This application contains sequence data provided on a computer readable diskette and as a paper version. The paper version of the sequence data is identical to the data provided on the diskette.
1. Field of the Invention
The present invention relates generally to the field of plant molecular biology. More specifically the invention relates to nucleic acid fragment encoding plant lipase and uses thereof.
2. Description of Related Art
Lipases (triacylglycerol acylhydrolase, EC 3.1.1.3) belong to the family of hydrolases that act on carboxylic ester bonds. In addition to their natural function of hydrolyzing carboxylic ester bonds, lipases can catalyze esterification, interesterification, and transesterification reactions in non aqueous media. Due to this versatility lipases have a variety of potential applications for industrial uses. Examples of fields where lipases have applications are such as dairy industry, detergents, oleo chemical industry, pharmaceutical and cosmetic industry, medical and environmental applications. Depending on the process, the required characteristics of the lipase enzymes are different. For purposes where for example processing temperatures are high, one would need to have enzyme with high optimal temperature, for another process one may need to have an enzyme having low pH tolerance etc. Moreover, the modern biotechnology has enabled production of industrial enzymes such as lipases cell cultures, whereby the production costs can be dramatically lowered.
GDSL lipases are an important family of lipases. GDSL lipases are widely found in microbes, and a number of bacterial GDSL genes have been cloned and characterized. GDSL lipases are also found in plant species, and several candidates from various plant species such as Arabidopsis thaliana, Rauvolfia serpentina, Medigago sativa, Hevea brasiliensis, Brassica napus, Oryza sativa and Alopecurus myosuroides have been isolated, cloned and characterized.
Due to the large variety of industrial uses where lipase enzymes can be used, there is a clear need to identify and characterize new enzymes and genes coding for them and provide systems for industrial production of the enzymes.
Accordingly, identification and characterization of genes coding for lipase like proteins in plant species tolerant to low temperatures can provide novel enzymes for industrial applications. A plant species extremely tolerant to low temperatures is Deschampsia antarctica Desv. (Poacea). Accordingly, we have studied the gene expression of this vascular plant naturally colonizing Maritime Antarctic Peninsula.
Due to the increased interest in lipases in various fields of industry, there is a clear need for novel lipase enzymes. Especially, there is a need for novel lipase enzymes functional in wide range of temperatures. Moreover, there is a need for a method for economic production of lipase enzymes.
Accordingly, an object of the current invention is to provide a novel recombinant lipase, which is psycrophilic and can therefore stand low temperatures.
Another object of the current invention is to provide a simple and rapid method of producing lipase enzyme in host cell and subsequent purification of recombinant lipase.
An even further object of the current invention is to provide a novel lipase that can be used in waste water cleaning.
A further object of the current invention is to provide a novel lipase to be used as a component in sun screens.
According to a preferred embodiment the lipase enzyme is encoded by a nucleotide sequence essentially according to SEQ ID NO: 1 isolated from Deschampsia antarctica.
In a preferred embodiment, lipase enzyme of the present invention comprises the amino acid sequence essentially according to SEQ ID NO: 2.
Yet another embodiment of the present invention is a chimeric gene comprising an isolated nucleotide sequence encoding lipase like protein of Deschampsia antarctica.
An even further embodiment of the present invention is isolated host cells comprising the chimeric gene. The host cell may be eukaryotic, such as yeast or a plant cell, or it may be prokaryotic such as a bacterial cell. According to one embodiment the host cell comprising the chimeric gene is a Pichia cell.
An even further embodiment of the instant invention is to provide a process for cultivating host cells comprising the chimeric gene and isolating the recombinant enzyme produced in the cells.
Yet another embodiment of the instant invention is to provide a lipase enzyme for purposes of waste water cleaning.
An even further embodiment of the instant invention is to provide a sunscreen comprising the plant lipase of this invention.
A cDNA expression library was obtained by using DNA samples of Deschampsia antarctica. This library enabled identification of one gene which encoded a lipase-like enzyme (triglyceride lipases EC 3.1.1.3). The cDNA gene sequence encoding the lipase of Deschampsia antarctica is according to SEQ ID NO: 1.
