PFKFB3 INHIBITORS AND THEIR USES

SEQUENCE LISTING

The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled 05_GERONZ00300_20210820_sequence_listing.txt, created Jun. 25, 2021, which is 4.27 Kb in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.

BACKGROUND OF THE INVENTION

Cancer cells exhibit preference for glycolysis instead of oxidative phosphorylation even in normoxia. Cancer cells benefit from elevated glycolytic flux to meet their high energy demands for rapid growth and proliferation. This finding is exploited clinically as a diagnostic tool for solid tumors, measuring the uptake of 2-Deoxy-2-[¹⁸F]fluoroglucose by positron-emission tomography (PET) imaging. In recent years glycolysis has drawn a revived attention due to its relation to cancer and the enzymes of glycolytic pathway were explored as potential targets for therapeutic intervention. Small-molecule inhibitors have been identified, for example, against glucose transporters, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), hexokinase II, and hypoxia-inducible factor 1-alpha (HIF1-alpha). Inhibition of glycolysis (for example by 2-deoxy-D-glucose, bromopyruvic acid, Lonidamine, Phloretin, WZB1117) has been shown to promote cell death. However, directly targeting glycolytic enzymes may have detrimental effects to cells as evidenced by preclinical trials of Lonidamine, which revealed significant pancreatic and hepatic toxicities, and clinical trial of 2-deoxy-D-glucose, administration of which was related to hyperglycemia in all treated patients.

In this view, the regulatory role of 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 (PFKFB3) and 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 (PFKFB4) in cell metabolism and proliferation is of particular interest. Fructose-2,6-bisphosphate (Fru-2,6-BP) is a potent positive allosteric regulator of a key glycolytic enzyme phosphofructokinase-1 (PFK1). Cellular level of Fru-2,6-BP is dynamically regulated by the family of bifunctional enzymes 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatases (PFKFB1-4), also referred to as phosphofructokinase-2 (PFK2). Increased level of Fru-2,6-BP promotes glycolytic flux by relieving the inhibitory effect of high ATP concentrations of PFK1.

Antisense siRNAs against PFKFB3 have been shown to inhibit cancer cell proliferation in vitro. Also, a decreased anchorage independent growth was observed for siRNA treated fibroblasts suggesting a potential antimetastatic effect. Recently, a key role of PFKFB3-driven glycolysis in vessel sprouting was identified. Silencing of PFKFB3 impaired endothelial tip cell activity also suggests an antiangiogenesis potential for a PFKFB3-targeting therapy.

PFKFB4 has shown to play a similar role in glycolytic flux but has different tissue distribution and has lower kinase:bisphosphatase ratio 4:1, as compared to 740:1 for PFKFB3. Both PFKFB3 and PFKFB4 are induced by hypoxia in various tumors. Interestingly, expression of PFKFB4 is higher than PFKFB3 in primary glioblastomas when compared with secondary glioblastomas as well as with the lower-grade astrocytomas and correlates with poor survival. PFKFB4 was shown to be important for glioma and prostate cancer cell survival.

PFKFB3 level and, consequently, Fru-2,6-BP and glycolysis are temporarily controlled during cell cycle progression and are elevated in G1-S phase transition. Another indication of the role of PFKFB3 in the cell cycle is the inactivation of cell-cycle inhibitor p27 and activation of cell-cycle promoting kinase Cdk1 by Fru-2,6-BP in the nucleus. These findings suggest that pharmacological inhibition of PFKFB3 kinase activity may go beyond solely regulating glycolysis metabolic flux. PFKFB3 is a key regulator of glycolysis, the central pathway of carbohydrate utilization, and as such is involved in several other disorders and pathological conditions. The proinflammatory cytokine interleukin-6 (IL6) was shown to enhance glycolytic flux in mouse embryonic fibroblasts and human cell lines. In vitro studies revealed that T-cell activation was accompanied by a marked increase of PFKFB3 level and Fru-2,6-BP concentration. Rheumatoid arthritis (RA) synovium is characterized by hypoxia induced changes in the expression of PFKFB3 and PFKFB4. Together these findings suggest a potential role of PFKFB3 inhibition for treatment of inflammatory conditions, autoimmune disorders, as well as application in immunosuppression.

Neurodegenerative pathologies are characterized by progressive loss of hippocampal and cortex neurons in Alzheimer's disease, dopaminergic neurons of the substantia nigra in Parkinson's disease, or motor neurons in Amyotrophic Lateral Sclerosis. Experimental data suggest that excitotoxicity along with mitochondrial dysfunction and increased ROS level are a common contributing cause. In normal conditions neurons maintain low level of PFKFB3, which is continuously degraded by the E3 ubiquitin ligase anaphase-promoting complex/cyclosome-Cdh1 (APC/C-Cdh1). During excitotoxicity, APC/C-Cdh1 is inhibited resulting in stabilization of PFKFB3, which leads to shifted glucose consumption by glycolysis at the expense of the pentose-phosphate pathway (PPP). This is detrimental to the redox status of glutathione and, hence, compromises the ability of neurons to detoxify reactive oxygen species (ROS) leading to apoptotic death.

A few small molecules have been postulated to inhibit kinase activity of PFKFB3/PFKFB4, however, new compounds and methods are needed. 3PO (3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one) and ACT-PFK-158 ((E)-1-(pyridin-4-yl)-3-(7-(trifluoromethyl)quinolin-2-yl)prop-2-en-1-one) were reported to inhibit PFKFB3, reduce intracellular concentration of Fru-2,6-BP, reduce glucose uptake, and reduce growth of established tumors in vivo, however the PFKFB3 inhibition of 3PO is unclear based on a conflicting study. 3PO has been extensively used in research and was shown to inhibit proliferation of activated T-cells and inhibit angiogenesis.

New therapies which are able to regulate the role of PFKFB3 and PFKFB4 in cell metabolism and proliferation may prove useful in the treatment of a variety of pathologies.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows that GO-672 did not reduce cell viability of HUVECs both in normoxia and hypoxia conditions.

FIGS. 2A-2D show the effects of GO-672 on vessel sprouting in vitro.

FIG. 3 shows that PFKFB3 inhibitors protect neurons against MG132- and β-amyloid-induced toxicity.

FIG. 4A shows that AZ67 and Compound 1 at 0.01 μM restore NADPH/NADP ratio under excitotoxic conditions induced by glutamate.

FIG. 4B shows that AZ67 and Compound 1 at 0.01 μM significantly prevented the increase in mitochondrial ROS triggered both by NMDA and glutamate excitotoxic models in primary neurons.

FIG. 5 shows that both glutamate and NMDA significantly increased apoptotic neuronal death, an effect that was significantly prevented by AZ67 and by Compound 1.

FIG. 6A shows that AZ67 and Compound 1 protect mouse primary cortical neurons from apoptosis induced by NMDA and glutamate.

FIGS. 6B and 6C shows that PFK1-M overexpression was able to abolish the neuroprotection caused by AZ67 and Compound 1.

FIG. 7 shows an evaluation of the effect of PFKFB3 inhibitors on motor coordination after MCAO using a rota-rod test.

FIG. 8 shows an evaluation of the effect of PFKFB3 inhibitors on infarct volume of mice after MCAO.

FIG. 9 shows the effect of GO-672 as a single agent and in combination with cisplatin in a syngeneic model.

FIGS. 10A-10D show the effect of GO-672 in an orthotopic 4T1-M3-Luc syngeneic breast tumor model in female BALB/c mice in vivo in comparison with a vehicle/control group.

FIGS. 11A-11C show the effect of GO-672 in an orthotopic RENCA model in comparison with a vehicle/control group in female BALB/c mice.

FIG. 12 shows the rate of glycolysis in neurons of WT and Cln7 KO mice.

FIG. 13 shows the results of an valuation of apoptosis level in neurons by measuring active Caspase-3 using Western blot.

FIG. 14 shows the expression of PFKFB3 protein in Cln7 KO and WT mice measured by Western blot.

FIGS. 15A-15C show that AZ67 prevented the accumulation of SCMAS, lipofuscin, and reactive astroglia in the cortex of Cln7Aex2 mice in vivo.

FIG. 15D shows that hindlimb paralysis in Cln7Aex2 mice was prevented by AZ67, indicating functional recovery.

FIG. 16 shows that AZ67 rectified the loss of perinuclear mitochondria observed in induced pluripotent stems cells (iPSC)-derived neural precursor cells (NPC) from CLN7 patients.

FIGS. 17A and 17B show AzPfkb367 dose responses.

BRIEF SUMMARY OF THE INVENTION

This disclosure relates to new phthalimide and isoindolinone derivatives as 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4 (PFKFB3, PFKFB4) and other PFKFB3 modulators and to pharmaceutical compositions comprising these compounds, and methods of using these compounds to reduce cellular glycolytic flux and/or treat and prevent cancer, inflammation, neurodegeneration, aging and other diseases and conditions, where the modulation of PFKFB3 and/or PFKFB4 has beneficial effect, in mammals, including humans and its use in manufacturing of the corresponding medicament and related kits.

In some embodiments, this disclosure relates to the new uses of agents deleting, reducing, binding, inhibiting or degrading PFKFB3, including but not limited to the known PFKFB3 inhibitors and their analogs and the inventions related to such new uses. PFKFB3 inhibitors can be useful for treatment of neurodegeneration, aging and aging-related diseases, disorders and conditions, can be used for rejuvenation and use in manufacturing of the corresponding medicament. The novel features of the invention are set forth with particularity in the appended claims and description. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings

Disclosed herein are methods, agents, pharmaceutical compositions, and systems for anti-aging treatment and treatment of neurodegeneration, as well as relative systems, methods and kits.

In some embodiments, the removal or inhibition or degradation of PFKFB3 or modulation of Indirect Target as defined below is effective in decreasing the biological age of a patient or as other anti-aging treatment.

In some embodiments, the removal or inhibition or degradation of PFKFB3 or modulation of Indirect Target as defined below is effective in neuroprotection or treatment of neurodegenerative disease.

Disclosed herein is a compound of Formula (0):

embedded image

or a pharmaceutically acceptable salt thereof, wherein RG6 and RG5 is one of the following: A) RG6 and RG5 are taken together with the N to which they are attached to form a C₂-C₈heterocycloalkyl optionally substituted with one or more substituents;

RG1, RG3 and RG4 are independently selected from R_M; RG2 is R_L; RG5 is Z; RG6 is —C(═O)—; AG1 is —Ar_C—Ar_T;

thus the Formula (0) can be represented as the Formula (I):

embedded image

wherein: Z is selected from —C(═O)— and —C(R^a)(R^b)—; R^aand R^bare independently selected from hydrogen, hydroxyl, halogen, optionally substituted C₁-C₆alkyl, optionally substituted C₁-C₆alkoxy, optionally substituted C₃-C₈cycloalkyl, optionally substituted —O—C₃-C₈cycloalkyl, optionally substituted C₂-C₈heterocycloalkyl, and optionally substituted —O—C₂-C₈heterocycloalkyl;

wherein the C₁-C₆alkyl and C₁-C₆alkoxy are optionally substituted with one or more substituents independently selected from halogen, —C(═O)OR⁷, —C(═O)NR¹R², —OH, aryl, heteroaryl, C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, C₂-C₈heterocycloalkyl, and —O—C₂-C₈heterocycloalkyl; and wherein the C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, C₂-C₈heterocycloalkyl, and —O—C₂-C₈heterocycloalkyl are optionally substituted with one or more substituents independently selected from halogen, —C(═O)OR⁷, —C(═O)NR¹R², —OH, aryl, heteroaryl, C₁-C₆alkyl, C₁-C₆alkoxy, C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, C₂-C₈heterocycloalkyl, and —O—C₂-C₈heterocycloalkyl;

Ar_cis selected from C₃-C₈cycloalkenylene, C₂-C₈heterocycloalkenylene, arylene, and heteroarylene; wherein Ar_cis substituted with one or more R_C;

each R_Care independently selected from —CN, —OH, halogen, optionally substituted C₁-C₆alkyl, optionally substituted C₁-C₆alkoxy, optionally substituted C₃-C₈cycloalkyl, optionally substituted —O—C₃-C₈cycloalkyl, optionally substituted C₂-C₈heterocycloalkyl, optionally substituted —O—C₂-C₈heterocycloalkyl, optionally substituted heteroaryl, optionally substituted aryl, —C(═O)OH, —C(═O)OR³, —C(═O)NR⁴R⁵, —S(═O)₂NR⁴R⁵, —NHC(═O)H, —NHC(═O)R⁶, —NHS(═O)₂R⁶, and —C(═O)NHS(═O)₂R⁶;

wherein the C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, C₂-C₈heterocycloalkyl, —O—C₂-C₈heterocycloalkyl, aryl, and heteroaryl are optionally substituted with one or more substituents independently selected from —OH, halogen, —C(═O)OR⁷, —C(═O)R⁶, —C(═O)NR¹R², C₁-C₆alkyl, C₁-C₆alkoxy, C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, C₂-C₈heterocycloalkyl, —O—C₂-C₈heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, and —NR⁷R⁸;

each R¹and R²is independently selected from hydrogen, optionally substituted C₁-C₆alkyl, and optionally substituted C₃-C₈cycloalkyl;

wherein the C₁-C₆alkyl is optionally substituted with one or more substituents independently selected from halogen, —C(═O)OR⁷, —C(═O)NR⁷R⁸, —OH, aryl, heteroaryl, C₁-C₆alkoxy, C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, C₂-C₈heterocycloalkyl, and —O—C₂-C₈heterocycloalkyl; and

wherein the C₃-C₈cycloalkyl is optionally substituted with one or more substituents independently selected from halogen, —C(═O)OR⁷, —C(═O)NR⁷R⁸, —OH, aryl, heteroaryl, C₁-C₆alkyl, C₁-C₆alkoxy, C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, C₂-C₈heterocycloalkyl, and —O—C₂-C₈heterocycloalkyl;

or R¹and R²are taken together with the N to which they are attached to form a C₂-C₈heterocycloalkyl optionally substituted with one or more substituents independently selected from halogen, —OH, C₁-C₆alkyl, and C₁-C₆alkoxy;

each R³is independently C₁-C₆alkyl optionally substituted with one or more substituents independently selected from halogen, —OH, optionally substituted —OC(═O)C₁-C₆alkyl, optionally substituted —C(═O)O—C₁-C₆alkyl, C₁-C₆alkoxy, —C(═O)OH, —NR¹R², —C(═O)NR¹R², optionally substituted C₂-C₈heterocycloalkyl, optionally substituted C₃-C₈cycloalkyl, optionally substituted aryl and optionally substituted heteroaryl;

wherein the —OC(═O)C₁-C₆alkyl and —C(═O)O—C₁-C₆alkyl are optionally substituted with one or more substituents independently selected from halogen, —OH, and —NR⁷R⁸; and

wherein the C₂-C₈heterocycloalkyl, C₃-C₈cycloalkyl, aryl and heteroaryl are optionally substituted with one or more substituents independently selected from —OH, halogen, —C(═O)OR⁷, —C(═O)NR⁷R⁸, C₁-C₆alkyl, C₁-C₆alkoxy, C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, C₂-C₈heterocycloalkyl, —O—C₂-C₈heterocycloalkyl, and —NR⁷R⁸;

or each R³is independently C₃-C₈cycloalkyl optionally substituted with one or more substituents independently selected from halogen, —OH, optionally substituted C₁-C₆alkyl, optionally substituted —O(C═O)C₁-C₆alkyl, optionally substituted —(C═O)OC₁-C₆alkyl, C₁-C₆alkoxy, —C(═O)OH, —NR¹R², —(C═O)NR¹R², optionally substituted C₂-C₈heterocycloalkyl, optionally substituted C₃-C₈cycloalkyl, optionally substituted aryl and optionally substituted heteroaryl;

wherein the C₁-C₆alkyl, —OC(═O)C₁-C₆alkyl and —C(═O)O—C₁-C₆alkyl are optionally substituted with one or more substituent independently selected from halogen, —OH, and —NR⁷R⁸; and

wherein the C₂-C₈heterocycloalkyl, C₃-C₈cycloalkyl, aryl and heteroaryl are optionally substituted with one or more substituents independently selected from —OH, halogen, —C(═O)OR⁷, —(C═O)NR⁷R⁸, C₁-C₆alkyl, C₁-C₆alkoxy, C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, C₂-C₈heterocycloalkyl, —O—C₂-C₈heterocycloalkyl, and —NR⁷R⁸;

each R⁴and R⁵is independently selected from hydrogen, optionally substituted C₁-C₆alkyl, optionally substituted C₃-C₈cycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;

wherein the C₁-C₆alkyl is optionally substituted with one or more substituents independently selected from halogen, —C(═O)OR⁷, —C(═O)NR¹R², —OH, aryl, heteroaryl, C₁-C₆alkoxy, C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, C₂-C₈heterocycloalkyl, and —O—C₂-C₈heterocycloalkyl; and

wherein the C₃-C₈cycloalkyl, aryl and heteroaryl are optionally substituted with one or more substituents independently selected from —OH, halogen, —C(═O)OR⁷, —C(═O)NR⁷R⁸, C₁-C₆alkyl, C₁-C₆alkoxy, C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, C₂-C₈heterocycloalkyl, —O—C₂-C₈heterocycloalkyl, and —NR⁷R⁸;

or R⁴and R⁵are taken together with the N to which they are attached to form a C₂-C₈heterocycloalkyl optionally substituted with one or more substituents independently selected from halogen, —OH, C₁-C₆alkyl, and C₁-C₆alkoxy;

each R⁶are independently selected from optionally substituted C₁-C₆alkyl, optionally substituted C₃-C₈cycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;

each R⁷and R⁸is independently selected from hydrogen and C₁-C₆alkyl;

or R⁷and R⁸are taken together with the N to which they are attached to form a C₂-C₈heterocycloalkyl optionally substituted with one or more C₁-C₆alkyl substituents;

Ar_Tis selected from pyridinyl, pyrimidinyl, pyridazinyl, pyrazinyl, phenyl, pyrrolyl, furanyl, thiophenyl, pyrazolyl, imidazolyl, triazolyl, and tetrazolyl, wherein Ar_Tis optionally substituted by one or more substituents independently selected from halogen, —OH, —NR⁷R⁸, —CN, optionally substituted C₁-C₆alkyl, optionally substituted C₁-C₆alkoxy, optionally substituted C₃-C₈cycloalkyl, optionally substituted —O—C₃-C₈cycloalkyl, optionally substituted C₂-C₈heterocycloalkyl, and optionally substituted —O—C₂-C₈heterocycloalkyl;

wherein the C₁-C₆alkyl and C₁-C₆alkoxy are optionally substituted with one or more substituents independently selected from halogen, —C(═O)OR⁷, —C(═O)NR⁷R⁸, —OH, aryl, heteroaryl, C₁-C₆alkoxy, C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, C₂-C₈heterocycloalkyl, and —O—C₂-C₈heterocycloalkyl; and

each R_Mis independently selected from hydrogen, halogen, —OH, —CN, optionally substituted C₁-C₆alkyl, optionally substituted C₁-C₆alkoxy, optionally substituted C₃-C₈cycloalkyl, optionally substituted —O—C₃-C₈cycloalkyl, optionally substituted C₂-C₈heterocycloalkyl, and optionally substituted —O—C₂-C₈heterocycloalkyl;

R_Lis selected from —OH, —CN, optionally substituted C₁-C₆hydroxyalkyl, optionally substituted C₁-C₆alkoxy, optionally substituted heteroaryl, —C(═O)OH, —C(═O)OR⁹, —C(═O)NR¹⁰R¹¹, —S(═O)₂NR¹⁰R¹¹, —NHC(═O)H, —NHC(═O)R¹², —NHS(═O)₂R¹²and —C(═O)NHS(═O)₂R¹²;

wherein the C₁-C₆hydroxyalkyl and C₁-C₆alkoxy are optionally substituted with one or more substituents independently selected from halogen, —C(═O)OR⁷, —C(═O)NR¹R², —OH, aryl, heteroaryl, C₁-C₆alkoxy, C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, C₂-C₈heterocycloalkyl, and —O—C₂-C₈heterocycloalkyl; and

wherein the heteroaryl is optionally substituted with one or more of —OH, —O—C(═O)C₁-C₆alkyl, (C₁-C₄alkylene)-O—C(═O)C₁-C₆alkyl, C₁-C₆alkyl-(aryl), C₁-C₆alkyl-(heteroaryl), halogen, —C(═O)OR⁷, —C(═O)R¹², —C(═O)NR¹R², C₁-C₆alkyl, C₁-C₆hydroxyalkyl, C₁-C₆alkoxy, C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, C₂-C₈heterocycloalkyl, —O—C₂-C₈heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, and —NR¹R²;

R⁹is C₁-C₆alkyl optionally substituted with one or more substituents independently selected from halogen, —OH, optionally substituted —OC(═O)C₁-C₆alkyl, optionally substituted —C(═O)O—C₁-C₆alkyl, C₁-C₆alkoxy, —C(═O)OH, —NR¹R², —C(═O)NR¹R², optionally substituted C₂-C₈heterocycloalkyl, optionally substituted C₃-C₈cycloalkyl, optionally substituted aryl and optionally substituted heteroaryl;

wherein the —OC(═O)C₁-C₆alkyl and —C(═O)O—C₁-C₆alkyl are optionally substituted with one or more substituents independently selected from halogen, —OH, and —NR⁷R⁸; and

or R⁹is C₃-C₈cycloalkyl optionally substituted with one or more substituents independently selected from halogen, —OH, optionally substituted C₁-C₆alkyl, optionally substituted —O(C═O)C₁-C₆alkyl, optionally substituted —(C═O)OC₁-C₆alkyl, C₁-C₆alkoxy, —C(═O)OH, —NR¹R², —(C═O)NR¹R², optionally substituted C₂-C₈heterocycloalkyl, optionally substituted C₃-C₈cycloalkyl, optionally substituted aryl and optionally substituted heteroaryl;

wherein the C₂-C₈heterocycloalkyl, C₃-C₈cycloalkyl, aryl and heteroaryl are optionally substituted with one or more substituents independently selected from —OH, halogen, —C(═O)OR⁷, —(C═O)NR⁷R⁸, C₁-C₆alkyl, C₁-C₆alkoxy, C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, C₂-C₈heterocycloalkyl, —O—C₂-C₈heterocycloalkyl, and —NR⁷R⁸;

each R¹⁰and R¹¹is independently selected from hydrogen, optionally substituted C₁-C₆alkyl, optionally substituted C₃-C₈cycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;

wherein the C₁-C₆alkyl is optionally substituted with one or more substituents independently selected from halogen, —C(═O)OR⁷, —C(═O)NR¹R², —OH, aryl (optionally substituted with —OH, halogen, —C(═O)OR⁷, —C(═O)NR⁷R⁸, C₁-C₆alkyl, C₁-C₆alkoxy, —NR⁷R⁸), and heteroaryl (optionally substituted with —OH, halogen, —C(═O)OR⁷, —C(═O)NR⁷R⁸, C₁-C₆alkyl, C₁-C₆alkoxy, —NR⁷R⁸, C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, C₂-C₈heterocycloalkyl, or —O—C₂-C₈heterocycloalkyl); and

wherein the C₃-C₈cycloalkyl, aryl and heteroaryl are optionally substituted with one or more substituents independently selected from —OH, halogen, —C(═O)OR⁷, —C(═O)NR¹R², C₁-C₆alkyl, C₁-C₆alkoxy, C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, C₂-C₈heterocycloalkyl, —O—C₂-C₈heterocycloalkyl, and —NR⁷R⁸;

or R¹⁰and R¹¹are taken together with the N to which they are attached to form a C₂-C₈heterocycloalkyl optionally substituted with one or more substituents independently selected from halogen, —OH, C₁-C₆alkyl, and C₁-C₆alkoxy;

R¹²is selected from optionally substituted C₁-C₆alkyl, optionally substituted C₃-C₈cycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;

provided that:

(a) at least one of R_Cis not —NHCOR⁶when R_Lis —NHCOR¹²and Ar_Cis heterocycloalkenylene or heteroarylene; or

(b) at least one of R_Cis not -Me when R_Lis —OMe; or

(d) at least one of R_Cis not —OH when R_Lis —C(═O)OH; or

(e) at least one of R_Cis not -Me when R_Lis —C(═O)OH; or

(f) at least one of R_Cis not -Et when R_Lis —OMe; or

(g) at least one of R_Cis not optionally substituted benzoxazolyl when R_Lis —C(═O)OH; or

(h) at least one of R_Cis not optionally substituted isoindoline-1,3-dione when R_Lis —C(═O)OH.

