Patent Application
20240398775
The present invention relates to a pharmaceutical composition, containing an antagonist of an AMPA receptor, for use in treating cognitive decline. The present invention also relates to a pharmaceutical composition, containing an antagonist of an AMPA receptor, for use in treating a disease or condition associated with an NMDA-insensitive NMDA receptor in a subject having an NMDA-insensitive NMDA receptor. The present invention further provides a pharmaceutical composition for use in treating overweight and obesity.
There is evidence that a high-fat diet (HFD) promotes obesity and adversely affects neurocognition due to the worldwide obesity epidemic (1, 2). However, evidence has accumulated that consuming a high-fat diet during adolescence and young adulthood can lead to changes in the function and morphology of the hippocampus, but the mechanism underlying this phenomenon has not yet been elucidated. Also, an attractive target for effective treatment for this phenomenon has not been established.
AMPA receptors (hereinafter also referred to as “AMPAR”) are involved in fast-rate excitatory synaptic transmission and play important roles in learning and memory in cooperation with NMDA receptors. In particular, the NMDA receptor (hereinafter also referred to as “NMDAR”) is a ligand-dependent ion channel belonging to the ionotropic glutamate receptor family. The NMDA receptor plays an important role in excitatory synaptic transmission, learning, and memory. The AMPA receptor is expressed on the postsynaptic membrane and induces hyperpolarization in the order of milliseconds in the presence of glutamic acid (or AMPA), but does not have calcium permeability. The NMDA receptor is expressed on the postsynaptic membrane and the non-synaptic region, and is activated in the presence of glycine and glutamic acid (or NMDA) accompanying depolarization of the cell membrane to allow cations including calcium ions to flow into the cell. The NMDA receptor normally binds magnesium ions and is inactivated. When the AMPA receptor is depolarized and the membrane potential of the membrane in which the NMDA receptor is present increases, the magnesium block of the NMDA receptor is released. This makes the NMDA receptor responsive to glycine and glutamic acid, and following the depolarization of the AMPA receptor, the NMDA receptor depolarizes and increases the intracellular calcium concentration, which can generate a signal in the postsynaptic membrane.
Hippocampus has the lowest firing threshold for stimulation in the brain, and plays an important role in acquisition of new memory and learning. For example, it is known that Alzheimer's dementia starts from a disorder of the entorhinal cortex (EC) and is caused by a decrease in hippocampal function. Also, the low firing threshold can cause epilepsy. Perampanel is commercially available as an AMPA receptor antagonist, and is used for treatment of epilepsy.
The present invention provides a pharmaceutical composition for use in treating cognitive decline.
The present inventors have found a new phenomenon in which calcium permeability of an AMPA receptor in the presence of AMPA increases, while activation of an NMDA receptor in the presence of NMDA is inhibited in the hippocampus. The inventors have also found that this new phenomenon occurs in overweight and obese subjects, as well as subjects with cognitive dysfunction. More specifically, in the hippocampus of a healthy subject, the AMPA receptor is non-permeable to calcium, whereas in Examples to be described later, in the hippocampus of a subject exhibiting overweight and obesity, it was revealed that the calcium permeability of the AMPA receptor in the presence of AMPA increased, and the activation of the NMDA receptor in the presence of NMDA was inhibited, and it was shown that the control of the AMPA receptor and the NMDA receptor in the hippocampus of the subject was abnormal. Subjects exhibiting overweight and obesity had certain cognitive decline. It was revealed that calcium permeability of the AMPA receptor in the presence of AMPA also increases in the hippocampus of a subject having Alzheimer's dementia, and activation of the NMDA receptor in the presence of NMDA was inhibited. It was revealed that the inhibition of the NMDA receptor from being activated under the conditions to be activated may cause cognitive dysfunction in overweight and obese subjects as well as subjects with cognitive dysfunction. The inventors also succeeded in restoring the NMDA-responsive channel activation capacity of NMDA receptors by applying AMPA receptor agonists to the hippocampus of these subjects. In the above subject, the control of the AMPA receptor and the NMDA receptor in the hippocampus is abnormal, and inhibition of the NMDA receptor due to hyperexcitability of the AMPA receptor (particularly, increase in calcium permeability) is involved in cognitive dysfunction. Therefore, by inhibiting intracellular influx of calcium via the AMPA receptor using the AMPA receptor antagonist, it is possible to induce release of the inhibition of the NMDA receptor (that is, NMDA receptor activation).
According to the present invention, for example, the following invention is provided.
According to the present invention, for example, the following invention is provided.
As used herein, a “subject” is a mammal, for example, a primate, and for example, a human. A human can be, for example, from 0 to 10 years of age, from 10 to 20 years of age, from 20 to 30 years of age, from 30 to 40 years of age, from 40 to 50 years of age, from 50 to 60 years of age, from 60 to 70 years of age, from 70 to 80 years of age, and from 80 years of age and beyond, and at any age within the above ranges of age. A human may be male or female.
As used herein, “cognitive function” refers to an intellectual function such as understanding, judgment, and logic, and is understood as including elements such as perception, judgment, imagining, inference, decision, memory, and language understanding from a psychological perspective. As used herein, “cognitive dysfunction” is a disorder (or functional decline or dysfunction) in the higher functions of the brain, including judgment, calculation, understanding, learning, orientation, and memory. “Cognitive dysfunction” can be memory disorder and can manifest itself in dementia as memory disorder such as forgetfulness (for example, work memory degradation and work memory disorder). Cognitive dysfunction is diagnosed in an environment which is suitable for testing cognitive and memory functions or in which attention or concentration is possible.
As used herein, “treatment” refers to prophylactic and therapeutic treatment. As used herein, “therapeutic treatment” means treatment, cure, prevention, or amelioration of a disease or disorder, or reduction in the rate of progression of a disease or disorder. As used herein, “prophylactic treatment” means reducing the likelihood of developing a disease or condition, or delaying the onset of a disease or condition.
As used herein, a “therapeutically effective amount” means an amount by which the effect of therapeutic treatment or prophylactic treatment is obtained.
In the present specification, the “NMDA receptor” is a kind of ion channel type glutamate receptor present in the postsynaptic membrane, and is also called NMDA type glutamate receptor. The ion channel type glutamate receptors present in the postsynaptic membrane are roughly classified into an AMPA receptor, a kainate type receptor, and an NMDA receptor according to their pharmacological characteristics. The NMDA receptor is considered to be a receptor involved in memory, learning, cell death after cerebral ischemia, and the like. The NMDA receptor is activated by N-methyl-D-aspartate (NMDA; NMDA receptor agonists), which differs from other ionotropic glutamate receptors. The NMDA receptor binds to extracellular magnesium ions (Mg2+) at a resting membrane potential of −60 mV to −70 mV, and its channel activity is inhibited. When the postsynaptic membrane is depolarized (for example, the membrane potential may be positive or equal to or greater than −20 mV, such as between −20 mV and −10 mV), the inhibition by magnesium ions is released, and the NMDA receptor reacts with glutamic acid in the presence of glycine, and induces inflow of cations (in particular, calcium ions (Ca2+), potassium (K+) and sodium (Na+) from the postsynaptic membrane into cells. In this manner, the NMDA receptor is depolarized (electrical signal; neural activity of the postsynaptic membrane) and stimulation with glutamic acid (biochemical signal; neural activity of presynaptic terminals) to express channel activity.
In the present specification, the “AMPA receptor” is a kind of ion channel type glutamate receptor present in the postsynaptic membrane, and is also called AMPA type glutamate receptor. The AMPA receptor is activated by α-amino-3-hydroxy-5-mesoxazole-4-propionic acid (AMPA; AMPA receptor agonists). The AMPA receptor is a tetramer containing any four of the four subunits GluA1, GluA2, GluA3, and GluA4. It is believed that each subunit has a glutamic acid receiving site and, when glutamic acid binds to two or more of the four, channel activity is induced. AMPA receptors with GluA2 are calcium-impermeable, whereas AMPA receptors without GluA2 are calcium-permeable (hereinafter the calcium permeable AMPA receptor may be referred to as a “CP-AMPA receptor”). The reason why the AMPA receptor including GluA2 is calcium impermeable is that glutamine (Q) in the M2 domain (second hydrophobic domain) of GluA2 is converted to arginine (R). The Q/R editing from the above Q to R of GluA2 above is the editing at the mRNA level (post-transcriptional regulation). Specifically, the conversion from the above Q to R occurs when the second base (adenine) of the codon specifying the glutamine of the GluA2 mRNA is deaminated by an adenine deaminase and converted to inosine, and the inosine is decoded as guanine by tRNA. Since the AMPA receptor containing unedited GluA2 is calcium permeable, the calcium impermeability of the AMPA receptor is believed to be due to the conversion of GluA2 from the above Q to R. An example of the nucleic acid sequence of human GluA2 is described in SEQ ID NO: 1, an example of the amino acid sequence of unedited human GluA2 is described in SEQ ID NO: 2, and an example of the amino acid sequence of edited human GluA2 is described in SEQ ID NO: 3. In the above Q to R editing of GluA2 from the Q to R, the 607th Q of SEQ ID NO: 2 is converted to R by editing. This site is referred to as a Q/R site of GluA2. Among glutamic acid responses, the AMPA receptor component is known to be faster than the NMDA receptor component. An example of the nucleic acid sequence of each of human GluA1, human GluA3, and human GluA4 is described in SEQ ID NO: 4, 6, and 8, and an example of the amino acid sequence is described in SEQ ID NO: 5, 7, and 9.
As used herein, the “hippocampus” is a cortex positioned in the bottom of the inferior horn of the lateral ventricle in the medial part of the cerebral temporal lobe. There is one hippocampus on each side of the brain. The hippocampus is a part of a limbic system called a hippocampus body, and the hippocampus body is divided into a dentate gyrus, a hippocampus, a subiculum, a presubiculum, a parasubiculum, and an entorhinal cortex. In addition, the hippocampus is roughly divided into CA1 to CA3 regions. The hippocampus is considered to be involved in various neuropsychiatric diseases such as epilepsy and Alzheimer's dementia. Hippocampus has the lowest seizure threshold in the brain, and in epileptic animal models, much of the electrical activity related to seizures is recorded from the hippocampus, starting in particular from the CA2 and CA3 fields. The initial symptom of Alzheimer's dementia is the lack of the ability to acquire new memory. The pathology of Alzheimer's dementia first appears in the entorhinal cortex. In Alzheimer's dementia, it is considered that the information processing ability of the hippocampus is deprived due to a disorder of the entorhinal cortex. As described above, the hippocampus has a low threshold of firing, and has an important function in saving and learning new memories. Hippocampus is vulnerable to hypoxia and ischemia and induces neuronal cell death under hypoxic conditions and ischemic conditions. Neuronal cell death is believed to be due to excitotoxicity via NMDA receptors. The hippocampus is believed to be essential for the formation of manifest memory, such as episodic memory. Temporal lobe cortical sites involved in memory formation have the entorhinal cortex, parasubiculum, anterior subiculum, subiculum, hippocampus (Ammons horn), and dentate gyrus. Inactivation of NMDA receptors in the hippocampus causes cognitive dysfunction, including memory disorder and learning disorder. Alzheimer's disease includes a state where the disease eventually transitions to Alzheimer's dementia but there are no clinical symptoms (preclinical stage Alzheimer's disease), mild cognitive dysfunction (MCI) that transitions to Alzheimer's dementia, and Alzheimer's dementia. In Alzheimer's disease, a decrease in Aβ42 levels, an increase in total tau levels, and an increase in phosphorylated tau levels in cerebrospinal fluid can be observed from the time of pre-clinical Alzheimer's disease. The reduction in Aβ42 levels in cerebrospinal fluid is believed to reflect the accumulation of Aβ42 in the brain. Accumulation of tau, changes in neurofibrils, shedding of nerve cells, and the like may increase and lead to transition to mild cognitive dysfunction. In mild cognitive dysfunction, a lesion is observed in a region around the hippocampus. In Alzheimer's dementia, the lesion also extends to the cerebral neocortex. Alzheimer's dementia is characterized, for example, by senile plaques and/or neurofibrillary tangles. Alzheimer's dementia may be diagnosed, for example, based on diagnostic criteria according to the American Society for Psychiatry Diagnostic and Statistical Manual, 5th Edition (DSM-5). That is, Alzheimer's dementia can be diagnosed when the following are satisfied:
Cognitive function is not stable for a long time, and is certainly getting worse gradually.
