Claims
- 1. A method of converting starch into ethanol comprising the step, growing yeast cells in a culture medium, wherein said yeast cells comprise a genetic construction, said genetic construction comprising a starch degrading enzyme encoding nucleotide sequence operatively linked with the regulatory region of ZZA1, wherein the regulatory region is located 5' to the starch degrading enzyme encoding polynucleotide sequence.
- 2. A method according to claim 1, wherein said starch degrading enzyme is .alpha.-amylase.
- 3. A method according to claim 1, wherein said regulatory region has been modified to delete the sequence GTTTCCTCAAGGCAAGAACTCC (SEQ ID No:3).
- 4. A method according to claim 1, wherein said regulatory region is derived from gene ZZA1.
- 5. A method according to claim 1, wherein said regulatory region comprises the regulatory region of alcohol oxidase gene ZZA1, wherein said genetic construction comprises the non-coding region of the nucleotide sequence of FIG. 9 (SEQ ID. NO.: 1).
RELATED APPLICATION
This patent application is a continuation-in-part of U.S patent application 08/037,618 filed Mar. 5, 1993 abandoned and a continuation-in-part of U.S patent application 08/037,617 filed Mar. 25, 1993, abandoned.
Non-Patent Literature Citations (7)
Entry |
Kumagai, Gene, 94:209-216 (1990). |
Cregg et al., Bio/Technology 5:1305-1308 (1987). |
Cregg et al., Mol. Cell. Biol., 9:1316-1323 (1989). |
Koutz et al., Yeast 5:167-177 (1989). |
Filho et al. Bio/Technology, 4:311-315 (1986). |
Inlow et al. Biotech. & Bioengin., 32:227-234 (1988). |
Cohen et al., Mol. Cell. Biol., 7:2753-2761 (1987). |
Continuation in Parts (1)
|
Number |
Date |
Country |
Parent |
37618 |
Mar 1993 |
|