pathogenic Coccidioides spp. fungi, such as C. posadasii or C. immitis.

BACKGROUND OF THE INVENTION

[0004] Coccidioidomycosis, otherwise known as the San Joaquin Valley Fever, is a fungal respiratory disease of humans and wild and domestic animals which is endemic to southwestern United States, northern Mexico, and numerous semiarid areas of Central and South America (Pappagianis, D. Epidemiology of Coccidioidomycosis. Current Topics in Medical Mycology. 1988. 2:199-23). Infection occurs by inhalation of airborne spores (arthroconidia) produced by the saprobic phase of Coccidioides spp., which grows in alkaline desert soil. C. immitis was the first described species, and is now becoming known as the Californian species. The C. posadasii species was recently defined, and was previously recognized as the non-Californian population of C. immitis (Fisher, M. C., Koenig, G. L., White, T. J., Taylor, J. W. Molecular and phenotypic description of Coccidioides posadasii sp. nov., previously recognized as the non-California population of Coccidioides immitis. Mycologia 2002. 94(1):73-84, 2002). The differences in the two species are slight. Morphologically they are indistinguishable and no differences in their ability to cause disease are known.

[0005] It is estimated that 100,000 new cases of this disease occur annually within the rapidly growing population of people who live in regions of the United States between southwest Texas and southern California, where the disease is endemic (Galgiani, J. N. Coccidioidomycosis: A regional disease of national importance; rethinking our approaches to its control. Annals of Internal Medicine. 1999. 130:293-300). Although the majority of immunocompetent individuals are able to resolve their Coccidioides spp. infection spontaneously, the level of morbidity associated even with the primary form of this respiratory mycosis warrants consideration of a vaccine against the disease. Immunocompromised patients, including those infected with human immunodeficiency virus, are at high risk to contract disseminated coccidioidomycosis (Ampel, N. M., C. L. Dols, and J. N. Galgiani. Results of a prospective study in a coccidioidal endemic area. American Journal of Medicine. 1993. 94:235-240). It is also apparent from results of several clinical studies that African-Americans and Asians are genetically predisposed to development of the potentially fatal, disseminated form of the respiratory disease (Galgiani, J. N. 1993. Coccidioidomycosis. Western Journal of Medicine 159:153-171).

[0006] The rationale for commitment of research efforts to develop a Coccidioides spp. vaccine is based on clinical evidence that individuals who recover from the respiratory coccidioidomycosis disease retain effective long-term cellular immunity against future infections by the pathogen (Smith, C. E. 1940. American Journal of Public Health 30:600-611). In addition, early preclinical studies demonstrated that a formalin-killed whole-cell (spherule) vaccine prevented deaths in mice after infection with even very large numbers of coccidioidal spores (Levine et al.1961. Journal of Immunology 87:218-227). However, when a similar vaccine preparation was evaluated in a human trial, there was substantial local inflammation, pain, and induration at the injection site, rendering the vaccine unacceptable (Pappagianis et al. Evaluation of the protective efficacy of the killed Coccidioides immitis spherule vaccine in humans. American Review of Respiratory Diseases. 1993. 148:656-660). Further, there was no difference in the number of cases of coccidioidomycosis or the severity of the disease in the formalin-killed spherule vaccinated group compared to the placebo group. Therefore, the original human vaccine trial was not successful.

[0007] Subsequent attempts to develop a coccidioidal vaccine focused on crude or partially purified subcellular preparations from the fungus, and had limited success in experimental models (Zimmermann, C. R., S. M. Johnson, G. W. Martens, A. G. White, B. L. Zimmer, and D. Pappagianis. Protection against lethal murine coccidioidomycosis by a soluble vaccine from spherules. Infection and Immunity. 1988. 66:2342-2345; Lecara, G., Cox, R. A., and Simpson, R. B. Coccidioides immitis vaccine: potential of an alkali-soluble, water-soluble cell wall antigen. Infection and Immunity. 1983. 39: 473-475; Cole, G. T., T. N. Kirkland, and S. H. Sun. An immunoreactive, water-soluble conidial wall fraction of Coccidioides immitis 1987. Infection and Immunity 55:657-667; Cole G. T., Kirkland T. N., Franco M., Zhu S., Yuan L., Sun S. H., Hearn V. M. Immunoreactivity of a surface wall fraction produced by spherules of Coccidioides immitis. Infection and Immunity October 1988;56:2695-701).

[0008] There is a long felt need for a more effective and usable treatment or vaccination regimen to prevent, treat, or ameliorate infection of Coccidioides spp. and disease states associated with the infection.

SUMMARY OF THE INVENTION

[0009] Accordingly, it is an object herein to provide the methods for identifying and isolating polypeptides and nucleic acids encoding polypeptides of Coccidioides spp. that have an immunostimulatory activity. Such immunostimulatory nucleotides and polypeptides will be useful in the prevention, treatment, and diagnosis of infections due to Coccidioides spp.

[0010] In order to meet these needs, the present invention provides compositions and methods for the production of antigens comprising polypeptide fragments of the Ag2/PRA protein of C. posadasii, including but not limited to the polypeptide sequences of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9 and or SEQ ID NO: 11.

[0011] The present invention also provides polynucleotides encoding the polypeptides, produced by recombinant technology from the Ag2/PRA gene and gene fragments derived from Coccidioides posadasii, including but not limited to the polynucleotide sequences of SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 8 and or SEQ ID NO: 10.

[0012] In one embodiment, the polypeptide of the present invention encompasses the polypeptide sequence of amino acids 37 to 142 of SEQ ID NO: 5 and or the polypeptide sequence of amino acids 21 to 126 of SEQ ID NO: 9, and is referred to as Ag2/PRA1-106. In another embodiment, the present invention includes a polypeptide that lacks the corresponding N-terminal amino acids 1 to 26 of Ag2/PRA1-106 (exclusive of the amino acids of the fusion partner protein encoded by the vector), resulting in the polypeptide sequence of amino acids 35 to 114 of SEQ ID NO: 7, and is referred to as Ag2/PRA27-106.

[0013] The present invention also provides the use of the Ag2/PRA1-106 and Ag2/PRA27-106 polypeptides and polynucleotides encoding the polypeptides to elicit an immune response sufficient to provide an effective immunization against Coccidioides spp. infection. In one embodiment, the polypeptides provide protection against Coccidioides posadasii and or Coccidioides immitis infections in a mammal, such as a human. In another embodiment, the polypeptides provide protection against Coccidioides spp. infection in domestic animals, including but not limited to dogs, cats, horses, and cattle. In a further embodiment, the invention provides polynucleotides encoding Ag2/PRA1-106 and or Ag2/PRA27-106 polypeptides in a vector suitable for transforming mammalian cells as a method for immunizing mammals against Coccidioides spp. infection.

[0014] The present invention further provides compositions and the methods of use of the above-mentioned Ag2/PRA1-106 and Ag2/PRA27-106 polypeptides in combination with one or more other Coccidioides spp. antigens to elicit an immune response sufficient to provide an effective immunization against Coccidioides spp. infection. In one embodiment the polypeptides are provided as a composition containing a mixture of said antigens, for example, Ag2/PRA1-106 and Coccidioides-immitis specific antigen (referred to hereafter as Csa), (Pan, S. and Cole, G. T. 1995. Molecular and biochemical characterization of Coccidioides immitis-specific (CS) antigen. Infection and Immunity, 63:3994-4002). In another embodiment the composition is provided as a single fusion polypeptide comprised of Coccidioides spp. antigens, for example the Ag2/PRA1-106+Csa chimeric fusion polypeptide of SEQ ID NO: 11.

[0015] The invention also provides expression vectors that include regulatory sequences such as promoters or other transcriptional regulatory elements operably linked to the nucleotide sequences that control expression of the nucleotide sequences or degenerate variants of the sequences in host cells for the production of the polypeptides of SEQ ID NO: 5, or SEQ ID NO: 7, or SEQ ID NO: 9, or SEQ ID NO: 11.

[0016] The invention further provides host cells derived from yeast, bacterial, plant, animal or human sources containing the expression vectors comprising the sequences of SEQ ID NO: 3 or SEQ ID NO: 6 or SEQ ID NO: 8 or SEQ ID NO: 10.

[0017] The present invention also provides shorter polypeptide fragments included within amino acids 37 to 142 of SEQ ID NO: 5 and or amino acids 55 to 136 of SEQ ID NO: 5 and or amino acids 21 to 126 of SEQ ID NO: 9 and or amino acids 35 to 114 of SEQ ID NO: 7 and or amino acids 11 to 264 of SEQ ID NO: 11, respectively. In preferred embodiments, these shorter polypeptides may include polypeptides of not less than 25 amino acids in length, inclusive of 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, and 78-100 amino acids in length. Such polypeptide fragments, which are substantially the same amino acid length as the sequences containing the antigenic epitopes, provide similar ability to elicit an immune response, including such immune responses that provides protection against Coccidioides spp. infection.

[0018] In another embodiment, the present invention includes polypeptides which are substantially identical to the polypeptide sequences of SEQ ID NO: 5 and or SEQ ID NO: 8 and or SEQ ID NO: 7 and or SEQ ID NO: 11 and or contain at least one conservative amino acid substitution. Such polypeptides, which are substantially the same amino acid length, provide similar ability to elicit an immune response, including such immune responses that provides protection against Coccidioides spp. infection. Such polypeptides, having substantial identity to the polypeptides of Ag2/PRA1-106 and or Ag2/PRA27-106, include those polypeptides at least about 99% identical or equivalent, at least about 95% identical or equivalent, at least about 90% identical or equivalent, at least about 85% identical or equivalent, at least about 80% identical or equivalent, at least about 75% identical or equivalent, and at least about 70% identical to said polypeptides and which have the aforementioned activities, are encompassed in the invention.

[0019] The present invention further provides methods and compositions of isolated polypeptides identical or substantially identical to the polypeptide sequences of SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 7 and or SEQ ID NO: 11 useful in pharmaceutical compositions.

[0020] The present invention also provides vaccine formulations and methods of preparing the formulations containing the Ag2/PRA1-106 and or Ag2/PRA27-106 polypeptides and or polynucleotides encoding the polypeptides. The present invention further provides vaccine formulations containing adjuvants and pharmaceutical excipients and carriers.

[0021] The present invention provides the Ag2/PRA1-106 and or Ag2/PRA27-106 and or other Coccidioides spp. polypeptides as vaccine formulations and methods for eliciting an effective immune response in a mammal, including humans and domestic animals, for the prevention of Coccidioides spp. infections.

[0022] The present invention further provides kits containing the Ag2/PRA1-106 and or Ag2/PRA27-106 polypeptides and or other Coccidioides spp. antigens and or polynucleotides encoding the polypeptides, to facilitate the use of the polypeptides and or polynucleotides.

[0023] The present invention also provides a contruct comprising a promoter sequence for the Ag2/PRA1-106 and or Ag2/PRA27-106 genes encoding the polypeptides and or other Coccidioides spp. antigens, which can direct gene expression in a host cell.

[0024] The present invention also provides the use of the Ag2/PRA1-106 and or Ag2/PRA27-106 polypeptides and or polynucleotides encoding the Ag2/PRA1-106 and or Ag2/PRA27-106 polypeptides in diagnostic kits for the detection of infections due to Coccidioides spp. in mammals, such as humans and domestic animals.

[0025] The present invention also provides an antibody specific for an antigen of the Ag2/PRA1-106 and or Ag2/PRA27-106 polypeptides and methods for the creation of such antibodies. Such antibodies may be used in diagnostic kits for the detection of infections due to Coccidioides spp. The present invention provides kits containing antibodies in suitable compositions for the detection of infections due to Coccidioides spp. in mammals, such as humans and domestic animals.

[0026] The above and other aspects of the invention will become readily apparent to those of skill in the art from the following detailed description and figures, wherein only the preferred embodiments of the invention are shown and described, simply by way of illustration of the best mode of carrying out the invention. As is readily recognized, the invention is capable of modifications within the skill of the relevant art without departing from the spirit and scope of the invention.

BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

[0028] FIG. 1: Nucleotide (SEQ ID NO: 1) and derived amino acid sequences (SEQ ID NO: 2) of the cDNA C. posadasii Ag2/PRA gene aligned by the TRANSLATE program of the GCG Package. The translated nucleotide sequence results in a protein of 194 amino acid residues with a putative N-terminal signal sequence as the first 18 amino acids.