No other neurodegenerative disease, cerebrovascular disease, nerve/mental/systemic disease or condition which are likely to cause cognitive dysfunction.
In the present specification, the term “overweight” means that a body mass index (BMI) is 25 or more and less than 30 (particularly men and women of 18 years old or more). BMI is calculated by weight (kg)/{height (m)}2. The standard BMI value is approximately 22 for both adult men and women. In the present specification, “obesity” refers to a human (particularly, adult men and women) having a BMI of 30 or more. Obesity is roughly classified into obesity class I with a BMI of 30 or more and less than 35, obesity class II with a BMI of 35 or more and less than 40, and obesity class III with a BMI of 40 or more according to the criteria (WHO criteria) by the World Health Organization (WHO). In the present specification, “metabolic syndrome” refers to a case where BMI is 25 or more, an abdominal circumference is 85 cm or more for men and 90 cm or more for women, and 2 or more of the following (1) to (3) are satisfied.
(1) The neutral fat is 150 mg/dL or more, or the HDL is less than 40 mg/dL. (2) The systolic blood pressure is 130 mmHg or more, or the diastolic blood pressure is 85 mmHg or more. (3) Fasting blood glucose is 110 mg/dL or more.
Obesity in a child can be determined by the degree of obesity. Specifically, the obesity of a child refers to a state where the degree of obesity is +20% or more, and the body fat percentage increases by 25% or more for males, increases by 30% or more for females under 11 years old, and increases by 35% or more for females over 11 years old. The degree of obesity (%) is calculated by (current body weight−standard body weight at that age)/standard body weight at that age×100.
In the present specification, the term “dyslipidemia” refers to a state where lipid metabolism such as neutral fat and cholesterol is abnormal. Dyslipidemia is roughly classified into hyper LDL cholesterolemia, hypo HDL cholesterolemia, and hypertriglyceridemia. In hyper LDL cholesterolemia, whether a blood LDL cholesterol level is 140 mg/dL or more may be a diagnostic criterion. In hypo HDL cholesterolemia, whether a blood LDL cholesterol level is less than 40 mg/dL may be a diagnostic criterion. In hypertriglyceridemia, whether a blood neutral fat is 150 mg/dL or more may be a diagnostic criterion.
In the present specification, the “cardiovascular disease” refers to a disease group in which the inner wall of a blood vessel is narrowed by arteriosclerosis and the supply of blood to an organ is insufficient. Cardiovascular diseases include coronary artery disease, stroke, cerebral infarction, myocardial infarction, and peripheral arterial disease. When a state such as hyperglycemia continues, the inner wall of the blood vessel is damaged, and cholesterol accumulates in the blood vessel wall. Accumulation increases over time, narrowing the vascular lumen and reducing the supply of blood. A decrease in blood flow to the brain can cause cerebral infarction, and a decrease in blood volume to the heart can cause myocardial infarction. Other coronary artery disease and peripheral arterial disease may occur. Risk factors for cardiovascular disease include dyslipidemia and arteriosclerosis.
As used herein, “diabetes” is a disease in which hyperglycemia chronically continues due to insufficient action of insulin (for example, lack of insulin or lack of responsiveness to insulin). Diabetes is often associated with three major complications: retinopathy, nephropathy, and neuropathy. Diabetes mellitus is diagnosed by satisfying any one of the following (1) to (3) and (4): (1) a fasting blood glucose in the morning is 126 mg/dL or more, (2) a 2 hour fluorescent glucose tolerance test value of 75 g is 200 mg/dL or more, (3) a blood glucose value measured regardless of time is 200 mg/dL or more, and (4) HbA1c is 6.5% or more.
According to the present specification, a phenomenon was found in which in the hippocampus of a subject, calcium permeability of an AMPA receptor in the presence of glutamic acid (or in the presence of AMPA) increased, while activation of an NMDA receptor in the presence of glutamic acid (or in the presence of NMDA) was inhibited. This inhibition of NMDA receptor activation was resolved by AMPA receptor antagonists.
According to the present disclosure, there is provided a pharmaceutical composition for use in treating a disease or condition associated with glutamic acid (or NMDA) insensitive NMDA receptor in a subject (hereinafter also simply referred to as “NMDA unresponsiveness”) having the glutamic acid (or NMDA) insensitive NMDA receptor, the pharmaceutical composition containing an AMPA receptor antagonist. As will be described later, the hippocampus of an NMDA-insensitive subject has an NMDA receptor that is inhibited regardless of the membrane potential of the postsynaptic membrane in the presence of glycine and NMDA. As a result, in the hippocampus of the NMDA-insensitive subject, the NMDA receptor is completely or partially inhibited regardless of the membrane potential of the postsynaptic membrane in the presence of glycine and NMDA. As described below, inhibition of the NMDA receptor may be inhibition of calcium influx into cells via the NMDA receptor (and preferably inhibition of increase in intracellular calcium concentration). As described later, in the above subject, the AMPA receptor has acquired agonist-dependent calcium permeability. As described below, in certain embodiments, the disease or condition associated with NMDA insensitivity may be cognitive dysfunction, including cognitive decline. As described below, cognitive dysfunction can be derived from overweight or obesity. As described below, cognitive dysfunction may be derived from Alzheimer's dementia. In an NMDA-insensitive subject, the ratio of blood oxygen level-dependent (BOLD) responses when working on a hippocampal memory task to the resting case (when not doing anything) can be equal to or greater than a first predetermined ratio as described below. In an NMDA-insensitive subject, the ratio of the BOLD response when working on the event-related memory task to the resting case at rest (when not doing anything) can be equal to or less than a second predetermined ratio as described below. An increase in BOLD response is indicative of overactivity of synaptic function and a decrease is indicative of synaptic dysfunction. NMDA insensitivity may be assessed by unresponsiveness of brain activity upon NMDA administration. In a living body, when working on a hippocampus functional problem using functional magnetic resonance imaging (fMRI), a task correct answer rate decreases, and a synaptic function decrease in which a BOLD signal is continuously low, or an overactive state of a synaptic function in which an initial dip disappears and a peak of a first positive wave increases can be used as an index to evaluate functional decrease and overactive state.
In addition, as suggested from Examples to be described later, in the hippocampus of a subject exhibiting overweight and obesity, the calcium permeability of the AMPA receptor in the presence of glutamic acid (AMPA) increases, while the activation of the NMDA receptor in the presence of glutamic acid (NMDA) is inhibited, and abnormality in the control of the AMPA receptor and the NMDA receptor may be observed. In addition, as suggested by Examples to be described later, in the hippocampus of a subject exhibiting overweight and obesity, inhibition of the NMDA receptor not to be activated under the conditions under which the NMDA receptor should be activated damages plasticity of synapses, leading to long-term potentiation (LTP) and long term depression (LTD) and may cause cognitive dysfunction. Furthermore, as suggested by Examples to be described below, the inhibition of the NMDA receptor can be released by inhibition of calcium entering from the AMPA receptor by the AMPA receptor antagonist (in particular, calcium permeable AMPA receptors in the hippocampus). Without wishing to be bound by theory, subjects exhibiting overweight and obesity may have certain cognitive dysfunction due to the aforementioned abnormalities in the control of the AMPA receptor and the NMDA receptor in the hippocampus. Calcium permeability of the AMPA receptor in the presence of AMPA also increased in the hippocampus of a subject having Alzheimer's dementia, and activation of the NMDA receptor in the presence of NMDA was inhibited.
According to the present disclosure, there is provided a pharmaceutical composition for use in treating cognitive dysfunction (including cognitive decline, the same applies hereinafter) in a subject, the pharmaceutical composition containing an AMPA receptor antagonist.
AMPA receptor antagonists include competitive and non-competitive antagonists (for example, allosteric antagonists). In certain embodiments, as the AMPA receptor antagonist, a non-competitive antagonist can be preferably used. Examples of the AMPA receptor antagonist include AMPA receptor-selective antagonists (for example, AMPA receptor-selective competitive antagonists and AMPA receptor-selective non-competitive antagonists). The AMPA receptor-selective antagonist means that the inhibitory effect on the AMPA receptor is greater (for example, the IC50 for the AMPA receptor is 2 times or less smaller, 3 times or less smaller, 5 times or less smaller, 10 times or less smaller, 30 times or less smaller, 50 times or less smaller, 100 times or less smaller, 300 times or less smaller, 500 times or less smaller, 1000 times or less smaller, 3000 times or less smaller, 5000 times or less smaller, or 10,000 times or less smaller than IC50 for other ion channel type glutamic acid receptors) than that on other ion channel type glutamic acid receptors such as the NMDA receptor and the kainate receptor. As the AMPA receptor antagonist, an AMPA receptor-selective antagonist can be preferably used.
