The present application claims the priority benefit of Taiwan Application No. 109134157, filed on Sep. 30, 2020; the entirety of which is hereby incorporated by reference herein.
The present disclosure relates to pharmaceutical compositions and methods for preventing, treating and diagnosing a neurodegenerative disease. The present disclosure also relates to biomarkers and kits for diagnosing a neurodegenerative disease.
Studies found that amyloid is distributed in various organs of a body, and excessive accumulation of amyloid can cause a variety of neurodegenerative diseases; one of which is Alzheimer's disease (AD), which is associated with accumulation of amyloid in the brain.
Reducing the accumulation of amyloid in the brain is regarded as one of the feasible strategies to prevent or treat AD. Currently, it is known that the effective methods to reduce amyloid in the brain include inhibiting enzymes that cleave amyloid, such as β-secretase and γ-secretase, or inhibiting amyloid precursor protein (APP), the raw material for amyloid accumulation. However, most of the methods of inhibiting APP or β-secretase have recently failed, and regulating γ-secretase is considered to be the most promising method for the treatment of Alzheimer's disease.
γ-secretase is composed of four proteins: presenilin-1 (PSEN-1), nicastrin (NCSTN), anterior pharynx-defective 1 (APH-1)), and presenilin enhancer 2 (PEN-2), where PSEN-1 is considered to be the key protein regulating γ-secretase. It has been reported that effective regulation of PSEN-1 significantly reduces accumulation of amyloid (Int. J. Mol. Sci. 2020, 21(4), 1327).
However, there is yet a safe and effective modulator of γ-secretase. For instance, the γ-secretase inhibitor (GSI) LY450139 not only damages Notch signaling, but also causes skin tumors and differentiation of intestinal epithelial cell, and leads to serious adverse reactions. In addition, the existing drugs for treating Alzheimer's disease have not yet achieved a satisfactory therapeutic efficacy, and thus treatment of Alzheimer's disease remains highly sought after. Furthermore, the current diagnostic methods for Alzheimer's disease do not cover for all Alzheimer's disease patients. Therefore, more effective biomarkers and methods are still needed for predicting or diagnosing Alzheimer's disease.
The present disclosure provides a pharmaceutical composition and a method for preventing or treating neurodegenerative diseases caused by accumulation of amyloid. In the present disclosure, miRNA-29b-2-5p (miR-29b-2-5p) was found to be significantly reduced in brains with higher PSEN-1. In the present disclosure, it was further found that increasing the expression level of miRNA-29b-2-5p reduces amyloid accumulation in the brain, thereby preventing or treating neurodegenerative diseases caused by amyloid accumulation. The present disclosure provides a pharmaceutical composition for preventing or treating neurodegenerative diseases, wherein the pharmaceutical composition comprises a modulator of miRNA-29b-2-5p.
In at least one embodiment of the present disclosure, the modulator of miRNA-29b-2-5p is a biologically active agent that increases the activity of miRNA-29b-2-5p, including a biologically active agent that increases the expression level of miRNA-29b-2-5p. In at least one embodiment, the biologically active agent includes an enhancer that enhances the expression of miRNA-29b-2-5p. In at least one embodiment of the present disclosure, the enhancer comprises nucleotides that are complementary to or hybridizes with a 3′-UTR (untranslated region) of human PSEN-1 gene sequence. In another embodiment, the enhancer is a nucleic acid that is complementary to or hybridizes with a 3′-UTR (untranslated region) of human PSEN-1 gene sequence at position 3791 to 3797 and 3856 to 3862. In at least one embodiment, the enhancer is a nucleic acid having a sequence of cugguuucacaugguggcuuag (SEQ ID NO.: 1). In another embodiment, the enhancer is a small molecule compound, peptide, protein, nucleotide or carbohydrate.