B) RG6 and RG5 do not form a C₂-C₈heterocycloalkyl;

RG1 is R5; RG2 is R1; RG3 is R6; RG4 is R20; RG5 is R4; RG6 is R10; AG1 is A;

thus the Formula (0) can be represented as the Formula (VII):

embedded image

or a pharmaceutically acceptable salt thereof, wherein:

A is selected from:

embedded image

R¹is selected from hydrogen, halogen, hydroxyl, C₁-C₆alkyl, and C₁-C₆alkoxy,

wherein the C₁-C₆alkyl and C₁-C₆alkoxy are optionally substituted with one or more halogens;

each R²and R³is independently selected from hydrogen and C₁-C₆alkyl,

wherein the C₁-C₆alkyl is optionally substituted with one or more halogens;

or R²and R³are taken together with the N to which they are attached to form a 3- to 10-membered heterocycle optionally substituted with one or more substituents independently selected from C₁-C₆alkyl;

R⁴is selected from hydrogen, halogen, C₁-C₆alkyl, and C₁-C₆alkoxy,

wherein the C₁-C₆alkyl and C₁-C₆alkoxy are optionally substituted with one or more substituents independently selected from halogens;

R⁵is selected from —C(═O)OR¹⁵, —C(═O)NR²R³, —S(═O)₂NR²R³, —C(═O)NHR¹⁵, —CH₂OH, 3-hydroxyoxetan-3-yl, and —NH₂;

R⁶is selected from hydrogen, halogen, hydroxyl, 5-membered heteroaryl, C₁-C₆alkyl, —C(═O)OR¹⁵, —C(═O)R¹², —C(═O)NHR¹⁵, and —C(═O)N═S(═X³)(CH₃)₂,

wherein the C₁-C₆alkyl are optionally substituted with one or more R⁹, and

wherein 5-membered heteroaryl contains at least two heteroatoms and is optionally substituted with one or more substituents independently selected from R¹⁷;

R⁷is selected from hydrogen, —NO₂, C₁-C₆alkyl, C₁-C₆alkoxy, C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, 3- to 10-membered heterocycloalkyl, —O—(3- to 10-membered heterocycloalkyl), aryl, and heteroaryl,

wherein the C₁-C₆alkyl and C₁-C₆alkoxy are optionally substituted with one or more halogens, and

wherein C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, 3- to 10-membered heterocycloalkyl, —O—(3- to 10-membered heterocycloalkyl), aryl and heteroaryl are optionally substituted with one or more R²⁴;

R⁸is selected from hydrogen, —NO₂, C₁-C₆alkyl, aryl, and heteroaryl,

wherein the C₁-C₆alkyl and C₁-C₆alkoxy are optionally substituted with one or more substituents independently selected at each occurrence from halogen; and

wherein aryl and heteroaryl are optionally substituted with one or more substituents independently selected at each occurrence from R²³;

or R⁷and R⁸are taken together to form a C₅-C₁₀carbocycle or 5- to 10-membered heterocycle,

wherein C₅-C₁₀carbocycle and 5- to 10-membered heterocycle are optionally substituted with one or more substituents independently selected from halogen, hydroxyl, —NO₂, C₁-C₆alkyl, C₁-C₆alkoxy, C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, 3- to 10-membered heterocycloalkyl, —O—(3- to 10-membered heterocycloalkyl), aryl, and heteroaryl,

wherein the C₁-C₆alkyl and C₁-C₆alkoxy are optionally substituted with one or more halogens, and

wherein aryl, heteroaryl, C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, 3- to 10-membered heterocycloalkyl, and —O-(3- to 10-membered heterocycloalkyl) are optionally substituted with one or more R²³;

each R⁹is independently selected from hydroxy and —COOH;

R¹⁰is selected from —C(═O)—X¹—, —CH₂—X¹—, —X¹—C(═O)—, and —X¹—CH₂—;

R¹¹is selected from hydrogen, —NO₂, C₁-C₆alkyl, C₁-C₆alkoxy, C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, 3- to 10-membered heterocycloalkyl, and —O—(3- to 10-membered heterocycloalkyl),

wherein the C₁-C₆alkyl and C₁-C₆alkoxy are optionally substituted with one or more halogens, and

wherein C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, 3- to 10-membered heterocycloalkyl, and —O—(3- to 10-membered heterocycloalkyl) are optionally substituted with one or more R²³;

R¹²is selected from alanine, arginine, asparagine, aspartic acid, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine, wherein the point of attachment of R¹²is a nitrogen atom;

R¹⁴is selected from hydrogen, halogen, hydroxyl, nitrile, —C(═O)CR¹⁵and —C(═O)OR¹⁵;

each R¹⁵is independently selected from hydrogen and C₁-C₆alkyl, -heterocyclyl,

wherein the C₁-C₆alkyl is optionally substituted with one or more substituents independently selected at each occurrence from —C(═O)NR²R³, -heterocyclyl, —NR²R³;

wherein the heterocyclyl is optionally substituted with one or more substituents independently selected at each occurrence from R²and R³.

R¹⁷is selected from C₁-C₆alkyl, aryl, and 6-membered heteroaryl,

wherein the C₁-C₆alkyl is optionally substituted with one or more hydroxy, and

wherein aryl and 6-membered heteroaryl are optionally substituted with one or more substituents independently selected from halogen, —R², and —OR²;

R²⁰is selected from hydrogen, halogen, hydroxyl, —COOH, —NC(═O)R², —OR², 5-membered heteroaryl, C₁-C₆alkyl, —C(═O)N═S(═X³)(CH₃)₂, —CH₂(OH)CH₂OH and —NH—SO₂—R²,

wherein the 5-membered heteroaryl contains at least two heteroatoms, and

wherein the C₁-C₆alkyl is optionally substituted with one or more substituents independently selected from 5-membered heteroaryl, wherein the 5-membered heteroaryl contains at least two heteroatoms;

R²¹is selected from hydrogen and nitrile;

R²²is selected from hydrogen and hydroxy;

each R²³is independently selected from halogen, C₁-C₆alkyl, C₁-C₆alkoxy,

wherein the C₁-C₆alkyl and C₁-C₆alkoxy are optionally substituted with one or more substituents independently selected from halogens;

each R²⁴is independently selected from halogen, C₁-C₆alkyl, C₁-C₆alkoxy, 5-membered heteroaryl

wherein the C₁-C₆alkyl and C₁-C₆alkoxy are optionally substituted with one or more substituents independently selected from halogens;

each X¹is independently selected from —NR²— and —CR²R³—; and

each X³is independently selected from NH and O.

Disclosed herein also a compound of Formula (I):

embedded image

or a pharmaceutically acceptable salt thereof, wherein:

Z is selected from —C(═O)— and —C(R^a)(R^b)—;

R^aand R^bare independently selected from hydrogen, hydroxyl, halogen, optionally substituted C₁-C₆alkyl, optionally substituted C₁-C₆alkoxy, optionally substituted C₃-C₈cycloalkyl, optionally substituted —O—C₃-C₈cycloalkyl, optionally substituted C₂-C₈heterocycloalkyl, and optionally substituted —O—C₂-C₈heterocycloalkyl;

Ar_cis selected from C₃-C₈cycloalkenylene, C₂-C₈heterocycloalkenylene, arylene, and heteroarylene;

wherein Ar_cis substituted with one or more R_C;

each R¹and R²is independently selected from hydrogen, optionally substituted C₁-C₆alkyl, and optionally substituted C₃-C₈cycloalkyl;

wherein the —OC(═O)C₁-C₆alkyl and —C(═O)O—C₁-C₆alkyl are optionally substituted with one or more substituents independently selected from halogen, —OH, and —NR⁷R⁸; and

wherein the C₂-C₈heterocycloalkyl, C₃-C₈cycloalkyl, aryl and heteroaryl are optionally substituted with one or more substituents independently selected from —OH, halogen, —C(═O)OR⁷, —(C═O)NR⁷R⁸, C₁-C₆alkyl, C₁-C₆alkoxy, C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, C₂-C₈heterocycloalkyl, —O—C₂-C₈heterocycloalkyl, and —NR⁷R⁸;

each R⁶are independently selected from optionally substituted C₁-C₆alkyl, optionally substituted C₃-C₈cycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;

each R⁷and R⁸is independently selected from hydrogen and C₁-C₆alkyl;

or R⁷and R⁸are taken together with the N to which they are attached to form a C₂-C₈heterocycloalkyl optionally substituted with one or more C₁-C₆alkyl substituents;

wherein the C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, C₂-C₈heterocycloalkyl, and —O—C₂-C₈heterocycloalkyl are optionally substituted with one or more substituents independently selected from halogen, —C(═O)OR⁷, —C(═O)NR⁷R⁸, —OH, C₁-C₆alkyl, C₁-C₆alkoxy, aryl, heteroaryl, C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, C₂-C₈heterocycloalkyl, and —O—C₂-C₈heterocycloalkyl; R_Lis selected from —OH, —CN, optionally substituted C₁-C₆hydroxyalkyl, optionally substituted C₁-C₆alkoxy, optionally substituted heteroaryl, —C(═O)OH, —C(═O)OR⁹, —C(═O)NR¹⁰R¹¹, —S(═O)₂NR¹⁰R¹¹, —NHC(═O)H, —NHC(═O)R¹², —NHS(═O)₂R¹²and —C(═O)NHS(═O)₂R¹²;

wherein the —OC(═O)C₁-C₆alkyl and —C(═O)O—C₁-C₆alkyl are optionally substituted with one or more substituents independently selected from halogen, —OH, and —NR⁷R⁸; and

wherein the C₂-C₈heterocycloalkyl, C₃-C₈cycloalkyl, aryl and heteroaryl are optionally substituted with one or more substituents independently selected from —OH, halogen, —C(═O)OR⁷, —(C═O)NR⁷R⁸, C₁-C₆alkyl, C₁-C₆alkoxy, C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, C₂-C₈heterocycloalkyl, —O—C₂-C₈heterocycloalkyl, and —NR⁷R⁸;

R¹²is selected from optionally substituted C₁-C₆alkyl, optionally substituted C₃-C₈cycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;

provided that:

(a) at least one of R_Cis not —NHCOR⁶when R_Lis —NHCOR¹²and Ar_Cis heterocycloalkenylene or heteroarylene; or

(b) at least one of R_Cis not -Me when R_Lis —OMe; or

(d) at least one of R_Cis not —OH when R_Lis —C(═O)OH; or

(e) at least one of R_Cis not -Me when R_Lis —C(═O)OH; or

(f) at least one of R_Cis not -Et when R_Lis —OMe; or

(g) at least one of R_Cis not optionally substituted benzoxazolyl when R_Lis —C(═O)OH; or

(h) at least one of R_Cis not optionally substituted isoindoline-1,3-dione when R_Lis —C(═O)OH.

In some embodiments of a compound of Formula (I), Z is —C(═O)—. In some embodiments of a compound of Formula (I), Z is —C(R^a)(R^b)—, and R^aand R^bare each independently selected from hydrogen, halogen, —OH, C_1-6alkyl, and C_1-6alkoxy. In some embodiments of a compound of Formula (I), Z is —C(R^a)(R^b)—, and R^aand R^bare each independently selected from hydrogen, fluorine, and methyl. In some embodiments of a compound of Formula (I), Z is —CH₂—.

In some embodiments of a compound of Formula (I), Ar_Cis arylene or heteroarylene; each substituted with one or more R_C. In some embodiments of a compound of Formula (I), Ar_Cis arylene substituted with one or two R_C. In some embodiments of a compound of Formula (I), Ar_Cis a phenylene substituted with one or two R_C. In some embodiments of a compound of Formula (I), Ar_Cis arylene substituted with one R_C. In some embodiments of a compound of Formula (I), Ar_Cis phenylene substituted with one R_C. In some embodiments of a compound of Formula (I), Ar_Cis heteroarylene substituted with one or two R_C. In some embodiments of a compound of Formula (I), Ar_Cis a monocyclic heteroarylene substituted with one or two R_C. In some embodiments of a compound of Formula (I), Ar_Cis heteroarylene substituted with one R_C. In some embodiments of a compound of Formula (I), Ar_Cis thiophenylene substituted with one R_C. In some embodiments of a compound of Formula (I), Ar_Cis thiophenylene substituted with two R_C.

In some embodiments of a compound of Formula (I), each R_Care independently selected from —CN, —OH, halogen, optionally substituted C₁-C₆alkyl, optionally substituted C₃-C₈cycloalkyl, optionally substituted C₁-C₆alkoxy, optionally substituted heteroaryl, optionally substituted aryl, —C(═O)OH, —C(═O)OR³, and —C(═O)NR⁴R⁵; wherein the C₁-C₆alkyl and C₁-C₆alkoxy are optionally substituted with one or more substituent independently selected from halogen, —C(═O)OR⁷, —C(═O)NR¹R², —OH, aryl, heteroaryl, C₁-C₆alkoxy, C₃-C₈cycloalkyl, and C₂-C₈heterocycloalkyl; and wherein the C₃-C₈cycloalkyl, aryl and heteroaryl are optionally substituted with one or more substituents independently selected from —OH, halogen, —C(═O)OR⁷, —C(═O)NR¹R², C₁-C₆alkyl, C₁-C₆alkoxy, and —NR⁷R⁸. In some embodiments of a compound of Formula (I), each R_Care independently selected from —CN, —OH, halogen, C₁-C₆alkyl, C₁-C₆hydroxyalkyl, C₁-C₆hydroxycycloalkyl, C₁-C₆alkoxy, heteroaryl, aryl, —C(═O)OH, —C(═O)OR³, and —C(═O)NR⁴R⁵. In some embodiments of a compound of Formula (I), one R_Cis selected from —CN, —OH, halogen, C₁-C₆alkyl, C₁-C₆hydroxyalkyl, C₁-C₆hydroxycycloalkyl, C₁-C₆alkoxy, heteroaryl, aryl, —C(═O)OH, —C(═O)OR³, and —C(═O)NR⁴R⁵; and a second R_Cis selected from —OH, halogen, C₁-C₆alkyl, C₁-C₆alkoxy, or aryl. In some embodiments of a compound of Formula (I), each R_Care independently selected from —CN, —C(═O)OH, —C(═O)OR³, and tetrazolyl. In some embodiments of a compound of Formula (I), one R_Cis selected from —CN, —C(═O)OH, —C(═O)OR³, and tetrazolyl; and a second R_Cis selected from —OH, halogen, C₁-C₆alkyl, C₁-C₆alkoxy, or aryl.

In some embodiments of a compound of Formula (I), each R³is independently selected from C₁-C₆alkyl optionally substituted with one or more of —OH, optionally substituted —OC(═O)C₁-C₆alkyl, C₁-C₆alkoxy, —C(═O)OH, and —NR¹R²; wherein the —OC(═O)C₁-C₆alkyl is optionally substituted with one or more of —OH and —NR⁷R⁸. In some embodiments of a compound of Formula (I), each R³is independently selected from C₁-C₆alkyl (optionally substituted with one or more of —OH, C₁-C₆alkoxy, and —NR¹R²) or —C₁-C₆alkylene-OC(═O)C₁-C₆alkyl (wherein C₁-C₆alkyl is optionally substituted with one or more of —OH and —NR⁷R⁸). In some embodiments of a compound of Formula (I), each R³is independently C₁-C₆alkyl optionally substituted with one or more of —OH, C₁-C₆alkoxy, and —NR¹R². In some embodiments of a compound of Formula (I), each R³is independently selected from

embedded image

In some embodiments of a compound of Formula (I), each R⁴and R⁵is independently selected from hydrogen and C₁-C₆alkyl; or R⁴and R⁵are taken together with the N to which they are attached to form a C₂-C₈heterocycloalkyl, optionally substituted with one or more C₁-C₆alkyl substituents. In some embodiments of a compound of Formula (I), each R⁴and R⁵are hydrogen.

In some embodiments of a compound of Formula (I), at least one of R_Cis —CN. In some embodiments of a compound of Formula (I), at least one of R_Cis —C(═O)OH. In some embodiments of a compound of Formula (I), at least one of R_Cis tetrazolyl.

In some embodiments of a compound of Formula (I), Ar_Tis selected from pyridinyl, pyrimidinyl, pyrazinyl, phenyl, thiophenyl, pyrazolyl, and imidazolyl, wherein Ar_Tis optionally substituted by one or more substituents independently selected from halogen, —OH, —NR⁷R⁸, —CN, C₁-C₆alkyl, and C₁-C₆alkoxy. In some embodiments of a compound of Formula (I), Ar_Tis phenyl optionally substituted by one or more substituents selected from halogen, —OH, —NR⁷R⁸, —CN, C₁-C₆alkyl, and C₁-C₆alkoxy.

In some embodiments of a compound of Formula (I), each R_Mis independently selected from hydrogen, halogen, —OH, —CN, C₁-C₆alkyl, and C₁-C₆alkoxy. In some embodiments of a compound of Formula (I), one R_Mis selected from hydrogen, halogen, —OH, —CN, C₁-C₆alkyl, and C₁-C₆alkoxy; and each other R_Mis independently selected from hydrogen and halogen. In some embodiments of a compound of Formula (I), each R_Mis hydrogen.

In some embodiments of a compound of Formula (I), R_Lis selected from optionally substituted heteroaryl, —C(═O)OH, —C(═O)OR⁹, —C(═O)NR¹⁰R¹¹, —NHC(═O)R¹², —NHS(═O)₂R¹², and —C(═O)NHS(═O)₂R¹²;

In some embodiments of a compound of Formula (I), R_Lis —C(═O)OR⁹and R⁹is C₁-C₆alkyl optionally substituted with —NR¹R². In some embodiments of a compound of Formula (I), R_Lis —C(═O)OR⁹and R⁹is C₁-C₆alkyl optionally substituted with —NR¹R²and each R¹and R²is independently selected from hydrogen or C₁-C₆alkyl. In some embodiments of a compound of Formula (I), R_Lis —C(═O)OR⁹and R⁹is selected from

embedded image

In some embodiments of a compound of Formula (I), R_Lis —C(═O)NR¹⁰R¹¹, and each R¹⁰and R¹¹is independently selected from hydrogen and C₁-C₆alkyl optionally substituted with one or more substituents independently selected from —C(═O)OH, —C(═O)NR¹R², —OH, aryl, and heteroaryl; or R¹⁰and R¹¹are taken together with the N to which they are attached to form a C₂-C₈heterocycloalkyl, optionally substituted with one or more C₁-C₆alkyl substituents. In some embodiments of a compound of Formula (I), R_Lis —C(═O)NR¹⁰R¹¹; R¹⁰is hydrogen; and R¹¹is selected from hydrogen

embedded image

In some embodiments of a compound of Formula (I), R_Lis monocyclic heteroaryl, optionally substituted with one or more substituents independently selected from —OH, C₁-C₆alkyl, C₁-C₆hydroxyalkyl, C₁-C₆alkoxy, —OC(═O)C₁-C₆alkyl, (C₁-C₄alkylene)-O—C(═O)C₁-C₆alkyl, —C(═O)R¹², aryl, heteroaryl, C₁-C₆alkyl-(aryl), and C₁-C₆alkyl-(heteroaryl). In some embodiments of a compound of Formula (I), R_Lis tetrazolyl. In some embodiments of a compound of Formula (I), R_Lis triazolyl, optionally substituted with one or more substituents independently selected from —OH, C₁-C₆alkyl, C₁-C₆hydroxyalkyl, C₁-C₆alkoxy, —OC(═O)C₁-C₆alkyl, (C₁-C₄alkylene)-O—C(═O)C₁-C₆alkyl, —C(═O)R¹², aryl, heteroaryl, C₁-C₆alkyl-(aryl), and C₁-C₆alkyl-(heteroaryl). In some embodiments of a compound of Formula (I), R_Lis triazolyl.

In some embodiments of a compound of Formula (I), each R¹and R²is independently selected from hydrogen and C₁-C₆alkyl; or R¹and R²are taken together with the N to which they are attached to form a C₂-C₈heterocycloalkyl, optionally substituted with one or more C₁-C₆alkyl substituents. In some embodiments of a compound of Formula (I), each R¹, R², R⁷and R⁸is independently selected from hydrogen and C₁-C₆alkyl. In some embodiments of a compound of Formula (I), each R¹and R⁸is hydrogen and each R²and R⁷is independently selected from hydrogen and C₁-C₆alkyl.

In some embodiments of a compound of Formula (I), R¹, R², R⁷and R⁸are each hydrogen. In some embodiments of a compound of Formula (I), the compound or a pharmaceutically acceptable salt thereof is in the form of a prodrug. In some embodiments of a compound of Formula (I), the compound or a pharmaceutically acceptable salt thereof is in the form of a prodrug and the prodrug comprises an ester moiety. In some embodiments of a compound of Formula (I), the compound or a pharmaceutically acceptable salt thereof is in the form of a prodrug and the prodrug comprises an amide moiety.

In certain embodiments, the disclosure provides compounds of Formula (Ia) or Formula (Ib):

embedded image

or a pharmaceutically acceptable salt thereof wherein:

Ar_Cis selected from arylene and heteroarylene; wherein Ar_Cis substituted with one or more R_C;

each R_Care independently selected from halogen, —CN, optionally substituted C₁-C₆alkyl, optionally substituted C₁-C₆alkoxy, optionally substituted heteroaryl, optionally substituted aryl, —C(═O)OH, —C(═O)OR³, —C(═O)NR⁴R⁵, —S(═O)₂NR⁴R⁵, —NHS(═O)₂R⁶, and —C(═O)NHS(═O)₂R⁶;

wherein the C₁-C₆alkyl and C₁-C₆alkoxy are optionally substituted with one or more substituents independently selected from halogen, —C(═O)OH, —C(═O)NR¹R², —OH, aryl, heteroaryl, C₃-C₈cycloalkyl, and C₂-C₈heterocycloalkyl; and

wherein the aryl and heteroaryl are optionally substituted with one or more substituents independently selected from —OH, halogen, —C(═O)OH, —C(═O)NR¹R², C₁-C₆alkyl, C₁-C₆alkoxy, and —NR⁷R⁸;

each R¹and R²is independently selected from hydrogen and C₁-C₆alkyl optionally substituted with one or more substituents independently selected from halogen, —C(═O)OH, —C(═O)NR⁷R⁸, —OH, aryl, heteroaryl, C₃-C₈cycloalkyl, and C₂-C₈heterocycloalkyl;

each R³is independently C₁-C₆alkyl optionally substituted with one or more substituents independently selected from —OH, optionally substituted —OC(═O)C₁-C₆alkyl, optionally substituted —C(═O)OC₁-C₆alkyl, C₁-C₆alkoxy, —C(═O)OH, and —NR¹R²; wherein the —OC(═O)C₁-C₆alkyl and —C(═O)OC₁-C₆alkyl are optionally substituted with one or more substituents independently selected from —OH and —NR⁷R⁸;

each R⁴and R⁵is independently selected from hydrogen and C₁-C₆alkyl optionally substituted with one or more substituents independently selected from halogen, —C(═O)OR⁷, —C(═O)NR¹R², —OH, aryl, heteroaryl, C₃-C₈cycloalkyl, and C₂-C₈heterocycloalkyl;

each R⁶are independently selected from optionally substituted C₁-C₆alkyl and optionally substituted aryl;

wherein the alkyl is optionally substituted with one or more substituents independently selected from halogen, —C(═O)OR⁷, —C(═O)NR¹R², —OH, aryl, heteroaryl, C₃-C₈cycloalkyl, and C₂-C₈heterocycloalkyl; and

wherein the aryl is optionally substituted with one or more substituents independently selected from —OH, halogen, —C(═O)OR⁷, —C(═O)NR⁷R⁸, C₁-C₆alkyl, C₁-C₆alkoxy, and —NR⁷R⁸;

each R⁷and R⁸is independently selected from hydrogen and C₁-C₆alkyl;

or R⁷and R⁸are taken together with the N to which they are attached to form an optionally substituted C₂-C₈heterocycloalkyl optionally substituted with one or more C₁-C₆alkyl substituents;

Ar_Tis selected from pyridinyl, pyrimidinyl, pyrazinyl, phenyl, thiophenyl, pyrazolyl, and imidazolyl, wherein Ar_Tis optionally substituted by one or more substituents selected from halogen, —OH, —NR⁷R⁸, —CN, C₁-C₆alkyl, and C₁-C₆alkoxy;

R_Lis selected from optionally substituted heteroaryl, —C(═O)OH, —C(═O)OR⁹, —C(═O)NR¹⁰R¹¹, —NHC(═O)R¹², —NHS(═O)₂R¹², or —C(═O)NHS(═O)₂R¹²; wherein the heteroaryl is optionally substituted with one or more substituents independently selected from C₁-C₆alkyl, —OC(═O)C₁-C₆alkyl, (C₁-C₄alkylene)-O—C(═O)C₁-C₆alkyl, —C(═O)NR¹R², —C(═O)R¹², aryl, and C₁-C₆alkyl-(aryl);

R⁹is C₁-C₆alkyl optionally substituted with one or more substituent independently selected from —OH and —NR¹R²;

each R¹⁰and R¹¹is independently selected from hydrogen and C₁-C₆alkyl optionally substituted with one or more substituents independently selected from —C(═O)OH, —C(═O)NR¹R², —OH, aryl, hydroxyaryl and heteroaryl;

or R¹⁰and R¹¹are taken together with the N to which they are attached to form a C₂-C₈heterocycloalkyl optionally substituted with one or more C₁-C₆alkyl substituents;

R¹²is selected from C₁-C₆alkyl and aryl optionally substituted with one or more C₁-C₆alkyl substituents;

provided that at least one of R_Cis not —OH when R_Lis —C(═O)OH in Formula (Ia) or at least one of R_Cis not —OEt when R_Lis —C(═O)OH in Formula (Ia).