The AMPA receptor antagonist is not particularly limited, and examples thereof include 2,3-benzodiazepine compounds, 4-(8-chloro-2 methyl-11H-imidazo[1,2-c][2,3]benzodiazepine-6-benzenamine (GYKI 47261), 1-(4-aminophenyl)-4 methyl-7,8-methylenedioxy-5H-2,3-benzodiazepine (GYKI 52466), and 1-(4-aminophenyl)-3 methylcarbamyl-4 methyl-7,8-methylenedioxy-3,4-dihydro-5H-2,3-benzodiazepine (GYKI 53655) (Paternain et al., Neuron 1995, 14:185-189), 2,3-dioxo-6-nitro-1,2,3,4-tetrahydrobenzo[f]quinoxaline-7-sulfonamide (NBQX), 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX), 6,7-dinitroquinoxaline-2,3-dione (DNQX), 1,4-dihydro-6-(1H-imidazo-1-yl)-7-nitro-2,3-quinoxalinedione (YM90K), (3S,4aR,6S,8aR)-6-(([1H]1,2,4-triazole-5-yl-sulfonyl)methyl)-1,2,3,4,4a,5,6,7,8,8a-decahydroisoquinoline-3-carboxylic acid (LY302679), LY292025, LY307190, LY280263, LY289178, LY289525, (3S,4aR,6R,8aR)-6-[2-([1H tetrazole-5-yl)ethyl]-1,2,3,4,4a,5,6,7,8,8a-decahydroisoquinoline-3-carboxylic acid (LY293558), (3SR,4aRS,6SR,8aRS)-6-((1H-tetrazole-5-yl)methyloxymethyl)-1,2,3,4,4a,5,6,7,8,8a-decahydroisoquinoline-3-carboxylic acid (LY294486) (Neuropharmacology, 37:1211-1222, 1998), 9-(1H-imidazole-1-yl)-8-nitro-[1,2,4]triazolo[1,5-c]quinazoline-2,5(3H,6H)-dione (Ro48-8587), N-[3-[[4-[(3-aminopropyl)amino]butyl]amino]propyl]-1-naphthaleneacetamide (Naspm), Joro spider venom, 8-methyl-5((4-(N,N-dimethylsulfamoyl)phenyl)6,7,8,9-tetrahydro-1H-pyrrolo[3,2-h]-isoquinoline-2,3-dione-3 O-(4-hydroxybutyrate-2-yl)oxime (SPD-502), NS-1209 (Neuropharmacology. 61(5-6): 1033-47, 2011), talamPanel, 1,2-dihydropyridine compound, for example, 3-(2-cyanophenyl)-5-(2-pyridyl)-1-phenyl-1,2-dihydropyridine-2-one (perampanel; E2007) (U.S. Pat. No. 6,949,571B), 2,3-dihydroxy-6-nitro-7-sulfamoylbenzo (f) quinoxaline, [1,2,3,4-tetrahydro-7-morpholin-yl-2,3-dioxo-6-(trifluoromethyl) quinoxaline-1-yl]methylphosphonate, 1-(4-aminophenyl)-4 methyl-7,8-methylene-dioxy-5H-2,3-benzodiazepine, or (−)1-(4-aminophenyl)-4-methyl-7,8-methylene-dioxy-4,5-dihydro-3 methylcarbamoyl-2,3-benzodiazepine, [7-(1H-Imidazole-1-yl)-6-nitro-2,3-dioxo-3,4-dihydroquinoxaline-1 (2H)-yl]acetic acid (ZonamPanel) (WO 96/10023), and 2-[N-(4-chlorophenyl)-N-methylamino]-4H-pyrido[3,2-e]-1,3-thiazine-4-one, and the compounds disclosed in WO 2003/082332 (for example, CX516, LU-73068, LU115445, Aloracetam, compound described in WO95/12594, IramPanel, compound described in WO98/17652, LY215490, LY-215490, LY-293558, LY-311446, LY326325, LY-377770, LY-404187, 2-methylsulfonylamino-6,7-dinitro-2 (1H)-quinoxalinone, compound described in WO97/32858, GYKI-47261, compound described in WO99/06408, GYKI52466, GYKI-53655, GYKI152466, TalamPanel, compound described in U.S. Pat. No. 5,639,751, RWJ37947, KRP-199, NS-1029, NS229, PNQX, COMP, AMP-397, NNC-07-0775, compound described in WO96/15100, NNC-07-9202, compound described in EP283959, 2-carboxy-1-methyl-7-trifluoromethylimidazo[1,2-a]quinoxalin-4 (5H)-one, compound described in WO95/21842, CNDQ, PD-159265, PD160725, CP-465022-27, NS-257, PNQX, 1-(4-aminophenyl)-7,8-(methylenedioxy)-3,5-dihydro-4H-2,3-benzodiazepine-4-one, SH-608, ZK-200.755-2, ZK-200775, compound described in WO99/07707, EGIS-9637, EGIS7444, S-17625, S-347301, S-1746, SYM2189, SYM-2207, SYM2229, SYM2259, SYM2267, YM90K, compound described in WO92/07847, TQX173, and Kaitocephalin) and their pharmaceutically acceptable salts (salts may include solvates such as hydrates). As the AMPA receptor antagonist, one or more selected from the group consisting of GYKI 47261, Naspm, and perampanel can be used.
In certain embodiments, the pharmaceutical compositions of the present disclosure contain a therapeutically effective amount of an AMPA receptor antagonist. In certain embodiments, the pharmaceutical compositions of the present disclosure contain a therapeutically effective amount of an AMPA receptor-selective antagonist. In certain embodiments, the pharmaceutical compositions of the present disclosure contain a therapeutically effective amount of one or more selected from the group consisting of GYKI 47261, Naspm, and perampanel.
In certain embodiments, the subject is a human. In certain embodiments, the subject is a human over the age of 18 (for example, male or female).
In certain embodiments, the subject is overweight. In certain embodiments, the subject is obese. In certain embodiments, the subject has obesity class I. In certain embodiments, the subject has obesity class II. In certain embodiments, the subject has obesity class III.
In certain embodiments, the subject has cognitive dysfunction (including cognitive decline). In certain embodiments, the subject has dementia and is overweight. In certain embodiments, the subject has cognitive dysfunction and obesity selected from the group consisting of obesity classes I to III. In certain embodiments, the subject is overweight or obese, and hippocampal memory function of pattern completion is lower than in healthy subjects. In certain embodiments, the subject has cognitive dysfunction, but is not overweight or obese.
In certain embodiments, the cognitive dysfunction is memory disorder (including a decline in memory function). In certain embodiments, the memory disorder may be social memory disorder. In certain embodiments, the memory disorder can be a decrease in pattern completion ability. In certain embodiments, the cognitive dysfunction is a learning disorder (including a decline in learning function). In certain embodiments, the memory disorder can be memory disorder in social memory.
In certain embodiments, the subject has dementia. In certain embodiments, the subject has dementia and is overweight. In certain embodiments, the subject has dementia and obesity selected from the group consisting of obesity classes I to III. In certain embodiments, the subject has dementia but is not overweight or obese.
In certain embodiments, the subject has Alzheimer's dementia. In certain embodiments, the subject has Alzheimer's dementia and is overweight. In certain embodiments, the subject has Alzheimer's dementia and obesity selected from the group consisting of obesity classes I to III. In certain embodiments, the subject is Alzheimer's dementia but is not overweight or obese. In certain embodiments, the patient with Alzheimer's dementia may be a patient with epilepsy. In certain embodiments, the patient with Alzheimer's dementia may be a patient without epilepsy. Epilepsy is a disease that causes epileptic seizures repeatedly such as sudden loss of consciousness and loss of response.
In certain embodiments, a subject with cognitive dysfunction has a reduced grey matter volume than that of a healthy subject.
In certain embodiments, in subjects with cognitive dysfunction, activation of the central enforcement network is observed in resting brain activity. In certain embodiments, in subjects with cognitive dysfunction, connectivity to a default mode network of a central enforcement network is permitted in resting brain activity. In certain embodiments, in subjects with cognitive dysfunction, activation of the visual network is observed in resting brain activity. In certain embodiments, in subjects with cognitive dysfunction, there is an activation of the central enforcement network and an activation of the visual network. In certain embodiments, in subjects with cognitive dysfunction, there is a connection between the saliency network and the cerebellar network in resting brain activity. The subject with cognitive dysfunction may be a subject with, in particular, obesity or overweight. The network has been developed as a biomarker of human cognitive function (35). Specifically, the network can be obtained by recording resting brain activity of a subject by fMRI and analyzing connectivity of activation of the brain (35).
In one embodiment, in the subject having cognitive dysfunction, the change ratio of the BOLD response in the CA3 region of the hippocampus is equal to or greater than the first predetermined ratio. The first predetermined ratio may be 1.1 times or more, 1.11 times or more, 1.12 times or more, 1.13 times or more, 1.14 times or more, 1.15 times or more, 1.16 times or more, 1.17 times or more, 1.18 times or more, 1.19 times or more, or 1.2 times or more. The upper limit of the first predetermined ratio may be, for example, either 1.3 times or a scale factor for the first predetermined value indicated above. In certain embodiments, in the subject having cognitive dysfunction, the change ratio of the BOLD response in the CA3 region of the hippocampus is less than the second predetermined ratio. The second predetermined ratio may be equal to or less than 0.9 times, equal to or less than 0.89 times, equal to or less than 0.88 times, equal to or less than 0.87 times, equal to or less than 0.86 times, equal to or less than 0.85 times, equal to or less than 0.84 times, equal to or less than 0.83 times, equal to or less than 0.82 times, equal to or less than 0.81 times, or equal to or less than 0.8 times. The lower limit of the second predetermined ratio may be, for example, either equal to or greater than 0.7 times or a scale factor for the second predetermined value indicated above. The change ratio of the BOLD response is determined by measuring the BOLD response by functional MRI (fMRI) under the condition of the presence or absence of a behavioral task. Examples of the behavioral task include an event-related memory task. In the event-related memory task, for example, it is possible to confirm whether the subject can correctly answer the same image, the similar image, and the new image as the same image, the similar image, and the new image, respectively. In the event-related memory task, a correct answer rate can be measured.
In certain embodiments, the subject has an NMDA receptor inhibited in at least one or more regions of a hippocampus body selected from the group consisting of an entorhinal cortex (EC), CA1, CA2, CA3, and a dentate gyrus (DG), thereby inhibiting NMDA receptor activity by NMDA in at least one or more regions of the hippocampus, and the subject has cognitive dysfunction. Inhibition of NMDA receptors is inhibition of NMDA receptor activation in the presence of glutamic acid and glycine (and preferably magnesium ion) (that is, under the condition that the NMDA receptor is activated in a physiological environment). When the NMDA receptor is not activated at the time to be activated, memory disorder and learning disorder may occur.
In the present disclosure, the inhibition of the NMDA receptor is based on the acquisition of calcium permeability of the AMPA receptor. In the present disclosure, the AMPA receptor antagonist is effective for releasing the inhibition of the NMDA receptor. Then, by releasing the inhibition of the NMDA receptor, the NMDA receptor can restore its original function and improve cognitive dysfunction. In certain embodiments, a pharmaceutical composition containing an AMPA receptor antagonist of the present disclosure may be combined with an NMDA receptor agonist. NMDA receptor agonists include Rapastinel (PCT/US2017/015851).
Therefore, the overweight and obese subject and the subject with cognitive dysfunction has an NMDA receptor inhibited in at least one or more regions of a hippocampus body selected from the group consisting of an entorhinal cortex (EC), CA1, CA2, CA3, and a dentate gyrus (DG), thereby inhibiting NMDA receptor activity by NMDA in at least one or more regions of the hippocampus, and the subject has cognitive dysfunction.