In at least one embodiment, the enhancer that promotes the expression of miRNA-29b-2-5p is a phthalide compound, including its metabolic precursor, a pharmaceutically acceptable salt of its metabolic precursor, and a pharmaceutically acceptable ester of its metabolic precursor and a combination thereof. In at least one embodiment, the phthalide compound is n-butylidenephthalide (BP), (Z)-butylidenephthalide (cis-butylidenephthalide), (E)-butylidenephthalide (trans-butylidenephthalide), ligustilide, 3-N-butylphthalide, or Senkyunolide I. In at least one embodiment, the n-butylidenephthalide used as an enhancer for promoting the expression of miRNA-29b-2-5p in the pharmaceutical composition for preventing or treating a neurodegenerative disease is not coated or encapsulated in any form. In another embodiment, the n-butylidenephthalide used as an enhancer for promoting the expression of miRNA-29b-2-5p in the pharmaceutical composition for preventing or treating a neurodegenerative disease does not comprise a pharmaceutical carrier. In at least one embodiment, the concentration of n-butylphthalide used as an enhancer of miRNA-29b-2-5p expression in the cell is 30 μM to 100 μM. In another embodiment, the amount of n-butylphthalide in animals is 30 mg/kg to 200 mg/kg. In another embodiment, the amount of n-butylphthalide in animals is 50 mg/kg to 150 mg/kg. In another embodiment, the amount of n-butylphthalide in animals is 60 mg/kg to 120 mg/kg. In another embodiment, the effective amount of n-butylphthalide as an enhancer to promote the expression of miRNA-29b-2-5p in human is 30 mg to 1500 mg per day. In another embodiment, the effective amount of n-butylphthalide as an enhancer to promote the expression of miRNA-29b-2-5p in human is 30 mg to 1000 mg, 50 mg to 1500 mg or 100 mg to 1500 mg per day. In another embodiment, the minimum effective amount of n-butylphthalide as an enhancer to promote the expression of miRNA-29b-2-5p in human is 30 mg per day, in yet another embodiment, the minimum effective amount is 50 mg per day, 60 mg per day, 70 mg per day, 80 mg per day, 90 mg per day, 100 mg per day, 200 mg per day, 300 mg per day, 400 mg per day, 500 mg per day. In another embodiment, the effective amount of n-butylphthalide as an enhancer to promote the expression of miRNA-29b-2-5p in human is 1500 mg per day, 1400 mg per day, 1300 mg per day, 1200 mg per day, 1100 mg per day, 1000 mg per day, 900 mg per day, 800 mg per day, 700 mg per day or 600 mg per day.
The present disclosure provides a pharmaceutical composition for preventing or treating a neurodegenerative disease comprising a bioactive agent that increases a miRNA-29b-2-5p expression level, an antioxidant or a medication that jointly promotes the expression of the miR-29b family. In at least one embodiment, the miR-29b family is miR-29b-3p, miR-29b-1-5p or miR-29b-2-5p. In at least one embodiment, the antioxidant includes water-soluble and fat-soluble ascorbic acid (vitamin C), esterified vitamin C, glutathione, lipoic acid, uric acid, carotene, α-tocopherol (vitamin E), ubiquinone (coenzyme Q) and retinol (vitamin A). In at least one embodiment, the antioxidant is vitamin C, with an amount of 50 mg/kg to 150 mg/kg in an animal. In another embodiment, the amount of the antioxidant is 100 mg/kg in an animal. In another embodiment, the amount of the antioxidant is 50 to 2,000 mg in a human per day, including 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,050, 1,100, 1,150, 1,200, 1,250, 1,300, 1,350, 1,400, 1,450, 1,500, 1,550, 1,600, 1,650, 1,700, 1,750, 1,800, 1,850, 1,900, and 1,950 mg.
The amount of a pharmaceutical composition for preventing or treating a neurodegenerative disease provided by the present disclosure is adjusted based on its formulation, time for administration, administration route, patient's age, weight, sex, state of disease, excretion rate and factors such as drug sensitivity. Usually, the doctor in charge of the treatment can easily determine the form of administration and effective dosage. In at least one embodiment, the dosage of the pharmaceutical composition for preventing or treating a neurodegenerative disease is 0.001 mg/kg to 100 mg/kg per day.
In at least one embodiment, the pharmaceutical composition for preventing or treating a neurodegenerative disease includes a pharmaceutically acceptable carrier. In at least one embodiment, the pharmaceutically acceptable carrier includes a pharmaceutically acceptable carrier commonly used in preparation of a pharmaceutical composition, including lactose, dextrose, sucrose, sorbitol, mannitol, starch, Arabic gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylparaben, propylparaben, talc, magnesium stearate, liposomes, exosomes and minerals, but not limited thereto. In addition to the above components, the pharmaceutical composition of the present disclosure may contain lubricants, wetting agents, sweeteners, flavorings, emulsifiers, suspending agents, preservatives, excipients, etc. The formulation of the pharmaceutical composition of the present disclosure may be in the form of a solution, suspension or emulsion in an oil-based or water-based medium, or in the form of an extract, powder, granule, tablet or capsule. Further, the pharmaceutical composition may also include a dispersant or stabilizer. Other suitable carriers and formulations that are pharmaceutically acceptable are described in detail in Remington's Pharmaceutical Sciences 19th ed., 1995.
