Patent Application
20110307974
The present invention relates to a plant growth promoting protein complex. More specifically, the invention relates to the use of specific proteins from the Anaphase Promoting Complex/Cyclosome for increasing shoot growth rates and/or enhancing cell division rates.
Ubiquitination-mediated proteolysis is a primary mechanism by which the levels of regulatory proteins are controlled. The process of ubiquitination of a substrate involves the activity of a cascade of three enzymes, the ubiquitin-activating enzyme (E1), the ubiquitin-conjugating enzyme (E2), and the ubiquitin-protein ligase (E3). The substrate specificity and regulation of ubiquitination are conferred by the E3 ubiquitin protein ligase, which binds directly to the target protein and is the rate-limiting step in the ubiquitination cascade (reviewed in Hershko and Ciechanover, 1998; and Peters, 2002).
Two structurally related multiprotein E3 ligases, the anaphase-promoting complex/cyclosome (APC/C) and the Skp1/Cullin/F-box protein (SCF) complex drive progression through the eukaryotic cell cycle. The activity of SCF ligases mainly controls the transition from G1/S and G2/M, while APC/C is primarily required for mitotic progression and exit (Morgan, 1999).
APC is one of the most complex molecular machines known to catalyze ubiquitination reactions, as it contains more than a dozen subunits (Yoon et al., 2002; Peters et al., 1996). This complexity is unexpected because many other ubiquitin ligases are only composed of one or a few subunits, meaning that ubiquitin ligase activity does not inevitably depend on multiple subunits. Therefore, it remains puzzling why the APC is composed of so many protein components and what their individual functions are.
APC10 is a subunit of APC/C that contains a Doc 1 (Destruction of Cyclin) domain, which is also found in several other proteins of the ubiquitin-proteasome system. Mutants of APC10 in yeast are known to prevent substrate binding to APC/CCdh1, suggesting that this subunit may play a role in substrate recognition. Passmore et al. (2003) have demonstrated that APC10 contributes to APC substrate recognition independently of coactivator and it implicates that APC10 acts as a potential APC regulatory subunit.
Biochemical analysis of budding-yeast APC shows that APC10/DOC1 increases the processivity of substrate ubiquitination by enhancing the affinity of the APC-substrate complex (Carrol et al., 2005). Importantly, the interaction between. APC and the activators CDH1 and CDC20 is not affected by loss of APC10/DOC1 function, suggesting that APC10/DOC1 promotes substrate binding directly or in concert with other core APC subunits (Au et al., 2002).
The identification of the complete set of genes encoding the APC subunits in Arabidopsis reinforces the evidence that the basic processes controlled by ubiquitin-mediated proteolysis in plants are similar to other eukaryotes (Eloy et al., 2006). However, the results on gene structure and expression unraveled unique characteristics of the plant APC and it indicates the prospect of flexible complexes that may be particularly required for growth responses needed to adapt to changing environmental conditions (Eloy et al., 2006).
Surprisingly, we found that lines overexpressing the APC10 subunit, as well as lines with a loss of function of a Novel Interactor of the APC 10 subunit (SAMBA), showed an increased growth.
A first aspect of the invention is the use of APC10, or a variant thereof, to increase plant growth and/or yield. The use, as indicated here, is the use of the protein and/or the use of a nucleic acid encoding this protein, or the complement thereof. It is including, but not limited to, genomic DNA, cDNA, messenger RNA (including the 5′ and 3′ untranslated regions) and RNAi. “Variants,” as used herein include, but are not limited to, homologues, orthologues and paralogues of SEQ ID NO:1 (APC10 protein) of the incorporated herein Sequence Listing. Homologues of a protein encompass peptides, oligopeptides, polypeptides, proteins and enzymes having amino acid substitutions, deletions and/or insertions relative to the unmodified protein in question and having similar biological and functional activity as the unmodified protein from which they are derived. Orthologues and paralogues encompass evolutionary concepts used to describe the ancestral relationships of genes. Paralogues are genes within the same species that have originated through duplication of an ancestral gene; orthologues are genes from different organisms that have originated through speciation and are also derived from a common ancestral gene. Preferably, the homologue, orthologue or paralogue has a sequence identity at a protein level of at least 50%, 51%, 52%, 53%, 54% or 55%, 56%, 57%, 58%, 59%, preferably 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, more preferably 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, even more preferably 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, and most preferably 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more as measured in a BLASTp (Altschul et al., 1997; Altschul et al., 2005). As a non-limiting example, orthologues of SEQ ID NO:1 are Pt796785 (poplar), Vv00024912001 (vitis), AC187383 (maize) and Os05g50360 (Rice). Increase of plant growth and/or yield is measured by comparing the test plant comprising a gene used according to the invention with the parental, non-transformed plant, grown under the same conditions as control. Preferably, increase of growth is measured as an increase of biomass production. “Yield” refers to a situation where only a part of the plant, preferably an economical important part of the plant, such as the leaves, roots or seeds, is increased in biomass. The term “increase” as used herein means at least a 5%, 6%, 7%, 8%, 9% or 10%, preferably at least a 15% or 20%, more preferably 25%, 30%, 35% or 40% more yield and/or growth in comparison to control plants as defined herein. “Increase of plant growth,” as used herein, is preferably measured as increase of any one or more of leaf biomass, root biomass and seed biomass.