This full length gene sequence was further compared with other gene sequences available in a public GeneBank (BLAST). The clone 3F9 showed homology (69% positive) with a putative GDSL lipase/acylhydrolase of Oryza sativa (japonica cultivar-group) having the sequence identified as AAT93907.1. The comparison is shown in
The alignment of lipase 3F9 clone with the putative GDSL lipase/acylhydrolase of Oryza sativa (japonica cultivar-group) gene was conducted by using the Vector NTI 7 software. The amino acid sequence for both lipases showed a 52.5% identity and 63.4% similarity (
A phylogenetic analysis of several plant and bacterial lipases was carried out in order to illustrate the presumed evolutionary relationships among them and to infer their evolutionary history. For this purpose, the lipase 3F9 of Deschampsia antarctica (Da), putative GDSL lipase/acylhydrolase of Oryza sativa (Os), lipase homolog of Arabidopsis thaliana (At), lipase A (CaA) and lipase precursor B (CaB) of Candida antarctica (
In order to assure that Deschampsia antarctica 3F9 protein is novel a further comparison with functional related lipases was conducted by using a GenBank information. The simultaneous alignment of D. antractica lipase 3F9, putative GDSL lipase/acylhydrolase of Oryza sativa, lipase homolog of Arabidopsis thaliana, lipase B precursor and lipase A of Candida antarctica are shown in
The molecular weight of 3F9 lipase of D. antarctica is 10.3 kDa, while the molecular weight of lipase of O. sativa is 11.1 kDa, and that of A. thaliana is 33.3 kDa. The isoelectric point of 3F9 lipase of D. antarctica is 8.99, while that of lipase of O. sativa is 9.26 and the isoelectric point of lipase of A. thaliana is 9.20. Thus, clearly also the biochemical characterization of the instant plant lipase is distinct from the known proteins with similar function. The results from the sequence comparison and the biochemical analysis are summarized in Tables 1 and 2.
Deschampsia antarctica (Da)
Oryza sativa (Os)
Arabidopsis thaliana (At)
Candida antarctica chain A (CaA)
Candida antarctica chain B (CaB)
Deschampsia antarctica (Da)
Orysa sativa (Os)
Arabidopsis thaliana (At)
Candida antarctica chain A (CaA)
Candida antarctica chain B (CaB)
The amino acid sequence of Deschampsia antarctica lipase deduced from DNA sequence is according to SEQ ID NO: 2. The amino acid composition of the lipase protein encoded by DNA sequence is presented in Table 3.
The present invention is now further defined in the following examples. It should be understood that these examples, while indicating preferred embodiments of the invention, are given by way of illustration only. It would be apparent to one skilled in the art that various modifications of the invention in addition to those shown and described herein are within the scope of the invention.
Escherichia coli strain DH5α (Invitrogen) was selected for vector construction and Pichia pastoris strain X-33 (Invitrogen) was used to express the Deschampsia antarctica lipase 3F9. E. coli was grown in low salt LB-Zeocin medium (1% tryptone, 0.5% yeast extract, 0.5% NaCl and 25 μg/ml of zeocin).
Pichia pastoris was grown in YPD medium (1% yeast extract, 2% peptone, 2% dextrose) for general growth and storage and in BMGY medium (1% yeast extract, 2% peptone, 100 mM potassium phosphate, pH 6.0, 1.34% YNB, 4×10−5% biotin, 1% glycerol) or in BMMY medium (1% yeast extract, 2% peptone, 100 mM potassium phosphate, pH 6.0, 1.34% YNB, 4×10−5% biotin, 0.5% methanol) to generate biomass or to induce expression, respectively. Zeocin 100 μg/ml agar plates were used (1% yeast extract, 2% peptone, 2% dextrose, 2% agar, 100 μg/ml zeocin) for selection of the transformants.
The P. pastoris X-33 and pPICZαB, used as fungal host and expression vector were purchased from Invitrogen Corporation.
The Deschampsia antarctica lipase 3F9 gene was isolated by polymerase chain reaction (PCR) amplification using de primers fw3F9 (5′CATGTTCGCCATCAAGTACG) SEQ ID NO:3 and rev3F9 (5′ TCTAGAGATGATGATTTCTTGGAGC) SEQ ID NO:4. This introduced a XbaI of the gene. PCR fragments were purified and DNA fragments were recovered from agarose gels using Ultra Clean 15 DNA purification Kit (Carlsbad, Calif., USA). DNA was purified and manipulated essentially as described by Sambrook et al., 1989. The PCR product was cloned into pGEM-T Easy (Promega) and liberated with the enzymes EcoRI and XbaI and ligated to the vector pPICZaB digested with the same restriction enzymes. This resulted in the expression vector pPICZalphaB-Lipase 3F9 Clon1 (
The resulting plasmid constructs were transformed into E. coli and transformants were selected on low salt LB-Zeocin. The plasmid recombinant DNA was sequenced with 5-AOX1 promoter primer (5′ GACTGGTTCCAATTGACAAGC) SEQ ID NO: 5 which annealed with the pPICZαB sequence. Sequence alignment was performed by BLAST.