In at least one embodiment, the route of administration of the pharmaceutical composition for preventing or treating a neurodegenerative disease includes oral or parenteral administration. When used for non-parenteral administration, the pharmaceutical composition disclosed in the present disclosure can be administered by intravenous injection, intranasal injection, local injection, intracerebroventricular injection, spinal cavity injection, subcutaneous injection, intraperitoneal injection, transdermal administration, etc.
Another aspect of the present disclosure is to provide a method for preventing or treating a neurodegenerative disease caused by amyloid accumulation, comprising administering a bioactive agent that increases the activity of miRNA-29b-2-5p to a subject in need thereof.
Another aspect of the present disclosure is to provide a biomarker for detecting a neurodegenerative disease. In at least one embodiment, the biomarker is the expression level of miR-29b. In another embodiment, the biomarker is the expression level of miRNA-29b-2-5p, miRNA-29b-1-5p or miR-29b-3p.
Another aspect of the present disclosure is to provide a kit for detecting neurodegenerative diseases. The kit comprises a nucleic acid having a miR-29b-2-5p sequence or a sequence complementary thereto, or a fragment of the sequence. In one embodiment, the nucleic acid having a miR-29b-2-5p sequence or a sequence complementary thereto in the kit is used as a probe on the surface of a microarray. In another embodiment, the kit is a kit including primers for gene amplification, and includes reagents required for polymerase chain reaction, such as buffers, DNA polymerase cofactors, and deoxyribonucleoside triphosphates (dNTPs).
Another aspect of the present disclosure is to provide a method for detecting a neurodegenerative disease. In at least one embodiment, the method detects an expression level of miRNA-29b-2-5p in a biological sample of a subject. In at least one embodiment, a reduced expression of miRNA-29b-2-5p, miRNA-29b-1-5p, or miR-29b-3p represents presence of a neurodegenerative disease. In one embodiment, the expression level of miRNA-29b-2-5p, miRNA-29b-1-5p or miR-29b-3p in the biological sample of the subject is detected by a microarray, a polymerase chain reaction, a real-time polymerase chain reaction or a reverse transcriptase-polymerase chain reaction (RT-PCR).
In at least one embodiment, the aforementioned neurodegenerative disease is a neurodegenerative disease caused by accumulation of amyloid. In another embodiment, the neurodegenerative disease includes cerebral amyloid angiopathy, familial amyloidosis, dementia, Huntington's disease, Alzheimer's disease, Parkinson's disease, or amyotrophic lateral sclerosis.
The content of the present disclosure will be understood easier through the following description and exemplary drawings:
In the present disclosure, it was found that miRNA-29b-2-5p (miR-29b-2-5p) is significantly reduced in brains with higher PSEN-1 expression. It is known that PSEN-1 is one of the main complexes of γ-secretase membrane protease, and γ-secretase is one of the important splicing enzymes that regulate the production of amyloid in the brain. The present disclosure further found that increasing the expression of miRNA-29b-2-5p can reduce the accumulation of amyloid in the brain, thereby preventing or treating neurodegenerative diseases caused by the accumulation of amyloid.
miRNA is an endogenous non-coding RNA molecule. Mature miRNA consists of 21 to 25 nucleotides, while the predecessor of mature miRNA is a circular miRNA formed of 70 to 90 nucleotides in length, called precursor miRNA (pre-miRNA), which needs to be cleaved by Dicer enzyme to form mature miRNA.
The miRNA affects the transcription of messenger RNA (mRNA) in animals and plants, and plays an important role in cell development, disease development, and cell transcription regulation. It has been found that miRNAs are involved in the development of various diseases, such as cancer and age-related inflammation, cardiovascular diseases and neurological diseases. The present disclosure further provides a pharmaceutical composition and method for the treatment of neurodegenerative diseases by modulating miRNA. The neurodegenerative diseases include those caused by amyloid accumulation, including AD.