[0029] FIG. 2: The aligned nucleotide (SEQ ID NO: 3) and deduced amino acid sequences (SEQ ID NO: 4) of the recombinant Ag2/PRA1-106 gene expressed in an E. coli host. The translated nucleotide sequence results in a protein of 271 amino acid residues, of which 142 are retained after thrombin cleavage (SEQ ID NO: 5).

[0030] FIG. 3: The aligned nucleotide (SEQ ID NO: 6) and deduced amino acid sequences (SEQ ID NO: 7) of the recombinant Ag2/PRA27-106 gene. The translated nucleotide sequence results in a protein of 114 amino acid residues.

[0031] FIG. 4: The aligned nucleotide (SEQ ID NO: 8) and deduced amino acid sequences (SEQ ID NO: 9) of the recombinant Ag2/PRA1-106 gene expressed in a Saccharomyces cerevisiae host. The translated nucleotide sequence results in a protein of 126 residues.

[0032] FIG. 5: Annotated diagram of full-length Ag2/PRA and subunits evaluated in experimental mouse models of coccidioidomycosis.

BRIEF DESCRIPTION OF THE SEQUENCE LISTING

[0033] SEQ ID NO: 1 depicts the determined cDNA nucleotide sequence encoding full-length Ag2/PRA;

[0034] SEQ ID NO: 2 depicts the deduced amino acid sequence of the full-length Ag2/PRA polypeptide encoded by the nucleotide sequence of SEQ ID NO: 1;

[0035] SEQ ID NO: 3 depicts the determined nucleotide sequence of the pET32a recombinant construct encoding the Ag2/PRA1-106 fusion polypeptide;

[0036] SEQ ID NO: 4 depicts the deduced amino acid sequence of the recombinant Ag2/PRA1-106 fusion polypeptide, including 165 N-terminal amino acids derived from the pET32a vector, encoded by the nucleotide sequence of SEQ ID NO: 3 and produced in E. coli;

[0037] SEQ ID NO: 5 depicts the deduced amino acid sequence of the recombinant Ag2/PRA1-106 fusion polypeptide remaining after thrombin cleavage of the polypeptide of SEQ ID NO: 4, including 36 N-terminal amino acids (SEQ ID NO: 20) derived from the pET32a vector;

[0038] SEQ ID NO: 6 depicts the determined nucleotide sequence of the pET28a recombinant construct encoding the Ag2/PRA27-106 fusion polypeptide;

[0039] SEQ ID NO: 7 depicts the deduced amino acid sequence of the recombinant Ag2/PRA27-106 fusion polypeptide, including 34 N-terminal amino acids (SEQ ID NO: 21) derived from the pET28a vector, encoded by the nucleotide sequence of SEQ ID NO: 5 and produced in E. coli;

[0040] SEQ ID NO: 8 depicts the determined nucleotide sequence of the YEpFLAG-1 recombinant construct encoding the Ag2/PRA1-106 fusion polypeptide;

[0041] SEQ ID NO: 9 depicts the deduced amino acid sequence of the recombinant Ag2/PRA1-106 fusion polypeptide, including 20 N-terminal amino acids (SEQ ID NO: 22) derived from the YEpFLAG-1 vector, encoded by the nucleotide sequence of SEQ ID NO: 8 and produced in Saccharomyces cerevisiae;

[0042] SEQ ID NO: 10 depicts the determined nucleotide sequence of the YEpFLAG-1 recombinant construct encoding the Ag2/PRA1-106+Csa chimeric fusion polypeptide;

[0043] SEQ ID NO: 11 depicts the deduced amino acid sequence of the recombinant Ag2/PRA1-106+Csa chimeric fusion polypeptide, including 10 N-terminal amino acids and two amino acids separating Ag2/PRA1-106 and Csa derived from the vector, encoded by the nucleotide sequence of SEQ ID NO: 10 and produced in Saccharomyces cerevisiae;

[0044] SEQ ID NO: 12 depicts the nucleotide sequence of the sense P1 primer used for cloning the Ag2/PRA sequence into the pET32a and pVR1020 vectors and subcloning the Ag2/PRA1-106 sequence into the pET32a, pVR1020 and YEpFLAG-1 vectors at the BamHl restriction site;

[0045] SEQ ID NO: 13 depicts the nucleotide sequence of the antisense P2 primer used for cloning the Ag2/PRA sequence into the pET32a vector at the EcoRI restriction site;

[0046] SEQ ID NO: 14 depicts the nucleotide sequence of the antisense P10 primer used for cloning the Ag2/PRA sequence into the pVR1020 vector at the BglII restriction site;

[0047] SEQ ID NO: 15 depicts the nucleotide sequence of the antisense P4 primer used to subclone the Ag2/PRA1-106 sequence into the pET32a vector and the Ag2/PRA27-106 sequence into the pET28a vector at the EcoRI restriction sites;

[0048] SEQ ID NO: 16 depicts the nucleotide sequence of the sense P3 primer used to subclone the Ag2/PRA27-106 sequence into the pET28a vector at the BamHI restriction site;

[0049] SEQ ID NO: 17 depicts the nucleotide sequence of the antisense P8 primer used to subclone the Ag2/PRA1-106 sequence into the pVR1020 vector at the BglII restriction site;

[0050] SEQ ID NO: 18 depicts the nucleotide sequence of the sense P5 primer used to subclone the Ag2/PRA27-106 sequence into the pVR1020 vector at the BamHI restriction site;

[0051] SEQ ID NO: 19 depicts the nucleotide sequence of the antisense P11 primer used to subclone the Ag2/PRA1-106 sequence into the YEpFLAG-1 vector at the SalI restriction site;

[0052] SEQ ID NO: 20 depicts the deduced amino acid sequence of the fusion partner peptide derived from the pET-32a vector at the N-terminal of the recombinant Ag2/PRA1-106 produced in E. coli;

[0053] SEQ ID NO: 21 depicts the deduced amino acid sequence of the fusion partner peptide derived from the pET-28a vector at the N-terminal of the recombinant Ag2/PRA27-106 produced in E. coli;

[0054] SEQ ID NO: 22 depicts the deduced amino acid sequence of the fusion partner peptide derived from the YEpFLAG-1 vector at the N-terminal of the recombinant Ag2/PRA1-106 produced in Saccharomyces cerevisiae;

[0055] SEQ ID NO: 23 depicts the determined cDNA sequence encoding the Csa polypeptide;

[0056] SEQ ID NO: 24 depicts the nucleotide sequence of the synthetic CpG adjuvant used in animal experiments.

[0057] SEQ ID NO: 25 depicts the nucleotide sequence of the sense P14 primer used for cloning the Ag2/PRA1-106 sequence component of the Ag2/PRA1-106+Csa chimeric construct into the YEpFLAG-1 vector at the EcoRI restriction site;

[0058] SEQ ID NO: 26 depicts the nucleotide sequence of the sense P15 primer used for cloning the Ag2/PRA1-106 sequence component of the Ag2/PRA1-106+Csa chimeric construct into the YEpFLAG-1 vector at the EcoRI restriction site;

[0059] SEQ ID NO: 27 depicts the nucleotide sequence of the sense P16 primer used for cloning the CSA sequence component of the Ag2/PRA1-106+Csa chimeric construct into the YEpFLAG-1 vector at the BamHI restriction site; and

[0060] SEQ ID NO: 28 depicts the nucleotide sequence of the sense P17 primer used for cloning the CSA sequence component of the Ag2/PRA1-106+Csa chimeric construct into the YEpFLAG-1 vector at the SalI restriction site.

[0061] SEQ ID NO: 29 depicts the nucleotide sequence of the sense P5 primer used to subclone the Ag2/PRA90-151 and Ag2/PRA90-194 sequences into the pET28a vector at the BamHI restriction site;

[0062] SEQ ID NO: 30 depicts the nucleotide sequence of the antisense P6 primer used to subclone the Ag2/PRA90-151 sequence into the pET28a vector at the EcoRI restriction site and the sense P6 primer used to subclone the Ag2/PRA90-194 sequence into the pVR1020 vector at the EcoRI restriction site;

[0063] SEQ ID NO: 31 depicts the nucleotide sequence of the antisense P7 primer used to subclone the Ag2/PRA90-194 sequence into the pET28a vector at the EcoRI restriction site;

[0064] SEQ ID NO: 32 depicts the nucleotide sequence of the antisense P9 primer used to subclone the Ag2/PRA90-151 sequence into the pET28a vector at the BglII restriction site;

[0065] SEQ ID NO: 33 depicts the nucleotide sequence of the antisense P10 primer used to subclone the Ag2/PRA1-194 and Ag2/PRA90-194 sequences into the pVR1020 vector at the BglII restriction site;

[0066] SEQ ID NO: 34 depicts the nucleotide sequence of the sense P12 primer used to subclone the Ag2/PRA19-100 sequence into the pET32a vector at the BamHI restriction site; and

[0067] SEQ ID NO: 35 depicts the nucleotide sequence of the antisense P13 primer used to subclone the Ag2/PRA19-100 sequence into the pET32a vector at the EcoRI restriction site.

DETAILED DESCRIPTION OF THE INVENTION

[0068] Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described herein. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In addition, the materials, methods, and examples are illustrative only and are not intended to be limiting.

[0069] Reference is made to standard textbooks of molecular biology that contain definitions and methods and means for carrying out basic techniques, encompassed by the present invention. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, New York (2001), Current Protocols in Molecular Biology, Ausubel et al (eds.), John Wiley & Sons, New York (2001) and the various references cited therein.

[0070] I. The Polypeptide Sequences of the Invention.

[0071] The invention focuses on the use of Ag2/PRA polypeptide fragments and the nucleotide sequences that encode them as immunogenic antigens for a preventative or therapeutic vaccine for coccidioidomycosis, or for detection of immune responses in individuals infected by Coccidioides spp.

[0072] Native Ag2/PRA is a 194 amino acid, proline-rich protein which is a component of a glycopeptide identified originally as “antigen 2” by a two-dimensional electrophoresis classification scheme (Huppert et al. 1978. Infection and Immunity 20:541-551). It contains an N-terminal signal sequence of 18 amino acids. The amino acid sequence of native Ag2/PRA is shown in SEQ ID NO: 2. The genomic sequence was cloned and subsequently modified to produce select polypeptide fragments and shorter DNA vaccine constructs. The reasons for reducing the full-length antigen to fragments are multiple; 1) a positive correlation between development of DTH (delayed-type hypersensitivity) (a Th1 immune response) to coccidioidal antigens and the ability to resist disseminated coccidioidomycosis has been shown. This response is generally regarded as a MHC II type response (Louie et al. 1999. Influence of host genetics on the severity of coccidioidomycosis. Emerging Infectious Diseases 5:672-680) and that peptides that bind to MHC II receptors are generally 13-25 residues in length; 2) determination of epitopes within a larger polypeptide or multiple peptides that enhance or suppress an immune response allow for the creation of fusion polypeptides containing select epitopes that can be used as vaccines with increased potency (Sette A, et al. 2002. Optimizing vaccine design for cellular processing, MHC binding and TCR recognition. Tissue Antigens 59:443-451) and 3) reducing the size of the polypeptide can lead to desirable advantages in the production, purification and safety of a vaccine. Consequently, the full-length Ag2/PRA polypeptide sequence was evaluated and recombinant methods were used to create nucleotide sequences and polypeptides that encoded or contained regions with predicted antigenic motifs and were evaluated for their ability to elicit a protective immune response. The rAg2/PRA1-106 of the present invention is a polypeptide of 106 amino acids in length, retaining the N-terminal signal sequence of 18 amino acids found in native Ag2/PRA. In the case of the rAg2/PRA1-106 of the present invention produced in E. coli, it was initially expressed as a fusion polypeptide in the E. coli host transformed with the Ag2/PRA1-106-pET32a plasmid construct, resulting in a recombinant fusion polypeptide with 271 amino acids (SEQ ID NO: 4). The aforementioned fusion polypeptide was subsequently treated with thrombin to release a polypeptide of 142 amino acids (SEQ ID NO: 5), of which amino acids 37 to 142 of the sequence represent rAg2/PRA1-106 of the present invention. In the case of the rAg2/PRA1-106 of the present invention produced in Saccharomyces cerevisiae, it was expressed as a fusion polypeptide in the yeast host transformed with the Ag2/PRA1-106-YEpFLAG-1 plasmid construct, resulting in a recombinant fusion polypeptide with 126 amino acids (SEQ ID NO: 9), of which amino acids 21 to 126 represent rAg2/PRA1-106 of the present invention.