The calcium permeability of the AMPA receptor may increase by decreasing the expression level of GluA2 and/or decreasing the Q/R editing of GluA2. In GluA2, glutamine at the Q/R site is converted to arginine by post-transcriptional translation (subject to Q/R editing). Q/R-edited GluA2, when incorporated into the AMPA receptor, renders the AMPA receptor calcium-impermeable. When the uptake of GluA2 subjected to Q/R editing into the AMPA receptor is inhibited, the AMPA receptor acquires calcium permeability and allows calcium to flow into the cell in response to glutamic acid.
In certain embodiments, in the hippocampus of the subject, the ratio of GluA2/AMPA receptor is lower than the ratio in a healthy subject. In certain embodiments, in the hippocampus of the subject, the ratio of the unedited type of GluA2 to the total number of GluA2 is increased more than the ratio in the healthy subject. In certain embodiments, in the CA2 region of the hippocampus of the subject, the ratio of the unedited type of GluA2 to the total number of GluA2 is increased by a predetermined ratio or more than the ratio in the healthy subject. The predetermined ratio may be 2 times or more, 3 times or more, 4 times or more, 5 times or more, 6 times or more, 7 times or more, 8 times or more, 9 times or more, 10 times or more, 15 times or more, 20 times or more, 25 times or more, 30 times or more, 35 times or more, 40 times or more, 45 times or more, or 50 times or more.
In certain embodiments, in any region (for example, CA3 region) selected from the group consisting of CA1, CA2, and CA3 of the hippocampus of the subject, the number of Thy-1 positive nerve cells is smaller than the number of cells in a healthy subject. In certain embodiments, in any region (for example, the CA1 region) selected from the group consisting of CA1, CA2, and CA3 of the hippocampus of the subject, integrity of the dendritic arbor (specifically, integrity to CA1) is lower than integrity in a healthy subject. In certain embodiments, in any region of the hippocampus body of the subject (for example, DG region), the ratio of the immature spine is increased more than the ratio in the healthy subject. AMPA receptor antagonists can improve these situations.
According to the present disclosure, there is provided a pharmaceutical composition for use in inhibiting suppression of activation of an NMDA receptor in a subject having a hippocampus expressing a calcium-permeable AMPA receptor, the pharmaceutical composition containing an AMPA receptor antagonist.
In a subject having a hippocampus expressing a calcium-permeable AMPA receptor, the intracellular calcium concentration of nerve cells is increased. Activation of the NMDA receptor is inhibited in the hippocampus of a subject having a hippocampus expressing a calcium-permeable AMPA receptor. In contrast, the AMPA receptor antagonist can inhibit glutamate-dependent calcium transport of the AMPA receptor into cells and inhibit suppression of activation of the NMDA receptor. By inhibiting the suppression of NMDA receptor activation, the NMDA receptor can induce activation dependent on glutamate and membrane potential.
Pharmaceutical compositions of the present disclosure may contain an AMPA receptor antagonist in the form of a pharmaceutically acceptable salt. Pharmaceutically acceptable salts include acid addition salts. Examples of the acid addition salt include inorganic acid salts such as hydrochloride, hydrobromide, sulfate, hydroiodide, nitrate and phosphate; and organic acid salts such as citrate, oxalate, phthalate, fumarate, maleate, succinate, malate, acetate, formate, propionate, benzoate, trifluoroacetate, methanesulfonate, benzenesulfonate, para-toluenesulfonate, and camphorsulfonate. Pharmaceutical compositions of the present disclosure may contain an AMPA receptor antagonist in the form of a prodrug. Prodrugs are metabolized in the body to exhibit drug efficacy in the body. Often, prodrugs are made by esterifying their carboxyl group or hydroxy group. The ester bond is broken down by an esterase present in the body, and the active ingredient is released from the prodrug. Pharmaceutical compositions of the present disclosure may further contain a pharmaceutically acceptable additive in addition to the AMPA receptor antagonist. As the pharmaceutically acceptable additive, an excipient, a disintegrant, a binder, a fluidizing agent, a lubricant, a coating agent, a dissolving agent, a solubilizing agent, a thickener, a dispersing agent, a stabilizing agent, a sweetening agent, a flavoring agent, and the like can be used depending on the purpose. Specific examples thereof include lactose, mannitol, crystalline cellulose, low substituted hydroxypropylcellulose, corn starch, partially gelatinized starch, carmellose calcium, croscarmellose sodium, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinyl alcohol, magnesium stearate, sodium stearyl fumarate, polyethylene glycol, propylene glycol, titanium oxide, and talc. Pharmaceutical compositions of the present disclosure may be formulated for oral or parenteral administration (for example, intravenous administration or the like). The dosage form is not particularly limited, and examples thereof include tablets, capsules, powders, granules, solutions, suspensions, injections, patches, and cataplasms. Administration can be by, for example, oral administration or parenteral administration (for example, intravenous administration, intracerebroventricular administration, intracerebral intrathecal administration, etc.). The dosage can be, for example, 100 to 2,000 mg per adult.
In an embodiment of the present disclosure, there is provided a method of treating a disease or condition associated with NMDA insensitivity in an NMDA-insensitive subject or a subject having an NMDA-insensitive NMDA receptor, the method including administering to the subject a therapeutically effective amount of an AMPA receptor antagonist. The subject, the disease or condition associated with NMDA insensitivity, and the AMPA receptor antagonist may each be as described above.
In an embodiment of the present disclosure, there is provided a method of treating cognitive dysfunction in a subject in need thereof, the method including administering to the subject a therapeutically effective amount of an AMPA receptor antagonist. The subject, cognitive dysfunction, and AMPA receptor antagonist may each be as described above.
According to an embodiment of the present disclosure, there is provided a method for inhibiting suppression of activation of an NMDA receptor in a subject having a hippocampus expressing a calcium-permeable AMPA receptor, the method including administering an effective amount of an AMPA receptor antagonist to the subject. The subject, cognitive dysfunction, and AMPA receptor antagonist may each be as described above.
In an embodiment of the present disclosure, there is provided a method of treating a subject having obesity or overweight, the method including administering to the subject an effective amount of an AMPA receptor antagonist. An effective amount can be an amount that can delay and stop the development of obesity or overweight, or ameliorate obesity or overweight. In certain embodiments of the present disclosure, the subject may be a subject subject to dietary restrictions. In certain embodiments of the present disclosure, the subject may be a subject that is not subject to dietary restrictions. In certain embodiments of the disclosure, the subject does not receive or is not receiving a diet. In certain embodiments of the disclosure, the subject receives or is receiving a diet. In certain embodiments of the present disclosure, cognitive dysfunction may be improved in a subject. In certain embodiments of the present disclosure, obesity or overweight may be ameliorated in a subject.
In certain embodiments of the present disclosure, there is provided a method of treating a subject having Alzheimer's dementia, the method including administering to the subject a therapeutically effective amount of an AMPA receptor antagonist. In certain embodiments of the present disclosure, there is provided a method of treating Alzheimer's dementia in a subject in need thereof, the method including administering to the subject a therapeutically effective amount of an AMPA receptor antagonist. The subject may be, for example, a subject having pre-clinical Alzheimer's disease. The subject may be, for example, a subject having an accumulation of Aβ in the brain. Accumulation of Aβ can be assessed by Positron Emission Tomography (PET). The subject may be, for example, a subject having any of reduced Aβ42 levels, elevated total tau levels, and elevated levels of phosphorylated tau in the cerebrospinal fluid. These levels can be examined using, for example, an antibody. The subject may be, for example, a subject with mild cognitive dysfunction, or moderate cognitive dysfunction, or severe cognitive dysfunction. The subject may be a subject having neurodegeneration in the hippocampus. The subject may be a subject having neurodegeneration in the cerebral neocortex. The subject may be, for example, a subject having an accumulation of tau in the brain. Accumulation of tau in the brain can be assessed by PET. In an embodiment of the present disclosure, an AMPA receptor antagonist for use in the method is provided. In an embodiment of the present disclosure, a pharmaceutical composition, for use in the above method, including an AMPA receptor antagonist may be provided.
In an embodiment of the present disclosure, there is provided a use of an AMPA receptor antagonist in the manufacture of a medicament for use in treating a disease or condition associated with NMDA insensitivity in an NMDA-insensitive subject. In addition, in an embodiment of the present disclosure, there is provided a use of an AMPA receptor antagonist in the manufacture of a medicament for use in treating cognitive dysfunction in a subject in need thereof. In an embodiment of the present disclosure, there is provided a use of an AMPA receptor antagonist in the manufacture of a medicament for use in inhibiting suppression of activation of an NMDA receptor in a subject having a hippocampus expressing a calcium-permeable AMPA receptor. The subject, cognitive dysfunction, and AMPA receptor antagonist may each be as described above.
The AMPA receptor antagonist can be used in combination with memantine. Memantine may be in the form of an addition salt, for example, in the form of an acid addition salt, preferably in the form of a hydrochloride salt. Therefore, memantine can be used in combination, for example, as memantine hydrochloride. In certain embodiments of the present disclosure, a combination pharmaceutical product containing an AMPA receptor antagonist and memantine is provided. In certain embodiments of the present disclosure, there is provided a combination pharmaceutical product including a pharmaceutical composition containing an AMPA receptor antagonist and a pharmaceutical composition containing memantine. The combination pharmaceutical product can be used for the treatment of cognitive dysfunction.
Male C57BL/6J background and ob/ob mice were obtained from CLEA Japan Inc. and Japan SLC, respectively (3). The reason why male mice were selected is that it has been reported that male mice are susceptible to HFD, such as weight gain, metabolic changes, and disorder of learning and hippocampal synaptic plasticity. These animals were housed 3 to 4 per cage in a standard 12 hour dark-light cycle room at 25° C. in an environment with freely available food and water. All animal experiments were performed in accordance with the guidelines of the Animal Experiment Ethics Committee of the University of the Ryukyus. Time series changes in average food intake and average body weight were monitored in each condition.
Human amyloid precursor protein knock-in (APP-KI) mice are provided by Dr. Takaomi Saido of the RIKEN, Japan. This mouse was obtained by introducing mutations of Swedish KM670/671NL mutation (NL), the Artic E693G mutation (G), and the Iberian I716F mutation (F) into a human APP gene, and an NL mouse having one mutation and an NL-G-F mouse having all mutations were used for the experiment. All of these mice produce human amyloid beta (Aβ)40 and Aβ42 oligomers (Saito et al., Single App knock-in mouse models of Alzheimer's disease. Nat. Neurosci. 2014 17, 661-4). In the knock-in mouse, accumulation of Aβ in the brain is observed after 2 months (8 weeks).
As a control diet (CD) for mice, CE-2 feed (CLEA Japan, Inc., Tokyo) was used. The composition table of the CE-2 feed was as shown in Table 1. CE-2 feed had a total energy of 339.1 kcal/100 g and a crude fat of 4.61%. On the other hand, as a high-fat diet (HFD), F2HFD2 feed (Oriental Yeast Co., Ltd., Tokyo, Japan) was used. The total energy of F2HFD2 is 640 kcal and is composed of 58% lard (wt/wt), 30% fish meal, 10% skim milk, and 2% vitamin mineral mixture (equivalent to carbohydrate 7.5%, protein 24.5%, and fat 60%) (7). The other components of the F2HFD were similar to those of the CE-2. HFD was administered to a 4-week-old mouse group (F2HFD2 feed). Control mice were fed a low fat diet (CE-2 feed).