Small RNA (miRNA) is a type of short, endogenous non-coding RNA with a length of 18 to 24 nucleotides (nt). It targets the 3′-untranslated region (3′-UTR) of specific mRNA and degrades or inhibits the translation of its target mRNA. As used herein, the term “small RNA” (miRNA or miR) includes human miRNA, mature single-stranded miRNA, precursor miRNA (pre-miR) and variants thereof, which may naturally exist or be artificially synthesized. In some cases, the term “miRNA” also includes primary miRNA (pri-miR) transcripts and double helix miRNA. Unless otherwise indicated, the name of the specific miRNAs used herein refers to mature miRNAs. For example, miR-122a refers to the mature miRNA sequence derived from pre-miR-122. For certain miRNAs, a single precursor contains more than one mature miRNA sequence. In other cases, multiple precursor miRNAs contain the same mature sequence. In some cases, mature miRNAs have been renamed according to new scientific consensus. Those skilled in the art will understand that the scientific consensus regarding the precise nucleic acid sequence of a particular miRNA, especially the mature form of miRNA, may change over time. The miRNA disclosed in the present disclosure includes naturally existing or artificially synthesized miRNA sequences.
The miRNA-29b described herein includes miR-29b-3p, miR-29b-1-5p, and miR-29b-2-5p. The human miRNA-29 family consists of three closely related precursors: miRNA-29a, miRNA-29b and miRNA-29c. miRNA-29a and miRNA-29c carry out their function through the RNA-induced silencing complex mechanism in the cytoplasm, while the miRNA-29b regulates the expression of target genes in the nucleus, where the miRNA-29b is further divided into miRNA-29b-1 and miRNA-29b-2. The miRNA-29a and miRNA-29b-1 are transcribed from chromosome 7 (7q32.3), while miRNA-29b-2 and miRNA-29c are transcribed from chromosome 1 (1q32.2). Although miRNA-29b-1 and miRNA-29b-2 are transcribed from different chromosomal sources, they have the same sequence and are considered to have the same function.
As used herein, “nucleic acid” includes a nucleic acid molecule having a sequence of a specific miRNA, especially a sequence complementary to PSEN-1, thereby forming miRNA and a duplex. Therefore, the term “nucleic acid” herein can be described as “nucleic acid inhibitor complementary to PSEN-1.” The term “complementary” herein means that under predetermined hybridization conditions, the antisense nucleic acids are in contact and hybridize to PSEN-1 to achieve full complementarity, which includes substantially complementary and perfectly complementary.
As known in the field of the present disclosure, a nucleoside is a combination of a base and a sugar, and a nucleotide is a nucleoside which further includes a phosphate group covalently linked to the sugar part of the nucleoside. When forming a nucleic acid, the phosphate group links to an adjacent nucleoside covalently to form a linear polymerized compound, which has a normal bond of RNA and DNA or a phosphodiester bond with the backbone being 3′ to 5′. Specific examples of nucleotides that can be used in the present disclosure include oligonucleotides containing modified backbones or non-natural inter-nucleoside linkages. As defined herein, nucleotides that retain phosphorus atoms in the backbone and nucleotides that lack phosphorus atoms in the backbone are included in nucleotides with modified backbones. For the present disclosure, as mentioned in the field of the present disclosure, modified nucleotides that do not have a phosphorus atom in the backbone between the nucleosides can also be considered as nucleotides. Nucleic acids as described herein can include various molecules, and can be deoxyribonucleic acid (DNA) molecules or ribonucleic acid (RNA) molecules. The nucleic acids used herein are ribonucleic acid (RNA), deoxyribonucleic acid (DNA), oligonucleotides, phosphorothioate oligonucleotides, peptide nucleic acids (PNA), locked nucleic acid (LNA), 2′-O-modified oligonucleotide, 2′-O-alkyl oligonucleotide, 2′-O—Cl-3 alkyl oligonucleotide acid and 2′-O—Cl-3 methyl oligonucleotides. The nucleotides used herein can include peptide-based backbones instead of sugar and phosphoric acid backbones. Other chemically modified structures of nucleic acids can include sugar modifications such as 2′-O-alkyl, 2′-O-methyl, 2′-O-methoxyethyl, 2′-fluoro and 4′-thioxy modifications, and backbone modifications such as phosphorothioate, morpholino or phosphoric carboxylic acid bond (such as those disclosed in U.S. Pat. Nos. 6,693,187 and 7,067,641). The nucleic acids may be encapsulated or unencapsulated, for example, nucleic acids encapsulated by liposomes or nucleic acids encapsulated by exosomes.