[0073] The rAg2/PRA27-106 of the present invention is expressed as a fusion polypeptide of 114 amino acids in length, a construct designed to eliminate the N-terminal signal sequence of the native polypeptide. The amino acid sequence of the rAg2/PRA27-106 fusion polypeptide produced in the E. coli host transformed with the Ag2/PRA27-106-pET28a construct is shown in SEQ ID NO: 7, of which amino acids 35 to 114 represent rAg2/PRA27-106 of the present invention.

[0074] Additional polypeptides are encompassed in the invention, consisting essentially of the sequences of the Ag2/PRA1-106 and or Ag2/PRA27-106 polypeptides, including polypeptides at least about 99% identical or equivalent, at least about 95% identical or equivalent, at least about 90% identical or equivalent, at least about 85% identical or equivalent, at least about 80% identical or equivalent, at least about 75% identical or equivalent, and at least about 70% identical to the sequences of the respective polypeptides.

[0075] As used herein, the terms “protein” or “polypeptide” are used in the broadest sense to mean a sequence of amino acids that can be encoded by a cellular gene or by a recombinant nucleic acid sequence or can be chemically synthesized. In some cases, the term “polypeptide” is used in referring to a portion of an amino acid sequence (peptides) of a full-length protein. An active fragment of a Ag2/PRA is an example of such a polypeptide. A protein can be a complete, full-length gene product, which can be a core protein having no amino acid modifications, or can be a post-translationally modified form of a protein such as a phosphoprotein, glycoprotein, proteoglycan, lipoprotein or nucleoprotein.

[0076] “Consisting essentially of”, in relation to amino acid sequence of a polypeptide, protein or peptide, is a term used hereinafter for the purposes of the specification and claims to refer to a conservative substitution or modification of one or more amino acids in that sequence such that the tertiary configuration of the polypeptide, protein or peptide is substantially unchanged.

[0077] “Conservative substitutions” is defined by substitutions of amino acids having substantially the same charge, size, hydrophilicity, and or aromaticity as the amino acid replaced. Such substitutions, known to those of ordinary skill in the art, include glycine-alanine-valine; isoleucine-leucine; tryptophan-tyrosine; aspartic acid-glutamic acid; arginine-lysine; asparagine-glutamine; and serine-threonine.

[0078] “Modification”, in relation to amino acid sequence of a polypeptide, protein or peptide, is defined functionally as a deletion of one or more amino acids which does not impart a change in the conformation, and hence the biological activity, of the polypeptide, protein or peptide sequence.

[0079] The common amino acids are generally known in the art. Additional amino acids that may be included and or substituted in the peptide of the present invention include: L-norleucine; aminobutyric acid; L-homophenylalanine; L-norvaline; D-alanine; D-cysteine; D-aspartic acid; D-glutamic acid; D-phenylalanine; D-histidine; D-isoleucine; D-lysine; D-leucine; D-methionine; D-asparagine; D-proline; D-glutamine; D-arginine; D-serine; D-threonine; D-valine; D-tryptophan; D-tyrosine; D-omithine; aminoisobutyric acid; L-ethylglycine; L-t-butylglycine; penicillamine; I-naphthylalanine; cyclohexylalanine; cyclopentylalanine; aminocyclopropane carboxylate; aminonorbornylcarboxylate; L-α-methylalanine; L-α-methylcysteine; L-α-methylaspartic acid; L-α-methylglutamic acid; L-α-methylphenylalanine; L α-methylhistidine; L-α-methylisoleucine; L-α-methyllysine; L-α-methylleucine; L-α-methylmethionine; L-α-methylasparagine; L-α-methylproline; L-α-methylglutamine; L-α-methylarginine; L-α-methylserine; L-α-methylthreonine; L-α-methylvaline; L-α-methyltryptophan; L-α-methyltyrosine; L-α-methylomithine; L-α-methylnorleucine; amino-α-methylbutyric acid;. L-α-methylnorvaiine; L-α-methylhomophenylalanine; L-α-methylethylglycine; methyl-γ-aminobutyric acid;. methylaminoisobutyric acid; L-α-methyl-t-butylglycine; methylpenicillamine; methyl-α-naphthylalanine; methylcyclohexylalanine; methylcyclopentylalanine; D-α-methylalanine; D-α-methylomithine; D-α.-methylcysteine; D-α-methylaspartic acid; D-α-methylglutamic acid; D-α-methylphenylalanine; D-α-methylhistidine; D-α-methylisoleucine; D-α-methyllysine; D-α-methylleucine; D-α-methylmethionine; D-α-methylasparagine; D-α-methylproline; D-α-methylglutamine; D-α-methylarginine; D-α-methylserine; D-α-methylthreonine; D-α-methylvaline; D-α-methyltryptophan; D-α-methyltyrosine; L-N-methylalanine; L-N-methylcysteine; L-N-methylaspartic acid; L-N-methylglutamic acid; L-N-methylphenylalanine; L-N-methylhistidine; L-N-methylisoleucine; L-N-methyllysine; L-N-methylleucine; L-N-methylmethionine; L-N-methylasparagine; N-methylcyclohexylalanine; L-N-methylglutamine; L-N-methylarginine; L-N-methylserine; L-N-methylthreonine; L-N-methylvaline; L-N-methyltryptophan; L-N-methyltyrosine; L-N-methylomithine; L-N-methylnorleucine; N-amino-α-methylbutyric acid; L-N-methylnorvaline; L-N-methylhomophenylalanine; L-N-methylethylglycine; N-methyl-γaminobutyric acid; N-methylcyclopentylalanine; L-N-methyl-t-butylglycine; N-methylpenicillamine; N-methyl-α-naphthylalanine; N-methylaminoisobutyric acid; N-(2-aminoethyl)glycine; D-N-methylalanine; D-N-methylomithine; D-N-methylcysteine; D-N-methylaspartic acid; D-N-methylglutamic acid; D-N-methylphenylalanine; D-N-methylhistidine; D-N-methylisoleucine; D-N-methyllysine; D-N-methylleucine; D-N-methylmethionine; D-N-methylasparagine; D-N-methylproline; D-N-methylglutamine; D-N-methylarginine; D-N-methylserine; D-N-methylthreonine; D-N-methylvaline; D-N-methyltryptophan; D-N-methyltyrosine; N-methylglycine; N-(carboxymethyl)glycine; N-(2-carboxyethyl)glycine; N-benzylglycine; N-(imidazolylethyl)glycine; N-(1-methylpropyl)glycine; N-(4-aminobutyl)glycine; N-(2-methylpropyl)glycine; N-(2-methylthioethyl)glycine; N-(hydroxyethyl)glycine; N-(carbamylmethyl)glycine; N-(2-carbamylethyl)glycine; N-(1-methylethyl)glycine; N-(3-guanidinopropyl)glycine; N-(3-indolylethyl)glycine; N-(p-hydroxyphenethyl)glycine; N-(1-hydroxyethyl)glycine; N-(thiomethyl)glycine; N-(3-aminopropyl)glycine; N-cyclopropylglycine; N-cyclobutyglycine; N-cyclohexylglycine; N-cycloheptylglycine; N-cyclooctylglycine; N-cyclodecylglycine; N-cycloundecylglycine; N-cyclododecylglycine; N-(2,2-diphenylethyl)glycine; N-(3,3-diphenylpropyl)glycine; N-(N-(2,2-diphenylethyl)carbamylmethyl)glycine; N-(N-(3,3-diphenylpropyl)carbamylmethyl)glycine; and 1-carboxy-1-(2,2-diphenylethylamino)cyclopropane.

[0080] The polypeptides of the present invention can be produced by known chemical synthesis methods; for example, a liquid phase synthesis method, a solid phase synthesis method, and others (Izumiya, N., Kato, T., Aoyagi, H., Waki, M., Basis and Experiments of Peptide Synthesis, 1985, Maruzen Co., Ltd.).

[0081] The polypeptides of the present invention may contain one or more protected amino acid residues. The protected amino acid is an amino acid whose functional group or groups is/are protected with a protecting group or groups by a known method or by the use of various protected amino acids that are commercially available.

[0082] Because native Ag2/PRA obtained from Coccidioides spp. is glycosylated, the polypeptides of the present invention may be provided in a glycosylated as well as an unglycosylated form. Preparation of glycosylated protein or peptide is known in the art and typically involves expression of the recombinant DNA encoding the protein or peptide in a eukaryotic cell (e.g., yeast or mammalian). Likewise, it is generally known in the art to express the recombinant DNA encoding the protein or peptide in a prokaryotic (e.g., bacterial) cell to obtain a protein or peptide, which is not glycosylated. These and other methods of altering carbohydrate moieties on glycoproteins is found, inter alia, in Essentials of Glycobiology (1999), Edited By Ajit Varki, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., the contents of which are incorporated herein by reference.

[0083] II. The DNA Sequences of the Invention.

[0084] Alternatively, the polypeptides of the present invention can be produced by producing a polynucleotide (DNA or RNA) which encodes the amino acid sequence of a polypeptide of the present invention and producing said polypeptide by a genetic engineering technique using the polynucleotide. Polynucleotide coding sequences for amino acid residues are known in the art and are disclosed for example in Molecular Cloning: A Laboratory Manual, Third Edition, Sambrook, Fritsch, and Maniatis, Cold Spring Harbor Laboratory Press, 2001.

[0085] Analysis of genomic DNA encoding Ag2/PRA reveals an open reading frame for 194 amino acids, interrupted by two introns (GenBank Accession AF013256). The cDNA sequence encoding full-length Ag2/PRA is shown in SEQ ID NO: 1 (GenBank Accession U39835). The nucleotide sequence encoding the fusion polypeptide rAg2/PRA1-106 of the present invention expressed in the E. coli host is comprised of 816 nucleotides, including a stop codon (SEQ ID NO: 3), in a pET32a plasmid construct (Ag2/PRA1-106-pET32a). Expression of this construct results in a recombinant fusion polypeptide with 271 amino acids (SEQ ID NO: 4), including 165 N-terminal fusion partner amino acids derived from the vector.

[0086] The nucleotide sequence encoding the fusion polypeptide rAg2/PRA1-106 of the present invention expressed in the Saccharomyces cerevisiae host is comprised of 381 nucleotides, including a stop codon (SEQ ID NO: 8), in a YEpFLAG-1 plasmid construct (Ag2/PRA1-106-YEpFLAG-1). Expression of this construct results in a recombinant fusion polypeptide with 126 amino acids (SEQ ID NO: 9), including 20 N-terminal fusion partner amino acids derived from the YEpFLAG-1 vector. The nucleotide sequence encoding the fusion polypeptide rAg2/PRA27-106 of the present invention in the E. coli host is comprised of 345 nucleotides, including a stop codon (SEQ ID NO: 6), in a pET28a plasmid construct (Ag2/PRA27-106-pET28a). Expression of this construct results in a recombinant polypeptide with 114 amino acids (SEQ ID NO: 7), which includes 34 N-terminal fusion partner amino acids derived from the pET28a vector.

[0087] Within the context of the present invention “polynucleotide” in general relates to polyribonucleotides and polydeoxyribonucleotides, it being possible for these to be non-modified RNA or DNA or modified RNA or DNA. Polynucleotides which encode the peptides of the present invention mean the sequences exemplified in this application as well as those which have substantial identity to those sequences and which encode the peptides. Preferably, such polynucleotides are those which hybridize under stringent conditions as defined herein and are at least 70%, preferably at least 80% and more preferably at least 90% to 95% identical to those sequences.

[0088] “Consisting essentially of”, in relation to a nucleic acid sequence, is a term used hereinafter for the purposes of the specification and claims to refer to sequences of the present invention and sequences with substitution of nucleotides as related to third base degeneracy. As appreciated by those skilled in the art, because of third base degeneracy, almost every amino acid can be represented by more than one triplet codon in a coding nucleotide sequence. Further, minor base pair changes may result in variation (conservative substitution) in the amino acid sequence encoded, which are not expected to substantially alter the biological activity of the gene product. Thus, a nucleic acid sequencing encoding a protein or peptide as disclosed herein, may be modified slightly in sequence (e.g., substitution of a nucleotide in a triplet codon), and yet still encode its respective gene product of the same amino acid sequence.