HFD mice were orally administered with HydroGel (Clear HO, Portland, ME 04101, USA) at a dose of 5 mg/kg body weight (HFD treated group with PER). For ob/ob mice, CE-2 feed (CLEA Japan, Inc., Tokyo) was used. HFD mice and ob/ob mice were orally administered one per cage with PER at a dose of 5 mg/kg body weight (HFD mice and ob/ob mice PER-administered group), and body weight and HydroGel intake were monitored twice a week for both groups to adjust the dose of PER to 5 mg/kg body weight.
Wheel cages (MELQUEST, Japan, Model RWC-15) were used to monitor the activity of individual mice. The wheel rotation was monitored and recorded every 10 minutes over a 14 day period as previously reported (45).
The open field test was performed as follows. Mice were allowed to move freely for 5 minutes in a space enclosed by 50 cm square 40 cm high walls (Muromachi Kikai Co., Ltd., Japan) and their trajectories were analyzed using the CompACT VAS/DV video tracking system (Muromachi Kikai Co., Ltd., Japan) (46).
The elevated plus-maze test was performed as follows. The space installed 50 cm above the floor consisted of 2 open arms, 2 closed arms (30 cm×6 cm each) and a neutral zone. Mice were disposed centrally in the neutral zone, facing the closed arms, and allowed to move freely for 3 minutes. Time spent in the open and closed arms and frequency of visits to different arms were recorded and scored using the CompACT VAS/DV video tracking system (Japan, Muromachi Kikai Co., Ltd.).
Mice of CD, HFD, and HFD with PER treatment were handled daily for 5 minutes for 5 days prior to the start of the novel object recognition test. PER means the perampanel, which is an AMPA receptor antagonist. The mice were habituated to a 35 cm square, 25 cm high box for 10 minutes on the first day, and were given 2 identical objects (familiar objects) for 10 minutes on the second day. On the third day, one of the familiar objects was replaced with a novel object of different shape and color (
Memory impairment was assessed using the Morris water maze test as previously described (48). In summary, the 120 cm diameter water maze pool (Muromachi Kikai Co., Ltd., Japan, Tokyo) contained opaque water (room temperature) and a platform (10 cm diameter) submerged 2 cm below the water surface. The hidden platform task was performed for 4 to 7 days (twice daily, 3 hour interval), during which two trials were performed each day (15 minute intervals). The platform location was kept constant and the entry points changed semi-randomly between the trials. A 1 minute probe trial was performed without the platform 24 hours after the last day of the hidden platform task. The entry point of the probe trial was set in the quadrant opposite to the target quadrant. Memory retention was evaluated at the time the escape platform was located in the correct quadrant in the hidden platform trial. Performance was monitored using a CompACT VAS/DV video tracking system.
The Morris water maze task was performed as previously described using mice with CD, HFD, and HFD with PER treatment (49). All experiments were performed at approximately the same time of day. Mice were transported from the colony to the holding area and kept undisturbed for 30 minutes prior to the experiment. The tests were performed in a rectangular dimly lit room with a circular pool (Muromachi Kikai Co., Ltd., Tokyo, Japan) of 120 cm diameter filled with opaque water with skim milk (Morinaga, Japan) kept at room temperature. Four large objects illuminated by floor lamps were hung on the black curtains surrounding the pool as cues outside the maze. A hidden circular platform with a diameter of 10 cm was placed 1 cm below the surface of the water and the mice were trained to find the platform 4 times per day at intervals of approximately 60 minutes for 12 days. During training, the mice were released from 4 start points (N, S, E, and W) assigned in a pseudo-random manner and allowed to swim for 300 seconds. Mice that did not find the platform within 300 seconds were manually guided to the platform and rested on the platform for 15 seconds.
On the thirteenth day, a probe trial was performed under the condition of full-cue (P1). Mice were released at the center of the pool and allowed to swim in the absence of a platform for 300 seconds. The probe trial was followed by four training trials in the presence of the platform to avoid memory extinction that may have occurred during the probe trial. Thereafter, once a day, four probe trials with extra maze cue manipulations were performed and no retraining was performed during the probe trials. In one-cue probe trial (P2), one cue that was located more distantly from the platform was left and the other three cues were removed from the surrounding curtains. In two-cue probe trial (P3), one cue positioned near the platform and the one used in the one-cue probe trial were left, and the other two cues were removed from the surrounding curtains. In the no-cue probe trial (P5), all four extra maze cues were removed. Training and probe trial data were collected and analyzed using CompACT VAS/DV video tracking system software. The escape latency to the hidden platform (goal reaching time) was measured.
Five-trial social tests were performed as previously described (19). In summary, subject mice with CD, HFD, and HFD with PER treatment were housed individually starting 7 days before the study to establish territory dominance. On the day of the test, a female mouse was presented in the cages of subject male mice, which is a subject (
Contextual fear conditioning was applied with slight modifications to published protocols (50). Mice were transferred to the animal experimental room and allowed to acclimatize for at least 30 minutes prior to contextual fear conditioning training. Next, the mice were placed in a foot shock system model MK-450 MSQ (Muromachi Kikai Co., Ltd., Japan), searching was performed for 2 minutes, and then 3 electric foot shocks (0.8 mA, 2 sec, 2 min interval) were performed. After mice were left in the apparatus for an additional 1 minute, the animals were removed.
Anatomical brain images of 8 ex vivo mice with CD, HFD, PER treatment were acquired using a Bruker BioSpec 117/11 11.75 Tesla MRI scanner (Bruker BioSpin GmbH, Ettlingen, Germany). MPRAGE (three-dimensional (3D)-prepared rapid gradient-echo) sequences were acquired as high resolution 100 μm iso-voxel images for voxel-based morphometry (matrix size: 280×220×220; field of view: 28×22× 22 mm, repetition time: 2000 ms, echo time: 1.78 ms, flip angle: 12 degrees, inversion time: 800 ms, echo train length: 13, average number of times: 2).
A region of interest was drawn in the acquired data image using a rapid acquisition protocol by relaxation enhancement (RARE) sequence (matrix size: 280×220×220, field of view: 28×22×22 mm; repeat time: 1500 ms; echo time: 25 ms; flip angle: 180°). The MPRAGE image and the RARE image were simultaneously acquired by one single scan.
MRI data acquisition of ex vivo mice was acquired by simultaneously placing the head parts of four mice fixed with PBS into an MRI coil. Brains of four mice were confirmed using raw MRI data.
Voxel-based morphometry (VBM) analysis and preprocessing of MPRAGE and RARE images were performed using the SPM8 analysis tool (Wellcome Department of Clinical Neurology, London; http://www.fil.ion.ucl.ac.uk) and SPMMouse toolbox (http://www.spmmouse.org/).
The raw data were divided into four mouse head part MRI images and stored separately. The 3D (x-y-z-) coordinates of the divided images were transformed into the SPM standard coordinate system, and the origin of the 3D coordinates was defined as a bregma point. The brain images were then segmented into grey matter (GM), white matter, and cerebrospinal fluid using a segmentation tool (installed in the SPM8 system). Dividing into GM images was performed using the tissue probability map in the SPMMouse toolbox. These divided GM images improved contrast and were normalized to deformation of the images. Finally, these images were smoothed using a 200 μm isotropic Gaussian kernel method (installed in the SPM8 system). The smoothed images were applied for VBM analysis.
The volume of subfields of the hippocampus (CA1, CA2, CA3, DG, EC) was calculated using the ROI file (31, 33, 51, 52). Differences between the average values of whole brain volumes of CD, HFD, and HFD with PER treatment were tested by one-way analysis of variance (ANOVA). When there was a significant difference between the 3 groups by ANOVA (p<0.05), Scheffe post hoc analysis (Scheffe) was performed between the CD group and the HFD group; between the CD group and the HFD group with PER treatment; and between the HFD group and the HFD group with PER treatment.
The participants of the study were 117 healthy volunteers (average age 37.8±19.6 years, 65 females, 52 males) and 5 patients with benign tumors (average age 55.5±9.6 years, 2 females and 3 males), all agreed in writing to participate in the study, and event-related memory tasks and T1-weighted images by 3T MRI were taken. The participants were divided into three groups based on body mass index (BMI) according to WHO criteria: normal body weight (BMI<25), overweight (BMI≥25 and <30), and obesity (BMI≥30). There were 84 participants in the normal body weight group (average BMI 20±1.8), 27 participants in the overweight group (average BMI 26±1.2), and 11 participants in the obese group (average BMI 32±2.3). All experiments were carried out with the approval of the Ethics Committee on Medical and Health Research on humans at the University of the Ryukyus.
Details of the fMRI experiment of the event-related memory task used in this study are described in the previous report (32). The memory task consisted of 108 photos of 16 luer sets (similar images), 16 repeat sets (identical images), and 44 novel items (new images). Participants were instructed to respond by pressing a button regarding whether the picture stimulus displayed on the display was a novel item (new), a repeated identical picture (same), or a picture that was similar but not the same as the previous picture (similar; lure). The button operation of the subject during the memory task was recorded in a personal computer, and the correct answer rate of new, same, and lure was calculated. The correct answer rate of each task (new task, similar task, same task) was calculated by the following equation.
In this experiment, the total number of tasks presented for a new stimulus was set to 76, and the total number of tasks presented for the same stimulus and a Luer stimulus was set to 16.
Functional and structural images of the brain were acquired using 3T-MRI (Discovery MR 750; General Electric, Milwaukee, WI). As a functional image for measuring the BOLD contrast, echo planar imaging (EPI, repetition time: 1500 ms, echo time: 25 ms, flip angle: 70°, matrix size: 128× 128, field of view: 192×192, in-plane resolution: 1.5×1.5 mm2, 23 slices, 3 mm thickness, 0 mm space) was used. Anatomical brain images were acquired using a three-dimensional (3D) spoiled gradient recoil echo (SPGR) sequence (slice thickness in sagittal section: 1 mm, matrix size: 256×256, field of view: 256×256 mm, repetition time: 6.9 ms, echo time: 3 ms, flip angle: 15°). High-resolution T2-weighted fast spin echo sequences (matrix size: 512×512, field of view: 192×192 mm, repetition time: 4300 ms, echo time: 92 ms, in-plane resolution: 0.375×0.375 mm2, 23 slices, thickness: 3 mm, space: 0 mm) were acquired to visualize the structure of the hippocampus and to perform co-registration of 3D SPGR images and EPI functional images.
Image Processing of Behavioral Task fMRI
Using the SPM12, preprocessing of realignment, temporal correlation, spatial normalization, and spatial smoothing of the functional image was performed and analyzed. Based on the hippocampus atlas (Duvernoy), a lower region of the hippocampus (CA3, CA1, DG) and a region around the hippocampus (parahippocampal gyrus, perirhinal cortex, entorhinal cortex) were drawn by handwriting using a pen tablet on a high-resolution coronal T2-weighted image. The percentage of signal change in the BOLD response in the hippocampal region of each subject was extracted using MarsBar toolbox. 3D-SPGR images were used for analysis of voxel-based morphometry. The T1-weighted image was segmented into GM, white matter, and cerebrospinal fluid images using the SPM12 segmentation tool. The volume of GM throughout the brain was calculated after spatial normalization and modulation of the GM image.