As used herein, the miR-29b-2-5p nucleic acid can be ribonucleic acid, deoxyribonucleic acid, oligonucleotide or modified oligonucleotide. The oligonucleotide contains at least one chemical change, and the modified oligonucleotide can contain one or more locked nucleic acids (LANs), and the locked nucleic acid is a modified ribonucleic acid. An additional bridging bond is comprised between the 2′ to 4′ carbons of the ribose to have a clocked morphology, and to improve thermal stability through the oligonucleotide having the LANs.
For each nucleic acid sequence provided herein and/or each SEQ ID NO. provided herein, an at least 80% sequence identity includes a sequence identity that is at least 82%, at least 84%, at least 86%, at least 88%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, and 100%.
Anyone of a number of sequence alignment methods can be used to determine the identity percentage, including but not limited to global methods, local methods, and hybrid methods, such as segment approach methods. The process of determining the identity percentage falls within the scope of the general process known to a technician in the field of the present disclosure. The global method aligns sequences from the beginning to the end of the molecule, and determines the best alignment by accumulating the scores of individual residue pairs and imposing gap penalties. Non-limiting methods include, such as CLUSTAL W (see, e.g., Julie D. Thompson et al., “CLUSTAL W: Improving the Sensitivity of Progressive Multiple Sequence Alignment through Sequence Weighting, Position-Specific Gap Penalties and Weight Matrix Choice,” 22 (22) Nucleic Acids Research 4673-4680, 1994), and iterative optimization (see, e.g., Osamu Gotoh, “Significant Improvement in Accuracy of Multiple Protein. Sequence Alignments by Iterative Refinement as Assessed by Reference to Structural Alignments,” 264(4) J. Mol. Biol. 823-838, 1996). The local method is to align sequences by confirming one or more conserved base sequences of all input sequences. Non-limiting methods include, for example, Match-box (for example, see Match-Box of Eric Depiereux and Ernest Feytmans: “A Fundamentally New Algorithm for the Simultaneous Alignment of Several Protein Sequences,” 8(5) CABIOS 501-509, 1992), Gibb Sampling (see, e.g., CE Lawrence et al., “Detecting Subtle Sequence Signals: A Gibbs Sampling Strategy for Multiple Alignment,” 262 (5131) Science 208-214, 1993), and Align-M (see, e.g., Ivo Van Wale et al., Align-M: “A New Algorithm for Multiple Alignment of Highly Divergent Sequences,” 20(9) Bioinformatics: 1428-1435, 2004). Therefore, the sequence identity percentage in the present disclosure is determined by a general method. For example, see Altschul et al., Bull. Math. Bio. 48: 603-16, 1986; Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89: 10915-19, 1992.
N-butylidenephthalide (BP), with a molecular weight of 188.22 and a molecular formula of C2H12O2, is a small molecule drug extracted from Angelica sinensis.
All terms used herein, including descriptive terms or technical terms, should be interpreted as having meanings that are obvious to a person of ordinary skill in the technical field of the present disclosure. However, according to the intentions of those of ordinary skill in the technical field of the present disclosure, precedents or the emergence of new technologies, these terms may have different meanings. In addition, the applicant can choose some terms arbitrarily, and in this case, the meaning of the selected terms will be detailed in the full description of this disclosure. Therefore, the terms used herein must be defined based on the meaning of the terms and the description of the entire specification.
As used herein, “comprising” ingredients or steps, unless there is a specific description to the contrary, may further include other ingredients or other steps without excluding other ingredients or steps.
As used herein, the term “progress” is used to describe the course of a disease (such as AD), which progresses into a more serious condition.
The terms “subject,” “patient” and “individual” are used interchangeably herein and refer to warm-blooded animals, such as mammals suffering from, suspected of having, or susceptible to the diseases described in this disclosure, or receiving disease screening. These terms include, but are not limited to, domestic animals, sports animals, primates and humans. For example, these terms refer to humans.
It should also be noted that, as used in this disclosure, the singular forms “a,” “an” and “the” include plural referents unless they are specifically limited to one referent. Unless the context clearly indicates otherwise, the term “or” and the term “and/or” are used interchangeably.
The following embodiments further describe exemplary embodiments of the present disclosure, which do not limit the scope of the present disclosure.