In some embodiments of a compound of Formula (Ia) or Formula (Ib), Ar_Cis arylene substituted with one or two R_C. In some embodiments of a compound of Formula (Ia) or Formula (Ib), Ar_Cis a monocyclic arylene substituted with one or two R_C. In some embodiments of a compound of Formula (Ia) or Formula (Ib), Ar_Cis arylene substituted with one R_C. In some embodiments of a compound of Formula (Ia) or Formula (Ib), Ar_Cis phenylene substituted with one R_C. In some embodiments of a compound of Formula (Ia) or Formula (Ib), Ar_Cis heteroarylene substituted with one or two R_C. In some embodiments of a compound of Formula (Ia) or Formula (Ib), Ar_Cis a monocyclic heteroarylene substituted with one or two R_C. In some embodiments of a compound of Formula (Ia) or Formula (Ib), Ar_Cis heteroarylene substituted with one R_C. In some embodiments of a compound of Formula (Ia) or Formula (Ib), Ar_Cis thiophenylene substituted with one R_C. In some embodiments of a compound of Formula (Ia) or Formula (Ib), Ar_Cis thiophenylene substituted with two R_C.

In some embodiments of a compound of Formula (Ia) or Formula (Ib), each R_Care independently selected from —OH, —CN, halogen, C₁-C₆alkyl, C₁-C₆alkoxy, C₁-C₆hydroxyalkyl, heteroaryl, aryl, —C(═O)OH, —C(═O)OR³, and —C(═O)NR⁴R⁵. In some embodiments of a compound of Formula (Ia) or Formula (Ib), each R_Care independently selected from —CN, halogen, C₁-C₆alkyl, C₁-C₆hydroxyalkyl, heteroaryl, aryl, —C(═O)OH, —C(═O)OR³, and —C(═O)NR⁴R⁵. In some embodiments of a compound of Formula (Ia) or Formula (Ib), one R_Cis selected from —OH, —CN, C₁-C₆hydroxyalkyl, heteroaryl, aryl, —C(═O)OH, —C(═O)OR³, and —C(═O)NR⁴R⁵; and a second R_Cis selected from —OH, halogen, C₁-C₆alkyl, C₁-C₆alkoxy, and aryl. In some embodiments of a compound of Formula (Ia) or Formula (Ib), each R_Care independently selected from —CN, —C(═O)OH, —C(═O)OR³, and tetrazolyl. In some embodiments of a compound of Formula (Ia) or Formula (Ib), one R_Cis selected from —CN, —C(═O)OH, —C(═O)OR³, and tetrazolyl; and a second R_Cis selected from —OH, halogen, C₁-C₆alkyl, C₁-C₆alkoxy, and aryl.

In some embodiments of a compound of Formula (Ia) or Formula (Ib), each R³is independently C₁-C₆alkyl optionally substituted with one or more substituent selected from —OH, optionally substituted —OC(═O)C₁-C₆alkyl, optionally substituted —C(═O)OC₁-C₆alkyl, C₁-C₆alkoxy, —C(═O)OH, —NR¹R²; wherein the —OC(═O)C₁-C₆alkyl and —C(═O)OC₁-C₆alkyl are optionally substituted with one or more substituent independently selected from —OH and —NR⁷R⁸. In some embodiments of a compound of Formula (Ia) or Formula (Ib), each R³is independently C₁-C₆alkyl optionally substituted with one or more substituents independently selected from C₁-C₆alkoxy and —NR¹R². In some embodiments of a compound of Formula (Ia) or Formula (Ib), each R³is independently selected from

embedded image

In some embodiments of a compound of Formula (Ia) or Formula (Ib), each R⁴and R⁵is independently selected from hydrogen and C₁-C₆alkyl; or R⁴and R⁵are taken together with the N to which they are attached to form a C₂-C₈heterocycloalkyl, optionally substituted with one or more C₁-C₆alkyl substituents. In some embodiments of a compound of Formula (Ia) or Formula (Ib), each R⁴and R⁵is hydrogen. In some embodiments of a compound of Formula (Ia) or Formula (Ib), at least one of R_Cis —CN. In some embodiments of a compound of Formula (Ia) or Formula (Ib), at least one of R_Cis —C(═O)OH. In some embodiments of a compound of Formula (Ia) or Formula (Ib), at least one of R_Cis tetrazolyl.

In some embodiments of a compound of Formula (Ia) or Formula (Ib), Ar_Tis phenyl optionally substituted by one or more substituents independently selected from halogen, —OH, —NR⁷R⁸, —CN, C₁-C₆alkyl, and C₁-C₆alkoxy. In some embodiments of a compound of Formula (Ia) or Formula (Ib), Ar_Tis selected from pyridinyl, pyrimidinyl, pyrazinyl, thiophenyl, pyrazolyl and imidazolyl, wherein Ar_Tis optionally substituted by one or more substituents independently selected from halogen, —OH, —NR⁷R⁸, —CN, C₁-C₆alkyl, and C₁-C₆alkoxy. In some embodiments of a compound of Formula (Ia) or Formula (Ib), Ar_Tis selected from thiophenyl, pyrazolyl, and imidazolyl, wherein Ar_Tis optionally substituted by one or more substituents independently selected from halogen, —OH, —NR⁷R⁸, —CN, C₁-C₆alkyl, and C₁-C₆alkoxy. In some embodiments of a compound of Formula (Ia) or Formula (Ib), Ar_Tis imidazolyl optionally substituted by methyl.

In some embodiments of a compound of Formula (Ia) or Formula (Ib), R_Lis —C(═O)OR⁹. In some embodiments of a compound of Formula (Ia) or Formula (Ib), R_Lis —C(═O)OR⁹and R⁹is selected from

embedded image

In some embodiments of a compound of Formula (Ia) or Formula (Ib), R_Lis —C(═O)NR¹⁰R¹¹; R¹⁰is hydrogen; and R¹¹is selected from hydrogen,

embedded image

In some embodiments of a compound of Formula (Ia) or Formula (Ib), R_Lis —NHC(═O)R¹²and R¹²is methyl. In some embodiments of a compound of Formula (Ia) or Formula (Ib), R_Lis —NHS(═O)₂R¹²and R¹²is selected from phenyl, toluyl, and methyl. In some embodiments of a compound of Formula (Ia) or Formula (Ib), R_Lis —C(═O)NHS(═O)R¹². In some embodiments of a compound of Formula (Ia) or Formula (Ib), R_Lis —C(═O)NHS(═O)R¹²and R¹²is selected from methyl, butyl, and phenyl. In some embodiments of a compound of Formula (Ia) or Formula (Ib), R_Lis —C(═O)OH. In some embodiments of a compound of Formula (Ia) or Formula (Ib), R_Lis tetrazolyl. In some embodiments of a compound of Formula (Ia) or Formula (Ib), R_Lis triazolyl, optionally substituted with one or more substituents independently selected from C₁-C₆alkyl, —OC(═O)C₁-C₆alkyl, (C₁-C₄alkylene)-O—C(═O)C₁-C₆alkyl, —C(═O)NR¹R², —C(═O)R¹², aryl, and C₁-C₆alkyl-(aryl). In some embodiments of a compound of Formula (Ia) or Formula (Ib), R_Lis triazolyl.

In some embodiments of a compound of Formula (Ia) or Formula (Ib), each R¹and R²is independently selected from hydrogen and C₁-C₆alkyl, or R¹and R²are taken together with the N to which they are attached to form an optionally substituted C₂-C₈heterocycloalkyl optionally substituted with one or more C₁-C₆alkyl substituents. In some embodiments of a compound of Formula (Ia) or Formula (Ib), each R¹, R², R⁷and R⁸is hydrogen.

In some embodiments of a compound of Formula (Ia) or Formula (Ib), the compound or a pharmaceutically acceptable salt thereof is in the form of a prodrug. In some embodiments of a compound of Formula (Ia) or Formula (Ib), the compound or a pharmaceutically acceptable salt thereof is in the form of a prodrug and the prodrug comprises an ester moiety. In some embodiments of a compound of Formula (Ia) or Formula (Ib), the compound or a pharmaceutically acceptable salt thereof is in the form of a prodrug and the prodrug comprises an amide moiety.

In certain embodiments, the disclosure provides compounds of Formula (II):

embedded image

a prodrug thereof, a pharmaceutically acceptable salt thereof, or combination thereof, wherein:

Z is —C(═O)— or —C(R^a)(R^b)—;

R^aand R^bare each independently selected from hydrogen, halogen, —OH, C₁-C₆alkyl, C₁-C₆alkoxy;

Ar_Cis selected from arylene and heteroarylene; wherein Ar_Cis substituted with one or more R_C;

each R_Cis independently selected from halogen, —CN, optionally substituted C₁-C₆alkyl, optionally substituted heteroaryl, optionally substituted aryl, —C(═O)OH, —C(═O)OR³, —C(═O)NR⁴R⁵, —S(═O)₂NR⁴R⁵, —NHS(═O)₂R⁶, and —C(═O)NHS(═O)₂R⁶;

wherein the aryl and heteroaryl are optionally substituted with one or more substituents independently selected from —OH, halogen, —C(═O)OR⁷, —C(═O)NR¹R², C₁-C₆alkyl, C₁-C₆alkoxy, and —NR⁷R⁸;

each R¹and R²is independently selected from hydrogen and C₁-C₆alkyl optionally substituted with one or more substituents independently selected from halogen, —C(═O)OR⁷, —C(═O)NR⁷R⁸, —OH, aryl, heteroaryl, C₃-C₈cycloalkyl, and C₂-C₈heterocycloalkyl;

or R¹and R²are taken together with the N to which they are attached to form a C₂-C₈heterocycloalkyl optionally substituted with one or more C₁-C₆alkyl substituents;

wherein the —OC(═O)C₁-C₆alkyl and —C(═O)OC₁-C₆alkyl are optionally substituted with one or more substituents independently selected from with —OH or —NR⁷R⁸;

each R⁴and R⁵is independently selected from hydrogen and C₁-C₆alkyl optionally substituted with one or more substituents independently selected from halogen, —C(═O)OH, —C(═O)NR¹R², —OH, aryl, heteroaryl, C₃-C₈cycloalkyl, and C₂-C₈heterocycloalkyl;

or R⁴and R⁵are taken together with the N to which they are attached to form a C₂-C₈heterocycloalkyl optionally substituted with one or more C₁-C₆alkyl substituents;

each R⁶are independently selected from optionally substituted C₁-C₆alkyl and optionally substituted aryl;

each R⁷and R⁸is independently selected from hydrogen and C₁-C₆alkyl;

each R_Mis independently selected from hydrogen, halogen, —OH, —CN, optionally substituted C₁-C₆alkyl, and optionally substituted C₁-C₆alkoxy;

wherein the C₁-C₆alkyl and C₁-C₆alkoxy are optionally substituted with one or more substituents independently selected from halogen, —C(═O)OR⁷, —C(═O)NR⁷R⁸, —OH, aryl, heteroaryl, C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, C₂-C₈heterocycloalkyl, and —O—C₂-C₈heterocycloalkyl;

R_Lis selected from optionally substituted heteroaryl, —C(═O)OH, —C(═O)OR⁹, —C(═O)NR¹⁰R¹¹, —NHC(═O)R¹², —NHS(═O)₂R¹², or —C(═O)NHS(═O)₂R¹²;

wherein the heteroaryl is optionally substituted with one or more substituents independently selected from C₁-C₆alkyl, —OC(═O)C₁-C₆alkyl, (C₁-C₄alkylene)-O—C(═O)C₁-C₆alkyl, —C(═O)NR¹⁰R¹¹, —C(═O)R¹², aryl, or C₁-C₆alkyl-(aryl);

R⁹is C₁-C₆alkyl optionally substituted with one or more substituents independently selected from —OH and —NR¹R²;

each R¹⁰and R¹¹is independently selected from hydrogen and C₁-C₆alkyl optionally substituted with one or more substituents independently selected from —C(═O)OR⁷, —C(═O)NR¹R², —OH, aryl, hydroxyaryl or heteroaryl;

or R¹⁰and R¹¹are taken together with the N to which they are attached to form a C₂-C₈heterocycloalkyl optionally substituted with one or more C₁-C₆alkyl substituents;

R¹²is selected from C₁-C₆alkyl and aryl optionally substituted with one or more C₁-C₆alkyl substituents; and

wherein at least one R_Cis —C(═O)OH; or R_Lis —C(═O)OH.

In some embodiments of a compound of Formula (II), Z is —C(═O)—. In some embodiments of a compound of Formula (II), Z is —C(R^a)(R^b)—, and R^aand R^bare each independently selected from hydrogen, fluorine and methyl. In some embodiments of a compound of Formula (II), Z is —CH₂—. In some embodiments of a compound of Formula (II), each R_Mis independently selected from hydrogen, halogen, —OH, —CN, C₁-C₆alkyl, and C₁-C₆alkoxy. In some embodiments of a compound of Formula (II), one R_Mis selected from hydrogen, halogen, —OH, —CN, C₁-C₆alkyl, and C₁-C₆alkoxy; and each other R_Mis independently selected from hydrogen and halogen. In some embodiments of a compound of Formula (II), each R_Mis hydrogen. In some embodiments of a compound of Formula (II), R_Lis —C(═O)OH.

In certain embodiments, the disclosure provides compounds of Formula (III):

embedded image

or a pharmaceutically acceptable salt thereof, wherein: Z is —C(═O)— or —C(R^a)(R^b)—;

R^aand R^bare each independently selected from hydrogen, halogen, —OH, C₁-C₆alkyl, C₁-C₆alkoxy;

Ar_Cis selected from arylene and heteroarylene; wherein Ar_Cis substituted with one or more R_C;

or R¹and R²are taken together with the N to which they are attached to form a C₂-C₈heterocycloalkyl optionally substituted with one or more C₁-C₆alkyl substituents;

wherein the —OC(═O)C₁-C₆alkyl and —C(═O)OC₁-C₆alkyl are optionally substituted with one or more substituents independently selected from with —OH or —NR⁷R⁸;

or R⁴and R⁵are taken together with the N to which they are attached to form a C₂-C₈heterocycloalkyl optionally substituted with one or more C₁-C₆alkyl substituents;

R⁶is selected from optionally substituted C₁-C₆alkyl and optionally substituted aryl;

each R⁷and R⁸is independently selected from hydrogen and C₁-C₆alkyl;

each R_Mis independently selected from hydrogen, halogen, —OH, —CN, optionally substituted C₁-C₆alkyl, and optionally substituted C₁-C₆alkoxy;

wherein the C₁-C₆alkyl and C₁-C₆alkoxy are optionally substituted with one or more substituents independently selected from halogen, —C(═O)OR⁷, —C(═O)NR⁷R⁸, —OH, aryl, heteroaryl, C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, C₂-C₈heterocycloalkyl, and —O—C₂-C₈heterocycloalkyl;

R_Lis selected from optionally substituted heteroaryl, —C(═O)OH, —C(═O)OR⁹, —C(═O)NR¹⁰R¹¹, —NHC(═O)R¹², —NHS(═O)₂R¹², or —C(═O)NHS(═O)₂R¹²;

R⁹is C₁-C₆alkyl optionally substituted with one or more substituents independently selected from —OH and —NR¹R²;

or R¹⁰and R¹¹are taken together with the N to which they are attached to form a C₂-C₈heterocycloalkyl optionally substituted with one or more C₁-C₆alkyl substituents;

R¹²is selected from C₁-C₆alkyl and aryl optionally substituted with one or more C₁-C₆alkyl substituents; and

wherein at least one R_Cis —C(═O)OR³or R_Lis —C(═O)OR⁹.

In some embodiments of a compound of Formula (III), Z is —C(═O)—. In some embodiments of a compound of Formula (III), Z is —C(R^a)(R^b)—, wherein R^aand R^bare each independently selected from hydrogen, fluorine and methyl. In some embodiments of a compound of Formula (III), Z is —CH₂—. In some embodiments of a compound of Formula (III), each R_Mis independently selected from hydrogen, halogen, —OH, —CN, C₁-C₆alkyl, and C₁-C₆alkoxy. In some embodiments of a compound of Formula (III), one R_Mis selected from hydrogen, halogen, —OH, —CN, C₁-C₆alkyl, and C₁-C₆alkoxy; and each other R_Mis independently selected from hydrogen and halogen. In some embodiments of a compound of Formula (III), each R_Mis hydrogen.

In certain embodiments, the disclosure provides compounds of Formula (IV):

embedded image

or a pharmaceutically acceptable salt thereof, wherein:

Z is —C(═O)— or —C(R^a)(R^b)—;

R^aand R^bare each independently selected from hydrogen, fluorine and methyl;

Ar_Cis selected from arylene and heteroarylene; each substituted with one or more R_C;

R_Cis selected from —CN, —OH, C₁-C₆alkoxy, C₁-C₆alkyl, C₁-C₆hydroxyalkyl, heteroaryl, aryl, —C(═O)OH, and —C(═O)OR³;

each R¹and R²is independently selected from hydrogen and C₁-C₆alkyl;

or R¹and R²are taken together with the N to which they are attached to form a C₂-C₈heterocycloalkyl;

each R³is independently C₁-C₆alkyl optionally substituted with one or more —NR¹R²or C₁-C₆alkoxy;

Ar_Tis selected from pyridinyl, phenyl, thiophenyl, pyrazolyl, imidazolyl, and tetrazolyl, wherein Ar_Tis optionally substituted by one or more substituents independently selected from halogen, —NR⁷R⁸, C₁-C₆alkyl, and C₁-C₆alkoxy;

each R_Mis independently selected from hydrogen and halogen;

R_Lis selected from optionally substituted heteroaryl, —C(═O)OH, —C(═O)NR¹⁰R¹¹, and —C(═O)NHS(═O)₂R¹²; wherein the heteroaryl is optionally substituted by one or more substituents independently selected from (C₁-C₄alkylene)-O—C(═O)C₁-C₆alkyl, —C(═O)NR¹R², —C(═O)R¹², aryl, and C₁-C₆alkyl-(aryl).

each R¹⁰and R¹¹is independently selected from hydrogen and C₁-C₆alkyl optionally substituted with one or more of —C(═O)OH, —OH, aryl, hydroxyaryl, or heteroaryl; and

R¹²is selected from C₁-C₆alkyl and aryl.

In some embodiments of a compound of Formula (IV):

is —C(═O)— or —CH₂—;

Ar_Cis selected from phenylene and monocyclic heteroarylene; each substituted with one or more R_C;

R_Cis selected from —CN, —OH, C₁-C₆alkoxy, C₁-C₆alkyl, heteroaryl, aryl, —C(═O)OH, —C(═O)OR³;

each R¹and R²is independently selected from hydrogen and C₁-C₆alkyl;

each R³is independently C₁-C₆alkyl optionally substituted with one or more —NR¹R²;

each R_Mis hydrogen;

each R¹⁰and R¹¹is independently selected from hydrogen and optionally substituted C₁-C₆alkyl; wherein the C₁-C₆alkyl is optionally substituted by one or more substituents independently selected from —C(═O)OH, —OH, aryl, hydroxyaryl, and heteroaryl; and

R¹²is C₁-C₆alkyl or aryl.

In some embodiments of a compound of Formula (IV):

Z is selected from —C(═O)— and —CH₂—;

Ar_Cis arylene substituted with one R_C;

R_Cis selected from —C(═O)OH and tetrazolyl;

Ar_Tis selected from pyridinyl, phenyl, thiophenyl, pyrazolyl, imidazolyl, and tetrazolyl, wherein Ar_Tis optionally substituted by one or more of halogen, C₁-C₆alkyl, and C₁-C₆alkoxy;

each R_Mare hydrogen;

R_Lis selected from optionally substituted heteroaryl, —C(═O)OH, —C(═O)NR¹⁰R¹¹, and —C(═O)NHS(═O)₂R¹²; wherein heteroaryl is optionally substituted by one of —C(═O)R¹²or aryl;

R¹²is C₁-C₆alkyl.

In some embodiments of a compound of Formula (IV), Ar_Cis phenylene. In some embodiments of a compound of Formula (IV), R_Lis triazolyl optionally substituted by one of —C(═O)R¹²or aryl.

In some embodiments of a compound of Formula (IV):

Z is selected from —C(═O)— and —CH₂—;

Ar_Cis heteroarylene substituted with one or two R_C;

each R_Cis independently selected from —CN, C₁-C₆alkyl, and aryl;

Ar_Tis phenyl optionally substituted by one or more substituents independently selected from halogen, C₁-C₆alkyl, or C₁-C₆alkoxy;

each R_Mare hydrogen;

R_Lis selected from optionally substituted heteroaryl, —C(═O)OH, —C(═O)NR¹⁰R¹¹, and —C(═O)NHS(═O)₂R¹²; wherein the heteroaryl is optionally substituted by one of —C(═O)R¹²or aryl;

each R¹⁰and R¹¹is independently selected from hydrogen and C₁-C₆alkyl optionally substituted by one or more substituents independently selected from —C(═O)OH, —OH, phenyl, hydroxyphenyl, and indolyl; and

R¹²is C₁-C₆alkyl.

In some embodiments of a compound of Formula (IV), Ar_Cis thiophenylene. In some embodiments of a compound of Formula (IV), R_Lis triazolyl optionally substituted by one of —C(═O)R¹²or aryl.

In some embodiments of a compound of Formula (IV), one of R_Cis —CN.

In some embodiments of a compound of Formula (IV):

Z is selected from —C(═O)— and —CH₂—;

Ar_Cis arylene substituted with one R_C;

R_Cis —C(═O)OR³;

R¹and R²is independently selected from hydrogen and C₁-C₆alkyl;

R³is C₁-C₆alkyl optionally substituted with one NR¹R²;

Ar_Tis phenyl optionally substituted by one or more substituents independently selected from halogen, C₁-C₆alkyl, and C₁-C₆alkoxy;

each R_Mare hydrogen;

R¹²is C₁-C₆alkyl.

In some embodiments of a compound of Formula (IV), Ar_Cis phenylene. In some embodiments of a compound of Formula (IV), R_Lis triazolyl optionally substituted by one of —C(═O)R¹²or aryl.