[0089] The terms “stringent conditions” or “stringent hybridization conditions” include reference to conditions under which a polynucleotide will hybridize to its target sequence, to a detectably greater degree than other sequences (e.g., at least 2-fold over background). In particular, a DNA or polynucleotide molecule which hybridizes under stringent conditions is preferably at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identical to the DNA that encodes the amino acid sequences described herein. In a preferred embodiment these polynucleotides that hybridize under stringent conditions also encode a protein or peptide which upon administration to a subject provides an immunostimulation sufficient to provide some level of immune protection against Coccidioides spp. infection as described herein.

[0090] Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short polynucleotides (e.g., 10 to 50 nucleotides) and at least about 60° C. for long polynucleotides (e.g., greater than 50 nucleotides)—for example, “stringent conditions” can include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.1×SSC at 60 to 65° C.

[0091] Homology, sequence similarity or sequence identity of nucleotide or amino acid sequences may be determined conventionally by using known software or computer programs such as the BestFit or Gap pairwise comparison programs (GCG Wisconsin Package, Genetics Computer Group, 575 Science Drive, Madison, Wis. 53711). BestFit uses the local homology algorithm of Smith and Waterman (Advances in Applied Mathematics. 1981. 2: 482-489), to find the best segment of identity or similarity between two sequences. Gap performs global alignments: all of one sequence with all of another similar sequence using the method of Needleman and Wunsch, (Journal of Molecular Biology. 1970. 48:443-453). When using a sequence alignment program such as BestFit to determine the degree of sequence homology, similarity or identity, the default setting may be used, or an appropriate scoring matrix may be selected to optimize identity, similarity or homology scores. Similarly, when using a program such as BestFit to determine sequence identity, similarity or homology between two different amino acid sequences, the default settings may be used, or an appropriate scoring matrix, such as blosum45 or blosum80, may be selected to optimize identity, similarity or homology scores.

[0092] Naturally, the present invention also encompasses DNA segments that consist essentially of or are complementary, or essentially complementary, to the sequences set forth in SEQ ID NO: 3 or SEQ ID NO: 6 or SEQ ID NO: 8 or SEQ ID NO: 10. Nucleic acid sequences that are “complementary” are those that are capable of base-pairing according to the standard Watson-Crick complementarity rules. As used herein, the term “complementary sequences” means nucleic acid sequences that are substantially complementary, as may be assessed by the same nucleotide comparison set forth above, or as defined as being capable of hybridizing to the nucleic acid segments SEQ ID NO: 3 or SEQ ID NO: 6 or SEQ ID NO: 8 or SEQ ID NO: 10 under stringent conditions such as those described herein.

[0093] The nucleic acid segments of the present invention, regardless of the length of the coding sequence itself, may be combined with other nucleic acid and DNA sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, other coding segments, and the like, such that their overall length may vary considerably. It is therefore contemplated that a nucleic acid segment or fragment of almost any length may be employed, with the total length preferably being limited by the ease of preparation and use in the intended recombinant protocol.

[0094] For example, nucleic acid segments or fragments may be prepared that include a short contiguous stretch identical to or complementary to the antigen encoding regions of SEQ ID NO: 3 or SEQ ID NO: 6 or SEQ ID NO: 8 or SEQ ID NO: 10, such as about a 15, 18 or 21 nucleotide stretch, up to about 20,000, about 10,000, about 5,000 or about 3,000 base pairs in length. Nucleic acid and DNA segments with total lengths of about 1,000, about 500, about 200, about 100 and about 50 base pairs in length (including all intermediate lengths) are also contemplated to be useful.

[0095] It will be readily understood that “intermediate lengths”, in these contexts, means any length between the quoted ranges, such as 21, 22, 23, 24, 25, etc.; 30, 31, 32, etc.; 50, 51, 52, 53, etc.; 100, 101, 102, 103, etc.; 150, 151, 152, 153, etc.; including all integers through the 200-500; 500-1,000; 1,000-2,000; 2,000-3,000; 3,000-5,000; 5,000-10,000 ranges, up to and including sequences of about 12,001, 12,002, 13,001, 13,002, 15,001, 20,001 and the like.

[0096] It will also be understood that this invention is not limited to the particular nucleic acid and amino acid sequences of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 or SEQ ID NO: 11, respectively. Recombinant vectors and isolated DNA segments may therefore variously include the coding region from SEQ ID NO: 3 or SEQ ID NO: 6 or SEQ ID NO: 8 or SEQ ID NO: 10 coding regions bearing selected alterations or modifications in the basic coding region, or they may encode larger polypeptides that nevertheless include such coding regions or may encode biologically functional equivalent proteins or peptides that have variant amino acids sequences.

[0097] The nucleic acid and DNA segments of the present invention further include sequences that encode biologically functional equivalent Coccidioides spp. peptides that arise as a consequence of codon redundancy and functional equivalency that are known to occur naturally within nucleic acid sequences and the proteins thus encoded. Equally, functionally equivalent proteins or peptides may be created via the application of recombinant DNA technology in which changes in the protein structure may be engineered, based on considerations of the properties of the amino acids being exchanged. Changes designed by human intervention may be introduced through the application of site-directed mutagenesis techniques, e.g., to introduce improvements to the antigenicity of the protein.

[0098] III. Expression Vectors, Hosts, and Expression of Polypeptides of the Invention in vitro and in vivo.

[0099] The term “expression vector” refers to a polynucleotide that includes coding sequences that encode the polypeptide of the invention and provides the sequences necessary for its expression in the selected host cell. Expression vectors will generally include a transcriptional promoter and terminator, or will provide for incorporation adjacent to an endogenous promoter. Promoters that are commonly used in recombinant DNA construction include the β-lactamase (penicillinase), β-galactosidase and tryptophan (trp) promoter systems. While these are the most commonly used, other microbial promoters have been discovered and utilized, and details concerning their nucleotide sequences have been published, enabling those of skill in the art to ligate them functionally with plasmid vectors.

[0100] The recombinant host cells of the present invention may be maintained in vitro, e.g., for recombinant protein, polypeptide or peptide production. Equally, the recombinant host cells could be host cells in vivo, such as results from immunization of an animal or human with a nucleic acid segment of the invention. Accordingly, the recombinant host cells may be prokaryotic or eukaryotic host cells, such as E. coli, Saccharomyces cerevisiae or other yeast, mammalian or human or plant host cells. It will be further appreciated by the skilled practitioner that other prokaryotic and eukaryotic cells and cell lines may be appropriate for a variety of purposes; e.g., to provide higher expression, desirable glycosylation patterns, or other features. Expression vectors will usually be plasmids, further comprising an origin of replication and one or more selectable markers. The pET32a-Ag2/PRA1-106 construct of the present invention is an example of such expression vectors. A YEpFLAG-1-Ag2/PRA1-106 construct is another example. However, expression vectors may alternatively be viral recombinants designed to infect the host, or integrating vectors designed to integrate at a preferred site within the host's genome. Examples of other expression vectors are disclosed in Molecular Cloning: A Laboratory Manual, Third Edition, Sambrook, Fritsch, and Maniatis, Cold Spring Harbor Laboratory Press, 2001.

[0101] Such polynucleotides encoding the polypeptides of the invention and expression vectors carrying the vectors can be used to produce the polypeptides in vitro or in vivo. The polypeptides so produced can be isolated according to the procedures described herein and commonly known in the art and then used in a therapeutic or immunization protocol.

[0102] One may also prepare fusion proteins and peptides, e.g., where the Coccidioides spp. peptide coding region is included within the same expression unit with other proteins or peptides having desired functions, such as for purification or immunodetection purposes (e.g., proteins that may be isolated by affinity chromatography and enzyme label coding regions, respectively), or proteins and peptides encoding additional antigens capable of eliciting a second or enhanced immunostimulatory response in a subject (e.g., such as the Coccidioides spp. antigens Csa [SEQ ID NO: 23], Gel1, Ure, or non-Coccidioides protein antigens or toxoids, such as tetanus toxoid, diphtheria toxoid, cholera toxoid, ovalbumin, or keyhole limpet haemocyanin).

[0103] In another embodiment, the present invention provides polynucleotide based vaccines or immune-stimulatory formulations, whereby the polynucleotide(s) encoding the polypeptides are administered directly to the subject patient in need thereof, provided the polynucleotide has the appropriate transcriptional control regions to direct the expression of the coding sequence contained in the polynucleotide or expression vector.

[0104] Therefore, the present invention also provides DNA based vaccines or immunogenic compositions to provide one or more of the polypeptides described herein. DNA vaccines have been developed for a number of diseases, whereby a DNA vaccine contains a DNA encoding an antigen cloned in a plasmid vector. It will be apparent to one skilled in the art that the immunostimulatory activity of the polypeptides encoded by the DNA sequences disclosed herein lies not in the precise nucleotide sequence of the DNA sequences, but rather in the epitopes inherent in the amino acid sequences encoded by the DNA sequences. It will therefore also be apparent that it is possible to recreate the immunostimulatory activity of one of these polypeptides by recreating the epitope, without necessarily recreating the exact DNA sequence. Such sequences may differ by reason of the redundancy of the genetic code from the sequences disclosed herein. Accordingly, the degeneracy of the genetic code further widens the scope of the present invention as it enables major variations in the nucleotide sequence of a DNA molecule while maintaining the amino acid sequence of the encoded protein or a protein that consists essentially of the same sequence. Such degeneracy is described in U.S. Pat. No. 6,228,371, the contents of which are incorporated herein by reference.

[0105] The expression of the antigen or polypeptide may be improved by providing a strong promoter such as, for example, Rous Sarcoma Virus LTR, the cytomegalovirus immediate early promoter, and the SV40 T antigen promoter. Success with DNA vaccines has been demonstrated using a variety of antigens for a number of diseases (U.S. Pat. Nos. 6,384,018, 6,284,533, 6,165,993, the contents of which are incorporated herein by reference). The DNA vaccine or immune stimulating composition may further include an acceptable carrier or liposome as described in U.S. Pat. No. 5,703,055, which is incorporated herein by reference; and can be made in accordance with known methods as described in, for example, U.S. Pat. Nos. 5,589,466; 5,580,859; 5,561,064; and 6,339,068, the contents of which are incorporated herein by reference.

[0106] The delivery of the DNA vaccine or immunostimulatory composition can be accomplished using a variety of procedures commonly employed in the art. For non-viral DNA transfer in cultured cells, examples of such methods include-calcium phosphate mediated, DEAE-dextran, electroporation, direct microinjection, liposome mediated delivery, cell sonication, and receptor mediated gene targeting which utilize a cell-receptor-specific ligand and an DNA binding agent, which mediate the uptake of a gene into a specific cell type based on the interaction of the ligand and the receptor. The recombinant DNA encoding the polypeptides of the present invention can also be provided to the cells by direct injection of the naked DNA or plasmid DNA or coupled to particle bombardment with known methods as described in, for example, U.S. Pat. No. 5,865,796, incorporated herein by reference.

[0107] In another embodied method of delivering the DNA vaccine or immunostimulatory composition to the cell, viral-vector mediated delivery can be used. Examples of viral vectors for such delivery include adeno-associated virus (AAV) (U.S. Pat. No. 5,843,742 incorporated herein by reference), adenovirus (U.S. Pat. Nos. 6,410,010 and 6,403,370, incorporated herein by reference), vaccinia virus (U.S. Pat. Nos. 6,287,570, and 6,214,353 incorporated herein by reference), herpesvirus, canarypox virus (U.S. Pat. No. 6,183,750 incorporated herein by reference), other Poxviruses, Retrovirus, and other RNA or DNA viral expression vectors known in the art.

[0108] The vectors used to deliver the polypeptides of the present invention may be maintained as an episome or stably integrated into the chromosome of the cell.

[0109] IV. How the Polypeptide may be Isolated.

[0110] The peptides and polypeptides of the present invention, when produced, can be purified by isolation and purification methods for proteins generally known in the field of protein chemistry. Within the context of the present invention, “isolated” means separated out of its natural environment. An “isolated polypeptide” is, in this context, a substantially pure polypeptide.