In the brain specimens from the dorsolateral prefrontal cortex (Brodmann Area 9, BA9) of patients with Alzheimer's disease, which is associated with working memory, it was found that the expression level of miRNA-29b-2-5p was significantly different from those without Alzheimer's disease. As shown in
Using miRNA analysis software RNA22 and MiRWalk, unknown miRNAs tha may affect the gene expression of Alzheimer's disease were explored. After mutual analysis and comparison, it was found that miR-29b-2-5p of the miR-29b family might have an obvious regulatory effect on PSEN-1 and PSEN-2 (
The sequence of the mature miRNA-29b-2-5p nucleic acid is 11-cugguuucacaugguggcuuag-32 (SEQ ID NO.: 1), and it is a complementary sequence to PSEN-1 (NCBI Reference Sequence: NM_000021.4) at positions 90966 to 90972 of the whole gene sequence or to the nucleotide sequence fragment ugugaaa (SEQ ID NO.: 2) at positions 3791 to 3797 (+3791 to +3797) from 3′-UTR (position 1617=3′-UTR+1) and at positions 91675 to 91681 of the whole gene sequence of PSEN-1, or to the nucleotide sequence fragment cauguga (SEQ ID NO.: 3) at positions 3856 to 3862 (+3856 to +3862) from 3′-UTR.
As shown in
Two putative miR-29b-2-5p target sites were identified in the PSEN1 3′ untranslated region (3′UTR), as shown in Table 1 below. Humans and mice share the same five nucleotides in the first site and seven nucleotides in the second site, as shown in
The specificity and inhibitory effect of miRNA-29b-2-5p on the specific sequence of PSEN-1 can be confirmed by a dual luciferase assay. The dual luciferase assay includes two luminescence proteins, namely firefly luciferase (molecular weight 61 kDa, emission wavelength at about 560 nm) isolated from firefly (Photlnus pyralls) and Renilla luciferase (molecular weight 31 kDa, emission wavelength at about 480 nm) isolated from Renilla reniformis, which are combined with the sequence to be analyzed and cloned into a vector for amplification. After transfection into cells, the cells emit luminescence. To investigate the influence of these complementary sites, neuroblastoma cell line (SH-SY5Y) as shown in
As shown in
Therefore, miR-29b-2-5p effectively modulates PSEN1 expression through two binding sites between them.
Western blotting is used to detect the expression levels of amyloid-related proteins, including PSEN-1, PSEN-2, and β-amyloid 1-42 (Aβ1-42), while simultaneously detect the expression level of Notch protein (Notch intracellular domain, NICD), which is an indicator of drug safety. If the Notch protein is not affected, then drug safety is indicated.
As shown in
APP-C99 was transfected into C6 cells with the C99 peptide through cumate-inducible system activation. The activation of the cumate system resulted in AP synthesis, causing green fluorescence in activated cells, as shown in
To explore the effect of miR-29b-2-5p on PSEN1, miR-29b-2 was used to transfer the miR-29b-2-5p mimic into C6-C99 cells. Western blotting showed that miR-29b-2-5p significantly decreased the expressions of PSEN1 (100%±19.31%, n=3) and Aβ1-42 (48.75%±26.77%, n=3), as shown in
Then, C6-C99 cells were used to explore the effect of 100 μM n-butylidenephthalide (n-BP) on the expressions of miR-29b-2-5p, PSEN1, and Aβ1-42. The flow cytometry results demonstrated that 100 μM n-BP treatment did not affect cumate expression in C6-C99 cells, as shown in
As shown in
These findings indicated that n-BP decreases the PSEN1 and Aβ1-42 protein expressions by regulating miR-29b-2-5p expression.