In some embodiments of a compound of Formula (IV):

Z is —C(═O)—;

Ar_Cis arylene substituted with one R_C;

R_Cis selected from —C(═O)OH and tetrazolyl;

each R_Mare hydrogen;

each R¹⁰and R¹¹is independently selected from hydrogen and C₁-C₆alkyl optionally substituted by one or more substituents independently selected from —C(═O)OH, —OH, aryl, hydroxyaryl and heteroaryl; and

R¹²is C₁-C₆alkyl.

In some embodiments of a compound of Formula (IV), Ar_Cis phenylene. In some embodiments of a compound of Formula (IV), R_Lis triazolyl optionally substituted by one of —C(═O)R¹²or aryl.

In some embodiments of a compound of Formula (IV):

Z is —C(═O)—;

Ar_Cis heteroarylene substituted with one or two R_C;

each R_Cis independently selected from —CN, C₁-C₆alkyl, and aryl;

Ar_Tis phenyl optionally substituted by one or more of halogen, C₁-C₆alkyl, or C₁-C₆alkoxy;

each R_Mare hydrogen;

R¹²is C₁-C₆alkyl.

In some embodiments of a compound of Formula (IV), Ar_Cis thiophenylene. In some embodiments of a compound of Formula (IV), R_Lis triazolyl optionally substituted by one of —C(═O)R¹²or aryl. In some embodiments of a compound of Formula (IV), one of R_Cis —CN.

In some embodiments of a compound of Formula (IV):

Z is —C(═O)—;

Ar_Cis arylene substituted with one R_C;

R_Cis —C(═O)OR³;

R¹and R²is independently selected from hydrogen and C₁-C₆alkyl;

R³is C₁-C₆alkyl optionally substituted with one —NR¹R²;

Ar_Tis phenyl optionally substituted by one or more of halogen, C₁-C₆alkyl, or C₁-C₆alkoxy;

each R_Mare hydrogen;

R¹⁰is selected from hydrogen and C₁-C₆alkyl;

R¹²is C₁-C₆alkyl.

In some embodiments of a compound of Formula (IV), Ar_Cis phenylene. In some embodiments of a compound of Formula (IV), R_Lis triazolyl optionally substituted by one of —C(═O)R¹²or aryl.

In certain embodiments, the disclosure provides compounds of Formula (V):

embedded image

or a pharmaceutically acceptable salt thereof, wherein:

Z is —C(═O)— or —C(R^a)(R^b)—;

R^aand R^bare each independently selected from hydrogen, fluorine and methyl;

R_C1is selected from —OH, tetrazolyl, —C(═O)OH, and —C(═O)OR³;

R_C2is selected from hydrogen, halogen, —OH, C₁-C₆alkyl, C₁-C₆hydroxyalkyl and C₁-C₆alkoxy;

R³is C₁-C₆alkyl optionally substituted with one or more substituent selected from —NR¹R²or C₁-C₆alkoxy;

each R¹and R²is independently selected from hydrogen and C₁-C₆alkyl;

or R¹and R²are taken together with the N to which they are attached to form a C₂-C₈heterocycloalkyl;

each R_Mis independently selected from hydrogen and halogen;

R¹⁰is selected from hydrogen and C₁-C₆alkyl;

R¹¹is selected from hydrogen and optionally substituted C₁-C₆alkyl; wherein the C₁-C₆alkyl is optionally substituted with one or more of —C(═O)OH, —OH, aryl, hydroxyaryl, and heteroaryl; and

R¹²is selected from C₁-C₆alkyl and aryl.

In some embodiments of a compound of Formula (V), R_C1is tetrazolyl or —C(═O)OH. In some embodiments of a compound of Formula (V), is —C(═O)OR³. In some embodiments of a compound of Formula (V), R_C2is hydrogen. In some embodiments of a compound of Formula (V), Ar_Tis selected from pyridinyl, phenyl and thiophenyl, each optionally substituted by one or more substituents independently selected from halogen, C₁-C₆alkyl, and C₁-C₆alkoxy. In some embodiments of a compound of Formula (V), Ar_Tis pyrazolyl or imidazolyl each optionally substituted by methyl. In some embodiments of a compound of Formula (V), R_Lis triazolyl optionally substituted by one of —C(═O)R¹²or aryl.

Also disclosed herein are compounds of Formula (VI):

embedded image

or a pharmaceutically acceptable salt thereof, wherein:

Z is —C(═O)— or —C(R^a)(R^b)—;

R^aand R^bare each independently selected from hydrogen, fluorine and methyl;

R_C2is selected from hydrogen, halogen, —OH, C₁-C₆alkyl, C₁-C₆hydroxyalkyl, C₁-C₆alkoxy and aryl;

Ar_Tis phenyl optionally substituted by one or more substituents independently selected from halogen, C₁-C₆alkyl, and C₁-C₆alkoxy;

each R_Mis independently selected from hydrogen and halogen;

R¹⁰is selected from hydrogen and C₁-C₆alkyl;

R¹²is selected from C₁-C₆alkyl and aryl.

In some embodiments of a compound of Formula (VI), R_C2is selected from C₁-C₆alkyl and phenyl. In some embodiments of a compound of Formula (VI), Z is —C(═O)—. In some embodiments of a compound of Formula (VI), Z is —CH₂—. In some embodiments of a compound of Formula (VI), each R_Mis hydrogen. In some embodiments of a compound of Formula (VI), R_Lis monocyclic heteroaryl optionally substituted by one of —C(═O)R¹²or aryl. In some embodiments of a compound of Formula (VI), R_Lis tetrazolyl. In some embodiments of a compound of Formula (VI), R_Lis triazolyl optionally substituted by one of —C(═O)R¹²or aryl. In some embodiments of a compound of Formula (VI), R_Lis —C(═O)OH. In some embodiments of a compound of Formula (VI), R_Lis —C(═O)NR¹⁰R¹¹, wherein R¹⁰is selected from hydrogen and C₁-C₆alkyl; and R¹¹is selected from hydrogen and C₁-C₆alkyl (optionally substituted with one or more of —C(═O)OH, —OH, phenyl, hydroxyphenyl, or indolyl). In some embodiments of a compound of Formula (VI), R_Lis —C(═O)NHS(═O)₂R¹². In some embodiments of a compound of Formula (VI), the compound or a pharmaceutically acceptable salt thereof is in the form of a prodrug. In some embodiments of a compound of Formula (VI), the prodrug comprises an ester moiety. In some embodiments of a compound of Formula (VI), the prodrug comprises an amide moiety.

Also disclosed herein is a pharmaceutical composition comprising a compound of Formula (0), (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) and one or more pharmaceutically acceptable carrier. Also disclosed herein is a pharmaceutical composition comprising a compound of Formula (0), (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) in combination with another therapeutic agent, and optionally, one or more pharmaceutically acceptable carriers. In some embodiments, the pharmaceutical composition further comprises a second therapeutic agent. In some embodiments, the second therapeutic agent is an anti-cancer agent.

Also disclosed herein is a method of inhibition of the glycolysis in a cell, comprising contacting the cell with an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of modulating the activity of PFKFB3 and/or PFKFB4 in a cell, comprising contacting the cell with an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of inhibition of PFKFB3 and/or PFKFB4 in a cell, comprising contacting the cell with an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of inhibiting 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 3 (PFKFB3), the method comprising contacting PFKFB3 with an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of inhibiting 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 4 (PFKFB4), the method comprising contacting PFKFB4 with an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of inhibiting of PFKFB3 and/or PFKFB4 in a cell, the method comprising contacting a cell with an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of treatment or prophylaxis of disease or condition for which glycolysis inhibition has beneficial effect, comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of treatment or prophylaxis of disease or condition for which PFKFB3 and/or PFKFB4 inhibition has beneficial effect, comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of reducing glycolytic flux in a cell, the method comprising contacting the cell with an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of treating an autoimmune disease, an inflammatory disorder, a metabolic disease, a viral disease, a proliferative disease comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of reducing proliferative capacity in a cell, the method comprising contacting the cell with an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of increasing of cell antioxidant capacity, the method comprising contacting the cell with an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of enhancing the effect of radiation treatment of cancer, the method comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (1), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of decreasing the ability of the cancer cells to repair their DNA, the method comprising contacting the cell with an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of sensitizing cancer cell towards cytostatic and/or radiation therapy, the method comprising contacting the cell with an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of treatment of neoplasm sensitive to inhibition of PFKFB3 or/and PFKFB4, the method comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB)

Also disclosed herein is a method of treatment of neoplasm sensitive to inhibition of glycolysis, the method comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of reducing proliferative capacity in a cancer cell, the method comprising contacting the cancer cell with an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of treatment of a cancer, the method comprising administering to the subject an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of treatment of cancer comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of treatment of solid tumor comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB). or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of treatment of a hematological cancer, comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of treatment of cancer selected from kidney cancer, colon cancer, pancreatic cancer, lung cancer, breast cancer, triple negative breast cancer, liver cancer, lymphoma, leukemia, myeloma, comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of treatment of cancer selected from: atypical teratoid rhabdoid tumor, brain tumor, anal cancer, astrocytoma, vaginal cancer, extrahepatic bile duct cancer, intraocular melanoma, hairy cell leukemia, hepatocellular liver cancer, gestational trophoblastic disease, germ cell tumor, hypopharyngeal cancer, histiocytosis, histiocytosis Langerhans, high-grade astrocytoma, astrocytoma, glioma, brain stem glioma, invasive lobular carcinoma, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, cutaneous T-cell lymphoma, peripheral T-cell lymphoma, non-specific lymphoma mantle cell, lymphogranulomatosis, colorectal cancer, craniopharyngioma, leukemia, mast cell leukemia, Burkitt's lymphoma, Hodgkin's lymphoma, Waldenström's macroglobulinemia (lymphoplasmacytic lymphoma), small bowel cancer, mastocytosis, malignant mesothelioma, melanoma, small-cell carcinoma (small-cell lung cancer), metastatic squamous neck cancer, myelodysplastic/myeloproliferative neoplasms, myelodysplastic syndrome, acute myeloid leukemia, chronic myelogenous leukemia, chronic myeloproliferative disease, multiple myeloma (plasma cell myeloma or Kahler's disease), male breast cancer, nasal cell carcinoma, neuroblastoma, non-small cell lung cancer, non-Hodgkin's lymphoma, Wilms tumor, osteosarcoma, malignant fibrous histiocytoma of bone, acute lymphoblastic leukemia, acute myeloid leukemia, papillomatosis, paraganglioma, parathyroid carcinoma, transitional cell cancer of the renal pelvis, transitional cell cancer of the ureter, pleuropulmonary blastoma, squamous cell carcinoma, renal cell carcinoma, ductal carcinoma in situ, rhabdomyosarcoma, vulvar cancer, eye cancer, head and neck cancer, throat cancer, laryngeal cancer, lip and oral cancer, stomach cancer, gall bladder cancer, bile duct cancer, skin cancer, cancer of the adrenal cortex, bone cancer, uterine cancer, Merkel carcinoma, bladder cancer, nasopharyngeal cancer, esophageal cancer, penile cancer, nasal cavity cancer, paranasal sinus cancer, renal pelvis cancer, ureter cancer, renal cancer, Papillary renal cell carcinoma, prostate cancer, rectal cancer, oral cancer, salivary gland cancer, cancer of the urethra, cancer of the cervix, thyroid cancer, endometrial cancer, cancer of the central nervous system, testis cancer, ovarian cancer, retinoblastoma, sarcoma, Kaposi's sarcoma, uterine sarcoma, soft tissue sarcoma, Ewing's sarcoma, cardiac tumor, Sezary syndrome, pharyngeal cancer, pheochromocytoma, fibrous histiocytoma of bone, chordoma, chronic myeloproliferative disorder, chronic lymphocytic leukemia, ependymoma, erythroleukemia, esthesioneuroblastoma, comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method for treating of a cancer, which comprises administering an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) and at least one other anti-cancer medication.

Also disclosed herein is a method for treating of a cancer, which comprises administering an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB). or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB). and at least one other anti-cancer medication, wherein anti-cancer medication is targeted therapy.

Also disclosed herein is a method for treating of a cancer, which comprises administering an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB). or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB). and at least one other anti-cancer medication, wherein anti-cancer medication is immunotherapy.

Also disclosed herein is a method of treating a cancer cell, comprising contacting the cancer cell with an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of inducing an apoptosis of cancer cell, comprising contacting the cancer cell with an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of inhibition of angiogenesis comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB). or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method for neuroprotection comprising administering to a subject in need thereof an effective amount of PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application.

Also disclosed herein is a method of treatment of a neurodegenerative disease comprising administering to a subject in need thereof an effective amount of PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application.

Also disclosed herein is a method of treatment of a neurodegenerative disease selected from Alzheimer's disease, amyotrophic lateral sclerosis, Huntington's disease, and Parkinson's disease, Late-onset Alzheimer disease, stroke, ataxia telangiectasia (Louis-Bar syndrome), argyrophilic grain disease, autosomal dominant cerebellar ataxia, Batten disease (Spielmeyer-Vogt-Sjögren-Batten disease), corticobasal degeneration, corticobasal ganglionic degeneration, progressive supranuclear palsy (Steele-Richardson-Olszewski syndrome), Creutzfeldt-Jakob disease, fatal familial insomnia, frontotemporal dementia and parkinsonism linked to chromosome 17, neuronal intermediate filament inclusion disease, basophilic inclusion body disease, Pick disease, dementia with Lewy bodies, multiple-system atrophy, hereditary motor and sensory neuropathy with proximal dominance, infantile refsum disease, Machado-Joseph disease, mental retardation and microcephaly with pontine and cerebellar hypoplasia (mental retardation, X-linked, syndromic, Najm type), neuroacanthocytosis, pontocerebellar hypoplasia, pyruvate dehydrogenase deficiency (pyruvate dehydrogenase complex deficiency), refsum disease (heredopathia atactica polyneuritiformis), abetalipoproteinemia (Bassen-Kornzweig syndrome), frontotemporal lobar degeneration, spinal muscular atrophy, Friedreich's ataxia, spinocerebellar ataxia, dentatorubral-pallidoluysian atrophy, Gerstmann-Sträussler-Scheinker syndrome, motor neurone disease, Charcot disease or Lou Gehrig's disease, sclerosis, spinal muscular atrophy, depression, bipolar disorder comprising administering to a subject in need thereof an effective amount of PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application.

Also disclosed herein is a method of decreasing a glycolytic uptake in neuron, comprising contacting the neuron with an effective amount of PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application.

Also disclosed herein is a method of prevention of apoptotic death of neuron, comprising contacting the neuron with an effective amount of PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application.

Also disclosed herein is a method of prevention of apoptotic death of neuron triggered by glutamate receptor over-activation, administering to a subject in need thereof an effective amount of PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising a PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (Ia), (Ib), (II), (Ill), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application.

Also disclosed herein is a method of prevention of apoptotic death of neuron triggered by glutamate receptor over-activation, comprising contacting the neuron with an effective amount of PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application.

Also disclosed herein is a method of decreasing a glycolytic uptake in astrocyte, comprising contacting the astrocyte with an effective amount of PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application.

Also disclosed herein is a method of inhibition reactive astrocyte proliferation comprising administering to a subject in need thereof an effective amount of PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising a PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application.

Also disclosed herein is a method of protection of neuron against excitotoxicity comprising administering to a subject in need thereof an effective amount of PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising a PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application.

Also disclosed herein is a method of protection of enteric neuron against excitotoxicity comprising administering to a subject in need thereof an effective amount of PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (la), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising a PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (la), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application.

Also disclosed herein is a method of protection of neuron against excitotoxicity comprising, comprising contacting the neuron with an effective amount of a PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (la), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application.

Also disclosed herein is a method of treatment of an autoimmune disease comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of treatment of an autoimmune disease selected from psoriasis, systemic lupus erythematosus, scleroderma, graft-versus-host disease, or transplanted organ rejection comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of treatment inflammation, comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of treatment of disorder selected from atherosclerosis, arthritis, rheumatoid arthritis, cystic fibrosis, inflammatory bowel disease, cerebral ischemia, neurological insult, influenza, inflammation, comprising administering to a subject in need thereof an effective amount of a PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (la), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising a PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application.

Also disclosed herein is a method of decreasing atherosclerotic inflammation and/or at least one of its clinical consequences comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB)

Also disclosed herein is a method of treatment of metabolic disease comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of treatment of glucose metabolism disorder comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of treatment of hyperlactatemia comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of immunosuppression, comprising the step of administering to a patient in need thereof a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of prophylaxis of cancer, an autoimmune disease, an inflammatory disorder, a metabolic disease, a viral disease, a proliferative disease comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of prophylaxis of neoplasm sensitive to inhibition of PFKFB3 or/and PFKFB4, the method comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB)

Also disclosed herein is a method of prophylaxis of neoplasm sensitive to inhibition of glycolysis, the method comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of prophylaxis of a cancer, the method comprising administering to the subject an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of prophylaxis of cancer selected from solid tumors, namely kidney, colon, pancreas, lung, breast and liver cancers, and hematologic neoplasms, namely lymphoma, leukemia and myeloma, a hematological cancer, breast cancer, comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of prophylaxis of a hematological cancer, comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of prophylaxis of cancer selected from kidney cancer, colon cancer, pancreatic cancer, lung cancer, breast cancer, triple negative breast cancer, liver cancer, lymphoma, leukemia, myeloma, comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of prophylaxis of cancer selected from: atypical teratoid rhabdoid tumor, anal cancer, astrocytoma, vaginal cancer, extrahepatic bile duct cancer, intraocular melanoma, hairy cell leukemia, hepatocellular liver cancer, gestational trophoblastic disease, germ cell tumor, hypopharyngeal cancer, histiocytosis, histiocytosis Langerhans, glioma, high-grade astrocytoma, astrocytoma, brain stem glioma, invasive lobular carcinoma, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, cutaneous T-cell lymphoma, peripheral T-cell lymphoma, non-specific lymphoma mantle cell, lymphogranulomatosis, colorectal cancer, craniopharyngioma, leukemia, mast cell leukemia, Burkitt's lymphoma, Hodgkin's lymphoma, Waldenström's macroglobulinemia (lymphoplasmacytic lymphoma), small bowel cancer, mastocytosis, malignant mesothelioma, melanoma, small-cell carcinoma (small-cell lung cancer), metastatic squamous neck cancer, myelodysplastic/myeloproliferative neoplasms, myelodysplastic syndrome, acute myeloid leukemia, chronic myelogenous leukemia, chronic myeloproliferative disease, multiple myeloma (plasma cell myeloma or Kahler's disease), male breast cancer, nasal cell carcinoma, neuroblastoma, non-small cell lung cancer, non-Hodgkin's lymphoma, Wilms tumor, osteosarcoma, malignant fibrous histiocytoma of bone, acute lymphoblastic leukemia, acute myeloid leukemia, papillomatosis, paraganglioma, parathyroid carcinoma, transitional cell cancer of the renal pelvis, transitional cell cancer of the ureter, pleuropulmonary blastoma, squamous cell carcinoma, renal cell carcinoma, ductal carcinoma in situ, rhabdomyosarcoma, vulvar cancer, eye cancer, head and neck cancer, throat cancer, laryngeal cancer, lip and oral cancer, stomach cancer, gall bladder cancer, bile duct cancer, skin cancer, cancer of the adrenal cortex, bone cancer, uterine cancer, Merkel carcinoma, bladder cancer, nasopharyngeal cancer, esophageal cancer, penile cancer, nasal cavity cancer, paranasal sinus cancer, renal pelvis cancer, ureter cancer, renal cancer, Papillary renal cell carcinoma, prostate cancer, rectal cancer, oral cancer, salivary gland cancer, cancer of the urethra, cancer of the cervix, thyroid cancer, endometrial cancer, cancer of the central nervous system, testis cancer, ovarian cancer, retinoblastoma, sarcoma, Kaposi's sarcoma, uterine sarcoma, soft tissue sarcoma, Ewing's sarcoma, cardiac tumor, Sezary syndrome, pharyngeal cancer, pheochromocytoma, fibrous histiocytoma of bone, chordoma, chronic myeloproliferative disorder, chronic lymphocytic leukemia, ependymoma, erythroleukemia, and esthesioneuroblastoma, comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method for prophylaxis of a cancer, which comprises administering an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of prophylaxis of a neurodegenerative disease comprising administering to a subject in need thereof an effective amount of PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising a PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application.

Also disclosed herein is a method of prophylaxis of a neurodegenerative disease selected from Alzheimer's disease, amyotrophic lateral sclerosis, stroke, Huntington's disease, and Parkinson's disease, Late-onset Alzheimer disease, ataxia telangiectasia (Louis-Bar syndrome), argyrophilic grain disease, autosomal dominant cerebellar ataxia, Batten disease (Spielmeyer-Vogt-Sjögren-Batten disease), corticobasal degeneration, corticobasal ganglionic degeneration, progressive supranuclear palsy (Steele-Richardson-Olszewski syndrome), Creutzfeldt-Jakob disease, fatal familial insomnia, frontotemporal dementia and parkinsonism linked to chromosome 17, neuronal intermediate filament inclusion disease, basophilic inclusion body disease, Pick disease, dementia with Lewy bodies, multiple-system atrophy, hereditary motor and sensory neuropathy with proximal dominance, infantile refsum disease, Machado-Joseph disease, mental retardation and microcephaly with pontine and cerebellar hypoplasia (mental retardation, X-linked, syndromic, Najm type), neuroacanthocytosis, pontocerebellar hypoplasia, pyruvate dehydrogenase deficiency (pyruvate dehydrogenase complex deficiency), refsum disease (heredopathia atactica polyneuritiformis), abetalipoproteinemia (Bassen-Kornzweig syndrome), frontotemporal lobar degeneration, spinal muscular atrophy, Friedreich's ataxia, spinocerebellar ataxia, dentatorubral-pallidoluysian atrophy, Gerstmann-Sträussler-Scheinker syndrome, motor neurone disease, Charcot disease or Lou Gehrig's disease, sclerosis, spinal muscular atrophy, depression, and bipolar disorder comprising administering to a subject in need thereof an effective amount of PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising a PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application.

Also disclosed herein is a method of prophylaxis of an autoimmune disease comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB). or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of prophylaxis of a disease selected from psoriasis, systemic lupus erythematosus, scleroderma, graft-versus-host disease, and transplanted organ rejection comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of prophylaxis of an inflammatory disorder comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of prophylaxis of disorder selected from atherosclerosis, arthritis, rheumatoid arthritis, cystic fibrosis, inflammatory bowel disease, cerebral ischemia, neurological insult, influenza, inflammation, comprising administering to a subject in need thereof an effective amount of PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising a compound of PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (Ia), (Ib), (II), (Ill), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application.

Also disclosed herein is a method of prophylaxis of metabolic disease comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of prophylaxis of glucose metabolism disorder comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of prophylaxis of hyperlactatemia comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).

Also disclosed herein is a method of manufacturing a medication, comprising the use of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) as an active ingredient, wherein the medicament is at least one of the following: medicament for treating a disease or condition for which glycolysis inhibition has beneficial effect, medicament for treating a cancer, a neuroprotector, a medicament for the treatment or prophylaxis of a disease or condition for which inhibition of kinase activity of PFKFB3 and/or PFKFB4 has beneficial effect, an inhibitor of glycolysis, an inhibitor of angiogenesis.

Also disclosed herein is a kit for treating a PFKFB3 and/or PFKFB4-mediated condition, comprising (a) a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB); and (b) instructions for use.

Also disclosed herein is a kit for treating a cancer, comprising (a) a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB); and (b) instructions for use.

In some embodiments, the compound described in this disclosure or a pharmaceutically acceptable salt thereof is in the form of a prodrug. In some embodiments, the prodrug comprises an ester moiety. In some embodiments the prodrug comprises an amide moiety.

Also disclosed herein is a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application and one or more pharmaceutically acceptable carrier comprised in the inventions described in any one of the items 1548 to 1848. Also disclosed herein is a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described below in this application or other PFKFB3 inhibitors described in this application in combination with another therapeutic agent, and optionally, one or more pharmaceutically acceptable carriers. In some embodiments, the pharmaceutical composition further comprises a second therapeutic agent.