[0111] The term “substantially pure polypeptide” means a polypeptide that has been separated from at least some of those components which naturally accompany it, such as other contaminating polypeptides, polynucleotides, and or other biological materials often found in cell extracts. Typically, the protein is substantially pure when it is at least 60%, by weight, free from the proteins and other naturally-occurring organic molecules with which it is naturally associated in vivo. Preferably, the purity of the preparation is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight. A substantially pure Ag2/PRA polypeptide or polypeptide fragment may be obtained, for example, by extraction from a natural source, or by expression of a recombinant nucleic acid encoding an immunoreactive Ag2/PRA1-106 or Ag2/PRA27-106 polypeptide, such as the nucleic acid molecule shown as SEQ ID NO: 3 or SEQ ID NO: 6, respectively, using methods described herein. In addition, an amino acid sequence consisting of at least an immunogenic portion of the amino acid sequence of SEQ ID NO: 5 or SEQ ID NO: 7 or SEQ ID NO: 9 or SEQ ID NO: 11 can be chemically synthesized in a substantially pure form.

[0112] Methods of purification include, for example, extraction, recrystalization, ammonium sulfate precipitation, sodium sulfate, centrifugation, dialysis, ultrafiltration, adsorption chromatography, ion exchange chromatography, hydrophobic chromatography, normal phase chromatography, reversed-phase chromatography, gel filtration method, gel permeation chromatography, affinity chromatography, electrophoresis, countercurrent distribution, combinations of these, and other know protein or peptide purification methods are well known to those of skill in the art and can be used herein.

[0113] Purity can be measured by any appropriate method, e.g., HPLC analysis, immunoaffinity chromatography using an antibody specific for the Ag2/PRA polypeptide fragment, polyacrylamide gel electrophoresis, and the like.

[0114] A Coccidioides spp. polypeptide that is “isolated to homogeneity,” as applied to the present invention, means that the Coccidioides spp. polypeptide has a level of purity where the Coccidioides spp. polypeptide is substantially free from other proteins, peptides and biological components. For example, an isolated Coccidioides spp. polypeptide will often be sufficiently free of other peptide and protein components so that sequencing may be performed successfully or that pharmaceutically acceptable formulations can be created. However, this does not exclude the re-mixing of the peptides of the invention, once isolated, with other vaccine components.

[0115] V. Preparation and Formulation of Vaccines.

[0116] The polypeptides and formulations employing the polypeptides may also be in the form of a peptide salt thereof. In view of the utility of the polypeptides of the present invention, preferred salts include those salts that are pharmaceutically acceptable for administration into a subject patient.

[0117] The polypeptides of the present invention may form a salt by addition of an acid. Examples of the acid include inorganic acids (such as hydrochloric acid, hydrobromic acid, phosphoric acid, nitric acid, and sulfuric acid) or organic carboxylic acids (such as acetic acid, propionic acid, maleic acid, succinic acid, malic acid, citric acid, tartaric acid, and salicylic acid), acidic sugars such as glucuronic acid, galacturonic acid, gluconic acid, ascorbic acid, etc., acidic polysaccharides such as hyaluronic acid, chondroitin sulfates, alginic acid, or organic sulfonic acids (such as methanesulfonic acid, and p-toluenesulfonic acid), etc.

[0118] The polypeptides of the present invention may also form a salt with a basic substance. Examples of these basic salts include, for example, salts with inorganic bases such as alkali metal salts (sodium salt, lithium salt, potassium salt, etc.), alkaline earth metal salts, ammonium salts, and the like or salts with organic bases, such as diethanolamine salts, cyclohexylamine salts, and the like.

[0119] In one embodiment of the present invention, the various polypeptides of the present invention may be admixed in various combinations and or admixed with other known proteins or peptides, which are known or believed to facilitate an immunological response, thereby providing protection against Coccidioides spp. infection. In an alternative embodiment, the polypeptides of the present invention may be administered separately, i.e., at different time points, from each or from other proteins or peptides, which are known or believed to facilitate an immunological response, thereby providing protection against Coccidioides spp. infection. For example, the peptide of amino acids 37 to 142 of SEQ ID NO: 5 can be combined with one or more additional Coccidioides spp. polypeptides or antigens, such as Csa, Gel1, Ure, or non-Coccidioides protein antigens or toxoids, such as tetanus toxoid, diphtheria toxoid, cholera toxoid, ovalbumin (OVA), or keyhole limpet haemocyanin (KLH).

[0120] The pharmaceutically acceptable carriers which can be used in the present invention include, but are not limited to, an excipient, a stabilizer, a binder, a lubricant, a colorant, a disintegrant, a buffer, an isotonic agent, a preservative, an anesthetic, and the like which are commonly used in a medical field.

[0121] Also, the dosage form, such as injectable preparations (solutions, suspensions, emulsions, solids to be dissolved when used, etc.), tablets, capsules, granules, powders, liquids, liposome inclusions, ointments, gels, external powders, sprays, inhalating powders, eye drops, eye ointments, suppositories, pessaries, and the like, can be used appropriately depending on the administration method and the polypeptides of the present invention can be accordingly formulated. Pharmaceutical formulations are generally known in the art and are described, for example, in Chapter 25.2 of Comprehensive Medicinal Chemistry, Volume 5, Editor Hansch et al, Pergamon Press 1990.

[0122] The present invention also provides compositions containing the polypeptides or fragments thereof containing one or more suitable adjuvants commonly used in the field of immunology and medicine to enhance the immune response in a subject. Examples of such adjuvants include monophosphoryl lipid A (MPL), a detoxified derivative of the lipopolysaccharide (LPS) moiety of Salmonella minnesota R595, which has retained immunostimulatory activities and has been shown to promote Th1 responses when co-administered with antigens (see U.S. Pat. No. 4,877,611; Tomai et al., Journal of Biological Response Modifiers. 1987. 6:99-107; Chen et al., Journal of Leukocyte Biology 1991. 49:416-422; Garg & Subbarao. Infection and Immunity. 1992. 60(6):2329-2336; Chase et al., Infection and Immunity.1986. 53(3):711-712; Masihi et al, Journal of Biological Response Modifiers. 1988. 7:535-539; Fitzgerald, Vaccine 1991. 9:265-272; Bennett et al, Journal of Biological Response Modifiers 1988. 7:65-76; Kovach et al., Journal of Experimental Medicine, 1990. 172:77-84; Elliott et al., Journal of Immunology. 1991.10:69-74; Wheeler A. W., Marshall J. S., Ulrich J. T., International Archives of Allergy and Immunology October 2001;126(2):135-9; and Odean et al., Infection and Immunity 1990. 58(2):427-432); MPL derivatives (see U.S. Pat. No. 4,987,237) other general adjuvants (see U.S. Pat. No. 4,877,611); CpG and ISS oligodeoxynucleotides (see U.S. Pat. No. 6,194,388; U.S. Pat. No. 6,207,646; U.S. Pat. No. 6,239,116; U.S. Pat. No. 6,339,068; McCluskie, M. J., and H. L. Davis. Vaccine 2002. 19:413-422; Ronaghy A, Prakken B J, Takabayashi K, Firestein G S, Boyle D, Zvailfler N J, Roord S T, Albani S, Carson D A, Raz E. Immunostimulatory DNA sequences influence the course of adjuvant arthritis. Journal of Immunology 2002. 168(1):51-6.; Miconnet et al (2002) 168(3) Journal of Immunology pp 1212-1218; Li et al (2001) Vaccine 20(1-2):148-157; Davis (2000) Devopmental Biology 104:165-169; Derek T. O'Hagan, Mary Lee MacKichan, Manmohan Singh, Recent developments in adjuvants for vaccines against infectious diseases, Biomolecular Engineering 18 (3) (2001) pp. 69-85; McCluskie et al (2001) Critical Reviews in Immunology 21(1-3):103-120); trehalose dimycolate (see U.S. Pat. No. 4,579,945); amphipathic and surface active agents, e.g., saponin and derivatives such as QS21 (see U.S. Pat. No. 5,583,112); oligonucleotides (Yamamoto et al, Japanese Journal of Cancer Research, 79:866-873, 1988); detoxified endotoxins (see U.S. Pat. No. 4,866,034); detoxified endotoxins combined with other adjuvants (see U.S. Pat. No.4,435,386); combinations with QS-21 (see U.S. Pat. No. 6,146,632); combinations of detoxified endotoxins with trehalose dimycolate and endotoxic glycolipids (see U.S. Pat. No.4,505,899); combinations of detoxified endotoxins with cell wall skeleton (CWS) or CWS and trehalose dimycolate (see U.S. Pat. Nos. 4,436,727, 4,436,728 and 4,505,900); combinations of just CWS and trehalose dimycolate, without detoxified endotoxins (as described in U.S. Pat. No. 4,520,019); chitosan adjuvants (see U.S. Pat. Nos. 5,912,000; 5,965,144; 5,980,912; Seferian, P. G., and Martinez, M. L. Immune stimulating activity of two new chitosan containing adjuvant formulations (2001) Vaccine. 2000. 19(6):661-8). All of the references cited in this paragraph are incorporated herein by reference.

[0123] In another embodiment, the antigenic compositions of the present invention can be provided as an adsorbed vaccine or immunostimulatory composition as described in Matheis et al. (Matheis, M., Zott, A., Schwanig, M. 2000. The role of the adsorption process for production and control combined adsorbed vaccines. Vaccine 20:67-73), which is incorporated herein by reference.

[0124] In another embodiment, various adjuvants, even those that are not commonly used in humans, may be employed in animals where, for example, one desires to subsequently obtain activated T cells or to protect valuable or valued animals from infection due to Coccidioides spp.

[0125] VI. Administration of Vaccines

[0126] As used herein the subject that would benefit from the administration of the polypeptide and or nucleotide vaccines and formulations described herein include any mammal which can benefit from protection against Coccidioides spp. infection. In a preferred embodiment, the subject is a human. In a second embodiment, the subject is a domestic animal, including but not limited to dog, cat, horse, bovine (meaning any sex or variety of cattle) or other such domestic animals.

[0127] By polypeptides capable of eliciting an immune response in a subject human, including vaccination, the invention covers any polypeptide, peptide, peptide mimic, or chemical product capable of inducing an immune reaction that results in or augments the subject's ability to mount some level of immune protection inhibiting Coccidioides spp. infection. In one embodiment, the Coccidioides spp. is Coccidioides immitis. In another embodiment, the Coccidioides spp. is Coccidioides posadasii.

[0128] As used herein, “inhibit”, “inhibiting” or “inhibition” includes any measurable or reproducible reduction in the infectivity of Coccidioides spp. in the subject patient. “Reduction in infectivity” means the ability of the subject to prevent or limit the spread of Coccidioides spp. fungus in tissues or organs exposed or infected by said fungus. Furthermore, “amelioration”, “protection”, “prevention” and “treatment” mean any measurable or reproducible reduction, prevention, or removal of any of the symptoms associated with Coccidioides spp. infectivity, and particularly, the prevention, or amelioration of Coccidioides spp. infection and resultant pathology itself.

[0129] The dosages used in the present invention to provide immunostimulation include from about 0.1 μg to about 500 μg, which includes, 0.5, 1.0, 1.5, 2.0, 5.0, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, and 450 μg, inclusive of all ranges and subranges there between. Such amount may be administered as a single dosage or may be administered according to a regimen, including subsequent booster doses, whereby it is effective; e.g., the compositions of the present invention can be administered one time or serially over the course of a period of days, weeks, months and or years.

[0130] The polypeptide compositions of the present invention can be administered by any suitable administration method including, but not limited to, injections (subcutaneous, intramuscular, intracutaneous, intravenous, intraperitoneal), eye dropping, instillation, percutaneous administration, transdermal administration, oral administration, intranasal administration, inhalation, etc.

[0131] VII. Other Uses.

[0132] Also included within the scope of the present invention are kits suitable for providing one or more of the polypeptides of the invention. For example, in such a kit one vial can comprise the polypeptides of the invention admixed with a pharmaceutically acceptable carrier, either in a aqueous, non-aqueous, or dry state; and a second vial which can carry immunostimulatory agents, and or a suitable diluent for the peptide composition, which will provide the user with the appropriate concentration of peptide to be delivered to the subject. In one embodiment, the kit will contain instructions for using the polypeptide composition and other components, as included; such instructions can be in the form of printed, electronic, visual, and or audio instructions. The vaccinations will normally be at from two to twelve week intervals, more usually from three to five week intervals. Periodic boosters at intervals of 1-5 years, usually three years, will be desirable to maintain protective levels. The course of the immunization may be followed by assays for activated T cells produced, skin-test reactivity, or other indicators of an immune response to Coccidioides spp.