Electrocompetent cells of P. pastoris X-33 were prepared according to the supplier's instruction (Invitrogen). Ten micrograms recombinant plasmid linearized with PmeI was mixed with 80 μl electrocompetent cells, and electroporated by means of pulse discharge (1500 V, 25 F, Bio-Rad Gene Pulser) for 5 ms. After pulsing, 1 ml ice-cold 1M sorbitol was immediately added to the cuvette. Then, 200 μl aliquots were spread on YPDS plates (1% yeast extract, 2% peptone, 2% dextrose, 1M sorbitol, 2% agar, 100 μg/ml zeocin), and the plates were incubated at 30° C. to screen for zeocin resistant transformants according to their capacity to grow in the presence of zeocin. Resistant zeocin clones were grown on BMGY medium at 30° C. over night until OD600=2-6 then transferred onto BMMY medium. Methanol was added to the culture medium to a final concentration of 0.5% (v/v) every 24 h to induce the lipase protein expression.
Culture grown in BMGY for 96 hr was transferred into BMMY medium for induction of the inserted gen. Methanol was added to the culture medium to a final concentration of 0.5% (v/v) every 24 h for the following 3 days. The sample was collected by separating the culture medium by filtration and concentration of the culture broth. One aliquot of the sample was taken and lipase activity was measured using the commercial kit (Lipase DC FS (Diagnostic Systems International). The kit is based on the use of a synthetic substrate for lipase, which generates a colored product whose formation is evaluated in thermoregulated spectrophotometer at 580 nm (
Assay to determine the optimum temperature of Deschampsia antarctica cloned lipase was conducted next. Supernatant samples were removed from the induced media to measure the lipase activity. The activity was measured in a thermoregulated spectrophotometer at 580 nm in a temperature range from 10° C. to 60° C. The assays were run for two different induction times, 48 hours and 96 hours (
Lipase enzymes are known to catalyze transesterification reaction resulting to ferulyl or coumaryl-substituted acylglycerols. Such acylglycerols are known to be efficient as sun screen agents.
The lipase enzyme according to the present invention is psycrophilic, i.e. it has low optimal temperature and at ambient temperatures it clearly has a high activity. Based on this characteristic a preferred embodiment of the instant invention is to use the novel lipase enzyme as a compound in sun screen lotion. Other components of the lotion would comprise triglycerides from natural origin, antioxidant compound that could act as photoreceptors and having at least one carboxyl group on its structure and other compound necessary for a spray formulation. Examples of triglycerides are glycerine, coconut oil, olive oil, rapeseed oil among others. The photoreceptor agent could be for example cinnamic acid, ferulic acid, quinic acid, shikimic acid, or the other antioxidants from Deschampsia antarctica. Any of the isolated optical stereoisomer, or derivatives as well as their mixtures, can be used in the composition of the invention. As the psychrophilic lipase is able to react under very mild conditions (
The lipase enzyme according to this disclosure can be used in a method for the continuous treatment to clean wastewater coming from different sources, mainly containing oil, fats waxes or any esterified compounds present during mil processing, soap producing, tannin industry and other related industries in a treatment plant. Such method comprises the steps of: a) providing a mixture comprising active amounts of an enzyme comprising a psycrophilic lipase (immobilized or not); b) immersing said mixture in fresh water for about 1 hour to about 3 hours at water temperature (ranging from 4 to 20° C.) in order to provide an activated mixture; c) mixing a volume of aqueous water waste from said treatment plant with a volume of said enzyme from about 2 hours to about 48 hours at room temperature to produce an acclimated mixture; d) adding a volume of said acclimated mixture to a wastewater treatment tank in said treatment plant and; e) maintaining said mixture and said wastewater in contact at water temperature for one to three days to reduce the amount of undesirable oil, fats and wastes and suspended solids in the treatment plant.
This application is a divisional application of U.S. non provisional application Ser. No. 11/787,383 filed on Apr. 16, 2007.
| Number | Name | Date | Kind |
|---|---|---|---|
| 7485445 | Gidekel et al. | Feb 2009 | B2 |
| Number | Date | Country | |
|---|---|---|---|
| 20090107914 A1 | Apr 2009 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 11787383 | Apr 2007 | US |
| Child | 12317039 | US |