Also disclosed herein is a method of modulating the activity of PFKFB3 in a neuron, comprising contacting the neuron with an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described below in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described below in this application or other PFKFB3 inhibitors described in this application.

Also disclosed herein is a method for neuroprotection comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described below in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described below in this application or other PFKFB3 inhibitors described in this application.

Also disclosed herein is a method of treatment of a neurodegenerative disease comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described below in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described below in this application or other PFKFB3 inhibitors described in this application.

Also disclosed herein is a method of treatment of a neurodegenerative disease selected from Alzheimer's disease, amyotrophic lateral sclerosis, Huntington's disease, and Parkinson's disease, Late-onset Alzheimer disease, stroke, ataxia telangiectasia (Louis-Bar syndrome), argyrophilic grain disease, autosomal dominant cerebellar ataxia, Batten disease (Spielmeyer-Vogt-Sjögren-Batten disease), corticobasal degeneration, corticobasal ganglionic degeneration, progressive supranuclear palsy (Steele-Richardson-Olszewski syndrome), Creutzfeldt-Jakob disease, fatal familial insomnia, frontotemporal dementia and parkinsonism linked to chromosome 17, neuronal intermediate filament inclusion disease, basophilic inclusion body disease, Pick disease, dementia with Lewy bodies, multiple-system atrophy, hereditary motor and sensory neuropathy with proximal dominance, infantile refsum disease, Machado-Joseph disease, mental retardation and microcephaly with pontine and cerebellar hypoplasia (mental retardation, X-linked, syndromic, Najm type), neuroacanthocytosis, pontocerebellar hypoplasia, pyruvate dehydrogenase deficiency (pyruvate dehydrogenase complex deficiency), refsum disease (heredopathia atactica polyneuritiformis), abetalipoproteinemia (Bassen-Kornzweig syndrome), frontotemporal lobar degeneration, spinal muscular atrophy, Friedreich's ataxia, spinocerebellar ataxia, dentatorubral-pallidoluysian atrophy, Gerstmann-Sträussler-Scheinker syndrome, motor neurone disease, Charcot disease or Lou Gehrig's disease, sclerosis, spinal muscular atrophy, depression, bipolar disorder comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described below in this application or other PFKFB3 inhibitors described in this application.

Also disclosed herein is a method of decreasing a glycolytic uptake in neuron, comprising contacting the neuron with an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described below in this application or other PFKFB3 inhibitors described in this application.

Also disclosed herein is a method of prevention of apoptotic death of neuron, comprising contacting the neuron with an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described below in this application or other PFKFB3 inhibitors described in this application

Also disclosed herein is a method of prevention of apoptotic death of neuron triggered by glutamate receptor over-activation, administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (Ill), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below

Also disclosed herein is a method of prevention of apoptotic death of neuron triggered by glutamate receptor over-activation, comprising contacting the neuron with an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below

Also disclosed herein is a method of decreasing a glycolytic uptake in astrocyte, comprising contacting the astrocyte with an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below

Also disclosed herein is a method of inhibition reactive astrocyte proliferation comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below

Also disclosed herein is a method of protection of neuron against excitotoxicity comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below

Also disclosed herein is a method of protection of enteric neuron against excitotoxicity comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below

Also disclosed herein is a method of protection of neuron against excitotoxicity comprising, comprising contacting the neuron with an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below

Also disclosed herein is a method of treatment of an autoimmune disease comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (Ill), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below

Also disclosed herein is a method of prophylaxis of a neurodegenerative disease comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below

Also disclosed herein is a method of prophylaxis of a neurodegenerative disease selected from Alzheimer's disease, amyotrophic lateral sclerosis, stroke, Huntington's disease, and Parkinson's disease, Late-onset Alzheimer disease, ataxia telangiectasia (Louis-Bar syndrome), argyrophilic grain disease, autosomal dominant cerebellar ataxia, Batten disease (Spielmeyer-Vogt-Sjögren-Batten disease), corticobasal degeneration, corticobasal ganglionic degeneration, progressive supranuclear palsy (Steele-Richardson-Olszewski syndrome), Creutzfeldt-Jakob disease, fatal familial insomnia, frontotemporal dementia and parkinsonism linked to chromosome 17, neuronal intermediate filament inclusion disease, basophilic inclusion body disease, Pick disease, dementia with Lewy bodies, multiple-system atrophy, hereditary motor and sensory neuropathy with proximal dominance, infantile refsum disease, Machado-Joseph disease, mental retardation and microcephaly with pontine and cerebellar hypoplasia (mental retardation, X-linked, syndromic, Najm type), neuroacanthocytosis, pontocerebellar hypoplasia, pyruvate dehydrogenase deficiency (pyruvate dehydrogenase complex deficiency), refsum disease (heredopathia atactica polyneuritiformis), abetalipoproteinemia (Bassen-Kornzweig syndrome), frontotemporal lobar degeneration, spinal muscular atrophy, Friedreich's ataxia, spinocerebellar ataxia, dentatorubral-pallidoluysian atrophy, Gerstmann-Sträussler-Scheinker syndrome, motor neurone disease, Charcot disease or Lou Gehrig's disease, sclerosis, spinal muscular atrophy, depression, and bipolar disorder comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or a pharmaceutical composition comprising a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below

Also disclosed herein is a method of manufacturing a medication, comprising the use of a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below as an active ingredient, wherein the medicament is at least one of the following: a neuroprotector, a anti-aging medication, a rejuvenation medication.

Also disclosed herein is a kit for treating a PFKFB3-mediated neurogenerative condition, comprising (a) a pharmaceutical composition comprising a PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application; and (b) instructions for use.

Also disclosed herein is a kit for treating a PFKFB3-mediated aging related disease or condition, comprising (a) a pharmaceutical composition comprising a PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application; and (b) instructions for use.

In some embodiments this invention is a kit, comprising an agent, disclosed or described in this disclosure, including but not limited to PFKFB3 inhibitor, or composition disclosed in this application or its functional or structural analog or prodrug and the notice, description or instruction regarding the reduction or modulating or binding or inhibiting or degrading of PFKFB3, by the means of such agent or composition for anti-aging treatment or for neuroprotection, optionally comprising at least the medication labeling information, optionally wherein such notice, description or instruction comprises information about administration of corresponding agent or composition in a dosage and regimen, optionally to produce the biological effect comparable or alike or close to the inhibition of PFKFB3.

In some embodiments this invention is a kit, comprising an agent, modulating or binding or inhibiting or degrading or activating at least one of the Indirect Targets, optionally, wherein such modulation or binding or inhibiting or degrading or activating has anti-aging or neuroprotective effect and the notice, description or instruction regarding the modulation or binding or inhibiting or degrading or activating or reduction of at least one such Indirect Targets, by the means of such agent or composition for anti-aging treatment or neuroprotection, optionally comprising at least the medication labeling information, optionally wherein such notice, description or instruction comprises information about administration of corresponding agent or composition in dosage and regimen to produce the biological effect comparable or alike or close to the inhibition of PFKFB3.

In some embodiments, this invention is a kit, comprising the PFKFB3 inhibitor or pharmaceutical composition, comprising such inhibitor and a notice, description or instruction regarding the inhibition of PFKFB3 by the means of such inhibitor or pharmaceutical composition for anti-aging treatment.

In some embodiments, this invention is a kit, comprising an PFKFB3 inhibitor or any other agent of this invention and a notice, description or instruction for its use by human or by other animal subject in a dosage and regimen to maintain concentration of such agent in blood of such subject. In some embodiments such notice, description or instruction comprises information related to the deactivation, inhibition or of PFKFB3 for anti-aging treatment.

In some embodiments, the mentioned notice, description or instruction attached to such device or imprinted or drawn or in any other way displayed on such device or in any other way associated with such kit or composition (e.g. in machine readable form). One of the primary purposes of some aspects of his invention is to provide medication for anti-aging treatment and treatment of neurodegeneration. As a rule the medication or kit comprising medication of this invention should be accompanied with the notice, description or instruction (e.g., treatment and/or operation guidelines).

In some embodiments the contents and appearance of such notice, description or instruction is regulated by the respective national or international rules regarding labeling of medication, incorporated here by reference or such notice, description or instruction comprise at least part or optionally most of the or optionally all the information required by applicable medicines labeling regulations. For example, The Federal Food, Drug and Cosmetic Act (FFDCA) in USA is the law under which the FDA takes action against regulated products. In some embodiments ‘label’ is defined as a: ‘display of written, printed, or graphic matter upon the immediate container of any article . . . ‘The term’ immediate container’ does not include package liners. In some embodiments ‘labeling’ is: ‘all labels and other written, printed, or graphic matter (1) upon any article or any of its containers or wrappers, or (2) accompanying such article’ at any time while a device is held for sale after shipment or delivery for shipment in interstate commerce. The term ‘accompanying’ is interpreted liberally to mean more than physical association with the product. It extends to posters, tags, pamphlets, circulars, booklets, brochures, instruction books, direction sheets, fillers, etc. ‘Accompanying’ also includes labeling that is brought together with the device after shipment or delivery for shipment in interstate commerce. According to an appellate court decision: “Most, if not all advertising, is labeling.

The notice, description or instruction, including but not limited to labeling means (e.g., treatment and/or operation guidelines) can be provided in any form that conveys the requisite information. Instruction means can be audio, for example spoken word, recorded in analog or digital form (e.g., audio recording), or received and/or transmitted in analog or digital form (e.g., by telephone, conference call, or audio signal transmitted over a network). Such information can also be visual or video, for example hard-copy (e.g., as a manual, recorded medium, booklet, leaflet, book and the like) or soft-copy (e.g., recorded in analog or digital form as a file recorded on an magnit, electronic, optical, or computer readable medium such as a DVD, disk drive, CD-ROM and the like). Additionally, instruction means can be interactive or real-time (e.g., a teleconference or internet chat or chat bot).

Some mediums, kits, or agents of this invention can include printed or made in any other way instructions to inform the user of the steps required to properly use it, optionally for reduction, deactivation, inhibition or degradation of PFKFB3 for anti-aging treatment or for neuroprotection.

In some embodiments, an mediums, kits or agents of this invention include a label configured to be coupled to respective mediums, kits or agents of this invention. The label includes a first surface and a second surface. In some embodiments, the first surface can be coupled to an outer surface of mediums, kits or agents of this invention. In some embodiments, for example, the first surface can include an adhesive. The second surface can include a textual indicia, such as, for example, a description of the mediums, kits, or agents of this invention, a mark indicating its manufacturer or distributor and/or an instruction associated with the use of such mediums, kits, or agents of this invention. The label can further include an electronic circuit system configured to output an electronic signal. In some embodiments, the electronic signal can include an instruction associated with the use of the mediums, kits or agents of this invention.

In some embodiments the instruction is an instruction for use as medication.

In some embodiments, the notice, description or instruction, including but not limited to labeling can be shown on the lenses, computer glasses, transmitted via brain computer interface or by any other means or can be encoded by the Quick Response Code or any other machine readable form.

The notice, description or instruction, including but not limited to labeling can be implemented in digital electronic circuitry, or in computer firmware, hardware, software, or in combinations thereof. The implementation can be as a computer program product, e.g., a computer program tangibly embodied in an information carrier, e.g., in a machine-readable storage device or in a propagated signal, for execution by, or to control the operation of, data processing apparatus, e.g., a programmable processor, a computer, or multiple computers. A computer program can be recorded in any form of programming language, including compiled or interpreted languages, and the computer program can be deployed in any form, including as a stand-alone program or as a subroutine, element, or other unit suitable for use in a computing environment. A computer program can be deployed to be executed on one computer or on multiple computers at one site or several sites.

The notice, description or instruction, including but not limited to labeling can be performed by one or more programmable processors executing a computer program to perform functions of the invention by operating on input data and generating output. It can also be performed by, and an apparatus can be implemented as, special purpose logic circuitry, e.g., an FPGA (field programmable gate array) or an ASIC (application-specific integrated circuit). Subroutines can refer to portions of the computer program and/or the processor/special circuitry that implements that functionality.

In some embodiments, kit of this invention further comprises information about approval by the relevant agency of manufacture, use or sale for human administration.

The non-limiting examples of kits of this invention, could be paper kits which are the paper boxes, comprising corresponding pharmaceutical described in this disclosure, paper instruction and description, comprising name of intervention, indication and instruction.

Compound CHEMBL3422676
Anti-aging, rejuvenation, anti-frailty,
For IV injection, one vial per

(AZ67)
neuroprotection, amelioration of
injection, once a day, 4 weeks.

cognitive decline, improvement of

hands grip force, amelioration of

other aging related declines.

Other PFKFB3 inhibitor, e.g. 4-({4-
Anti-aging, rejuvenation, anti-frailty,
For IV injection, one vial per

carboxy-2′,4′-dichloro-[1,1′-
neuroprotection, amelioration of
injection, two times a day, 12

biphenyl]-3-yl}carbamoyl)-6-
cognitive decline, improvement of
weeks.

hydroxybenzene-1,3-dicarboxylic
hands grip force, amelioration of

acid
other aging related declines.

Compound CHEMBL3422676
Neuroprotector, Cerebral ischemia,
For IV injection, one vial per

(AZ67)
including ischemic stroke
injection, once a day, 4 weeks.

Other PFKFB3 inhibitor, , e.g. 4-({4-
Neuroprotector, Cerebral ischemia,
For IV injection, one vial per

carboxy-2′,4′-dichloro-[1,1′-
including ischemic stroke
injection, two times a day, 12 weeks

biphenyl]-3-yl}carbamoyl)-6-

hydroxybenzene-1,3-dicarboxylic

acid

Compound CHEMBL3422676
Neuroprotector, traumatic brain
For stereotactic injection, or internal

(AZ67)
injury, Cerebral ischemia, including
carotid artery, or lateral ventricle

ischemic stroke
delivery or direct brain infusion.

One vial per injection/infusion.

Compound CHEMBL3422676
Neuroprotector, stroke, Cerebral
IV Administered via jugular vein

(AZ67)
ischemia, including ischemic stroke
right after reperfusion

One vial per injection.

Method of Testing Efficacy

In some embodiments this invention is a method, including but not limited to method of testing of efficacy of therapy deleting, reducing, binding, inhibiting or degrading PFKFB3 or therapy modulating (by deleting, reducing, binding, deactivating, inhibiting or degrading or by activating or by any other way) at least one of Indirect Targets, wherein such modulation has an anti-aging or neuroprotective effect, comprising the checking in the subject treated by such therapy at least one of the following: checking biological age of the patient, at least one aging biomarker, at least one of markers of neurodegeneration or neuroprotection, at least one age related deficit or disease, at least one of rejuvenation marker, frailty, health span or life span, or any other marker or parameter reasonable for checking in testing of anti-aging therapy efficacy, optionally wherein therapy is a monoclonal or polyclonal antibody, optionally humanized, which recognizes the receptor of at least one respective Indirect Targets, protein, aptamer, peptide, polymer, virus or small molecule, binding or inhibiting or degrading PFKFB3 or at least one of Indirect Targets or any molecule or composition described in this disclosure or its analog.

In some embodiments checking of efficacy of therapy can be done as measurement of markers or symptoms of related diseases or conditions which is conducted in 1 month after the administration of therapy in therapeutically effective amount, in 3 months, in 6 months, in 12 months, in 18 months, in 24 months or in 36 months after such infusion, or in around such date, or in date reasonably defined by the doctor based on the parameter being measured and other factors known to the expert in the field.

Related Systems

In some embodiments this invention is a tangible medium comprising a computer program, which, when executed, causes a medium to perform a method comprising: attribution to the information about a subject an information about a treatment or therapy related to deactivating, deleting, reducing, binding, inhibiting or degrading PFKFB3 or in some embodiments to treatment or therapy related to modulating or binding or inhibiting or degrading or activating at least one of Indirect Targets, wherein such modulation or binding or inhibiting or degrading or activating has anti-aging or neuroprotective effect, optionally wherein treatment is anti-aging or neuroprotective treatment, optionally wherein such deactivating, deleting, reducing, binding, inhibiting or degrading is achieved by composition or agent described in this disclosure, optionally further comprising attributing to the information about patient before or after or before and after the treatment to information about checking of at least one selected from the group: biological age of the patient, at least one aging biomarker, at least one age related deficit or disease, at least one of rejuvenation marker, frailty, health span or life span, neuroprotection or neurodegeneration level or marker.

An example of such tangible medium could be a APPLE™ 2014 MACBOOK AIR™ 13″ Intel™ i5 with Microsoft™ Excel™ installed and executed on it, wherein to patient with name John Junior Smith (born 2 Jan. 1937) the information about inhibition of PFKFB3 is attributed in the sense that is logically linked as an information in Excel table (in this example attribution is realized as placing the information about treatment by inhibition of PFKFB3 in the same line in the file with the name and ID of the patient to whom such treatment is prescribed) and allows easy finding of patients in need of anti-aging or neuroprotective treatment to whom such treatment is prescribed and other processing of such information.

Date of

Treatment

patient ID
Name
birth
diagnosis
prescribed

28282838
John
3 Jan.
Before treatment: moderate
Administration

Junior
1937
frailty, moderate cognitive
of PFKFB3

Smith

decline, hand grip strength −21.3
inhibitor.

kg and other age related deficites

28282839
John
3 Aug.
Before treatment: neurodegeneration
Administration

Black
1940

of PFKFB3

inhibitor

One of the examples of such PFKFB3 inhibitors could be a pharmaceutical composition comprising compound CHEMBL3422676 (AZ67), another example can be 4-({4-carboxy-2′,4′-dichloro-[1,1′-biphenyl]-3-yl}carbamoyl)-6-hydroxybenzene-1,3-dicarboxylic acid.

Processors suitable for the execution of a computer program related to this invention include, by way of example, both general and special purpose microprocessors, and any one or more processors of any kind of digital computer. Generally, a processor receives instructions and data from a read-only memory or a random access memory or both. The essential elements of a computer are a processor for executing instructions and one or more memory devices for storing instructions and data. Generally, a computer also includes, or be operatively coupled to receive data from or transfer data to, or both, one or more mass storage devices for storing data, e.g., magnetic, magneto-optical disks, or optical disks. Data transmission and instructions can also occur over a communications network. Information carriers suitable for embodying computer program instructions and data include all forms of non-volatile memory, including by way of example semiconductor memory devices, e.g., EPROM, EEPROM, and flash memory devices; magnetic disks, e.g., internal hard disks or removable disks; magneto-optical disks; and CD-ROM and DVD-ROM disks. The processor and the memory can be supplemented by, or incorporated in special purpose logic circuitry.

In some embodiments this invention is a tangible medium comprising a computer program, which, when executed, causes a device to perform a method comprising: attribution to the information regarding therapeutic agent or composition an information about deactivating, deleting, reducing, binding, inhibiting or degrading of PFKFB3, or in some embodiments an information about modulating or binding or inhibiting or degrading or activating at least one of Indirect Targets, if such modulation or binding or inhibiting or degrading or activating has anti-aging or neuroprotective effect or the purpose of such action is to induce anti-aging effect or neuroprotective effect, optionally, wherein information about deleting, reducing, binding, inhibiting or degrading PFKFB3 is associated with the information about anti-aging or neurodegeneration treatment, optionally wherein agent is described in this disclosure.

As an example of such attribution the excel file executed on the same computer as described above or website or webpage available in Internet hosted on the server e.g. www.ipage.com, can be suggested, any of which when executed show at list one line of the following:

Name
Agent/Mechanism of Action/Mode of action
Indication

ASD1
Small molecule PFKFB3 inhibitor, e.g. 4-({4-
anti-aging, anti-frailty, amelioration of moderate

carboxy-2′,4′-dichloro-[1,1′-biphenyl]-3-
cognitive decline, amelioration hand grip strength

yl}carbamoyl)-6-hydroxybenzene-1,3-
lose and amelioration of other age related deficits

dicarboxylic acid

GER23
Small molecule PFKFB3 inhibitor
Neuroprotection, treatment of neurodegenerative

disease

GER56
Compound CHEMBL3422676 (AZ67)
anti-aging, anti-frailty, amelioration of moderate

cognitive decline, amelioration hand grip strength

lose and amelioration of other age related deficits

FDS89
Compound CHEMBL3422676 (AZ67)
Neuroprotection, treatment of neurodegenerative

disease

GERO288
4-({4-carboxy-2′,4′-dichloro-[1,1′-biphenyl]-3-
cancer

yl}carbamoyl)-6-hydroxybenzene-1,3-

dicarboxylic acid or any other compound of of

Formula (0), (I), (Ia), (Ib), (II), (III), (IV), (V), (VI),

(VII), (VIIA), (VIIB).

In some embodiments this invention is a method, comprising an attribution to information about the patient an information about the treatment related to deactivating deleting, reducing, binding, inhibiting or degrading of PFKFB3 or related to information about the modulating or binding or inhibiting or degrading or activating at least one the Indirect Targets, wherein such modulation or binding or inhibiting or degrading or activating has anti-aging or neuroprotective effect, wherein such attribution is performed in database or medium, comprising a computer program, which, when executed, causes a medium to perform such attribution or in other medium, optionally wherein the treatment is described as administration of PFKFB3 inhibitor or pharmaceutical composition, comprising such inhibitor or administration of Indirect Target modulator or pharmaceutical composition, comprising such modulator.

In some embodiments this invention is a method, comprising an attribution of information about the patient to an information about the agent deactivating, deleting, reducing, binding, inhibiting or degrading at least one of PFKFB3 or about the agent modulating or binding or inhibiting or degrading or activating at least one at least one of the Indirect Targets, wherein such modulation or binding or inhibiting or degrading or activating has anti-aging or neuroprotective effect, optionally wherein agent is selected from the group: a monoclonal or polyclonal antibody, protein, aptamer, peptide, polymer, gene therapy, virus or small molecule, nanoparticle or any identification meaning such agent or composition, or to the information related to treatment associated with deletion, reduction, binding, inhibiting or degrading of PFKFB3, wherein such attribution is performed in database or medium, comprising a computer program, which, when executed, causes a medium to perform such attribution or in other medium, optionally wherein inhibiting or binding of PFKFB3 is achieved by at least one of the agent selected from the PFKFB3 inhibitors described in this application or is its analog.

In some embodiments this invention is a method, comprising attribution of information about the therapy, agent, medium or procedure associated with deactivation, deletion, reduction, binding, inhibiting or degrading of PFKFB3 to the information related to anti-aging treatment or neurodegeneration treatment, wherein such attribution is performed in database or medium, comprising a computer program, which, when executed, causes a medium to perform such attribution or in other medium, optionally to the labeling information related to medication.

In some embodiments this invention is a method of this disclosure, comprising attribution of information where in the patient age is above 30 years old or above 40 years old or above 50 years old and/or the patient is someone who is in need of anti-aging treatment and/or the patient is someone who is in need of neuroprotection treatment, optionally, wherein agent is selected from the group: a monoclonal or polyclonal antibody, optionally humanized, protein, aptamer, peptide, polymer, nanoparticle, virus or small molecule, or other agent described as PFKFB3 inhibitor in this application, or its analog or information about pharmaceutical composition, comprising such agent or its analog or any ID/identification meaning such agent or composition or wherein, wherein treatment is an anti-aging treatment or treatment of neurodegenerative disease or neuroprotection.

In some embodiments this invention is a method or a tangible medium comprising a computer program, which, when executed, causes a medium to perform a method comprising step of attributing to agent of this invention an information comprised in notice, description or instruction described in this disclosure for kits, comprising notice, description or instruction.

In some embodiments the method of this invention comprising attribution of information described in this disclosure is a computer implemented method. In some embodiments this invention is a method, the method of this invention, comprising attribution of information executed on the medium of this invention and described in corresponding part of this disclosure related to such medium.

In some embodiments this invention is a tangible medium or computer system or processor, comprising a executable instruction or computer program, which, when executed, causes a medium to perform a method comprising attribution of information described in this disclosure.

In some embodiments this invention is an apparatus to execute method described in this disclosure the apparatus comprising the processor comprising the tangible medium described in this disclosure.