[0133] The polypeptide of the invention can be used to detect the presence of antibodies in the sera of patients potentially infected with Coccidioides spp. Antibodies that react specifically with the inventive polypeptides can be used to detect the presence of circulating antigens in the sera of patients potentially infected with Coccidioides spp. Such detection systems include radioimmunoassays and various modifications thereof which are well-know to those skilled in the art. In addition, the polypeptide of the invention can be used to detect the presence of a cell-mediated immune response in a biological sample. Such assay systems are also well-known to those skilled in the art and generally involve the clonal expansion of a sub-population of T cells or the production of cytokines in response to stimuli from the polypeptide or detection of reactive T cells by flow cytometry or other methods known to those skilled in the art; e.g., methods described by Richards et al. (Richards, J. O., Ampel, N. M., Galgiani, J. N. and Lake, D. F. 2001. Dendritic cells matured by Coccidioides immitis lysate induce antigen specific naive T cell activation. Journal of Infectious Diseases 184:1220-1224). When so-used, the humoral and or cell-mediated response of a patient can be determined and monitored over the course of the disease. Methods of generating antibodies directed to a specific peptide fragment are known in the art. Examples of such methods are disclosed in Antibodies, A Laboratory Manual, Harlow and Lane, Cold Spring Harbor Press, 1988, herein incorporated by reference.

[0134] Having generally described this invention, a further understanding can be obtained by reference to certain specific examples that are provided herein for purposes of illustration only, and are not intended to be limiting unless otherwise specified.

EXAMPLES

Example 1

[0135] Immunoprotection Studies with Recombinant Ag2/PRA Vaccines Expressed in E. coli

[0136] Materials and Methods

[0137] Cloning, Expression, and Characterization of Recombinant Vaccines

[0138] Design of Ag2/PRA subunits. Potential antigenic domains were identified in the predicted 194 amino acid sequence of Ag2/PRA (Dugger, Kris Orsborn, Kara M. Villareal, An Ngyuen, Charles R. Zimmermann, John H. Law and John N. Galgiani. 1996. Cloning and Sequence Analysis of the cDNA for a Protein from Coccidioides immitis with Immunogenic Potential. Biochemical Biophysical Research Communication 218:485-489; Genbank Accession number U39835). We used the antigenicity prediction algorithm of the PEPTIDESTRUCTURE program of the GCG Package (Genetics Computer Group, Madison, Mich. [now Accelrys, San Diego, Calif.]), which analyzes six properties relating to secondary peptide structure and calculates the “antigenic index” as defined for antibody based immune responses to model proteins, and the ANTIGEN program of PC Gene (Intelligenetics, subsumed by Accelrys), which analyzes the hydrophilicity profile of polypeptides. Sequences were examined for breakpoints between high-scoring fields which were identified by both programs, and these boundaries were used as a guide in designing four overlapping subunits, corresponding to amino acids 1-40, 27-106, 90-150 and 125-194. In order to not miss epitopes, sequences were also created in which the full-length protein was divided approximately in half, separating the N-terminal cysteine motifs and C-terminal proline-threonine-rich and GPI anchor motifs, with a 17-amino acid overlap (1-106 and 90-194). Lastly, a sequence was created in which the cysteine motif was separated from the signal peptide (19-100).

[0139] Construction of plasmids. Total RNA was extracted from 48-h spherules of C. posadasii strain Silveira and reverse transcribed with Superscript II and oligo(dT) as previously described (Duger, K. O., Villareal, K. M., Ngyuen, A., Zimmermann, C. R., Law, J. H., and Galgiani, J. N. 1991. An immunoreactive apoglycoprotein purified from Coccidioides immitis. Infection and Immunity 59:2245-2251). The resulting cDNA was used as a template in a 3-step PCR process catalyzed by Pfu DNA polymerase (Stratagene, San Diego, Calif.) for 35 cycles. PCR reactions consisted of 1× Pfu buffer (10 mM KCl, 10 mM (NH4)2SO4, 20 mM Tris-Cl pH 8.75, 2 mM MgSO4, 0.1% Triton X-100 and 0.1 mg/ml BSA), 2 μl template, 0.4 mM dNTP's, and 5U Pfu polymerase. The nucleotide sequences of the sense and antisense PCR primers were 5′ CCGGATCCATGCAGTTCTCTCACGCTC 3′(P1, SEQ ID NO: 12) and 5′CCGAATTCAGTGAAATCAGGTGTGTT 3′ (P2, SEQ ID NO: 13), each of which includes a restriction site to facilitate subcloning (see Tables land 2). The resulting 970 bp product encoding the full-length Ag2/PRA was gel purified, digested with BamHI and EcoRI, and ligated into the BamHI/EcoRI sites of pBluescript SK+ (Stratagene) by standard techniques to create pCiAg33.41 ( J. Sambrook, E. F. Fritsch and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).

[0140] The sequence of the cDNA insert was confirmed by automated DNA sequencing on an ABI 377 sequencer (Macromolecular Structures Facility, Arizona Research Labs, University of Arizona). The insert was excised from pBluescript with BamHI and EcoRI, and ligated into pET32a (Novagen, Madison, Wis.) to produce pPRA.B15. The orientation and frame were confirmed by sequencing, and the plasmid transformed into E. coli BL21(DE3)SlyD− (kind gift of Ry Young, Texas A&M University) by a CaCl2 method as described (Theo N. Kirkland, Fred Finley, Kris I. Orsborn and John N. Galgiani. 1998. Evaluation of the Proline-Rich Antigen of Coccidioides immitis as a Vaccine Candidate in Mice. Infection and Immunity 66:3519-3522; and J. Sambrook, E. F. Fritsch and T. Maniatis. 1989. Molecular Cloning:. A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). To create plasmids encoding the peptide subunits of Ag2/PRA, a series of oligonucleotide PCR primers corresponding to the desired sequences, including restriction sites for BamHI and EcoRI were designed (see Tables 1 and 2). Stop codons were included on antisense primers as appropriate. Primer pairs were used in a set of 2-step PCR reactions with pPRA.B 15 as template and Pfu DNA polymerase as above and the resulting amplimers cloned into the BamHI/EcoRI sites of pET28a (Novagen) or pET32a by standard methods (see Table 2) for expression (see Table 3).

TABLE 1
Primers used in cloning/PCR procedures
Primer
No.	SEQ ID NO:	Primer sequence*	Restiction Site Added
P1	12	CCGGATCC-ATGCAGTTCTCTCACGCTC	BamHI
P2	13	CCGAATTC-AGTGAAATCAGGTGTGTT	EcoRI
P3	16	CCGGATCC-GCTCTCAACTGCTTCGTTG	BamHI
P4	15	GGGAATTCTTA-	EcoRI, stop
		GGTCTCGGATGGCTCGGG
P5	29	CCGGATCC-	BamHI
		ATTGACATCCCACCAGTTG
P6	30	CCGAATTCTTA-	EcoRI, stop
		GCCAGTGGGGACACCACC
P7	31	CCGAATTC-GTGCTTGTCAGTTTTGCT	EcoRI
P8	17	GGAGATCTTTA-	BglII, stop
		GGTCTCGGATGGCTCGGG
P9	32	CCAGATCTTTA-	BglII, stop
		GCCAGTGGGGACACCACC
P10	33	CCCCAGATC-GTGCTTGTCAGTTTTCGT	BglII
P11	19	CCCGTCGACTTA-GGTCTCGGATGGCTC	SalI, stop
P12	34	CCGGATCC-CAGCTCCCAGACATCCCA	BamHI
P13	35	CGAATTCTTA-	EcoRI, stop
		AGCGGCGGTGGTGTCAAC
P14	25	CCGAATTC-ATGCAGTTCTCTCACGC	EcoRI
P15	26	TTGGATCC-GGTCTCGGATGGCTCG	BamHI
P16	27	CCCGGATCC-ATGAAGTTCTCACTCCTC	BamHI
P17	28	CCCGTCGACTTA-TTTCAACCCGCAC	SalI, stop
*hyphen indicates interface of cDNA homology sequence and nucleotides for restriction sites, stop codons, and clamps

[0141]

TABLE 2
Summary information for cloning and expression
Expressed
polypeptide/
Encoded
vaccine (plasmid	Primers	Template	Recipient
designation)	used	Used	vector	Host
Ag2/PRA 1-194	P1/P2	cDNA	pET32a	E. coli
(pPRA.B 15)
Ag2/PRA 27-106	P3/P4	pCiAg33.41	pET28a	E. coli
Ag2/PRA 90-151	P5/P6	pCiAg33.41	pET28a	E. coli
Ag2/PRA 1-106	P1/P4	pPRA.B15	pET32a	E. coli
Ag2/PRA 90-194	P5/P7	pPRA.B15	pET28a	E. coli
Ag2/PRA 19-100	P12/P13	pCVP20.17	pET32a	E. coli
Ag2/PRA 1-194	P1/P10	pCiAg33.41	pVR1020	Mammalian
(pCVP20. 17)				host
Ag2/PRA 1-106	P1/P8	pCiAg33.41	pVR1020	Mammalian
(pTPA)				host
Ag2/PRA 90-194	P6/P10	pCiAg33.41	pVR1020	Mammalian
(pTPB)				host
Ag2/PRA 27-106	P5/P8	pCiAg33.41	pVR1020	Mammalian
(pTP2)				host
Ag2/PRA 90-151	P6/P9	PCiAg33.41	pVR1020	Mammalian
(pTP3)				host
Ag2/PRA 1-106	P1/P11	PCVP20.17	YEpFLAG-1	S. cerevisiae
Ag2/PRA 1-106	P14/P15	PCVP20.17	YEpFLAG-1	S. cerevisiae
(Ag2/PRA
1-106 + Csa)
Csa	P16/P17	PET28b-	YEpFLAG-1	S. cerevisiae
(Ag2/PRA		CSA
1-106 + Csa)
*full length cDNA clone

[0142] Construction of plasmid vaccines. A transcript encoding Ag2/PRA (amino acids 1-194) was cloned into the mammalian expression vector VR1020 (Vical, Inc., San Diego, Calif.). to create pCVP20.17. Briefly, the full length cDNA clone, pCiAg33.41 (Dugger et.al.1996), was used as a template with primers P1 and P2 (see Tables 1 and 2) in a two-step PCR catalyzed by Pfu DNA polymerase (Stratagene), and the resulting 615 bp amplimer ligated into the BamHI/BglII sites on pVR1020 by standard techniques to create pCVP20.17 (Abuodeh, R. O., Shubitz, L. F., Siegel, E., Snyder, S., Peng, T., Orsborn, K. I., Brummer, E., Stevens, D. A., and Galgiani, J. N. 1999. Resistance to Coccidioides immitis in mice after immunization with recombinant protein or DNA vaccine of a proline-rich antigen. Infection and Immunity 67:2935-2940). To make overlapping subunits in the same vector, oligonucleotide primers corresponding to the desired sequence (see FIG. 3) plus restriction sites for BamHI or BglII (see Tables 1 and 2) were used in to create sequences encoding the desired peptide fragments. The amplified fragments were cloned into the BamHI/BglII sites of VR1020 to create plasmids pTP-A (corresponding to Ag2/PRA1-106), pTP-B (corresponding to Ag2/PRA 90-194), pTP-Super2 (corresponding to Ag2/PRA19-100), pTP-2 (corresponding to Ag2/PRA 27-106) and pTP-3 (corresponding to Ag2/PRA 90-151) using the previously described methods. The orientation, frame and sequence of plasmid inserts were confirmed by DNA sequencing. DNA for use as a vaccine was prepared with the Qiagien Gigaprep kit (Chatsworth, Calif.), ethanol precipitated, and adjusted to a concentration of 1 mg/ml in phosphate buffered sterile saline and stored at −20° C. until use.

[0143] Expression and purification of recombinant peptides. Procedures for optimal expression rAg2/PRA and its subunits were developed and conditions varied individually as shown in Table 3. Growth and induction was essentially as described (Kirkland et al. 1998), with changes in medium composition and IPTG concentration as noted, except that medium for initial overnight growth of the host cells contained 10% glucose to inhibit premature expression of the polypeptides.