MRI data was acquired using a GE Medical Discovery MR 750 3T scanner (with 32 channel head coil). Subjects lying on the scanner bed in a supine position had their head and neck clamped with foam pads and Philadelphia neck collar to minimize head movement. Resting-state fMRI images were acquired using a single shot EPI sequence covering the whole brain (42-axis slice, thickness 4 mm, no gap between slices, repetition time 2000 ms, echo time 30 ms, flip angle 70°, matrix size 64×64, field of view 256×256). A total of 150 volumes were captured in one session. Anatomical brain images were acquired using a T1-weighted sagittal 3D SPGR sequence.
Image preprocessing and functional network analysis were performed using SPM12 and CONN toolbox 18.b (www.nitrc.org/projects/conn, RRID: SCR 009550 [Whitfield-Gabrieli and Nieto-Castanon, 2012]). Details are as described in the previous report (32). The image was preprocessed in the order of realignment, slice-timing correction, coregistration, normalization, smoothing, and segmentation. The noise of the BOLD signal was removed by linear regression of potential confounding effects contained in the BOLD signal and by temporal bandpass filtering (time frequency was 0.008 Hz or lower or 0.09 Hz or higher).
In the functional network analysis using the CONN toolbox, the default mode network (DMN) and the functional connectivity were analyzed. First, as an individual analysis, regions that had a positive correlation with BOLD fluctuations in the posterior cingulate cortex (PCC) and precuneus were calculated as a DMN map. Next, a region having a negative correlation with the DMN map was calculated as an anti-correlation DMN map. The average images of the DMN map and the anti-correlation DMN map of the normal body weight group, the overweight group, and the obese group were calculated using the one-sample t-test (the threshold of the voxel level was p<0.001 (without correction), and the threshold of the cluster level of the false discovery rate [FDR] was p<0.05 (with correction).).
In the functional combination analysis, nodes and edges of graph theory parameters were calculated. The correlation coefficient of the fluctuation of the BOLD signal between each ROI was calculated with a seed-based connectivity measurement method (53) using a 132×132 ROI map (default ROI atlas of CONN toolbox). The ROI-to-ROI degree (the number of edges of any node between nodes) and betweenness centrality (the number of shortest paths for a vertex through any two pairs of nodes (j, i) in the graph) were calculated by ROI-to-ROI correlation 132×132 matrix established using our 132×132 ROI map.
Degree is defined as the number of edges from/to each node at each node.
The degree (di) is defined by the following formula.
Here, Ai,j represents the correlation between ROI and ROI in a 132×132 matrix.
Betweenness centrality (BCi) represents a hub that connects other functional modules and nodes (54), and BCi is defined as follows.
Here, Pj,x is the number of nodes in the shortest path between each pair of nodes (k, j) (the shortest path when passing through any node defined with i as a variable), and N is the number of all nodes in the graph of the ROI map.
The average value of each node and the number of edges were calculated for each of the normal body weight group, the overweight group, and the obese group. In addition to PCC and precuneus in DMN, anterior cingulate cortex, cerebellar lobules CrusI, and hippocampus related to memory function of hippocampus were set as a region of interest as described in the previous report (32), and functional connectivity of 3 groups was analyzed. Functional connectivity maps for each group were shown using a BrainNet viewer (https://www.nitrc.org/projects/bnv/) (55).
Hippocampal brain slices were prepared from 17 to 18 week old male C57BL/6J background mice, and according to previous reports (56, 57), mice were divided into the CD group, the HFD group, and the HFD group with PER treatment (HFD with PER), or 12 to 13 week old ob/ob mice were divided into ob/ob and ob/ob groups with PER treatment. After cutting out slices (thickness, 300 to 400 μm) using a Linear Slicer (PRO 7N, Dosaka EM, Japan), hippocampal brain slices were incubated in normal Krebs Ringer (125 mM NaCl, 2.5 mM KCl, 10 mM D-glucose, 1.25 mM NaH2PO4, 26 mM NaHCO3, 2 mM CaCl2), 1 mM MgCl2, with continuous bubbling of mixed gas [95% O2]; 5% CO2]) for 60 min at room temperature to restore cutting damage. The Ca2+ indicator Fluo-3 AM (excitation wavelength: 508 nm, emission wavelength: 525 nm, Kd, 0.4 μmol/L) (5 μM) (Dojindo, Kumamoto, Japan) was loaded into brain slice specimens for 90 minutes. To monitor [Ca2+]i, the fluorescence intensity (F525) of Fluo-3 was monitored using a photomultiplier tube under a confocal microscope (excitation wavelength: 488 nm; LSM5 PASCAL, Carl Zeiss, Germany). In this experiment, Ca imaging of the entire hippocampal slice was performed using a low magnification (2.5 times) objective lens (FLUAR 2.5×, NA=0.12, Carl Zeiss, Germany) (
Surface AMPAR Subunits of Cross-Linking with BS3
Crosslinking using the BS3 procedure carried out here was carried out based on previously described methods (60). Hippocampal slices of 17 to 18 week old male C57BL/6J background mice (CD, HFD, and HFD with PER treatment) or 12 to 13 week old ob/ob mice (ob/ob, and ob/ob with PER treatment) were prepared as previously reported (56, 57). Hippocampal slices were prepared and collected, and then CA1, CA2, CA3, DG, and EC regions were separated from the hippocampal slices using a dissection knife. CA1, CA2, CA3, DG, and EC regions were added to an Eppendorf tube (Eppendorf, Hamburg, Germany) containing ice-cold artificial cerebrospinal fluid (ARTCEREB; Otsuka Pharmaceutical Co., Ltd., Tokyo, Japan) supplemented with 2 mM BS3 (Thermo Fisher Scientific, Wilmington, DE, USA). Incubation was performed on ice for 30 minutes. Crosslinking was terminated by quenching the reaction with 100 mM glycine (10 min at 4° C.). Hippocampal subregions were resuspended in ice-cold lysis buffer (25 mM HEPES, pH 7.4, 500 mM NaCl, 2 mM EDTA, 1 mM DTT, 1 mM phenylmethylsulfonyl fluoride, 20 mM NaF, 1 mM sodium orthovanadate, 10 mM sodium pyrophosphate, 1× protease inhibitor mixture [Sigma-Aldrich, St Louis, MO], and 0.1% Nonidet P-40 [v/v]) containing protease and phosphatase inhibitors and rapidly homogenized with 5 sec ultrasonication. The total protein concentration of the lysate was measured using the Lowry method (61). Samples were dispensed (divided into approximately 15 per mouse) and stored at −80° C. for later analysis. BS3 samples were analyzed by SDS-PAGE directly without purification, and surface and intracellular bands were measured in the same lane, thus no normalization was required and sample throughput was improved. Total protein lysate (40 μg) was loaded and electrophoresed on 5% to 10% Tris-HCl gel (Thermo Fisher Scientific, Wilmington, DE) under reducing conditions and proteins were transferred to nitrocellulose membranes (Thermo Fisher Scientific, Wilmington, DE) for immunoblotting. The membrane was blocked at room temperature for 30 minutes using a blocking reagent Blocking One (Nacalai Tesque, Tokyo, Japan). The membrane was then incubated overnight at 4° C. with anti-GluA1 (1:1,000, Merck Millipore, Burlington, MA) and actin (1:5,000, Protein Teck, Chicago, IL, USA). Membranes were incubated with HRP-labeled anti-rabbit IgG (1:3,000, Cell Signaling Technology, Danvers, MA, USA) for 30 min and extensively washed again with TBS-T. After soaking the membrane in the chemiluminescence detection substrate Chemi-Lumi One (Nacalai Tesque, Tokyo, Japan) for 1 min, luminescence was detected using a LuminoGraph1 imaging system (Atto, Tokyo, Japan). The surface and intracellular bands of each lane were analyzed using a CS Analyzer (Atto, Tokyo, Japan).
Hippocampal slices of 17 to 18 week old male C57BL/6J background mice (CD, HFD, and HFD with PER treatment) or 12 to 13 week old ob/ob mice (ob/ob, and ob/ob with PER treatment) were prepared as previously reported (56, 57). After preparing and collecting hippocampal slices, CA1, CA2, CA3, DG, and EC regions were separated from hippocampal slices using a dissection knife from 57BL/6J background mice and ob/ob mice, respectively. The CA1, CA2, CA3, DG, and EC regions of mice were separated and immediately lysed in disposable homogenization tube BioMasher2 (trademark) (Nippi, Tokyo, Japan) using 0.5 mL of TRIzol RNA isolation reagent (Thermo Fisher Scientific, Wilmington, DE). Total RNA was individually extracted from each region according to the remaining protocol of the TRIzol RNA isolation reagent provided by the manufacturer (Thermo Fisher Scientific, Wilmington, DE). 1 μg of total RNA was reverse transcribed using PrimeScript RT Reagent Kit (Takara, Shiga, Japan). An aliquot of the obtained CDNA was diluted 1:10 and added to a master mix of TB Green Premix ExTaq (Takara, Shiga, Japan), and real-time PCR was performed using a 7500 Fast Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's instructions. The conditions for real-time PCR were as follows. 40 cycles of 95° C. for 30 seconds, then 95° C. for 5 seconds and 60° C. for 34 seconds. The fluorescence intensity was measured for each annealing step and the threshold cycle time was determined using 7500 software. In addition, relative expression levels of β-actin were normalized to respective controls (vehicle group). The relative expression level of the target gene in each sample was determined using a standard curve and further normalized to the expression level of β-actin of the same sample. The sequences of primers and probes for these genes are shown in Supplemental Table 2. The “ratio of GluA2 mRNA amount/(GluA1+GluA3+GluA4 mRNA amount” was used as a Ca2+ permeability index.
A template for Sanger sequencing of the GluA2 editing site was prepared by amplifying cDNA using a forward primer (GAGGAATTTGAAGATGGAAGAGA: SEQ ID NO: 44) and a reverse primer (AGGAGGAGATGATGATGAGGGT: SEQ ID NO: 45). PCR products (10%) were confirmed by agarose gel electrophoresis. After confirming the appropriate expected size, the PCR product was purified according to the manufacturer's instructions using innuPREP PCRpure Lite Kit (Analytik Jena, Jena, Germany) prior to direct sequencing. The cycle sequence was performed using the BigDye Terminator v 3.1 Cycle Sequencing Kit (Applied Biosystems, CA, USA) and each primer described above. Sanger sequence analysis was performed using the ABI 3500 (Applied Biosystems, CA, USA) and sequence viewer software 4 Peaks.