SIRNA

In some embodiments PFKFB3 inhibitor is a PFKFB3 inhibiting Small RNA.

Accordingly in such embodiments kit, method, composition, pharmaceutical composition, use, PFKFB3 inhibitor, medium described in this application comprises instead of small molecule PFKFB3 inhibitor a PFKFB3 inhibiting Small RNA is used or PFKFB3 inhibitor is a PFKFB3 inhibiting Small RNA.

RNA interference (RNAi) is a natural process used by cells to regulate gene expression. The process to silence genes first begins with the entrance of a double-stranded RNA (dsRNA) molecule into the cell, which triggers the RNAi pathway. The double-stranded molecule is then cut into small double-stranded fragments by an enzyme called Dicer. These small fragments, which include small interfering RNAs (siRNA) and microRNA (miRNA), are approximately 21-23 nucleotides in length. The fragments integrate into a multi-subunit protein called the RNA-induced silencing complex, which contains Argonaute proteins that are essential components of the RNAi pathway. One strand of the molecule, called the “guide” strand, binds to RISC, while the other strand, known as the “passenger” strand is degraded. The guide or antisense strand of the fragment that remains bound to RISC directs the sequence-specific silencing of the target mRNA molecule. The genes can be silenced by siRNA molecules that cause the endonucleatic cleavage of the target mRNA molecules or by miRNA molecules that suppress translation of the mRNA molecule. With the cleavage or translational repression of the mRNA molecules, the genes that form them are essentially inactive. RNAi is thought to have evolved as a cellular defense mechanism against invaders, such as RNA viruses, or to combat the proliferation of transposons within a cell's DNA. Both RNA viruses and transposons can exist as double-stranded RNA and lead to the activation of RNAi. Currently, siRNAs are being widely used to suppress specific gene expression and to assess the function of genes. Companies utilizing this approach include Alnylam, Sanofi, Arrowhead, Discerna and Persomics, among others.

siRNAs can now be easily produced by the methods known in the art and modified to be used in vivo. Another option could be a purchase of siRNAs or siRNAs modified for in vivo use for respective targets.

For example Ambion® In Vivo siRNAs are designed using the Silencer® Select algorithm and incorporate chemical modifications that help provide superior serum stability for in vivo delivery.

Invitrogen™ Silencer™ Pre-designed siRNAs are available for all human, mouse, and rat gene targets in the RefSeq database. These siRNAs are designed for maximum potency and specificity using a highly effective and extensively tested algorithm. Each siRNA is synthesized to the highest quality standards and is provided with full sequence information. Furthermore, when one purchases three Silencer Pre-Designed siRNAs to the same target, there is a guarantee that with at least two of the siRNAs you will achieve >70% reduction in target mRNA levels.

The further modification and optimisation of siRNAs for human use is made by the methods known in the art.

Antisense therapy is a form of treatment. When the genetic sequence of a particular gene is known to be causative of a particular disease, it is possible to synthesize a strand of nucleic acid (DNA, RNA or a chemical analogue) that will bind to the messenger RNA (mRNA) produced by that gene and inactivate it, effectively turning that gene “off”. This is because mRNA has to be single stranded for it to be translated. Alternatively, the strand might be targeted to bind a splicing site on pre-mRNA and modify the exon content of an mRNA. Delivery Because nucleases that cleave the phosphodiester linkage in DNA are expressed in almost every cell, unmodified DNA molecules are generally degraded before they reach their targets. Therefore, antisense drug candidate molecules are generally modified during the drug discovery phase of their development. Additionally, most targets of antisense are located inside cells, and getting nucleic acids across cell membranes is also difficult. Therefore, most clinical candidates have modified DNA “backbones”, or the nucleobase or sugar moieties of the nucleotides are altered. Additionally, other molecules may be conjugated to antisense molecules in order to improve their ability to target certain cells or to cross barriers like cell membranes or the blood brain barrier

PFKFB3 inhibiting RNAi (siRNA, shRNA,miRNA) as well as non-viral DNA vectors can be delivered in vivo using a synthetic carrier for the siRNA or shRNA/DNA payload or naked DNA vectors or chemically modified siRNA (i.e. Ambion In Vivo siRNA). Synthetic carriers include cationic liposomes (stable nucleic-acid lipid particle SNALP carrier by Tekmira, siRNA-lipoplex AtuPLEX™), anionic liposome, polymeric carriers (cyclodextrin nanoparticles from Calando, biodegradable polymeric matrix LODER). For example, for systemic delivery of Ambion In Vivo siRNA (a dose starting with 7 mg/kg should be used) injection of siRNA solution of 0.7 mg/mL in PBS, saline (0.9% NaCl or variants containing sugars such as mannitol or glucose (5-15%) or Ringer's solution (147 mM NaCl, 4 mM KCl, 1.13 mM CaCl₂)) may be used. For hepatic delivery Invivofectamine 2.0 reagent (Invitrogen) may be used (˜3 mg/mL working solution). In order to prepare Invivofectamine-siRNA complex resuspended siRNA duplex should be diluted 1:1 Complexation Buffer. Then the solution should be added to an equal volume of warm Invivofectamine 2.0 Reagent, vortex for 2-3 seconds and incubated for 30 minutes at 50° C. Afterwards ˜14 volumes of PBS, pH 7.4 should be added. The solution is then diafiltrated using Amicon® Ultra-15 Centrifugal Device with Ultracel-50 membrane. The retentate retentate containing the Invivofectamine 2.0-siRNA complex is then collected, brought to 00 μL with PBS and used for in vivo injection immediately or alternatively can be stored at 4° C. for up to a week prior to injection. Specific silencing of targeted genes can be confirmed by the independent experiments known in the art.

Examples of commercially available siRNA for PFKFB3:

Ambion In Vivo siRNAs from ThermoFisher Scientific (https://www.thermofisher.com/ru/ru/home/life-science/rnai/introduction-to-in-vivo-rnai/ambion-in-vivo-sirna.html): s10359, s10357, s10358, n364686, n364691, n364684, n364683, n364689, n364690, n364685, n364687, n364682, n364688

MISSION® siRNA from Sigma Aldrich (https://www.sigmaaldrich.com/life-science/functional-genomics-and-rnai/)

SIHK1581 MISSION® siRNA Human Kinase PFKFB3 (siRNA2), Nano Scale 0.25 nmol

SIHK1580 MISSION® siRNA Human Kinase PFKFB3 (siRNA1), Nano Scale 0.25 nmol

SIHK1582 MISSION® siRNA Human Kinase PFKFB3 (siRNA3), Nano Scale 0.25 nmol

Examples of siRNA sequences for PFKFB3:

SEQ ID NO 1

GUCUUCGGUGUCUCCAUUAAU,

SEQ ID NO 2

GAAGCAGUACAGCUCCUACAA,

SEQ ID NO 3

GCAGUACAGCUCCUACAACUU,

SEQ ID NO 4

GCCUUAGCUGCCUUGAGAGAU,

SEQ ID NO 5

GAAGAGGAUCAGUUGCUAUGA,

SEQ ID NO 6

GACACCUACCCUGAGGAGUAU,

SEQ ID NO 7

GGGAGCAGGACAAGUACUAUU

SEQ ID NO 8

GGAGCAGGACAAGUACUAUUA,

SEQ ID NO 9

GCAGGAGAAUGUGCUGGUCAU,

SEQ ID NO 10

GCCUACUUCCUGGAUAAGAGU,

SEQ ID NO 11

GGAUAAGAGUGCAGAGGAGAU,

SEQ ID NO 12

GAGGUCAGAGGAUGCAAAGAA,

SEQ ID NO 13

GGAUGCAAAGAAGGGACCUAA

In some embodiments this invention is kit, method, composition, pharmaceutical composition, use, PFKFB3 inhibitor, medium of any one of items of this application, wherein PFKFB3 inhibitor is a small interfering RNA (siRNA) targeting a phosphoinositide PFKFB3 signal transduction pathway.

In some embodiments this invention relates to following siRNA items

1. In some embodiments this invention is kit, method, composition, pharmaceutical composition, use, PFKFB3 inhibitor, medium of any one of items of this application, wherein inhibitor of PFKFB3 is a chemically modified double stranded siRNA molecule that down regulates expression of an PFKFB3 gene via RNA interference (RNAi), wherein:

a) each strand of said siRNA molecule is independently about 18 to about 28 nucleotides in length; and

b) one strand of said siRNA molecule comprises nucleotide sequence having sufficient complementarity to an RNA of said PFKFB3 gene for the siRNA molecule to direct cleavage of said RNA via RNA interference.

2. The invention of item 1, wherein each strand of the siRNA molecule comprises about 18 to about 28 nucleotides, and wherein each strand comprises at least about 14 to 24 nucleotides that are complementary to the nucleotides of the other strand.

3. The invention of item 1, wherein said siRNA molecule is assembled from two separate oligonucleotide fragments wherein a first fragment comprises the sense strand and a second fragment comprises the antisense strand of said siRNA molecule.

4. The invention of item 3, wherein said sense strand is connected to the antisense strand via a linker molecule.

5. The invention of item 4, wherein said linker molecule is a polynucleotide linker.

6. The invention of item 4, wherein said linker molecule is a non-nucleotide linker.

7. The invention of item 3, wherein said second fragment comprises a terminal cap moiety at a 5′-end, a 3′-end, or both of the 5′ and 3′ ends of said second strand.

8. The invention of item 7, wherein said terminal cap moiety is an inverted deoxy abasic moiety.

9. The invention of item 3, wherein said first fragment comprises a phosphorothioate internucleotide linkage at the 3′ end of said first strand.

10. The invention of item 1, wherein said siRNA molecule comprises at least one 2′-sugar modification.

11. The invention of item 10, wherein said 2′-sugar modification is a 2′-deoxy-2′-fluoro modification.

12. The invention of item 10, wherein said 2′-sugar modification is a 2′—O-methyl modification.

13. The invention of item 10, wherein said 2′-sugar modification is a 2′-deoxy modification.

14. The invention of item 1, wherein said siRNA molecule comprises at least one nucleic acid base modification.

15. The invention of item 1, wherein said siRNA molecule comprises at least one phosphate backbone modification.

16. A composition comprising the siRNA molecule of any of the items of this application in a pharmaceutically acceptable carrier or diluent.

In some embodiments this invention relates to following siRNA items

1. In some embodiments this invention is kit, method, composition, pharmaceutical composition, use, PFKFB3 inhibitor, medium of any one of items of this application, wherein PFKFB3 inhibitor is an isolated siRNA (small interfering RNA) molecule comprising a sense region and an antisense region that down regulates expression of an PFKFB3 gene via RNA interference (RNAi), wherein the sense region comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-, and wherein the antisense region comprises a sequence that is complementary to a nucleotide sequence from the group consisting of SEQ ID NOs: 1-.13

2. The invention of item 1, wherein the sense and antisense RNA strands forming the duplex region are covalently linked by a linker molecule.

3. The invention of item 1, wherein the siRNA further comprises non-nucleotide material.

4. The invention of item 1, wherein the linker molecule is a polynucleotide linker.

5. The invention of item 1, wherein the linker molecule is a non-nucleotide linker.

6. A recombinant nucleic acid construct comprising a nucleic acid that is capable of directing transcription of a small interfering RNA (siRNA), the nucleic acid comprising: (a) at least one promoter; (b) a DNA polynucleotide segment that is operably linked to the promoter, (c) a linker sequence comprising at least 4 nucleotides operably linked to the DNA polynucleotide segment of (b); and (d) operably linked to the linker sequence a second polynucleotide, wherein the polynucleotide segment of (b) comprises a polynucleotide that is selected from the group consisting of SEQ ID Nos: 1-13, wherein the second polynucleotide of (d) comprises a polynucleotide that is complementary to at least one polynucleotide from the group consisting of SEQ ID NOs: 1-13

RNAi may be introduced in vivo as virus-delivered shRNA, for example MISSION® In Vivo shRNA from Sigma Aldrich (https://www.sigmaaldrich.com/life-science/functional-genomics-and-rnai/shrna/): SHCLNV-NM_004566 MISSION® shRNA Lentiviral Transduction Particles for human and SHCLNV-NM_172976 MISSION® shRNA Lentiviral Transduction Particles for mouse.

siRNAs and shRNAs are also commercially available from Santa Cruz biotechnology (sc-44011 and sc-44011-SH, respectively).

MicroRNAs (abbreviated miRNA) are small non-coding RNA molecules (containing about 22 nucleotides) naturally occurring in plants, animals and some viruses, that functions in RNA silencing and post-transcriptional regulation of gene expression.

MicroRNA mimics are double-stranded RNA oligonucleotides designed to mimic the function of endogenous, mature microRNAs. Micro RNA mimics are chemically enhanced with the ON-TARGET modification pattern to preferentially program RISC with the active microRNA strand. Predesigned micro RNAmimics are available for all human, mouse, and rat microRNAs, for example miRIDIAN microRNA Mimic from Dharmacon (http://dharmacon.horizondiscovery.com/rnai/microrna/miridian-microrna-mimic/) and miScript miRNA Mimics from Qiagen (https://www.qiagen.com/us/shop/pcr/real-time-pcr-enzymes-and-kits/miscript-mirna-mimics/)

Non-exclusive list of microRNA that may target PFKFB3: hsa-miR-224-5p, hsa-miR-7110-3p, hsa-miR-3160-5p, hsa-miR-608, hsa-miR-940, hsa-miR-6893-5p, hsa-miR-6808-5p, hsa-miR-6791-3p, hsa-miR-513a-3p, hsa-miR-6829-3p, hsa-miR-3606-3p, hsa-miR-513c-3p, hsa-miR-1468-3p, hsa-miR-4731-5p, hsa-miR-4465, hsa-miR-26a-5p, hsa-miR-4660, hsa-miR-26b-5p, hsa-miR-1297, hsa-miR-6814-5p, hsa-miR-5692a, hsa-miR-4297

CRISPR-CAS9

In some embodiments this invention is kit, method, composition, pharmaceutical composition, use, PFKFB3 inhibitor, medium of any one of items of this application, wherein PFKFB3 inhibitor is is a gene therapy, for example but not limited to therapy comprising CRISPR-CAS9.

PFKFB3 may be inhibited be editing PFKFB3 gene for the purposes of this application such as neuroprotection or anti-aging treatment. Genome editing tools include engineered nucleases, i.e meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector-based nucleases (TALEN), and the clustered regularly interspaced short palindromic repeats (CRISPR/Cas9) system. These nucleases create site-specific double-strand breaks (DSBs) at desired locations in the genome. The induced double-strand breaks are repaired through nonhomologous end-joining (NHEJ) or homologous recombination (HR), resulting in targeted mutations (‘edits’).

Meganucleases are naturally occurring endonucleases characterized by a large recognition site (double-stranded DNA sequences of 12 to 40 base pairs); as a result this site generally occurs only once in any given genome. Custom meganucleases may be produced by modifying the specificity of existing meganucleases by introducing a small number of variations to the amino acid sequence and then selecting the functional proteins on variations of the natural recognition site. Meganuclease design methods range from high-throughput experimental screening to in silico physical models and machine learning model [Zaslavskiy M, Bertonati C, Duchateau P, Duclert A, Silva G H. Efficient design of meganucleases using a machine learning approach. BMC Bioinformatics. 2014; 15:191].

Transcription activator-like effector nucleases (TALEN) are restriction enzymes that can be engineered to cut specific sequences of DNA. They are made by fusing a TAL effector DNA-binding domain to a DNA cleavage domain (a nuclease which cuts DNA strands). Transcription activator-like effectors (TALEs) can be engineered to bind to practically any desired DNA sequence, so when combined with a nuclease, DNA can be cut at specific locations [Boch J (February 2011). “TALEs of genome targeting”. Nature Biotechnology. 29 (2): 135-6].

Zinc finger nucleases (ZFNs) are hybrid proteins composed of a nonspecific cleavage domain from the Type IIS restriction enzyme FokI and a DNA-binding domain made up of zinc fingers (ZFs). The number of fingers in each ZFN can be varied. The minimum number to achieve adequate affinity is three fingers, and combinations up to six have been produced and tested in some contexts. For purposes strictly of genomic cleavage, three-finger and four-finger ZFNs have been used successfully [Carroll D, Morton J J, Beumer K J, Segal D J. Design, construction and in vitro testing of zinc finger nucleases. Nat Protoc. 2006; 1(3):1329-41]

The CRISPR/Cas9 system is widely used for various genome editing approaches in cultured cells and living organisms and was broadly explored for preclinical applications. CRISPR/CRISPR-associated (Cas) systems use Streptococcus pyogenes Cas9 nuclease that is targeted to a genomic site by complexing with a synthetic guide RNA (sgRNA) binds to its complementary target protospacer sequence preceding a protospacer adjunct motif (PAM) recognized by Cas9. CRISPR/Cas9 generates a double-strand break that is usually repaired by non-homologous end-joining (NHEJ), which is error-prone and conducive to frameshift mutations resulting in knock-out alleles of genes

Adeno-associated viral vectors (AAV) are commonly used for in vivo gene delivery due to their low immunogenicity and range of serotypes allowing preferential infection of certain tissues. Since packaging Streptococcus pyogenes (SpCas9) and a chimeric sgRNA together (˜4.2 kb) into an AAV vector is challenging due to the low packaging capacity of AAV (˜4.5 kb.) these elements are packed dual-vector system is used.

AAV CRISPR/CAS9 systems are commercially available, for example from Takara (https://www.takarabio.com/products/gene-function/viral-transduction/adeno-associated-virus-(aav)/vector-systems/crispr/cas9-system).

sgRNA targeting PFKFB3 (chr10):

Exon 7

AATGCGACAGGTGATTCCCGTGG,

Exon 10

TTACCGCTACCCCACCGGGGAGG,

Exon 4

AGCTACCTGGCGAAAGAAGGGGG,

Exon 9

TCGACGCGGTGAGTCCTGGGAGG,

Exon 1

AGGTAGGAGTCCCGGTGACGCGG,

Exon 11

CAGGTACCTCGGGCAGGTCGTGG,

Exon 1

TTTCCTGAAGGGCATCGCGCCGG,

Exon 10

ACCCTGAGGAGTATGCGCTGCGG,

Exon 11

GGCAAGCAGGCAGCGCAGGACGG,

Exon 9

GGCGCTCAATGAGATCGACGCGG.

CRISPR PFKFB3 Knockout Kit is available from Origene (https://www.origene.com/) for mouse (CAT #: KN513141) and human (CAT #: KN206043), GeneCopoeia (http://www.genecopoeia.com/product/search3/?s=PFKFB3&search_type=1 &tags %5B %5D=7824&tags %5B %5D=7833&utm_source=genecards&utm_medium=referral&utm_campaign=product), and Santa Cruz Biotechnology (https://www.scbt.com/scbt/browse/PFK-2-CRISPR-Plasmids/_/N-irgxre).

In some embodiments this invention is a Kit, method, composition, pharmaceutical composition, use, PFKFB3 inhibitor, medium of any one items described below or anywhere in this application, wherein PFKFB3 inhibitor comprises RNAi molecule or gene therapy selected from the described above or its analog.

While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.

Compounds such as AZ67 and its analogs, including but not limited to those described in the following publication are known in the art and their methods of synthesis are described in J Med Chem. 2015 Apr. 23; 58(8):3611-25. doi: 10.1021/acs.jmedchem.5b00352. Epub 2015 Apr. 13.

Structure-Based Design of Potent and Selective Inhibitors of the Metabolic Kinase PFKFB3. For some known compounds comprised in the disclosed inventions the references for methods of their preparations are available in Table 5.

Tables. Table 1

“Declines”.

Non-limiting list of parameters which age related change is regarded as age related decline and which can be changed into younger state or stabilized or its further change into the older state delayed by anti-aging intervention of this disclosure

Field
Units

Standing height
cm

Forced expiratory volume in 1-second (FEV1)
litres

Leg fat-free mass (right)
Kg

Leg predicted mass (right)
Kg

Basal metabolic rate
KJ

Forced vital capacity (FVC)
litres

Leg fat-free mass (left)
Kg

Leg predicted mass (left)
Kg

Systolic blood pressure, automated reading
mmHg

Heel bone mineral density (BMD) (left)
g/cm2

Heel quantitative ultrasound index (QUI), direct entry (left)

Whole body fat-free mass
Kg

Whole body water mass
Kg

Heel bone mineral density (BMD) T-score,
Std. Devs

automated (left)

Speed of sound through heel (left)
m/s

Sitting height
cm

Heel bone mineral density (BMD) (right)
g/cm2

Heel quantitative ultrasound index (QUI), direct entry (right)

Speed of sound through heel (right)
m/s

Heel bone mineral density (BMD) T-score,
Std. Devs

automated (right)

Peak expiratory flow (PEF)
litres/min

Leg fat percentage (left)
percent

Trunk fat-free mass
Kg

Leg fat percentage (right)
percent

Trunk predicted mass
Kg

Hand grip strength (left)
Kg

Heel broadband ultrasound attenuation (left)
dB/MHz

Heel broadband ultrasound attenuation (right)
dB/MHz

Hand grip strength (right)
Kg

Duration to first press of snap-button in each round
milliseconds

Mean time to correctly identify matches
milliseconds

Body fat percentage
percent

Trunk fat percentage
percent

Body mass index (BMI)
Kg/m2

Leg fat mass (left)
Kg

Arm fat-free mass (left)
Kg

Arm predicted mass (left)
Kg

Arm fat-free mass (right)
Kg

Haematocrit percentage
percent

Arm predicted mass (right)
Kg

Waist circumference
cm

Leg fat mass (right)
Kg

Haemoglobin concentration
grams/declitre

Arm fat percentage (left)
percent

Ankle spacing width (left)
mm

Whole body fat mass
Kg

Body mass index (BMI)
Kg/m2

Pulse wave peak to peak time
milliseconds

Arm fat percentage (right)
percent

Weight
Kg

Mean corpuscular volume
femtolitres

Trank fat mass
Kg

Pulse wave Arterial Stiffness index

Ankle spacing width (right)
mm

Platelet crit
percent

Red blood cell (erythrocyte) count
10{circumflex over ( )}12 cells/Litre

Mean sphered cell volume
femtolitres

Mean platelet (thrombocyte) volume
femtolitres

Weight
Kg

Arm fat mass (left)
Kg

Lymphocyte percentage
percent

Neutrophill percentage
percent

Arm fat mass (right)
Kg

Impedance of leg (left)
ohms

Mean reticulocyte volume
femtolitres

Platelet count
10{circumflex over ( )}9 cells/Litre

Mean corpuscular haemoglobin
picograms

Impedance of leg (right)
ohms

Red blood cell (erythrocyte) distribution width
percent

Pulse rate, automated reading
bpm

Impedance of whole body
ohms

Diastolic blood pressure, automated reading
mmHg

Lymphocyte count
10{circumflex over ( )}9 cells/Litre

Number of measurements made

Neutrophill count
10{circumflex over ( )}9 cells/Litre

Monocyte percentage
percent

Hip circumference
cm

Monocyte count
10{circumflex over ( )}9 cells/Litre

Platelet distribution width
percent

Mean corpuscular haemoglobin concentration
grams/decilitre

Immature reticulocyte fraction
ratio

Impedance of arm (right)
ohms

Reticulocyte percentage
percent

Number of times snap-button pressed

White blood cell (leukocyte) count
10{circumflex over ( )}9 cells/Litre

Pulse rate
bpm

High light scatter reticulocyte count
10{circumflex over ( )}12 cells/Litre

Basophill percentage
percent

Impedance of arm (left)
ohms

Pulse wave reflection index

Eosinophill count
10{circumflex over ( )}9 cells/Litre

Nucleated red blood cell count
10{circumflex over ( )}9 cells/Litre

Eosinophill percentage
percent

Basophill count
10{circumflex over ( )}9 cells/Litre

Reticulocyte count
10{circumflex over ( )}12 cells/Litre

High light scatter reticulocyte percentage
percent

Nucleated red blood cell percentage
percent

INCORPORATION BY REFERENCE

All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

DETAILED DESCRIPTION OF THE INVENTION
Definitions

As used in the specification and appended claims, unless specified to the contrary, the following terms have the meaning indicated below.