TABLE 3
Conditions for expression of recombinant Ag2/PRA and its subunits.
Sequences*	Vector	Competent Cell	Medium	IPTG (mM)
1-194	PET32a	BL21(DE3)slyD-	SB	0.5
1-106	PET32a	BL21(DE3)	TB	0.25
19-100	PET32a	BL21(DE3)	LB	0.5
90-194	PET28a	Tuner(DE3)plysS	TB	0.5
27-106	PET28a	BL21(DE3)star	LB	0.5
*refers to corresponding amino acid numbers of native Ag2/PRA sequence

[0144] pET32 and pET28 both encode a 6×-his tag, which facilitates purification by immobilized metal affinity chromatography (IMAC). Full length Ag2/PRA was purified by batch IMAC under denaturing conditions on Ni-nitrilotriacetic acid (NTA) agarose (Qiagen, Inc., Chatsworth, Calif.) by elution with a pH step gradient essentially as described in Kirkland et. al. 1998, with the following changes. Column buffer consisted of 8M urea, 100 mM NaH2PO4, 10 mM Tris, pH 8.0 and 10% glycerol. Renaturation buffer consisted of 6.5M urea, 150 mM NaCl, 1 mM EDTA, 5 mM glutathione, 0.5 mM GSSH (oxidized glutathione), 20 mM Tris, pH 9.5 and 10% glycerol. The urea concentration of renaturation buffer was stepped down every 24 hours to 5M, 3.5M, 1M and finally 0 M urea.

[0145] Polypeptides expressed in pET32a (Ag2/PRA 1-194 and Ag2/PRA 1-106, sequence ID 4) were subjected to thrombin cleavage, to remove some vector encoded amino acids prior to final purification and use as vaccines. The fusion polypeptides were dialyzed into thrombin cleavage buffer, 20 mM Tris, pH 8.0, 150 mM NaCl and the pH adjusted to pH 8.4. CaCl2 (to 2.5 mM) was added and the 6×-his tag removed by digestion with biotinylated thrombin as described (Kirkland et. al. 1998). After separation from the 6×-his tag, the protein was dialyzed into physiological buffer consisting of 5.3 mM KCl, 0.4 mM KH2PO4, 137 mM NaCl, 0.3 mM Na2HPO4 and 10 mM DTT, concentrated and quantitated.

[0146] Polypeptides expressed in pET28a (see Table 2) were not subjected to thrombin cleavage. Following step down urea dialysis, these polypeptides were dialyzed directly into physiological buffer, employing dialysis tubing and spin concentrator units with smaller molecular weight cutoffs.

[0147] The recombinant Ag2/PRA1-106 fusion polypeptide of the present invention expressed by the transformed bacterium was 271 amino acids in length and contains 165 amino acids encoded by the pET32a vector (SEQ ID NO: 4). 130 amino acids, including the 6×-his tag, are removed by thrombin cleavage, leaving 36 vector-encoded and 106 Ag2/PRA1-106-encoded amino acids on the vaccine polypeptide (SEQ ID NO: 5). The recombinant Ag2/PRA27-106 fusion polypeptide of the present invention expressed by the transformed bacterium is 114 amino acids in length and contains 34 amino acids encoded by the pET28a vector and retains the 6×-his tag (SEQ ID NO: 7).

[0148] Polypeptides were separated by SDS-PAGE on 12.5% polyacrylamide (Tris/glycine buffered) or 16.5% polyacrylamide (Tris/glycine buffered) gels (Bio-Rad, Hercules, Calif.), and the purity of recombinant proteins was assessed as greater than 95% by Coomassie Blue staining. Immunoblots were probed with a goat antiserum (Dugger et. al. 1996) to spherule-derived Ag2/PRA as previously described (Kirkland et al, 1998) or with anti-T7-Tag antibody conjugated to alkaline phosphatase (Novagen).

[0149] Immunization and Protection Studies

[0150] Mice. Female, 6-weeks old BALB/c mice were purchased from Harlan-Sprague-Dawley (Indianapolis, Ind.) and maintained in conventional housing under microisolation lids. Mice were immunized within one week of receipt. At the time of infection, mice were moved to Biosafety Level 3 housing where they remained for the duration of their experiment.

[0151] Immunizations. Immunization with various plasmid and recombinant peptide vaccines was carried out as previously described with groups of eight or more mice (Abuodeh R O, Shubitz L F, Siegel E, Snyder S, Peng T, Orsborn K I, Brummer E, Stevens D A, Galgiani J N. 1999 Resistance to Coccidioides immitis in mice after immunization with recombinant protein or DNA vaccine of a proline-rich antigen. Infection and Immunity 67:2935-40.). For DNA vaccination, mice were immunized twice 4 weeks apart with 50 μl of plasmid in various concentrations as indicated in the results injected into each cranial tibial muscle. Unimmunized control mice received the vector without insert (VR1020). For vaccination with recombinant peptides, protein suspended in 0.9% sterile saline was combined with MPL-SE adjuvant (Corixa, Inc, Hamilton, Mont.) according to the manufacturer's instructions. Mice were vaccinated twice 4 weeks apart subcutaneously in the inguinal region with 1 μg of protein per dose.

[0152] Infection. Mice were infected intraperitoneally one month after booster immunizations as previously described (Abuodeh et al., 1999), using arthroconidia of C. immitis, strain RS, were kindly supplied by Dr. Theo Kirkland (University of California, San Diego). For each study, viability and the size of the infecting inoculum was confirmed by plate count at the time of infection (Abuodeh et al. 1999).

[0153] Fourteen days after infection, all mice were sacrificed with an overdose of inhalant anesthesia and the right lung removed aseptically. Organs were homogenized, diluted, and plated. Colony-forming units (CFU) were enumerated at three days and reported as Log10 CFU/organ.

[0154] Statistical analyses. For fungal burden of organs of infected animals, comparisons between groups were determined by analysis of variance (ANOVA) and Duncan's multiple range tests as implemented by SAS (SAS Institute, Inc., Cary, N.C., software version 6.12). The type I experiment-wise error rate of 0.05 was used to control for multiple comparisons.

[0155] Results

[0156] Differential effects of DNA subunit vaccines. In addition to pCVP20.17, which encodes the full-length 194-amino acid Ag2/PRA, plasmid vaccines were constructed with inserts encoding amino acid sequences 1-106, 27-106, 90-151, and 90-194 of Ag2/PRA. In two separate studies, vaccination with each of these plasmids was compared to the plasmid vector alone, using doses and conditions based on previous studies with DNA vaccines encoding full-length Ag2/PRA. As shown in Table 4, significantly fewer colonies of Coccidioides spp. were isolated from lungs of mice vaccinated with plasmids encoding either Ag2/PRA1-106 or Ag2/PRA27-106 than from mice receiving the vector alone. Furthermore, the plasmid encoding Ag2/PRA27-194 was less effective than the plasmid encoding full-length Ag2/PRA. In contrast, there was virtually no beneficial effect of vaccination with plasmids encoding either Ag2/PRA90-151 or Ag2/PRA90-194.

TABLE 4
Fungal burdens in lungs of mice challenged with Coccidicides spp.
	Geometric Mean CFU*
	Plasmid Vaccine Group	Exp. 1	Exp. 2
	Vector Control	4.92	4.20
	rAg2/PRA 90-194	N.D.	4.48
	rAg2/PRA 90-151	4.80	4.05
	rAg2/PRA 27-106	2.90	3.15
	rAg2/PRA 1-106	2.61	3.09
	rAg2/PRA (full length)	2.01	1.94
	*expressed as log10 values
	N.D.: not determined

[0157] Protection afforded by recombinant peptide subunit vaccines. To compare their protective efficacy as vaccines in mice, recombinant Ag2/PRA, rAg2/PRA1-106, rAg2/PRA27-106, and rAg2/PRA90-194 were expressed in E. coli, the polypeptides were isolated and used to immunize mice that were then challenged with C. immitis in a fungal burden assay. The results from quantitative cultures of the target organ lungs are shown in Table 5. As previously seen with plasmid vaccination data described above, mice vaccinated with full-length rAg2/PRA or either rAg2/PRA1-106 or rAg2/PRA27-106 of the present invention were significantly protected as compared to mice receiving adjuvant alone. Also similar to the previous study, vaccination with rAg2/PRA1-106

TABLE 5
Fungal burdens in lungs of mice challenged with Coccidicides spp.
Group                    Geometric Mean CFU*
Adjuvant Control         5.85
rAg2/PRA 90-194          5.69
rAg2/PRA 90-151          2.58
rAg2/PRA 27-106 + 90-194 3.84
rAg2/PRA 27-106          4.25
rAg2/PRA 1-106 + 90-194  2.58
rAg2/PRA 1-106           2.60
rAg2/PRA (full length)   2.91
*expressed as log10 values

[0158] was more protective under the conditions of the experiment than that obtained by immunization with rAg2/PRA27-106. In contrast, vaccination with rAg2/PRA90-194 showed virtually no protection and the fungal burdens were similar to those seen in the adjuvant control. Furthermore, immunization by co-administration of rAg2/PRA90-194 with either rAg2/PRA106 or rAg2/PRA27-106 did not enhance the protection obtained by immunization with the single, later recombinant polypeptides. These studies with recombinant polypeptide vaccines fully corroborate the determination of the protective antigen domain of the N-terminal 1-106 portion of the Ag2/PRA identified in the previous studies with subunit DNA vaccinations and provide strong support that the region of amino acids 90-194 does not provide any additional enhancement over that afforded by MPL adjuvant alone.

Example 2

[0159] Protection Studies with S. cerevisiae Expressed Ag2/PRA1-106 Polypeptide Antigen Used Singly or in Combination with a Second Coccidioides spp. Antigen

[0160] Materials and Methods

[0161] Cloning and Expression of Ag2/PRA1-106 in Saccharomyces cerevisiae

[0162] pCVP20.17 was used as a template in a PCR catalyzed by Pfu DNA polymerase for 35 cycles as described in Example 1 above. The sense primer was P1 (5′CCGGATCCATGCAGTTCTCTCACGCT 3′)(Table 1 and SEQ ID NO: 12) and the antisense primer P2 (5′CCCGTCGACTTAGGTCTCGGATGGCTC 3′)(SEQ ID NO: 13), each of which includes a restriction site to facilitate subcloning. The resulting 338 bp product encoding the Ag2/PRA1-106 was purified using NucleoSpin Kit (Clontech, Palo Alto, Calif.), digested with BamHI and SalI, and ligated into the BamHI/SalI sites of the 7190 bp yeast expression vector YEpFLAG-1 (Sigma, St. Louis, Mo.) using the manufacturer's protocols. The YEpFLAG-1-Ag2/PRA1-106 construct was used to transform E. coli DH5α by standard techniques, and clones were screened and confirmed by sequencing as described in Example 1. The YEpFLAG-1 construct was then transformed into the S. cerevisiae BJ3505 (Sigma, St. Louis, Mo.) host using a Yeast Transformation Kit (Sigma) by the manufacturer's protocols. Transformed yeast cells were selected by plating on Synthetic Complete Medium (SCM) minus tryptophan (Sigma).

[0163] The YEpFLAG-1-Ag2/PRA1-106+CSA chimeric construct was created using the standard methods described above. The sense and antisense primers used for the creation of the chimeric construct comprise the sequences of SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28. The chimeric YEpFLAG-1 construct was then transformed into the S. cerevisiae BJ3505 (Sigma, St. Louis, Mo.) host using a Yeast Transformation Kit (Sigma) by the manufacturer's protocols. Transformed yeast cells were selected by plating on Synthetic Complete Medium (SCM) minus tryptophan (Sigma).

[0164] Recombinant protein was produced by inoculating a yeast colony from the selective agar into 30 ml of SCM minus tryptophan and growing the cells for 48-72 hours at 30° C. until the cell density reached A600=0.6. Twenty five ml of the starter culture was added to 500 ml of YP High Stability Expression Media (Sigma) containing 1% yeast extract, 8% peptone, 1% glucose, 3% glycerol and 20 mM CaCl2, and the expression culture was grown at 30° C. at 175 rpm for 96 hours. The culture supernatant containing the rAg2/PRA1-106 fusion polypeptide or the chimeric Ag2/PRA1-106+Csa fusion protein, respectively, were separated from yeast cells by centrifugation at 3000 rpm for 15 minutes.