Trisomy 21 (Ts21) is a genetic mutation having 3 chromosome 21 in a genome, which leads to Down's syndrome and exhibits Alzheimer's symptoms, such as AP aggregation and hyperphosphorylation of Tau protein, affecting the formation and function of synapses. By genetic engineering, the four transcription factors Oct-4, Sox-2, c-Myc, and Klf-4 were delivered into adult cells and reverse-transcribed the cells into induced pluripotent stem cells (iPSC) carrying trisomy 21(Ts21) gene mutation. As shown in
Ts21 induced pluripotent stem cells (Ts21-iPSCs) were differentiated into neurons, as shown in
Real-time PCR data showed that 100 μM n-BP-treated Ts-21 iPSCs exhibited elevated miR-29b-2-5p expression (12.38-fold), as shown in
Because the Notch intracellular domain (NICD) is most relevant to the development of AD drugs, western blot analysis was conducted to explore the effect of 100 μM n-BP-induced inhibition of Notch cleavage in iPSC-derived human neurons and on the expressions of miR-29b-2-5p and PSEN1. Lower expressions of PSEN1 (65.94%±4.52%) and Aβ1-42 (35.02%±24.39%) proteins were observed and no change in the expression of proteins in NICD after 100 μM n-BP treatment, as shown by
To examine the mechanism by which n-BP regulated miR expression, n-BP-treated Ts-21 iPSCs were subjected to gene microarray analysis. The results showed that the expression of four long noncoding RNA (lncRNA) was significantly reduced (less than −50 fold), as shown in
Then, a biotin-based pulldown assay was used to validate this interaction. The result shown in
These results indicated that n-BP could effectively decrease AP production while upregulating miR-29b-2-5p expression and downregulating PSEN1 expression in Ts-21 iPSCs.
AD-3xTg transgenic mice are an animal model used to study Alzheimer's disease. The transgenic mice are genetically engineered to carry point mutations of human amyloid precursor protein (APP), microtubule-associated protein tau (MAPT P301L) and type I presenilin protein (PSEN-1). The AD-3xTg transgenic mice carrying Alzheimer's mutation genes affect the brain and produce symptoms, mainly involving amyloid aggregation in the hippocampus and cerebral cortex. The progression of pathogenesis of AD-3xTg transgenic mice is that β-amyloid will increase at 3 to 4 months, and its synaptic transmission and long-term potentiation are found to be significantly impaired at 6 months, while hyperphosphorylated tau protein aggregates are detected in the hippocampus at 12 to 15 months. The 3xTg mice have β-amyloid accumulation in the brain and have problems related to cognition. The n-butylidenephthalide (n-BP) treatment on 3xTg AD mice was shown to increase the expression of miR-29b-2-5p (control: 100%±44.47%, BP: 188.58%±55.09%) and decrease that of PSEN1 (control: 100%±29.11%, BP: 26.26%±27.75%), as shown in
The mice behavioral experiment using Morris water maze is a classical test to detect short-term memory and complex memory. Through its behavior, it can be determined whether there is a difference in memory after drug treatment. Specifically, as shown in
As shown in
Most of the untreated 3xTg mice showed no improvement with time, as shown in
The accumulation of amyloid in brain tissues can be detected by using an amyloid tracking agent, 18F-Florbetaben (FBB). 18F-FBB positron emission tomography-computed tomography (PET/CT) was used to explore the effect of n-BP treatment on AP accumulation in the hippocampus and cortex. The accumulation of amyloid will appear red in the picture. The quantity and location of AP accumulation in the brains of mice were determined using the tracking reagent 18F-FBB from birth to 4 to 12 months of age.
The results showed that non-transgenic B6 mice exhibited almost no AP accumulation in the hippocampus or cortex. In 3xTg AD mice, AP accumulation in the hippocampus and cortex increased by age, i.e., from birth to 4 to 12 months, as shown in
In mice treated with 120 mg n-BP/kg, the standardized uptake value ratio (SUVR) of FBB in the hippocampus and cortex was significantly lower at age 12 months than at age 6 months.
These results showed that n-BP reduced and cleared amyloid deposition in the brain.
Table 2 below shows the changes in gene expression in neurons with Alzheimer's disease symptoms after treated with n-butylidenephthalide. The results show that n-butylidenephthalide increases expression levels of genes related to autophagy in neurons, and reduces expression levels of inflammation-related genes. For example, ATP6V0D2 and IST1 are autophagy-related genes, and the expression levels thereof increase by 30.07 times and 15.72 times, respectively, after administration of n-butylidenephthalide, while genes related to inflammation including NT5E, STAP1, DEC1, ADAMDEC1 have their expression levels reduced by 12.6, 12.79, 28.35 and 43.55 times, respectively.
The above examples are used for illustration only. Based on the content of the present disclosure, a person of ordinary skill in the art can think of other advantages of the present disclosure. The present disclosure can also be implemented or applied as described in different examples. Modifications and alterations can be made to above examples by anyone skilled in the art without departing from the scope of the present disclosure.
| Number | Date | Country | Kind |
|---|---|---|---|
| 109134157 | Sep 2020 | TW | national |