“Amino” refers to the —NH₂radical, optionally substituted with one or more groups

selected from, for example: alkyl, fluoroalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heterocycloalkylalkyl, heteroaryl and heteroarylalkyl.

“Cyano” or “nitrile” refers to the —CN radical.

“Hydroxy” or “hydroxyl” refers to the —OH radical.

“Nitro” refers to the —NO₂radical.

“Oxo” refers to the ═O substituent.

“Thioxo” refers to the ═S substituent.

“Oximo” or “hydroximino” refer to the ═N—OH substituent

“Alkyl” refers to a linear or branched hydrocarbon chain radical, which is fully saturated. Alkyl may have from one to thirty carbon atoms. Alkyl may be attached to the rest of the molecule by a single bond.

An alkyl comprising up to 30 carbon atoms is referred to as a C₁-C₃₀alkyl, likewise, for example, an alkyl comprising up to 12 carbon atoms is a C₁-C₁₂alkyl. An alkyl comprising up to 6 carbons is a C₁-C₆alkyl. Alkyls (and other moieties defined herein) comprising other numbers of carbon atoms are represented similarly. Alkyl groups include, but are not limited to, C₁-C₃₀alkyl, C₁-C₂₀alkyl, C₁-C₁₅alkyl, C₁-C₁₀alkyl, C₁-C₈alkyl, C₁-C₆alkyl, C₁-C₄alkyl, C₁-C₃alkyl, C₁-C₂alkyl, C₂-C₈alkyl, C₃-C₈alkyl, C₄-C₈alkyl, and C₅-C₁₂alkyl. Representative alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, 1-methylethyl (isopropyl), n-butyl, i-butyl, s-butyl, n-pentyl, 1,1-dimethylethyl (t-butyl), 2-ethylpropyl, and the like. Representative linear alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, n-butyl, n-pentyl and the like. In certain embodiments, an alkyl group is optionally substituted by one or more of the following substituents: halo, cyano, nitro, oxo, thioxo, imino, oximo, trimethylsilyl, —OR^a, —SR^a, —OC(O)—R^a, —N(R^a)₂, —C(O)R^a, —C(O)OR^a, —C(O)N(R^a)₂, —N(R^a)C(O)OR^f, —OC(O)—NR^aR^f, —N(R^a)C(O)R^f, —N(R^a)S(O)_tR^f(where t is 1 or 2), —S(O)_tOR^a(where t is 1 or 2), —S(O)_tR^f(where t is 1 or 2) and —S(O)_tN(R^a)₂(where t is 1 or 2) where each R^ais independently hydrogen, alkyl, fluoroalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heterocycloalkylalkyl, heteroaryl or heteroarylalkyl, and each R^fis independently alkyl, fluoroalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heterocycloalkylalkyl, heteroaryl or heteroarylalkyl.

“Alkenyl” refers to a straight or branched hydrocarbon chain radical, containing at least one carbon-carbon double bond. In certain embodiments, alkenyl comprises from two to twelve carbon atoms. In certain embodiments, an alkenyl comprises two to eight carbon atoms. In certain embodiments, an alkenyl comprises two to six carbon atoms. In other embodiments, an alkenyl comprises two to four carbon atoms. The alkenyl may be attached to the rest of the molecule by a single bond, for example, ethenyl (i.e., vinyl), prop-1-enyl (i.e., allyl), but-1-enyl, pent-1-enyl, penta-1,4-dienyl, and the like. Alkenyl may be attached to the rest of the molecule by a double bond, e.g., ═CH₂, ═CH(CH₂)₃CH₃. In certain embodiments, an alkenyl group is optionally substituted by one or more of the following substituents: halo, cyano, nitro, oxo, thioxo, imino, oximo, trimethylsilyl, —OR^a, —SR^a, —OC(O)—R^a, —N(R^a)₂, —C(O)R^a, —C(O)OR^a, —C(O)N(R^a)₂, —N(R^a)C(O)OR^f, —OC(O)—NR^aR^f, —N(R^a)C(O)R^f, —N(R^a)S(O)_tR^f(where t is 1 or 2), —S(O)_tOR^a(where t is 1 or 2), —S(O)_tR^f(where t is 1 or 2) and —S(O)_tN(R^a)₂(where t is 1 or 2) where each R^ais independently hydrogen, alkyl, fluoroalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heterocycloalkylalkyl, heteroaryl or heteroarylalkyl, and each R^fis independently alkyl, fluoroalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heterocycloalkylalkyl, heteroaryl or heteroarylalkyl.

“Alkynyl” refers to a straight or branched hydrocarbon chain radical group, containing at least one carbon-carbon triple bond. In certain embodiments, alkynyl comprises from two to twelve carbon atoms. In certain embodiments, an alkynyl comprises two to eight carbon atoms. In certain embodiments, an alkynyl comprises two to six carbon atoms. In other embodiments, an alkynyl has two to four carbon atoms. The alkynyl may be attached to the rest of the molecule by a single bond, for example, ethynyl, propynyl, butynyl, pentynyl, hexynyl, and the like. In certain embodiments, an alkynyl group is optionally substituted by one or more of the following substituents: halo, cyano, nitro, oxo, thioxo, imino, oximo, trimethylsilanyl, —OR^a, —SR^a, —OC(O)—R^a, —N(R^a)₂, —C(O)R^a, —C(O)OR^a, —C(O)N(R^a)₂, —N(R^a)C(O)OR^f, —OC(O)—NR^aR^f, —N(R^a)C(O)R^f, —N(R^a)S(O)_tR^f(where t is 1 or 2), —S(O)_tOR^a(where t is 1 or 2), —S(O)_tR^f(where t is 1 or 2) and —S(O)_tN(R^a)₂(where t is 1 or 2) where each R^ais independently hydrogen, alkyl, fluoroalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heterocycloalkylalkyl, heteroaryl or heteroarylalkyl, and each R^fis independently alkyl, fluoroalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heterocycloalkylalkyl, heteroaryl or heteroarylalkyl.

“Alkylene” or “alkylene chain” refers to a straight or branched divalent hydrocarbon chain linking the rest of the molecule to a radical group, consisting solely of carbon and hydrogen, containing no unsaturation and having, for example, from one to twelve carbon atoms, e.g., methylene, ethylene, propylene, n-butylene, and the like. The alkylene chain is attached to the rest of the molecule through a single bond and to the radical group through a single bond. The points of attachment of the alkylene chain to the rest of the molecule and to the radical group are through one carbon in the alkylene chain or through any two carbons within the chain. In certain embodiments, an alkylene comprises one to eight carbon atoms (e.g., C₁-C₈alkylene). In other embodiments, an alkylene comprises one to five carbon atoms (e.g., C₁-C₅alkylene). In other embodiments, an alkylene comprises one to four carbon atoms (e.g., C₁-C₄alkylene). In other embodiments, an alkylene comprises one to three carbon atoms (e.g., C₁-C₃alkylene). In other embodiments, an alkylene comprises one to two carbon atoms (e.g., C₁-C₂alkylene). In other embodiments, an alkylene comprises one carbon atom (e.g., C₁alkylene). In certain embodiments, an alkylene comprises five to eight carbon atoms (e.g., C₅-C₈alkylene). In certain embodiments, an alkylene comprises two to five carbon atoms (e.g., C₂-C₅alkylene). In certain embodiments, an alkylene comprises three to five carbon atoms (e.g., C₃-C₅alkylene). In certain embodiments, an alkylene chain is optionally substituted by one or more of the following substituents: halo, cyano, nitro, oxo, thioxo, imino, oximo, trimethylsilyl, —OR^a, —SR^a, —OC(O)—R^a, —N(R^a)₂, —C(O)R^a, —C(O)OR^a, —C(O)N(R^a)₂, —N(R^a)C(O)OR^f, —OC(O)—NR^aR^f, —N(R^a)C(O)R^f, —N(R^a)S(O)_tR^f(where t is 1 or 2), —S(O)_tOR^a(where t is 1 or 2), —S(O)_tR^f(where t is 1 or 2) and —S(O)_tN(R^a)₂(where t is 1 or 2) where each R^ais independently hydrogen, alkyl, fluoroalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heterocycloalkylalkyl, heteroaryl or heteroarylalkyl, and each R^fis independently alkyl, fluoroalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heterocycloalkylalkyl, heteroaryl or heteroarylalkyl.

“Alkenylene” or “alkenylene chain” refers to a straight or branched divalent hydrocarbon chain linking the rest of the molecule to a radical group, consisting solely of carbon and hydrogen, containing at least one carbon-carbon double bond, and preferably having from two to twelve carbon atoms. The alkenylene chain may be attached to the rest of the molecule through a single bond and to the radical group through a single bond. The points of attachment of the alkenylene chain to the rest of the molecule and to the radical group may be through any two carbons within the chain. In certain embodiments, an alkenylene comprises two to ten carbon atoms (i.e., C₂-C₁₀alkenylene). In certain embodiments, an alkenylene comprises two to eight carbon atoms (i.e., C₂-C₈alkenylene). In other embodiments, an alkenylene comprises two to five carbon atoms (i.e., C₂-C₅alkenylene). In other embodiments, an alkenylene comprises two to four carbon atoms (i.e., C₂-C₄alkenylene). In other embodiments, an alkenylene comprises two to three carbon atoms (i.e., C₂-C₃alkenylene). In other embodiments, an alkenylene comprises two carbon atom (i.e., C₂alkenylene). In other embodiments, an alkenylene comprises five to eight carbon atoms (i.e., C₅-C₈alkenylene). In other embodiments, an alkenylene comprises three to five carbon atoms (i.e., C₃-C₅alkenylene). Unless stated otherwise specifically in the specification, an alkenylene chain is optionally substituted by one or more substituents such as those substituents described herein.

“Alkynylene” or “alkynylene chain” refers to a straight or branched divalent hydrocarbon chain linking the rest of the molecule to a radical group, consisting solely of carbon and hydrogen, containing at least one carbon-carbon triple bond, and preferably having from two to twelve carbon atoms. The alkynylene chain is attached to the rest of the molecule through a single bond and to the radical group through a single bond.

The points of attachment of the alkynylene chain to the rest of the molecule and to the radical group may be through any two carbons within the chain. In certain embodiments, an alkynylene comprises two to ten carbon atoms (i.e., C₂-C₁₀alkynylene). In certain embodiments, an alkynylene comprises two to eight carbon atoms (i.e., C₂-C₈alkynylene). In other embodiments, an alkynylene comprises two to five carbon atoms (i.e., C₂-C₅alkynylene). In other embodiments, an alkynylene comprises two to four carbon atoms (i.e., C₂-C₄alkynylene).

In other embodiments, an alkynylene comprises two to three carbon atoms (i.e., C₂-C₃alkynylene). In other embodiments, an alkynylene comprises two carbon atom (i.e., C₂alkynylene). In other embodiments, an alkynylene comprises five to eight carbon atoms (i.e., C₅-C₈alkynylene). In other embodiments, an alkynylene comprises three to five carbon atoms (i.e., C₃-C₅alkynylene). Unless stated otherwise specifically in the specification, an alkynylene chain is optionally substituted by one or more substituents such as those substituents described herein.

“Aminoalkyl” refers to a radical of the formula —R_c—N(R^a)₂or —R_c—N(R^a)—R_c, where each R_cis independently an alkylene chain as defined above, for example, methylene, ethylene, and the like; and each R^ais independently hydrogen, or a substituent, e.g., alkyl, fluoroalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heterocycloalkylalkyl, heteroaryl or heteroarylalkyl.

“Alkoxy” refers to a radical of the formula —O-alkyl where alkyl is as defined herein. Unless stated otherwise specifically in the specification, an alkoxy group may be optionally substituted as described above for alkyl.

“Aryl” refers to a radical derived from an aromatic monocyclic hydrocarbon or aromatic multicyclic hydrocarbon ring system by removing a hydrogen atom from a ring carbon atom. Aryl may includes cycles with five to eighteen carbon atoms, where at least one of the rings in the ring system is aromatic, i.e., it contains a cyclic, delocalized (4n+2) π-electron system in accordance with the Hückel theory. The ring system from which aryl groups are derived include, but are not limited to, groups such as benzene, fluorene, indane, indene, tetralin and naphthalene. The term “arylene” refers to the diradical derived from aryl as defined herein and is exemplified by phenylene and the like. In certain embodiments, an aryl or arylene is optionally substituted by one or more of the following substituents: alkyl, alkenyl, alkynyl, halo, fluoroalkyl, cyano, nitro, aryl, aralkyl, aralkenyl, aralkynyl, cycloalkyl, cycloalkylalkyl, heterocycloalkyl, heterocycloalkylalkyl, heteroaryl, heteroarylalkyl, —R^b—OR^a, —R^b—OC(O)—R^a, —R^b—OC(O)—OR^a, —R^b—OC(O)—N(R^a)₂, —R^b—N(R^a)₂, —R^b—C(O)R^a, —R^b—C(O)OR^a, —R^b—C(O)N(R^a)₂, —R^b—O—R—C(O)N(R^a)₂, —R^b—N(R^a)C(O)OR^a, —R^b—N(R^a)C(O)R^a, —R^b—N(R^a)S(O)_tR^a(where t is 1 or 2), —R^b—S(O)_tOR^a(where t is 1 or 2), —R^b—S(O)_tR^a(where t is 1 or 2), and —R^b—S(O)_tN(R^a)₂(where t is 1 or 2), where each R^ais independently hydrogen, alkyl, fluoroalkyl, cycloalkyl, cycloalkylalkyl, aryl (optionally substituted with one or more halo groups), aralkyl, heterocycloalkyl (optionally substituted with one or more alkyl groups), heterocycloalkylalkyl, heteroaryl or heteroarylalkyl, or two R^aattached to the same nitrogen atom are combined to form a heterocycloalkyl, each R^bis independently a direct bond or a straight or branched alkylene or alkenylene chain, and R_cis a straight or branched alkylene or alkenylene chain, and where each of the above substituents is unsubstituted unless otherwise indicated.

“Aralkyl” refers to a radical of the formula —R_c-aryl where R_cis an alkylene chain as defined above, for example, methylene, ethylene, and the like. The alkylene chain part of the aralkyl radical is optionally substituted as described above for an alkylene chain. The aryl part of the aralkyl radical is optionally substituted as described above for an aryl group.

“Aralkenyl” refers to a radical of the formula —R^d-aryl where R^dis an alkenylene chain as defined above. The aryl part of the aralkenyl radical is optionally substituted as described above for an aryl group. The alkenylene chain part of the aralkenyl radical is optionally substituted as defined above for an alkenylene group.

“Aralkynyl” refers to a radical of the formula —R^e-aryl, where R^eis an alkynylene chain as defined above. The aryl part of the aralkynyl radical is optionally substituted as described above for an aryl group. The alkynylene chain part of the aralkynyl radical is optionally substituted as defined above for an alkynylene chain.

The term “C_x-C_y” when used in conjunction with a chemical moiety, such as alkyl, alkenyl, or alkynyl is meant to include groups that contain from x to y carbons in the chain. For example, the term “C_x-C_yalkyl” refers to substituted or unsubstituted saturated hydrocarbon groups, including straight-chain alkyl and branched-chain alkyl groups that contain from x to y carbons in the chain, including haloalkyl groups such as trifluoromethyl and 2,2,2-trifluoroethyl, etc. The terms “C_x-C_yalkenyl“and” C_x-C_yalkynyl” refer to substituted or unsubstituted unsaturated aliphatic groups analogous in length and possible substitution to the alkyls described above, but that contain at least one double or triple bond respectively.

“Cycloalkyl” refers to a saturated or partially unsaturated, monocyclic or polycyclic hydrocarbon radical. In certain embodiments, the cycloalkyl includes fused (when fused with an aryl or a heteroaryl ring, the cycloalkyl is bonded through a non-aromatic ring atom) or bridged ring systems. In certain embodiments, the cycloalkyl comprises from three to twenty carbon atoms. In certain embodiments, a cycloalkyl comprises three to ten carbon atoms. In other embodiments, a cycloalkyl comprises five to seven carbon atoms. The cycloalkyl may be attached to the rest of the molecule by a single bond. In some embodiments, the cycloalkyl is fully saturated. Examples of monocyclic fully saturated cycloalkyls include, e.g., cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Polycyclic fully saturated cycloalkyl radicals include, for example, adamantyl, norbornyl (i.e., bicyclo[2.2.1]heptanyl), norbornenyl, decalinyl, 7,7-dimethyl-bicyclo[2.2.1]heptanyl, and the like. In some embodiments, the cycloalkyl is partially unsaturated or also known as a “cycloalkenyl”.

Examples of cycloalkenyls include cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclooctenyl, and the like. In certain embodiments, the cycloalkyl is optionally substituted by one or more substituents independently selected from alkyl, alkenyl, alkynyl, halo, fluoroalkyl, oxo, thioxo, cyano, nitro, optionally substituted aryl, optionally substituted aralkyl, optionally substituted aralkenyl, optionally substituted aralkynyl, optionally substituted cycloalkyl, optionally substituted cycloalkylalkyl, optionally substituted heterocycloalkyl, optionally substituted heterocycloalkylalkyl, optionally substituted heteroaryl, optionally substituted heteroarylalkyl, —R^b—OR^a, —R^b—OC(O)—R^a, —R^b—OC(O)—OR^a, —R^b—OC(O)—N(R^a)₂, —R^b—N(R^a)₂, —R^b—C(O)R^a, —R^b—C(O)OR^a, —R^b—C(O)N(R^a)₂, —R^b—O—R—C(O)N(R^a)₂, —R^b—N(R^a)C(O)OR^a, —R^b—N(R^a)C(O)R^a, —R^b—N(R^a)S(O)_tR^a(where t is 1 or 2), —R^b—S(O)_tOR^a(where t is 1 or 2), —R^b—S(O)_tR^a(where t is 1 or 2) and —R^b—S(O)_tN(R^a)₂(where t is 1 or 2), where each R^ais independently hydrogen, alkyl, fluoroalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heterocycloalkylalkyl, heteroaryl or heteroarylalkyl, each R^bis independently a direct bond or a straight or branched alkylene or alkenylene chain, and R^cis a straight or branched alkylene or alkenylene chain, and where each of the above substituents is unsubstituted unless otherwise indicated.

The term “cycloalkylene” refers to the diradical derived from cycloalkyl as defined herein. In some embodiments the cycloalkylene is fully saturated and is exemplified by cyclopropylene, cyclobutylene, cyclopentylene, cyclohexylene, and the like. In some embodiments, the cycloalkylene is partially unsaturated or also known as a “cycloalkenylene” and is exemplified by 1,2-cyclobut-1-enylene, 1,4-cyclohex-2-enylene and the like.

“Cycloalkylalkyl” refers to a radical of the formula —R^c-cycloalkyl where R^cis an alkylene chain as defined above. The alkylene chain and the cycloalkyl radical are optionally substituted as described above.

Halo” or “halogen” refers to a halogen radical, e.g., bromo, chloro, fluoro or iodo. In some embodiments, halogen refers to chloro or fluoro.

“Haloalkyl” refers to an alkyl radical, as defined above, that is substituted by one or more halo radicals, as defined above, e.g., trifluoromethyl, difluoromethyl, fluoromethyl, trichloromethyl, 2,2,2-trifluoroethyl, 1,2-difluoroethyl, 3-bromo-2-fluoropropyl, 1,2-dibromoethyl, and the like. In certain embodiments, a haloalkyl group may be optionally substituted.

“Heterocycloalkyl” refers to a saturated or partially unsaturated ring radical that comprises two to twenty carbon atoms and at least one heteroatom. In certain embodiments, the heteroatoms are independently selected from N, O, Si, P, B, and S atoms. The heterocycloalkyl may be selected from monocyclic or bicyclic, (fused when fused with an aryl or a heteroaryl ring, the heterocycloalkyl is bonded through a non-aromatic ring atom) or bridged ring systems. The heteroatoms in the heterocycloalkyl radical are optionally oxidized. One or more nitrogen atoms, if present, are optionally quaternized. The heterocycloalkyl is attached to the rest of the molecule through any atom of the heterocycloalkyl, valence permitting, such as any carbon or nitrogen atoms of the heterocycloalkyl. In certain embodiments, the heterocycloalkyl comprises from five to twenty carbon atoms. In certain embodiments, a heterocycloalkyl comprises five to ten carbon atoms. In other embodiments, a heterocycloalkyl comprises five to seven carbon atoms. In some embodiments, the heterocycloalkyl is fully saturated. Examples of fully saturated heterocycloalkyl radicals include, but are not limited to, 1,4-dioxanyl, dioxolanyl, thienyl[1,3]dithianyl, decahydroisoquinolyl, imidazolinyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxopiperazinyl, 2-oxopiperidinyl, 2-oxopyrrolidinyl, oxazolidinyl, oxiranyl, piperidinyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuryl, trithianyl, tetrahydropyranyl, thiomorpholinyl, thiamorpholinyl, 1-oxo-thiomorpholinyl, and 1,1-dioxo-thiomorpholinyl. In some embodiments, the heterocycloalkyl is partially unsaturated or also known as a “heterocycloalkenyl”. Examples of heterocycloalkenyl include 1,2,3,4-tetrahydropyridinyl, 1,2-dihydropyridinyl, 2-oxo-1,3-dioxolyl and the like. In certain embodiments, the heterocycloalkyl is optionally substituted by one or more of the following substituents selected from alkyl, alkenyl, alkynyl, halo, fluoroalkyl, oxo, thioxo, cyano, nitro, optionally substituted aryl, optionally substituted aralkyl, optionally substituted aralkenyl, optionally substituted aralkynyl, optionally substituted cycloalkyl, optionally substituted cycloalkylalkyl, optionally substituted heterocycloalkyl, optionally substituted heterocycloalkylalkyl, optionally substituted heteroaryl, optionally substituted heteroarylalkyl, —R^b—OR^a, —R^b—OC(O)—R^a, —R^b—OC(O)—OR^a, —R^b—OC(O)—N(R^a)₂, —R^b—N(R^a)₂, —R^b—C(O)R^a, —R^b—C(O)OR^a, —R^b—C(O)N(R^a)₂, —R^b—O—R—C(O)N(R^a)₂, —R^b—N(R^a)C(O)OR^a, —R^b—N(R^a)C(O)R^a, —R^b—N(R^a)S(O)_tR^a(where t is 1 or 2), —R^b—S(O)_tOR^a(where t is 1 or 2), —R^b—S(O)_tR^a(where t is 1 or 2) and —R^b—S(O)_tN(R^a)₂(where t is 1 or 2), where each R^ais independently hydrogen, alkyl, fluoroalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heterocycloalkylalkyl, heteroaryl or heteroarylalkyl, each R^bis independently a direct bond or a straight or branched alkylene or alkenylene chain, and R^cis a straight or branched alkylene or alkenylene chain, and where each of the above substituents is unsubstituted unless otherwise indicated.

The term “heterocycloalkylene” refers to the diradical derived from heterocycloalkyl as defined herein. In some embodiments the heterocycloalkylene is fully saturated and is exemplified by azetidinyllene, aziridinylene, pyrrolidylene, piperidinylene, morpholinylene, and the like. In some embodiments, the heterocycloalkylene is partially unsaturated or also known as a “heterocycloalkenylene”.

“Heterocycloalkylalkyl” refers to a radical of the formula —R_c-heterocycloalkyl where R_cis an alkylene chain as defined above. If the heterocycloalkyl is a nitrogen-containing heterocycloalkyl, the heterocycloalkyl is optionally attached to the alkyl radical at the nitrogen atom. The alkylene chain of the heterocycloalkylslkyl radical is optionally substituted as defined above for an alkylene chain. The heterocycloalkyl part of the heterocycloalkylalkyl radical is optionally substituted as defined above for a heterocycloalkyl group.