Another aspect of the invention is the use of an APC10 interacting protein, or a variant thereof, or the use of nucleic acid encoding this protein, or the complement thereof to increase plant growth. Indeed, as APC10 is part of a protein complex, its function can be compensated by over- or underexpression of other proteins in the complex. Preferably, the APC10 interacting protein is selected from the list consisting of any one or more of AT2G39090, AT2G20000, AT5G05560, AT3G48150, AT1G06590, AT1G78770, AT4G21530, AT2G04660, AT1G32310, AT2G42260, AT4GA19210, AT3G57860, AT3G16320, AT4G25550, AT5G13840, AT3G48750, AT3G56150 and AT2G06210, or a variant thereof. Even more preferably, the APC10 interacting protein is SAMBA (SEQ ID NO:2), or a variant thereof. “Variants,” as used herein, include, but are not limited to, homologues, orthologues or paralogues of SEQ ID NO:2 (SAMBA protein). Homologues of a protein encompass peptides, oligopeptides, polypeptides, proteins and enzymes having amino acid substitutions, deletions and/or insertions relative to the unmodified protein in question and having similar biological and functional activity as the unmodified protein from which they are derived. Orthologues and paralogues encompass evolutionary concepts used to describe the ancestral relationships of genes. Paralogues are genes within the same species that have originated through duplication of an ancestral gene; orthologues are genes from different organisms that have originated through speciation, and are also derived from a common ancestral gene. Preferably, the homologue, orthologue or paralogue has a sequence identity at a protein level of at least 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, preferably 50%, 51%, 52%, 53%, 54% or 55%, 56%, 57%, 58%, 59%, preferably 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, more preferably 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, even more preferably 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, and most preferably 90% 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more as measured in a BLASTp (Altschul et al., 1997; Altschul et al., 2005). Preferably, the homologue, orthologue or paralogue comprises one or more of the following conserved motifs K(D/E)EA (SEQ ID NO:22) and/or PRS(R/H/C)I (SEQ ID NO:23), even more preferably, the motifs (R/S)K(D/E)EA(M/L/V) and/or F(E/Q/D/G/A)(G/A)PRS(R/H/C)I, most preferably the motive K(D/E)EAXXXLXXXXMXXLXXXVXXLXXXXWXFXXPRSXI (SEQ ID NO:26), where X can be any amino acid. The conserved motifs are shown in
In one preferred embodiment, APC10 is overexpressed. In another preferred embodiment, the expression of SAMBA is repressed or completely eliminated. Overexpression or repression refers to the expression in the modified plant, compared with the non modified parental plant, grown under the same conditions. Methods for overexpressing genes or repressing gene expression are known to the person skilled in the art. Overexpression can be realized by, as a non-limiting example, placing the coding sequence of the gene under control of a strong promoter, such as, but not limited to, the CMV 35 S promoter. Alternatively, overexpression can be realized by increasing the copy number of the gene. Repression of gene expression can be realized, as a non-limiting example, by gene silencing, antisense RNA or by RNAi. Design of RNAi is known to the person skilled in the art. As a non limiting example, RNAi can be designed with Web micro RNA designer (Ossowki et al., 2005-2009). RNAi can be directed against a part of the 5′ untranslated terminal region, against a part of the coding sequence, and/or against the 3′ terminal region of the mRNA. Some non-limiting examples of target sequences are listed in Table 1.
Therefore, another aspect of the invention is the use of RNAi against a nucleic acid encoding SAMBA or a variant thereof, as defined above, to increase plant growth. RNAi will target only a part of the nucleic acid, whereby the target sequence can be situated in the coding sequence, or in the 5′ or 3′ untranslated regions of the nucleic acid encoding SAMBA or variant.