The Q/R editing status of GluA2 was analyzed using a Quant Studio™ 3D digital PCR system equipped with a TaqMan (trademark) custom SNP genotyping assay (Thermo Fisher Scientific, Wilmington, DE). The TaqMan probe was synthesized by Thermo Fisher Scientific Inc., and a VIC-labeled probe was used for detection of the non-edited (Q) sequence, and a FAM-labeled probe was used for detection of the edited (R) sequence (5′ CATCCTTGCTGCATAAA3′: SEQ ID NO: 46, 5′ ATCCTTGCCGCATAAA3′: SEQ ID NO: 47, respectively). The following amplification primer pairs were used for the PCR reaction:
Coronal sections of mouse brains from Bregma-0.94 mm to Bregma-4.04 mm (5 mm wide, including the entire hippocampus from dorsal to ventral, medial to lateral) were fixed with 4% paraformaldehyde for 2 days, and then stained with the Golgi Cox staining system (FD Rapid GolgiStain™ Kit, MD 21041, USA). The impregnated tissues were cut into 100 μm sections and counterstained with crystal violet, and the total number of 15 μm spines on the apical dendrites of CA1 and DG and the percentage of morphologic spines (thin, stubby, mushroom) were examined using an Axio Observer Z1 (Carl Zeiss, Germany). Another set of paraformaldehyde-fixed 5 mm wide coronal sections of the brain, including the entire hippocampus, were processed using the passive CLARITY technique (PACT) (62) and examined through Lightsheet Z.1 (Carl Zeiss, Germany) using a 10× clear objective lens, and 3D images of Thy1-YFPH transgenic mice (the Jackson Laboratory, stock number: 003709, strain name: B6. Cg-Tg. (Thy1-YFP) 16Jrs/J) (63, 64), HFD-fed mice, and whole hippocampus of the HFD-fed mice with PER treatment. were acquired respectively. Maximum intensity projection images were acquired along the Z dimension, time dimension, and channel dimension to create an output image with the pixel containing the maximum value for all images in the stack at a particular pixel position. With the Z-stack function, a series of XY images at different focus positions can be acquired to create Z-stack. In this manner, a 3D dataset of 400 μm×400 μm was obtained from the specimens, dorsal to lateral and medial to lateral for each of CA1, CA3, and DG. In the gallery view, the images from the Z-stack are displayed in chronological order.
3D reconstruction was performed using Arivis Vision 4-dimensional (4D) software. Blob finder (filter) was used for rounded 2D and 3D segments, close to spherical shape, out of noisy images. The Gaussian scale was used to find the seeds of the object and specify the boundaries of the object with the watershed algorithm. The average size of the structure of interest was set to 20 μm and the threshold was set to 5. High resolution rendering is an approach that visualizes the current view with higher image and data resolution.
Mouse brains were perfusion-fixed with 4% paraformaldehyde, embedded in paraffin, and cut into 4 micrometer thick sections to be used for immunohistochemical analysis of monoclonal antibodies against DCX (E-6 monoclonal, 1:50, Santa Cruz Biotechnology Inc, Dallas, USA), MAP2ab (AP-20 monoclonal, 1:100, SIGMA-ALDRICH, St. Louis, USA), GluA1 (Aβ1540 polyclonal, 1:100, EMD Millipore Corp., Burlington, USA), and GluA2 (AB 1768-1 polyclonal, 1:5, EMD Millipore Corp., Burlington, USA).
The immunostained region in each of the expression regions of MAP2, GluA1, and GluA2 was acquired using a ZVI format AxioVision (Carl Zeiss, Germany) microscope (objective lens 20×). Generation of data image processing with image segmentation was performed using machine learning with ZEN Intelliesis software. 1000 or more cells were examined in each group. One-way variance analysis was used for testing variance among the three groups excluding data of 3SD or higher. Then, the following number of samples was used.
MAP2 CD n=731, HFDs n=288, HFD+PER n=225; GluA1 CD n=220, HFD n=156, HFD+PER n=94; GluA2 CD n=78, HFD n=114, HFD+PER n=182; GluA2/GluA1 CD n=78, HFD n=94, HFD+PER n=94
ob/ob Series
MAP2 ob/ob control n=849, ob/ob PER 1 w n=967, ob/ob+PER 12 w n=511; GluA1 ob/ob control n=163, ob/ob PER 1 w n=124, ob/ob+PER 12 w n=242. GluA2 ob/ob control n=39, ob/ob PER 1 w n=44, ob/ob+PER 12 w n=369, GluA2/GluA1 ob/ob control n=54, ob/ob PER 1 w n=41, ob/ob+PER 12 w n=234.
Bonferroni method was used for post hoc test to analyze significant differences between groups.
Sequenced raw RNA-seq fastq reads were aligned to the genome of mouse GRCm 38 (Ensemble Release 104, http://ftp.ensembl.org/pub/release-104/fasta/mus_musculus/dna/) using HISAT2 (v.2.2.0) (65). The average mapping rate of all samples was 94.21% (range 88.70 to 96.30%). Aligned reads were quantified using Salmon (v.0.14.2) (66) and TPM values were calculated using StringTie (v.2.1.2) (67). Variant cools were performed using GATK package (v.3.8) (70) according to GATK Best Practice for RNAseq short variant discovery (68, 69). The addition of the read group information, the sorting, the creation of the duplication mark, and the creation of the index were performed using a tool of Picard. GATK tool Split N Cigar Reads were used to split reads into exon segments and hard clip sequences that protrude into intron regions. Variant coating and filtration were performed using GATK HaplotypeCaller and VariantFiltration, respectively. The functional annotation of the output variants was performed using SnpEff (v.4.3) (71). RNA-editing levels were calculated as the ratio of the total number of reads aligned to the R/Q editing site of GluA2 (chr3: 80706912) to the number of reads that were T-C-converted at this site.
In animal model experiments, statistical analysis was performed using one-way ANOVA and Bonferroni's multiple comparison test and/or two-tailed t-test. Statistical significance was p<0.05. In the human experiment, the relationship between BMI, GM volume of whole brain, and body weight, and the correct answer rate for the task condition (new, similar, same) was analyzed by partial correlation analysis. Furthermore, the difference between the average brain activity and the correct answer rate under the three task conditions (new, similar, same) was analyzed by one-way analysis of variance.
First, the intracellular calcium concentration ([Ca2+]i) was directly measured in an acute brain slice of the hippocampus having a perihippocampal region using a mouse obesity model associated with HFD feeding (composition of diet (7) shown in Table 1) for 12 weeks after weaning to track calcium signaling (
In contrast, calcium signal transduction via 50 μM NMDA (N-methyl-D-aspartic acid) with 10 μM glycine (channel coactivator) was inactivated in hippocampi derived from HFD-fed mice, whereas mice fed CD (control diet: normal diet but not high-fat diet) showed activation via the hippocampus (
In hippocampal slices from mice fed HFD and perampanel (PER) (Fycompa (trademark), Eisai, Japan) (5 mg/kg/day orally administered by hydrogel), mice treated with a new non-competitive AMPAR antagonist (8) were identified to normalize transmission via AMPAR (
Experiments similar to the above were performed on Alzheimer's disease models. As the Alzheimer's disease model, NL mice and NLGF mice were used. NL and NLGF mice were fed CD. The results were as shown in
Ca2+-permeable AMPAR (CP-AMPAR) is associated with pathophysiology underlying various neurological diseases, such as brain tumors (10), amyotrophic lateral sclerosis (ALS) (11), cocaine addiction (12), neuropathic pain (13), and epilepsy (14). The molecular diversity behind pathophysiology is different in each disease and is not well understood. However, based on the above results, altered calcium dynamics in [Ca2+]i via AMPAR and NMDAR may play an important role in obesity with cognitive decline.
AMPAR mediates the fastest rate of excitatory neurotransmission. AMPAR consists of four subunits GluA1-4 that determine the functional properties of AMPAR channels, and the diversity of AMPAR depends on the abundance of these subunits. Specifically, other subunits of GluA1, GluA3, and GluA4 are Ca2+ permeable, whereas the GluA2 subunit is essentially Ca2+ impermeable. In addition, the Ca2+ permeability of AMPAR is regulated by the relative amount of GluA2 expression. That is, it is considered that the Ca2+ permeability of AMPAR decreases as the relative amount of GluA2 subunit increases, and the Ca2+ permeability of AMPAR increases as the relative amount decreases.
GluA2 is edited at the Q/R site within the reentry M2 membrane loop region by adenosine deaminase (ADAR2), which acts on RNA type 2 involved in editing double-stranded RNA from adenosine (A) to inosine (I) (review, refer to 15, 16 and 17). Attempts were made to determine real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR), subunit composition of AMPAR and NMDAR. Total RNA in hippocampal subregions (CA1, CA3, DG, EC) was separated, and quantitative analysis of mRNA of GluA1, GluA2, GluA3, and GluA4 for AMPAR, and GluN1, GluN2A, GluN2B, and GluN2C for NMDAR was performed by qRT-PCR. As a result, a significant increase in GluA1, GluN1, and GluN2B expression in the CA3 region associated with HFD-fed mice, an increase in GluN2B expression in DG (p<0.05, respectively), and a significant increase in GluA2 in CA1 in mice fed HFD with PER (p<0.05) (
The reduction in Ca2+ permeability index (
Post-weaning (6 weeks) food intake and body weight of mice maintained on control diet (CD), high-fat diet (HFD), or HFD containing PER (Fycompa (trademark), Eisai, Japan) (5 mg/kg/day) was monitored up to 18 w (
Quantitative analysis of the brain by 11.7 T MRI (Bruker BioSpec 117/11, Bruker BioSpin GmbH, Germany) showed hydrocephalus, a sign of brain atrophy caused by a decrease in brain volume, in all mice fed HFD after weaning (n=6) (
NL-GF mice begin to accumulate in the brain of Aβ from 8 weeks of age (Nat. Neurosci. 2014 17, 661-4). In this example, the AD model mouse (n=5) was fed a CD diet containing a perampanel at a dose of 5 mg/kg body weight/day from 8 to 13 weeks of age, and the mouse was subjected to a novel object recognition test. In the negative control (n=5), a normal CD diet without perampanel was taken. The results of the novel object recognition test of mice at 13 weeks of age were as shown in
Functional Changes of AMPA and NMDA Glutamate Receptors in ob/ob Mice
Leptin (25, 26), a hormone that regulates energy expenditure stimulated by anorexigenic eating behaviors, also plays an important role in synaptic transmission via NMDAR (27). HFD-fed Mice generally first show elevated leptin, one of the hallmarks of obesity, gradually chronic obesity forms leptin resistance and fails to suppress appetite and promote energy expenditure (28). For CP-AMPAR in ob/ob mice, all of Gyki, Naspm, and PER exhibited a significant inhibitory effect in any region of EC, CA1, CA2, CA3, and DG (
A leptin deficient obesity model and the ob/ob mice as a leptin resistant obesity model were analyzed. Specifically, these leptin deficient/resistant models were analyzed for high-resolution MRI, tissue morphology in staining of MAP2, GluA1, GluA2, qRT-PCR, and behavioral analysis. This revealed whether the state of leptin deficiency/resistance status affects hippocampal morphology (
To apply the volumetric analysis, MRI images were acquired of ob/ob and lean littermate control wild-type (C57BL/6 background) mice, showing that the grey matter mass (0.18±0.02 ml (n=8)) of ob/ob mice was different compared to wild-type (0.28±0.02 ml (n=8)) (
ob/ob mice and their littermates with wild-type traits were obtained as the offspring of ob +/− mice. These mice were fed freely and some of the ob/ob mice were fed perampanel-containing diet at 5 mg/kg body weight from 8 to 12 weeks of age. The appearance and body weight of these mice were compared at 12 weeks of age. The results were as shown in
Mice were then split into an HFD-fed group (n=5) and a PER-containing HFD-fed group (n=5) under the condition of the same feeding amount (refer to lower Panel of
Furthermore, our data (
To investigate the correlation of body mass index (BMI) and grey brain mass, analysis was performed by applying volumetric analysis from data obtained by T2 magnetic resonance (MR) imaging of the brain of 122 Japanese subjects (84 people (BMI: less than 25), 27 people (BMI: 25 or more and less than 30), and 11 people (BMI: 30 or more)) (Table 5).