[0165] The yeast-derived rAg2/PRA1-106 fusion polypeptide (SEQ ID NO: 9) or the chimeric Ag2/PRA1-106+Csa fusion protein (SEQ ID NO: 11), respectively, were purified by binding to anti-Flag-M1 Affinity Gel (Sigma) and elution with 0.1M glycine per the manufacturer's protocol. The fusion polypeptides were collected and dialyzed in physiological buffer at 4° C. and stored at −70° C. until used. Protein concentration was measured with the BCA Protein Assay Kit (Pierce, Rockford Ill.) and the purity assessed by Coomassie stain of SDS-PAGE gels and immunoblot using an anti-Ag2/PRA goat antibody as described above. Purity was further assessed by mass spectrometry, using Bruker Reflex-III MALDI/TOF (Bruker Daltonics, Billerica, Mass.). The data were analyzed with software “M over Z” (Genomic Solutions, Canada).

[0166] Mouse Immunization and Challenge Methods

[0167] Female, 6-weeks old C57Bl/6 mice were purchased from Harlan-Sprague-Dawley (Indianapolis, Ind.) and maintained in conventional housing under microisolation lids. Mice were divided into four groups of 10 mice each for experimental testing of the recombinant polypeptide antigens rAg2/PRA1-106, rCsa (derived and expressed by recombinant methods from C. posadasii [encoded by the nucleotide sequence of SEQ ID NO: 23; isolated by Dr. Garry Cole, Medical College of Ohio, Toledo, Ohio]), rAg2/PRA1-106+rCsa, or adjuvant control. For vaccination with recombinant peptides, protein was suspended in 0.9% sterile saline and combined with MPL-SE adjuvant (Corixa) and CpG, an immunostimulatory oligonucleotide sequence purchased from Integrated DNA Technologies, Inc. The CpG ODN sequence used to immunize mice was TCCATGACGTTCCTGACGTT (SEQ ID NO: 24) (CpG motifs are underlined). Mice were vaccinated twice, 14 days apart, subcutaneously in the inguinal region with 200 μl saline containing 1 μg of protein, 10 μg of CpG, and MPL-SE according to manufacturer's instructions. Controls received 10 μg CpG and MPL-SE. Animals were challenged intranasally 26 days after the last administration of antigen with 50 arthroconidia of C. posadasii strain Silveira. Animals were monitored for deaths for 56 days. Survivors were sacrificed with an overdose of inhalant anesthesia and the right lung removed aseptically. Organs were homogenized, diluted, and plated on agar plates for the quantitative recovery of viable Coccidioides spp. Colony-forming units (CFU) were enumerated at three days and reported as Log10 CFU/organ.

[0168] Results

[0169] Mice began to look ill 14 days after challenge, with deaths ensuing thereafter. All mice in the adjuvant control group had died by Day 18 post-infection. Animals were held for a total of 56 days and the in-life portion of the experiment was terminated. The survival results are presented in Table 6. The data indicate pronounced survival in the rAg2/PRA1-106 immunized mice in comparison to those immunized with rCsa or adjuvant control. What is also apparent is the enhanced protection provided by the combination of rAg2/PRA1-106 and rCsa in comparison to the survival conferred by immunization with the single antigens alone, based both on percent survival at 56 days and mean days survived.

TABLE 6
Survival of mice challenged with C. posadasli
	Group	% Survival	Mean Survival (Days)
	Adjuvant Control	0	16.2
	rCsa	30	39.7
	rAg2/PRA 1-106	60	42.6
	rAg2/PRA 1-106 + rCsa	90	52.2

[0170] The surviving mice were euthanized on Day 56 post-infection and the lungs were removed and processed for the recovery and enumeration of the fungal burden in this target organ. The results of the quantitative cultures are presented in Table 7. To normalize the results across experimental groups, lungs from mice not surviving to Day 56 were assigned a fungal burden value of 5.0×106 cfu; a value that is twice the level possible to detect under the conditions of the experiment.

TABLE 7
Fungal burdens in lungs of mice challenged with Coccidicides spp.
Group                 Geometric Mean CFU*
Adjuvant Control      6.70
rCsa                  5.85
rAg2/PRA 1-106        4.56
rAg2fPRA 1-106 + rCsa 3.92
*expressed as log10 values

[0171] Closely reflecting the pattern observed among survival of the vaccine groups, the fungal burdens of the mice immunized with the single antigen rAg2/PRA1-106 were. reduced in comparison to those immunized with rCsa alone or in animals receiving the adjuvant control. The results of the fungal burden assay parallel those of the survival experiment in that the fungal burdens were further reduced in the group immunized by the combination of rAg2/PRA1-106 and rCsa in comparison to the survival conferred by immunization with the single antigens alone. The results thereby demonstrate the ability of the single recombinant protein rAg2/PRA1-106 to serve as an effective immunizing vaccine, and that the protection can be further enhanced by the addition of a second Coccidioides spp. antigen; in this case rCsa. The data also provide evidence that the yeast-derived rAg2/PRA1-106 polypeptide produces a protective immune response comparable to that seen with the comparable E. coli-derived polypeptide.

[0172] Example 3

[0173] Ex-vivo Production of Interferon-Gamma in Response to Single and Combination Antigen Vaccines

[0174] Materials and Methods

[0175] Female, 17-weeks old C57Bl/6 mice were purchased from Harlan-Sprague-Dawley (Indianapolis, Ind.) and maintained in conventional housing under microisolation lids. Mice were divided into groups of 3 animals each for experimental testing of the recombinant polypeptide antigens rAg2/PRA1-106 (yeast-derived), rCsa (obtained from Dr. Garry Cole), rAg2/PRA1-106+rCsa, or adjuvant controls. For vaccination with recombinant peptides, the protein was suspended in 0.9% sterile saline and was combined with a mixture of 10 μg of CpG and 25 μg of MPL (Corixa, Inc., Hamilton, Mont.) adjuvants. Mice were vaccinated twice 14 days apart subcutaneously in the inguinal region with doses of 1 μg of protein of each antigen or control adjuvants in a volume of 200 μl. Thirty-seven days after the last immunization, mice were euthanized and spleens were aseptically removed from animals, processed and placed in cell culture media as described previously [Abuodeh et al., 1999]. Cells from each experimental group were stimulated with 10 μg/ml of each of the following: bovine serum albumin (BSA) as negative control, Concanavalin A (Con A) as positive control, rAg/PRA1-106 polypeptide, or rCsa polypeptide. After stimulation for approximately 72 h, supernatants were removed and assayed for the production of interferon gamma (IFN-γ), a key immunologic marker of a Th1 response, using an OptEIA kit (Pharmingen, Inc., San Diego, Calif.) according to the manufacturer's protocols.

[0176] Results

[0177] The results of the INF-γ assay are presented in Table 8. The positive and negative controls provided IFN-γ responses consistent with expectations. Stimulation of cells with the homologous antigens also resulted in marked responses, while stimulation with the heterologous antigens did not result in the release of detectable IFN-γ, a key immunologic marker of a Th1 response. The data indicate that vaccination of mice with

TABLE 8
Production of
IFN-γ from cells obtained from immunized mice and stimulated
with recombinant C. posadasii polypeptide antigens
	Immunizing	IFN-γ(pg/ml) from Stimulus
	Antigen	BSA	Con A	rAg2/PRA 1-106	rCsa
Adjuvant Control	ND*	6,228	ND	ND
rCsa	NP	3,611	ND	652
rAg2/PRA 1-106	ND	13,120	5,070	ND
rAg2/PRA 1-106 +	NP	20,000	22,419	1,496
rCsa
*Not detected: less than 125 pg/ml

[0178] the recombinant Coccidioides spp. polypeptides leads to an immunized state that can be detected by production of the cytokine IFN-γ in response to ex vivo stimulation of spleenic cells by the antigens. There was also a markedly enhanced response to stimulation by each of the single antigens in the cells from the mice immunized by the combination of rAg2/PRA1-106+rCsa in comparison to the responses from mice immunized with the single antigens. The data suggest that immunization with the two C. posadasii antigens in combination may result in an additive response, as measured by IFN-γ.

[0179] Obviously, numerous modifications and variations on the present invention are possible in light of the above teachings. It is therefore to be understood that within the scope of the appended claims, the invention may be practiced otherwise than as specifically described herein.

Claims

1. An isolated nucleic acid selected from the group consisting of: a nucleic acid consisting of the sequence of nucleotides 496 to 816 of SEQ ID NO: 3, a nucleic acid consisting of the sequence of nucleotides 61 to 381 of SEQ ID NO: 8, a nucleic acid encoding the polypeptide consisting of the sequence of amino acids 21 to 126 of SEQ ID NO: 9, and a nucleic acid encoding the polypeptide comprising the sequence of amino acids 21 to 126 of SEQ ID NO: 9 with conservative amino acid substitutions.

2. An expression vector comprising the nucleic acid of claim 1.

3. The expression vector of claim 2, further comprising a recombinant regulatory sequence operably linked to said nucleic acid.

4. The expression vector of claim 3, wherein said regulatory sequence is a promoter.

5. The expression vector of claim 3, wherein said regulatory sequence comprises one or more transcriptional regulatory elements that control expression of the nucleic acid in a host cell.

6. The expression vector of claim 5, wherein said host cell is selected from the group consisting of yeast, plant, animal, human and bacterial cells.

7. A host cell comprising the expression vector of claim 2.

8. The host cell of claim 7, wherein said host cell is selected from the group consisting of yeast, plant, animal, human and bacterial cells.

9. The nucleic acid of claim 1, further comprising at least a second coding region that encodes a second, distinct Coccidioides spp. protein, polypeptide or peptide.

10. An isolated polypeptide selected from the group consisting of: a polypeptide encoded by the nucleotide sequence of nucleotides 61 to 381 of SEQ ID NO: 8, a polypeptide consisting of the amino acid sequence of amino acids 21 to 126 of SEQ ID NO: 9, and a polypeptide consisting of the amino acid sequence of amino acids 21 to 126 of SEQ ID NO: 9 with conservative amino acid substitutions.

11. A composition comprising the polypeptide of claim 10.

12. The composition of claim 11, wherein said composition includes a pharmaceutically acceptable carrier.

13. The composition of claim 11, further including an adjuvant.

14. The composition of claim 11, further comprising at least a second Coccidioides spp. polypeptide.

15. The composition of claim 14, wherein said second Coccidioides spp. polypeptide is Csa.

16. The composition of claim 15, consisting of a polypeptide consisting of the amino acid sequence of the fusion polypeptide of amino acids 11 to 264 of SEQ ID NO: 11.

17. A method of eliciting an immune response in a mammal, comprising introducing into the mammal a composition comprising the isolated polypeptide of claim 10, in an amount sufficient to elicit an immune response.

18. The method of claim 17 wherein said mammal is a human.

19. The method of claim 17 wherein said mammal is a domestic animal selected from the group consisting of dog, cat, horse, and bovine.

20. A method of generating antibodies specific for Ag2/PRA1-106 comprising introducing into a mammal the composition of claim 11, in an amount sufficient to elicit an antibody response.

21. The method of claim 20 wherein said mammal is a human.

22. The method of claim 20 wherein said mammal is a domestic animal selected from the group consisting of dog, cat, horse, and bovine.

23. A method of generating antibodies specific for Ag2/PRA1-106 comprising introducing into a mammal the composition of claim 12, in an amount sufficient to elicit an antibody response.

24. A method of generating antibodies specific for Ag2/PRA1-106 comprising introducing into a mammal the composition of claim 13, in an amount sufficient to elicit an antibody response.

25. A vector that (a) transfects a mammalian cell and (b) is stably transformed with a nucleic acid consisting of the nucleotide sequence of nucleotides 495 to 816 of SEQ ID NO: 3.

26. The vector of claim 25 wherein said vector encodes a polypeptide, the amino acid sequence of which consists of amino acids 37 to 142 of SEQ ID NO: 5.

27. A method of vaccinating a mammal from coccidioidomycosis, comprising: administering the composition of claim 11 in an amount sufficient to elicit an immune response wherein said immune response is sufficient to suppress or attenuate growth of Coccidioides spp. fungus in a mammal infected with said fungus.

28. The method of claim 27 wherein said mammal is a human.

29. The method of claim 27 wherein said mammal is a domestic animal selected from the group consisting of dog, cat, horse, and bovine.

30. The method of claim 27 wherein said composition further includes a pharmaceutically acceptable carrier.

31. The method of claim 27, wherein said composition further includes an adjuvant.

32. A kit, comprising the isolated polypeptide of claim 10.

33. The kit of claim 32, further including an adjuvant.

34. The kit of claim 32, further including instructions for use.

35. An isolated nucleic acid comprising the nucleotide sequence of nucleotides 103 to 345 of SEQ ID NO: 6.