Overexpression or repression of expression of a target gene can be obtained by transfer of a genetic construct, intended for overexpression or repression of expression into a plant. The transfer of foreign genes into the genome of a plant is called transformation. Transformation of plant species is a fairly routine technique known to the person skilled in the art. Advantageously, any of several transformation methods may be used to introduce the gene of interest into a suitable ancestor cell. The methods described for the transformation and regeneration of plants from plant tissues or plant cells may be utilized for transient or for stable transformation. Transformation methods include, but are not limited to, agrobacterium-mediated transformation, the use of liposomes, electroporation, chemicals that increase free DNA uptake, injection of the DNA directly into the plant, particle gun bombardment, transformation using viruses or pollen and microprojection.
Preferably, the plant as used for this invention is selected from the group consisting of Arabidopsis thaliana, Brassicus sp., Glycine max, Medicago truncatula, Vitis vinifera, Populus sp., Solanum sp., Beta vulgaris, Gossypium hirsutum, Avena sativa, Hordeum vulgare, Triticum aestivum, Oryza sativa, Phyllostachys edulis, Miscanthus sp., Panicum virgatum, Zea mays, Saccharum officinarum, Sorghum bicolor and Ricinus communis. In a preferred embodiment, the plant is a crop plant, preferably a monocot or a cereal, even more preferably it is a cereal selected from the group consisting of rice, maize, wheat, barley, millet, rye, sorghum and oats.
Still another aspect of the invention is a transgenic plant, comprising a RNAi against a nucleic acid encoding SAMBA (SEQ ID NO:2) or a variant thereof. A “transgenic plant” as used herein is a plant, comprising a recombinant DNA construct, whereby the recombinant DNA construct might be introduced directly by transformation, or indirectly by inbreeding. RNAi against a nucleic acid against SAMBA means that the RNAi is capable of down-regulating the wild-type expression of SAMBA. Preferably, the transgenic plant is selected from the group consisting of Arabidopsis thaliana, Brassicus sp., Glycine max, Medicago truncatula, Vitis vinifera, Populus sp., Solanum sp., Beta vulgaris, Gossypium hirsutum, Avena sativa, Hordeum vulgare, Triticum aestivum, Oryza sativa, Phyllostachys edulis, Miscanthus sp., Panicum virgatum, Zea mays, Saccharum officinarum, Sorghum bicolor and Ricinus communis. More preferably, the transgenic plant is a crop plant, preferably a monocot or a cereal, even more preferably it is a cereal selected from the group consisting of rice, maize, wheat, barley, millet, rye, sorghum and oats.
Cloning of transgenes encoding tag fusions under control of the constitutive Cauliflower tobacco mosaic virus 35S promoter, transformation of Arabidopsis cell suspension cultures, protein extract preparation, TAP purification, protein precipitation and separation were done as described (Van Leene et al., 2007 and 2008).
The genome version of Arabidopsis thaliana (www.arabidopsis.org) was searched for homolog of the APC10 gene using a BLAST program. A sequence of 579 bp and approximately 21 KDa was identified in the TAIR database. The coding region of APC10 (AT2G18290) was used to design specific primers (Attb1APC10 ggggacaagtttgtacaaaaaagcaggcttcacaatggcgacagagtcatcggaat (SEQ ID NO:27) and Attb2APC 10 ggggaccactttgtacaagaaagctgggtatgttcttcaaacttctcctgctc (SEQ ID NO:28)) to isolate the respective cDNA and it was amplified directly by PCR from tissues of Arabidopsis thaliana ecotype Columbia.
The PCR reaction was performed using the Pfx Kit (Invitrogen) according to the manufacturer's instructions. The PCR fragment, referring to complete cDNA from APC10 gene was introduced into pDONr 201 using the Gateway system (Invitrogen) by attBXattP recombination sites and subsequently recombined into the pK7WG2 vector by attL XattR sites recombination. The sequence was confirmed by sequencing.
The APC10_pK7WG2 construction was used to transform Arabidopsis thaliana by the flower-dip method (Clough and Bent, 1998).