“Heteroaryl” refers to a 5- to 14-membered ring system radical comprising hydrogen atoms, one to thirteen carbon atoms, one to six heteroatoms selected from the group consisting of nitrogen, oxygen, phosphorous and sulfur, and at least one aromatic ring. In some embodiments, the heteroaryl is a 5-membered heteroaryl. In some embodiments, the heteroaryl is a 6-membered heteroaryl. For purposes of this invention, the heteroaryl radical may be a monocyclic, bicyclic, tricyclic or tetracyclic ring system, which may include fused (when fused with a cycloalkyl or heterocycloalkyl ring, the heteroaryl is bonded through an aromatic ring atom) or bridged ring systems; and the nitrogen, carbon or sulfur atoms in the heteroaryl radical may be optionally oxidized; the nitrogen atom may be optionally quaternized. Examples include, but are not limited to, azepinyl, acridinyl, benzimidazolyl, benzothiazolyl, benzindolyl, benzodioxolyl, benzofuranyl, benzooxazolyl, benzothiazolyl, benzothiadiazolyl, benzo[b][1,4]dioxepinyl, 1,4-benzodioxanyl, benzonaphthofuranyl, benzoxazolyl, benzodioxolyl, benzodioxinyl, benzopyranyl, benzopyranonyl, benzofuranyl, benzofuranonyl, benzothienyl (benzothiophenyl), benzotriazolyl, benzo[4,6]imidazo[1,2-a]pyridinyl, carbazolyl, cinnolinyl, dibenzofuranyl, dibenzothiophenyl, furanyl, isothiazolyl, imidazolyl, indazolyl, indolyl, isoindolyl, indolinyl, isoindolinyl, isoquinolyl, indolizinyl, isoxazolyl, naphthyridinyl, oxadiazolyl, 2-oxoazepinyl, oxazolyl, 1-oxidopyridinyl, 1-oxidopyrimidinyl, 1-oxidopyrazinyl, 1-oxidopyridazinyl, 1-phenyl-1H-pyrrolyl, phenazinyl, phenothiazinyl, phenoxazinyl, phthalazinyl, pteridinyl, purinyl, pyrrolyl, pyrazolyl, pyridinyl, pyrazinyl, pyrimidinyl, pyridazinyl, quinazolinyl, quinoxalinyl, quinolinyl, isoquinolinyl, tetrahydroquinolinyl, thiazolyl, thiadiazolyl, triazolyl, tetrazolyl, triazinyl, and thiophenyl (i.e., thienyl). The term “heteroarylene” refers to the diradical derived from heteroaryl as defined herein and is exemplified by pyridinylene, pyrimidinylene, pyrazinylene, and the like. Unless stated otherwise specifically in the specification, a heteroaryl group is optionally substituted by one or more of the following substituents selected from alkyl, alkenyl, alkynyl, halo, fluoroalkyl, haloalkenyl, haloalkynyl, oxo, thioxo, cyano, nitro, optionally substituted aryl, optionally substituted aralkyl, optionally substituted aralkenyl, optionally substituted aralkynyl, optionally substituted cycloalkyl, optionally substituted cycloalkylalkyl, optionally substituted heterocycloalkyl, optionally substituted heterocycloalkylalkyl, optionally substituted heteroaryl, optionally substituted heteroarylalkyl, —R^b—OR^a, —R^b—OC(O)—R^a, —R^b—OC(O)—OR^a, —R^b—OC(O)—N(R^a)₂, —R^b—N(R^a)₂, —R^b—C(O)R^a, —R^b—C(O)OR^a, —R^b—C(O)N(R^a)₂, —R^b—O—R_c—C(O)N(R^a)₂, —R^b—N(R^a)C(O)OR^a, —R^b—N(R^a)C(O)R^a, —R^b—N(R^a)S(O)_tR^a(where t is 1 or 2), —R^b—S(O)_tOR^a(where t is 1 or 2), —R^b—S(O)_tR^a(where t is 1 or 2) and —R^b—S(O)_tN(R^a)₂(where t is 1 or 2), where each R^ais independently hydrogen, alkyl, fluoroalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heterocycloalkylalkyl, heteroaryl or heteroarylalkyl, each R^bis independently a direct bond or a straight or branched alkylene or alkenylene chain, and R_cis a straight or branched alkylene or alkenylene chain, and where each of the above substituents is unsubstituted unless otherwise indicated.

“Heteroarylalkyl” refers to a radical of the formula —R^c-heteroaryl, where R^cis an alkylene chain as defined above. If the heteroaryl is a nitrogen-containing heteroaryl, the heteroaryl is optionally attached to the alkyl radical at the nitrogen atom. The alkylene chain of the heteroarylalkyl radical is optionally substituted as defined above for an alkylene chain. The heteroaryl part of the heteroarylalkyl radical is optionally substituted as defined above for a heteroaryl group.

A “tautomer” refers to a molecule wherein a proton shift from one atom of a molecule to another atom of the same molecule is possible. In certain embodiments, the compounds presented herein exist as tautomers. In circumstances where tautomerization is possible, a chemical equilibrium of the tautomers will exist. The exact ratio of the tautomers depends on several factors, including physical state, temperature, solvent, and pH. Some examples of tautomeric equilibrium include:

embedded image

“Optional” or “optionally” means that a subsequently described event or circumstance may or may not occur and that the description includes instances when the event or circumstance occurs and instances in which it does not. For example, “optionally substituted aryl” means that the aryl radical may or may not be substituted and that the description includes both substituted aryl radicals and aryl radicals having no substitution. “Optionally substituted” and “substituted or unsubstituted” and “unsubstituted or substituted” are used interchangeably herein.

“Pharmaceutically acceptable salt” includes both acid and base addition salts. A pharmaceutically acceptable salt of any one of the compounds described herein is intended to encompass any and all pharmaceutically suitable salt forms. Preferred pharmaceutically acceptable salts of the compounds described herein are pharmaceutically acceptable acid addition salts and pharmaceutically acceptable base addition salts.

“Pharmaceutically acceptable acid addition salt” refers to those salts which retain the biological effectiveness and properties of the free bases, which are not biologically or otherwise undesirable, and which are formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, hydroiodic acid, hydrofluoric acid, phosphorous acid, and the like. Also included are salts that are formed with organic acids such as aliphatic mono- and dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxy alkanoic acids, alkanedioic acids, aromatic acids, aliphatic and. aromatic sulfonic acids, etc. and include, for example, acetic acid, trifluoroacetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, nicotinic acid, succinic acid, fumaric acid, formic acid, tartaric acid, camphor-10-sulfonic acid, citric acid, benzoic acid, cinnamic acid, isonipecotinic acid, levulinic acid, maleic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, and the like. Exemplary salts thus include sulfates, pyrosulfates, bisulfates, sulfites, bisulfites, nitrates, phosphates, monohydrogenphosphates, dihydrogenphosphates, metaphosphates, pyrophosphates, chlorides, bromides, iodides, acetates, trifluoroacetates, propionates, caprylates, isobutyrates, isonipecotinates, levuliates, oxalates, malonates, nicotinates, succinate, suberates, sebacates, fumarates, maleates, mandelates, benzoates, chlorobenzoates, methylbenzoates, dinitrobenzoates, phthalates, benzenesulfonates, toluenesulfonates, phenylacetates, citrates, lactates, malates, tartrates, methanesulfonates, and the like. Also contemplated are salts of amino acids, such as arginates, gluconates, and galacturonates (see, for example, Berge S. M. et al., “Pharmaceutical Salts,” Journal of Pharmaceutical Science, 66:1-19 (1997)). Acid addition salts of basic compounds are as a rule prepared by contacting the free base forms with a sufficient amount of the desired acid to produce the salt.

“Pharmaceutically acceptable base addition salt” refers to those salts that retain the biological effectiveness and properties of the free acids, which are not biologically or otherwise undesirable. These salts are prepared by addition of an inorganic base or an organic base to the free acid. In some embodiments, pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali and alkaline earth metals or organic amines. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts and the like. Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, for example, isopropylamine, trimethylamine, diethylamine, triethylamine, triethanolamine, tripropylamine, ethanolamine, diethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, N,N-dibenzylethylenediamine, chloroprocaine, hydrabamine, choline, betaine, ethylenediamine, ethylenedianiline, N-methylglucamine, glucosamine, methylglucamine, theobromine, purines, piperazine, piperidine, N-ethylpiperidine, polyamine resins and the like. See Berge et al., supra.

In a specific embodiment and in this context, the term “pharmaceutically acceptable carrier” can mean a carrier, excipient or diluent approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term “carrier” refers to a diluent, adjuvant (e.g., Freund's adjuvant (complete and incomplete)), excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a specific carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Examples of suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences” by E.W. Martin.

As used herein and in the appended claims, the singular forms “a,” “and,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “an agent” includes a plurality of such agents, and reference to “the cell” includes reference to one or more cells (or to a plurality of cells) and equivalents thereof.

When ranges are used herein for physical properties, such as molecular weight, or chemical properties, such as chemical formulae, all combinations and subcombinations of ranges and specific embodiments therein are intended to be included.

The term “about” when referring to a number or a numerical range means that the number or numerical range referred to is an approximation within experimental variability (or within statistical experimental error), and thus the number or numerical range varies between 1% and 15% of the stated number or numerical range.

The term “comprising” (and related terms such as “comprise” or “comprises” or “having” or “including”) is not intended to exclude that which in other certain embodiments, for example, an embodiment of any composition of matter, composition, method, or process, or the like, described herein, “consist of” or “consist essentially of” the described features.

The term “subject” or “patient” encompasses mammals and non-mammals. Examples of mammals include, but are not limited to, any member of the Mammalian class: humans, non-human primates such as chimpanzees, and other apes and monkey species; farm animals such as cattle, horses, sheep, goats, swine; domestic animals such as rabbits, dogs, and cats; laboratory animals including rodents, such as rats, mice and guinea pigs, and the like. Examples of non-mammals include, but are not limited to, birds, fish and the like. In one embodiment of the methods and compositions provided herein, the mammal is a human.

The term “modulate,” as used herein, means to interact with a target protein either directly or indirectly so as to alter the activity of the target protein, including, by way of example only, to inhibit the activity of the target, or to limit or reduce the activity of the target, or to increase certain activity of a target compared to the magnitude of the activity in the absence of the modulator

As used herein, the term “modulator” refers to a compound that alters an activity of a target. For example, a modulator can cause an increase or decrease in the magnitude of a certain activity of a target compared to the magnitude of the activity in the absence of the modulator. In certain embodiments, a modulator is an inhibitor, which decreases the magnitude of one or more activities of a target. In certain embodiments, an inhibitor completely prevents one or more activities of a target.

As used herein, “treatment” or “treating” or “palliating” or “ameliorating” are used interchangeably herein. These terms refers to an approach for obtaining beneficial or desired results including but not limited to therapeutic benefit and/or a prophylactic benefit. By “therapeutic benefit” is meant eradication or amelioration of the underlying disorder being treated. Also, a therapeutic benefit is achieved with the eradication or amelioration of one or more of the physiological symptoms associated with the underlying disorder such that an improvement is observed in the patient, notwithstanding that the patient is still afflicted with the underlying disorder. For prophylactic benefit, the compositions are administered to a patient at risk of developing a particular disease, or to a patient reporting one or more of the physiological symptoms of a disease, even though a diagnosis of this disease has been made.

As used herein, “PFK1” refers to phosphofructokinase 1, also known as 6-phosphofructo-1-kinase.

As used herein, “PFK2” refers to phosphofructokinase 2, also known as 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase.

As used herein, “PFKFB1,” “PFKFB2,” “PFKFB3,” “PFKFB4” refer to specific forms of PFK2.

The term “subject,” as used herein, generally refers to an animal, such as a mammalian species (e.g., mouse or human) or avian (i.e., bird) species, nematode (e.g., C. elegans), or other organism, such as a plant. More specifically, the subject can be a vertebrate, e.g., a mammal such as a mouse, a primate, a simian or a human. Preferably, the subject is a human. Preferably, the subject is more than 40 years old. Animals include, but are not limited to, farm animals, sport animals, and pets. A subject can be a healthy individual, an individual that has or is suspected of having a disease or a predisposition to the disease, or an individual that is in need of therapy or suspected of needing therapy, or an aged or frail individual. A subject can be any human being.

In some embodiments, by treating or preventing an age-related disease or disorder, any anti-aging treatment is meant. Anti-aging treatment includes (but is not limited to) treatments leading to prevention, amelioration or lessening the effects of aging, decreasing or delaying an increase in the biological age, slowing rate of aging; treatment, prevention, amelioration and lessening the effects of frailty or at least one of aging related diseases and conditions or declines or slowing down the progression of such decline (including but not limited to those indicated in Table 1, “Declines”), condition or disease, increasing health span or lifespan, rejuvenation, increasing stress resistance or resilience, increasing rate or other enhancement of recovery after surgery, radiotherapy, disease and/or any other stress, prevention and/or the treatment of menopausal syndrome, restoring reproductive function, eliminating or decrease in spreading of senescent cells, decreasing all-causes or multiple causes of mortality risks or mortality risks related to at least one or at least two of age related diseases or conditions or delaying in increase of such risks, decreasing morbidity risks. The treatment leading to the modulating at least one of biomarkers of aging into more youthful state or slowing down its change into “elder” state is also regarded to be an anti-aging treatment, including but not limited to biomarkers of aging which are visible signs of aging, such as wrinkles, grey hairs etc. In some embodiments, an age-related disease or disorder is selected from: atherosclerosis, cardiovascular disease, arthritis, cataracts, osteoporosis, type 2 diabetes, hypertension, neurodegeneration (including but not limited to Alzheimer's disease, Huntington's disease, and other age-progressive dementias; Parkinson's disease; and amyotrophic lateral sclerosis [ALS]), stroke, atrophic gastritis, osteoarthritis, NASH, camptocormia, chronic obstructive pulmonary disease, coronary artery disease, dopamine dysregulation syndrome, metabolic syndrome, effort incontinence, Hashimoto's thyroiditis, heart failure, late life depression, immunosenescence (including but not limited to age related decline in immune response to vaccines, age related decline in response to immunotherapy etc.), myocardial infarction, acute coronary syndrome, sarcopenia, sarcopenic obesity, senile osteoporosis, urinary incontinence etc. Cancer survivors, patients under chemiotherapy and radiotherapy and others comparable stress and as well as HIV patients may suffer accelarated aging, treatment against such accelerated aging or its consequences is also regarded as anti-aging treatment, as well as preventive measures against it.

Aging-related changes in any parameter or physiological metric are also regarded as age-related conditions, including but not limited to aging related change in blood parameters, heart rate, cognitive functions/decline, bone density, basal metabolic rate, systolic blood pressure, heel bone mineral density (BMD), heel quantitative ultrasound index (QUI), heel broadband ultrasound attenuation, heel broadband ultrasound attenuation, forced expiratory volume in 1-second (FEV1), forced vital capacity (FVC), peak expiratory flow (PEF), duration to first press of snap-button in each round, reaction time, mean time to correctly identify matches, hand grip strength (right and/or left), whole body fat-free mass, leg fat-free mass (right and/or left), and time for recovery after any stress (wound, operation, chemotherapy, disease, change in lifestyle etc.). In some embodiments, the age-related disorder is a cardiovascular disease. In some embodiments, the age-related disorder is a bone loss disorder. In some embodiments, the age-related disorder is a neuromuscular disorder. In some embodiments, the age-related disorder is a neurodegenerative disorder or a cognitive disorder. In some embodiments, the age-related disorder is a metabolic disorder. In some embodiments, the age-related disorder is sarcopenia, osteoarthritis, chronic fatigue syndrome, senile dementia, mild cognitive impairment due to aging, schizophrenia, Huntington's disease, Pick's disease, Creutzfeldt-Jakob disease, stroke, CNS cerebral senility, age-related cognitive decline, pre-diabetes, diabetes, obesity, osteoporosis, coronary artery disease, cerebrovascular disease, heart attack, stroke, peripheral arterial disease, aortic valve disease, stroke, Lewy body disease, amyotrophic lateral sclerosis (ALS), mild cognitive impairment, pre-dementia, dementia, progressive subcortical gliosis, progressive supranuclear palsy, thalamic degeneration syndrome, hereditary aphasia, myoclonus epilepsy, macular degeneration, or cataracts. Aging related change in any parameter of organism is also regarded as an aging related condition, including but not limited to aging related change in at least one of the parameter selected from the Table “Declines”. In some embodiments, term “anti-aging treatment” means treatment of disease or condition mediated by PFKFB3, excluding cancer. In some embodiments, term “anti-aging treatment” means treatment increasing resistance to radiation. In some embodiments, term “anti-aging treatment” means treatment of disease or age related condition or neurodegeneration associated with the alleviated level of PFKFB3 in subject's cells. some embodiments of this invention “aged subject” is understood as a human being of chronological age (or in some embodiments, of biological age) of 30 years or older, 35 years or older, 40 years or older, 45 years or older, 50 years or older, 55 years or older, 60 years or older, 65 years or older, 70 years or older, 75 years or older, 80 years or older, 85 years or older, 90 years or older, 95 years or older. In some embodiments of this invention “aged subject” is understood as a frail human (or other animal).

In some embodiments, an age related disease or disorder is selected from: atherosclerosis, cardiovascular disease, arthritis, cataracts, osteoporosis, type 2 diabetes, hypertension, neurodegenaration, including but not limited to Alzheimer's disease, dementia, Parkinson's disease), stroke, atrophic gastritis, osteoarthritis, NASH, camptocormia, chronic obstructive pulmonary disease, coronary artery disease, dopamine dysregulation syndrome, metabolic syndrome, effort incontinence, Hashimoto's thyroiditis, heart failure, late life depression, immunosenescence, myocardial infarction, acute coronary syndrome, sarcopenia, sarcopenic obesity, senile osteoporosis, urinary incontinence or diseases and conditions mentioned in “Frameworks for Proof-of-Concept Clinical Trials of Interventions That Target Fundamental Aging Processes”. Justice et al., 2016), Juvenescence: Investing in the Age of Longevity, Mellon at al., 2017) etc.

In some embodiments, age related, aging-related or ageing-related means “caused by pathological processes which persistently lead to the loss of organism's adaptation and progress in older ages”.

“Indirect Target” means effector upstream or downstream of a PFKFB3, which can be an element (protein, small molecule, cell, electrolytes, antibodies, antigens, hormones, microRNA, RNA etc.) which is upstream or downstream in a pathway in relation to PFKFB3. In some embodiments Indirect Target means any upstream or downstream element, which modulation or reduction effects or mimics the effect of PFKFB3 reduction, inhibition or degradation, optionally that have anti-aging or neuroprotective effect.

In some embodiments, everything related to PFKFB3 relates to Indirect Target, e.g. when it is said that PFKFB3 inhibitor is for use as neuroprotector, in such embodiment it will mean that the modulator of Indirect Target is for use as neuroprotector.

In some embodiments, term “Small molecule” means an individual compound with molecular weight less than about 2000 daltons in size, usually less than about 1500 daltons in size, more usually less than about 750 daltons in size, preferably less than about 500 daltons in size, although molecules larger than 2000 daltons in size will also be PFKFB3 inhibitors herein.

The terms “pharmaceutical composition” and formulation are used interchangeably herein.

The term “selected from . . . ” means “one or more of” (e.g. bind one or more of the following proteins . . . ”).

In this context, the term “PFKFB3 inhibitor(s) selectively bind(s) a PFKFB3” can mean the following:

The term “solely” means that the PFKFB3 inhibitor(s) bind(s) exclusively to a PFKFB3, i.e. the PFKFB3 inhibitor(s) do(does) not bind to proteins other than a PFKFB3.

Compounds

The compounds, and compositions comprising the compounds described herein, are useful for the treatment of diseases or conditions where the modulation of PFKFB3 and/or PFKFB4 has beneficial effect. In certain embodiments, compounds, and compositions comprising the compounds, described herein are useful for the treatment of diseases or conditions wherein the inhibition of kinase activity of PFKFB3 and/or PFKFB4 has beneficial effect or for manufacturing of corresponding medications.

The compounds, and compositions comprising the compounds described herein, are useful for many uses, including but not limited to the treatment of cancer, neudegenerative and aging related diseases or conditions where the modulation of PFKFB3 has beneficial effect. In certain embodiments, compounds, and compositions comprising the compounds, described herein are useful for the treatment of diseases or conditions wherein the inhibition of kinase activity of PFKFB3 has beneficial effect or for manufacturing of corresponding medications.

In some embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of less than 1×10-3M. In some embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of less than 1×10-4 M. In some embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of less than 1×10-5 M. In some embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of less than 1×10-6 M. In some embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of less than 1×10-7 M. In some embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of less than 1×10-8 M. In some embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of less than 1×10-9 M. In some embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of less than 1×10-10 M. In some embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of less than 1×10-12 M. In some embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of less than 1×10-15 M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1×10-3M to about 1×10-15M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1×10-3M to about 1×10-14M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1×10-3M to about 1×10-13M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1×10-3M to about 1×10-12M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1×10-3M to about 1×10-11 M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1×10-3M to about 1×10-10M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1×10-3M to about 1×10-9M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1×10-3M to about 1×10-8M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1×10-3M to about 1×10-7M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1×10-3M to about 1×10-6M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1×10-6M to about 1×10-15M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1×10-9M to about 1×10-15M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1×10-12M to about 1×10-15M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1×10-6M to about 1×10-12M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1×10-6M to about 1×10-9M.

Disclosed herein is a compound of Formula (I):

embedded image

or a pharmaceutically acceptable salt thereof, wherein:

Z is selected from —C(═O)— and —C(R^a)(R^b)—;

Ar_Cis selected from C₃-C₈cycloalkenylene, C₂-C₈heterocycloalkenylene, arylene, and heteroarylene; wherein Ar_Cis substituted with one or more R_C;

each R³is independently optionally substituted C₁-C₆alkyl or optionally substituted C₃-C₈cycloalkyl;

or R⁴and R⁵are taken together with the N to which they are attached to form an optionally substituted C₂-C₈heterocycloalkyl;

each R⁶are independently selected from optionally substituted C₁-C₆alkyl, optionally substituted C₃-C₈cycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;

Ar_Tis selected from pyridinyl, pyrimidinyl, pyridazinyl, pyrazinyl, phenyl, pyrrolyl, furanyl, thiophenyl, pyrazolyl, imidazolyl, triazolyl, and tetrazolyl, wherein Ar_Tis optionally substituted;

R⁹is optionally substituted C₁-C₆alkyl;

or R⁹is optionally substituted C₃-C₈cycloalkyl;

or R¹⁰and R¹¹are taken together with the N to which they are attached to form an optionally substituted C₂-C₈heterocycloalkyl;

R¹²is selected from optionally substituted C₁-C₆alkyl, optionally substituted C₃-C₈cycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;

provided that:

(a) at least one of R_Cis not —NHCOR⁶when R_Lis —NHCOR¹²and Ar_Cis heterocycloalkenylene or heteroarylene; or

(b) at least one of R_Cis not -Me when R_Lis —OMe; or

(d) at least one of R_Cis not —OH when R_Lis —C(═O)OH; or

(e) at least one of R_Cis not -Me when R_Lis —C(═O)OH; or

(f) at least one of R_Cis not -Et when R_Lis —OMe; or

(g) at least one of R_Cis not optionally substituted benzoxazolyl when R_Lis —C(═O)OH; or

(h) at least one of R_Cis not optionally substituted isoindoline-1,3-dione when R_Lis —C(═O)OH.

In some embodiments of a compound of Formula (I):

embedded image

or a pharmaceutically acceptable salt thereof, wherein:

Z is selected from —C(═O)— and —C(R^a)(R^b)—;

Ar_Cis selected from C₃-C₈cycloalkenylene, C₂-C₈heterocycloalkenylene, arylene, and heteroarylene; wherein Ar_Cis substituted with one or more R_C;

wherein the C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, C₂-C₈heterocycloalkyl, —O—C₂-C₈heterocycloalkyl, aryl, and heteroaryl are optionally substituted with one or more substituents independently selected from —OH, halogen, —C(═O)OR⁷, —C(═O)R⁶, —C(═O)NR¹R², C₁-C₆alkyl, C₁-C₈alkoxy, C₃-C₈cycloalkyl, —O—C₃-C₈cycloalkyl, C₂-C₈heterocycloalkyl, —O—C₂-C₈heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, and —NR⁷R⁸;