In men, a significant negative correlation was found between BMI and grey matter mass compared to women. As for healthy subjects having a high (to 30.2) value and a low (to 21.1) value of BMI (
Next, the influence of BMI elevation on human hippocampal synaptic transmission was examined by analyzing variations in blood oxygenation level-dependent (BOLD) response, hippocampal memory function of pattern completion, and pattern separability (formation of separate representations of similar inputs) by fMRI behavioral task (35, 36). BMI, pattern completion, and memory recall ability were negatively correlated. The structural network supporting pattern complementarity is based on CA3 and CA1. The central role of ensemble dynamics (dynamic synchronization) was observed in healthy volunteers in this region (37) (
Human's Pattern Completion Ability for Memory Recall Inversely Correlates with BMI
In particular, the importance of resting fMRI for biomarkers of human cognition in hippocampal memory function has increased (35). The fMRI data, which measured resting brain activity, suggests that among organized large networks, the default mode network dynamically controls salience and central executive networks of healthy individuals. In obese individuals, this network was disrupted, resulting in impaired cognitive function (
The effect of an AMPA receptor antagonist on the hippocampus and body weight of a 70 year old female with a BMI value of 38 was investigated. A 70 year old female had quadriplegia and respiratory disorders due to a large foramen magnum tumor. After the tumor extraction, anti-epileptic treatment was performed. As an anti-epileptic treatment, 2 mg/day (thereafter, the dose was changed to 4 mg/day) of perampanel was orally administered. The transition of the female body weight and the Fugl-meyer assessment score of the lower limb was observed. In addition, the size of the hippocampus was evaluated from MRI of the brain of the female at 26 weeks after surgery. The results were as shown in
Units are in L/L for grey matter and mm3 for hippocampal region.
From the above results, AMPA receptor antagonists increased hippocampal volume in women. Furthermore, as shown in
Furthermore, it was investigated whether inactivation of the NMDA receptor is a calcium-dependent inhibition. Calcium ion dependent NMDA receptor expression and reactivity to NMDA and glycine in mice (2 w HFD) fed with HFD for 2 weeks were confirmed. The results were as shown in Panel A of
From these results, it was expected that the Ca2+-dependent inactivation (CDI) [15, 40, 41] observed in obese mice was probably regulated by AMPAR's Ca2+ permeability and endogenous Ca2+ buffering capacity. Indeed, NMDAR inactivation via AMPAR disappeared in the presence of intracellular fast Ca2+ buffer BAPTA or in Ca2+ free extracellular solution (Panels A and B of
HFD stimulated calcium dynamics in the hippocampus via AMPAR, and subunit structures rearranged from non-CP-AMPAR to CP-AMPAR, altering NMDAR calcium signal transduction to downregulate Ca2+ influx. Inactivation of transmission by function of the NMDAR is thought to correspond to a decline in cognitive function. CP-AMPAR led to decreased hippocampal size and cell number (especially CA3), decreased dendritic integrity of CA1, and maturation of the spine in the DG region. It was found that ingestion of HFD for 7 days or more affects the memory circuit of the hippocampus via a calcium signal. While calcium dynamics via NMDAR was maintained with this short-term ingestion, calcium entry via AMPAR was evident in the hippocampus. Long-term ingestion for 8 weeks or more after weaning completely reduced calcium entry via NMDAR with changes in calcium kinetics via AMPAR. AMPAR and NMDAR are involved in the high-speed transmission of glutamate-based synapses and are localized in the postsynaptic membrane, and play an important role in human cognition such as learning and memory. Inhibition of calcium influx into a synapse by an NMDAR is regulated by the intracellular calcium concentration, regardless of the source of calcium, such as AMPAR, voltage-dependent calcium channels, internal storage, NMDAR (9). Notably, AMPAR is co-active with NMDAR and is responsible for excitatory synaptic responses on the 1/10 millisecond timescale, while HFD increased calcium entry of these receptors and ultimately decreased the magnitude of calcium current through NMDAR. NMDARs have been reported to play an important role in controlling appetite and dietary preferences, in addition to inducing synaptic plasticity (LTP/LTD) (36), which is believed to cause a vicious cycle of binge drinking, reaction due to dietary restriction failure, and increased obesity (37), ultimately further accelerating decline in cognitive function. Attempts to activate the NMDAR to restore neural function by AMPAR-mediated hyperthermia have also been shown to conversely promote neuronal injury (72).
Modification of Glutamatergic Synaptic Transmission Affects Functional Network Connectivity of Resting fMRI Data
Higher BMI is associated with cognitive dysfunction in young people (38), and in middle age, overweight and obesity may increase the future risk of cognitive decline in old age. In the elderly, there is a paradoxical phenomenon that higher BMI results in better cognitive function and lower mortality (39). HFD induces obesity and causes hypertension, type 2 diabetes, and cardiovascular events, and patients with these diseases are at increased risk of cognitive decline (40, 41). Presumably, the inability to properly manage lifestyle, including self-regulation of dietary behavior, prevents effective treatment and disease control. In medical care, developing an effective intervention method against the decline in cognitive function associated with obesity is a key to better disease management. In the brains of an overweight person and an obese person, the correlation between the decrease in resting activity of the precuneus and posterior cingulate cortex and the decrease in activity of the dorsal lateral prefrontal area and the insular cortex occurred at the same time was broken (
Notably, the appearance of frequent hydrocephalus was seen among the early onset obese mouse group. In humans, obesity began in early childhood from 2 to 6 years of age (46), and even most children who were obese at that age were obese in adolescence. Appropriate and effective interventions are an urgent challenge for human health and illness. Importantly, application of HFD with PER treatment restored dysregulated calcium signal transduction via both AMPAR and NMDAR, while eliciting restoration of brain size and behavioral memory capacity. Preventing weight gain due to obesity provides health benefits. Food restriction (47), which has been reported to induce CP-AMPAR in the nucleus accumbens, usually rebounds and ends up with weight gain and binge eating. Taken together, AMPAR is suggested to be an attractive therapeutic target for cognitive decline associated with human obesity.
In the examples, using the perampanel as an AMPA receptor antagonist, it was demonstrated that the perampanel significantly increased the Aβ42/Aβ40 ratio of the culture supernatant in the neural stem cell culture system derived from the Alzheimer's type model mouse, decreased the deposition of Aβ, and inhibited the accumulation of Aβ in the hippocampus and cerebrum of the model mouse.
Biomarkers of Alzheimer's dementia include the Aβ42/Aβ40 ratio of cerebrospinal fluid (CSF) and plasma levels, phosphorylated tau (P-tau) in threonines 181 and 217, and neurofilament lite (NfL) (Curr Opin Neurol 2021 1 266-274). The Aβ42/Aβ40 ratio is considered to be able to predict Aβ accumulation in PET (Doecke J D et al., Neurology 2020). Hippocampus on 17 to 19 days of NL-G-F(−/−) mouse embryonic life was taken out and cultured by a Neurosphere method by Brewer G J et al. (Nat Protoc 2007 2, 1490-1498), and a supernatant was measured by an EIA method using this culture system. The change in the Aβ42/Aβ40 ratio by the perampanel (50 μM/methyl cellulose 4 μL) was analyzed. In 4 μL of a 0.5 w/v % aqueous solution of methyl cellulose 400, 5×104 spheres smaller than 50 μm in diameter were cultured in 50 ml Falcon Flask coated with poly-D-lysine/laminin, and Aβ42 and Aβ40 of the supernatant were measured by EIA method on the second day (
The effect of perampanel administration on Aβ accumulation in the hippocampal dentate gyrus (DG) CA1 and the cerebral cortex (Cx) in the Alzheimer's dementia model mouse (NL-G-F(−/−)) is shown. The X axis indicates the intensity of fluorescence, and the Y axis indicates the fluorescence count. A shows an untreated mouse (control group), and B shows a mouse administered with perampanel (5 mg/kg) from 6 to 15 weeks of age (PER administration group). As shown in
Epilepsy occurs more frequently in AD patients than in the control population (Pascal E 2012), and the incidence of epilepsy increases to 7 to 21% (Amatniek et al., 2006; Hauser et al., 1986; Mendez and Lim, 2003) in sporadic AD patients and 30% in early-onset familial AD (FAD) (Palop and Mucke, 2009; Larner and Doran, 2006). Early latent hippocampal hyperexcitability was detected in AD patients (Lam A D et al., Nat Med 2017). As shown in
The perampanel, which is a non-competitive AMPA receptor antagonist, inhibits the activation of the AMPA receptor of the postsynaptic membrane by glutamic acid, and is indicated for partial seizures (including secondary generalized seizures) like epileptic patients of 12 years old or older, tonic-clonic seizures, and partial seizures (including secondary generalized seizures) like epileptic patients of 4 years old or older, but it seems to be also indicated for epileptic seizures of the elderly and epileptic seizures accompanied by dementia in the future.
Administration of the perampanel to NL(−/−) mice almost completely abolished the epileptiform reactions induced by bicculine (refer to
AMPA Receptor Antagonists Improve Cognitive Function in Dementia Subjects Together with Memantine
NL-G-F(−/−) mice, a dementia model, were administered with memantine (mema), exercise, memantine and exercise, memantine and perampanel, and perampanel alone (5 mg/kg or 10 mg/kg), and subjected to behavioral experiments. As the behavior test, a novel object recognition test and a hippocampus function-dependent fear conditioning test were performed. Memantine is an antagonist of the NMDA receptor, but has distinct properties from other NMDA receptor antagonists (refer to Hokama Y., et al., Neuro Oncology, 2022, noac162). That is, memantine is a drug that works only when glutamic acid is excessively present in the brain. Memantine also has a superior effect on the site of synaptic NMDAR relative to the non-synaptic NMDA receptor (extrasynaptic NMDAR).
As a result, as shown in
The documents cited in this specification are incorporated herein by reference in their entirety.
| Number | Date | Country | Kind |
|---|---|---|---|
| 2021-150271 | Sep 2021 | JP | national |
| 2022-128640 | Aug 2022 | JP | national |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/JP2022/034601 | 9/15/2022 | WO |