SAMBA knockout plants (seed code: SALK—048833 and SALK—018488) were obtained from the Salk collection (WorldWideWeb//signal.salk.edu/). Twenty plant genotypes of each line were determined by PCR with specific primers for T-DNA insertion element and for SAMBA (LP_atgacgaaacaccgaaaacac (SEQ ID NO:29) and; RP_agttttatggtcggtcacacg (SEQ ID NO:30) for Salk 018488 and LP_ccattgggatcattactgctg (SEQ ID NO:31); RP_aaaggaaacgtgacgattgtg (SEQ ID NO:32) for Salk 048833 and LBb1—3 attttgccgatttcggaac (SEQ ID NO:33) for the left T-DNA border primer).
Among 20 plants, we found two individual homozygous of each line. The presence of T-DNA insertion and absence of the wild-type gene was confirmed by genomic PCR from leaves of 15 days old plants. These plants were selected to produce more seeds and for subsequent analysis. Q-PCR using specific primers (SAMBA_Fwd gctggtctagacgatttcca and SAMBA_Rev-gcttcacttcacctcctttc) for SAMBA was performed to confirm the absence of mRNA of SAMBA.
Arabidopsis plants (ecotype Col-0) were transformed with the APC10_pK7WG2 construction by the floral dip method.(10)
Transgenic lines (APC10OE) were identified by selection in 50 mg/l kanamycin in germination medium and later transferred to soil for optimal seed production, and selection of T3 homozygous plants. The overexpressing lines were confirmed by Q-PCR using specific primers (APC10_Fwd tcatatccgccagatcaaagttt (SEQ ID NO:36) and APC10_Rev aaggttggtgcggaatagga (SEQ ID NO:37)) to confirm the mRNA levels of transgenic plants.
RNA Extraction and cDNA Preparation
Total RNA was extracted from the frozen materials using TRIzol Reagent (Invitrogen). To eliminate the residual genomic DNA present in the preparation, the RNA was treated by RNAse-free DNAse I according to the manufacturer's instructions (Amersham Biosciences) and purification with the RNEASY® Mini kit from Qiagen was performed. Total RNA was then quantified with a spectrophotometer and loaded onto an agarose gel to check its integrity. cDNA was made with “SuperScript III first strand synthesis system” (Invitrogen) with oligo (dT) primer solution on 2 μg RNA template according to the manufacturer's instructions.
After destaining, gel slabs were washed for 1 hour in H2O, polypeptide disulfide bridges were reduced for 40 minutes in 25 mL of 6.66 mM DTT in 50 mM NH4HCO3 and sequentially the thiol groups were alkylated for 30 minutes in 25 mL 55 mM IAM in 50 mM NH4HCO3. After washing the gel slabs three times with water, complete lanes from the protein gels were cut into slices, collected in microtiter plates and treated essentially as described before with minor modifications (Van Leene et al., 2007). Per microtiter plate well, dehydrated gel particles were rehydrated in 20 μL digest buffer containing 250 ng trypsin (M S Gold; Promega, Madison, Wis.), 50 mM NH4HCO3 and 10% CH3CN (v/v) for 30 minutes at 4° C. After adding 10 μL of a buffer containing 50 mM NH4HCO3 and 10% CH3CN (v/v), proteins were digested at 37° C. for 3 hours. The resulting peptides were concentrated and desalted with microcolumn solid phase tips (PerfectPure™ C18 tip, 200 nL bed volume; Eppendorf, Hamburg, Germany) and eluted directly onto a MALDI target plate (Opti-TOFTM384 Well Insert; Applied Biosystems, Foster City, Calif.) using 1.2 μL of 50% CH3CN: 0.1% CF3COOH solution saturated with α-cyano-4-hydroxycinnamic acid and spiked with 20 (mole/μL Glu1 Fibrinopeptide B (Sigma Aldrich), 20 fmole/μL des-Pro2-Bradykinin (Sigma Aldrich), and 20 fmole/μL Adrenocorticotropic Hormone Fragment 18-39 human (Sigma Aldrich).
A MALDI tandem MS instrument (4700 and 4800 Proteomics Analyzer; Applied Biosystems) was used to acquire peptide mass fingerprints and subsequent 1 kV CID fragmentation spectra of selected peptides. Peptide mass spectra and peptide sequence spectra were obtained using the settings essentially as previously described (Van Leene et al., 2007). Each MALDI plate was calibrated according to the manufacturers' specifications. All peptide mass fingerprinting (PMF) spectra were internally calibrated with three internal standards at m/z 963.516 (des-Pro2-Bradykinin), m/z 1570.677 (Glu1-Fibrinopeptide B), and m/z 2465,198 (Adrenocorticotropic Hormone Fragment 18-39) resulting in an average mass accuracy of 5 ppm±10 ppm for each analyzed peptide spot on the analyzed MALDI targets. Using the individual PMF spectra, up to sixteen peptides, exceeding a signal-to-noise ratio of 20 that passed through a mass exclusion filter, were submitted to fragmentation analysis.
PMF spectra and the peptide sequence spectra of each sample were processed using the accompanied software suite (GPS Explorer 3.6, Applied Biosystems) with parameter settings essentially as previously described (Van Leene et al., 2007). Data search files were generated and submitted for protein homology identification against the TAIR 8.0 by using a local database search engine (Mascot 2.1, Matrix Science). Protein homology identifications of the top hit (first rank) with a relative score exceeding 95% probability were retained. Additional positive identifications (second rank and more) were retained when the score exceeded the 98% probability threshold.
Flow-cytometry analysis. The leaves' tissue were chopped with a razorblade in 200-400 μl of buffer (45 mM MgCl2, 30 mM sodium citrate, 20 mM 3-[N-morpholino]-propane-sulfonic acid, pH 7, and 1% Triton X-100), filtered over a 30 μm mesh, and 1 μl of 1 μg/mL of 4,6-diamidino-2-phenylindole (DAPI) was added. The nuclear DNA content distribution was analyzed with a Cyflow ML flowcytometer (Partec).
The leaf measurement and subsequent cell number analysis of SAMBA knockout and wild-type plants was performed on the abaxial epidermis of leaf 1 and 2 blades harvested on days 12 and 15, as described earlier (De Veylder et al., 2001). Plants were sown in quarter sections of round 12-cm Petri dishes filled with 100 mL of 0.5× Murashige and Skoog medium (Duchefa, Haarlem, The Netherlands) and 0.9% plant tissue culture agar. All healthy plants were placed in ethanol overnight to remove chlorophyll, and subsequently cleared and stored in lactic acid for microscopy. The complete kinematics analysis was performed as described earlier (De Veylder et al., 2001) on the abaxial epidermis of leaf 1 and 2 blades harvested daily from days 4 to 25 with APC10OE and control plants.
For the biomass measurement, the vegetative part of a 20-day-old plant was harvested and the fresh weight was measured by weighing about 20 plants of each line and for dry weight, the same plants were placed on petri plates and allowed to dry for one week and weighed again. For the leaf area measurement, leaf series were made from plants grown in vitro for 22 days. Leaves were dissected from the rosettes on the left side, starting from two cotyledons followed from left to right by the 1st, 2nd, 3rd and the subsequent leaves.
For the root analysis, the plants were grown on vertical position on plates with MS medium 1.2% agar during 15 days. After 15 days, the plates were scanned and the pictures were analyzed using image J 1.37 program. For fresh weight measurement, the total root of 25 plants was cut from the shoot and weighed individually and for dry weight, the same plants were placed on petri plates and allowed to dry for one week and weighed again
The seed size measurement was performed by placing the seeds on transparent plastic paper and each line was scanned separately. The images of total seed area were analyzed using image J 1.37 program.
Kinematic analysis was performed as described earlier (De Veylder et al., 2001) on the abaxial epidermis of leaf 1 and 2 blades harvested daily from days 4 to 25.
Seedlings of SAMBA knockout and wild-type. Ecotype Columbia-0 (Col-0) were grown in vitro in half-strength Murashige and Skoog medium (Murashige and Skoog, 1962), supplemented with 1% sucrose under a 16-hour day (110 μmol m-2 s-1) and 8-hour night regime. Before autoclaving, 25 mM Mannitol (Sigma) was added to the agar medium. The treated plants were grown on 25 mM Mannitol plates, while the control plants were grown on the same medium without Mannitol. The plants were grown during 20 days and the pictures were taken and the images were analyzed using Image J 1.37 program.
To assess the function of APC10 during development, Arabidopsis plants expressing higher levels of APC10 mRNA under the control of the cauliflower mosaic virus (CaMV) 35S constitutive promoter were generated. We selected 11 independent homozygous, single locus plants in which the increased expression levels of APC10 was confirmed by QPCR (
Comparative phenotype analyses between APC10 overexpressing lines (APC 10OE) and control lines showed that plants with higher levels of APC 10 caused an increase in the rosette and leaf growth during development (
To know which of the leaves were affected, we determined the area of all leaves from two independent lines from APC10OE and wild-type control. In three-week-old grown in the soil, the area of all leaves was significantly increased in the transgenic plants when compared to wild-type controls (
To investigate the cellular basis of the observed phenotype, we performed kinematics analysis of developing leaves.
The main conclusion is that cell division rates were higher in APC10OE plants during early leaf development when compared with wild-type controls. Though leaf cell organization and cell sizes were similar to those of control plants, cell numbers were significantly increased in mature leaves of APC10OE plants.
To verify if we have significant difference on biomass of transgenic plants compared to wild-type, the fresh and dry weights of shoots were measured in APC10OE and wild-type plants. We observed an increase of biomass in the transgenic plants when compared to wild-type controls (
We analyzed the DNA content in different developmental stages: proliferation (d8; d10 and d12), expansion (d14; d16 and 18), and mature tissues (d20; d22; d24) of leaf cells of the APC10OE plants. We observed a higher proportion of cells with 2C and 4C DNA contents and, conversely, a lower proportion of cells with 8C and 16C DNA contents compared to wild-type plants, showing that in APC10OE plants, the endoreduplication is reduced (
In order to identify the interaction partners of APC10 in vivo, we performed tandem affinity (TAP) purifications on transgenic Arabidopsis cell suspension cultures that expressed under control of the 35ScaMV promoter the APC10 as a protein fused at its N-terminus with the traditional TAP tag developed for yeast (Rigaut et al., 1999) and with the GS tag (Bürckstümmer et al., 2006). Four independent TAP purifications were performed on the cultures with the traditional tag according to Van Leene et al. (2007), and two purifications on the cultures with the GS tag according to Van Leene et al. (2008). Protein extracts were harvested two days after sub-culturing into fresh medium. The affinity-purified proteins were separated on a 4-12% NuPAGE gel and stained with Coomassie Brilliant Blue. Protein bands were cut, in-gel digested with trypsin and subjected to MALDI-TOF/TOF mass spectrometry for protein identification. After subtracting background proteins, identified by control purifications (Van Leene et al., 2007 and 2008), we identified 18 APC10 interacting proteins (Table 2). These can be divided into two groups: 14 proteins were confirmed experimentally and four proteins were identified only in one out of six TAP experiments and which may represent rather weak or transient interactions.
Among the interacting proteins, a novel 100-amino-acid protein (AT1G32310) was identified (Table 2). We selected this protein to analyze in more detail because it showed very specific binding with APC 10 subunit. The expressed protein is an unknown protein similar to unknown protein from Oryza sativa (GB:AAL67597.1).
To better understand the function of this gene, knockout plants from SALK collection were selected and analyzed. The representative scheme of T-DNA insertions on the first exon of SAMBA gene is shown in
The phenotype of the SAMBA knockout was analyzed in detail by measuring the total leaf area of 22-day-old plants grown in vitro. The result showed a significantly increased leaf area compared to wild-type plants (
To investigate the cellular basis of the observed phenotype, we measured and analyzed the area and cell number of the first pair of leaves of day 12 and 15.
Flow cytometry analysis was performed to analyze the impact of reduced expression of the SAMBA gene on the plant DNA content. The SAMBA knockout plants show slight increased levels of 8C DNA content when compared to wild-type plants (
The impact of the SAMBA knockout on root and seed yield was also evaluated. The primary root length was measured 15 days after germination. The data show a significant increase on the length of SAMBA knockout roots compared to wild-type plants (
The analysis of seed also shows an increased seed size. The total seed area of plants, wild-type and SAMBA mutant, was measured. As we can observe, the seed of SAMBA mutants are significantly bigger than wild-type plants (
Wild-type and SAMBA knockout plants were grown on agar plates supplemented with 25 mM Mannitol to evaluate the capacity of SAMBA mutant plants to grow under stress conditions. As shown in
Arabidopsis thaliana
Hordeum vulgare
Oryzae sativa
Brassica napus
Saccharum officinarum
Glycine max
Vinis vinifera
Solanaceum lycopersicum
Tricitum aestivum
Zea mays
| Number | Date | Country | Kind |
|---|---|---|---|
| 08170792.9 | Dec 2008 | EP | regional |
This is a national phase entry under 35 U.S.C. §371 of International Patent Application PCT/EP2009/066419, filed Dec. 4, 2009, published in English as International Patent Publication WO 2010/063833 A2 on Jun. 10, 2010, which claims the benefit under Article 8 of the Patent Cooperation Treaty to European Patent Application Serial No. 08170792.9, filed Dec. 5, 2008.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/EP2009/066419 | 12/4/2009 | WO | 00 | 8/22/2011 |
