Patent Application
20160160254
The disclosure herein relates to plants expressing cell wall degrading enzymes, vectors, nucleic acids, proteins, related methods, and applications thereof.
Hydrolytic enzymes have important industrial and agricultural applications, but their expression and production may be associated with adverse phenotypic effects, depending upon the expression host. In particular, expression of cell wall degrading enzymes, such as cellulases, xylanases, ligninases, esterases, peroxidases, and other hydrolytic enzymes are often associated with detrimental effects on growth, physiological, and agronomic performance when expressed in plants. Some of these enzymes may also be poorly expressed in microbial hosts, due to their hydrolytic activity.
In an aspect, the invention relates to a transgenic plant including a nucleic acid encoding an amino acid sequence with at least 90% identity to a sequence selected from SEQ ID NOS: 44-115.
In an aspect, the invention relates to a transgenic plant including a first nucleic acid that is capable of hybridizing under conditions of moderate stringency to a second nucleic acid consisting of a nucleotide sequence selected from SEQ ID NOS: 116-187 or the complement thereof.
In an aspect, the invention relates to a vector including a first nucleic acid capable of hybridizing under conditions of one of low, moderate or high stringency to a second nucleic acid consisting of the sequence of one of SEQ ID NOS: 116-187.
In an aspect, the invention relates to a vector including a nucleic acid having a sequence with at least 90% identity to a reference sequence selected from SEQ ID NOS: 188-283.
In an aspect, the invention relates to a method of processing plant biomass. The method includes pretreating a plant or part thereof through mixing the plant or part thereof with liquid to form a mixture having a liquid to solid ratio of less than or equal to 15. Pretreating also includes providing conditions to maintain the mixture at a temperature less than or equal to 100° C. The method also includes providing one or more enzyme for modification of at least one component of the plant or part thereof.
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
The following detailed description of the preferred embodiment of the present invention will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the invention, there are shown in the drawings embodiments which are presently preferred. It is understood, however, that the invention is not limited to the precise arrangements and instrumentalities shown. In the drawings:
Certain terminology is used in the following description for convenience only and is not limiting. The words “right,” “left,” “top” and “bottom” designate directions in the drawings or specific examples to which reference is made.
The words “a” and “one,” as used in the claims and in the corresponding portions of the specification, are defined as including one or more of the referenced item unless specifically stated otherwise. The phrase “at least one” followed by a list of two or more items, such as “A, B or C,” means any individual one of A, B or C as well as any combination thereof.
Despite potential detrimental effects of enzymes on the expression host, producing enzymes in plants, microbes, and other organisms can create large economic benefits in the production of fuels, fiber, chemicals, sugars, textiles, pulp, paper, and animal feed. In some cases there are economic benefits to producing enzymes in plants, despite an agronomic or phenotypic effect. In addition, some phenotypic effects may be overcome using a variety of strategies that protect the plant from the enzyme activity. The embodiments herein include but are not limited to these strategies.
Strategies for plant-expressed enzymes may be crop dependent. A specific enzyme may have little or no value or benefits when expressed in one crop, but significant value or benefits when expressed in another crop. That is, the properties of the engineered plant may depend not only on the specific enzyme, but also on the specific plant that expresses the enzyme. For example, the expression of xylanase enzymes in plants can facilitate the hydrolysis of plant cell wall hemicellulose, and plant fiber, into fermentable sugars (for the production of fuels and chemicals) or digestible sugars (for animal feed and meat production). However, specific xylanase enzymes also decrease grain yield and may cause infertility when expressed in corn, preventing the use of that crop as a host for enzyme expression. Despite the negative effects on grain yield and fertility in corn, which may decrease the net economic value of the engineered plant versus the non-engineered plant, expression of the identical xylanases in another crop, such as switchgrass, miscanthus, sugarcane or sorghum, may actually be beneficial because infertility in these crops would prevent the outcrossing of the xylanase gene and commercially relevant amounts of plant propagules could be produced using tissue culture or vegetative propagation. While a decrease in fertility, grain yield, or dry matter biomass in corn might prevent, or decrease the value of, expression of specific xylanase enzymes that would otherwise be valuable in the chemical processing and animal feed industries, expression of the identical enzymes in switchgrass, miscanthus, sorghum, or sugarcane may not only provide the economic value created by the enzyme, but could be beneficial from a regulatory and safety perspective.
Likewise, the value of an enzyme expressed in one tissue of a crop may be different when expressed in a different tissue, or when expressed in the same tissue in a different crop. Different benefits result because specific crop tissues (such as grain, seed, leaves, stalks, roots, flowers, pollen, etc.) may have different values depending upon the crop and the new properties imparted by the expressed enzyme. Specific xylanase and cellulase enzymes have dramatic agronomic and phenotypic effects when expressed constitutively in corn. Constitutive expression of these enzymes, individually or in combination, often results in stunted plants, infertile plants, or plants with lower yields and agronomic performance. However, seed specific expression of specific xylanase and cellulase enzymes may decrease or eliminate any detrimental agronomic effect or yield decrease, while still providing high levels of enzyme. This may be a benefit in corn grain. Producing the same enzymes in switchgrass, miscanthus, forage or sweet sorghum, or sugarcane, where grain yields may be considerably lower on a per acre basis when compared to corn, may lead to a different profile for seed specific expression of a xylanase or cellulase. Embodiments include expression of a CWDE seed specifically in any kind of transgenic plant. Depending upon the application, such as animal feed production, meat or dairy production, poultry production, paper production, or the production of fermentable sugars, where the enzyme containing grain could be mixed with other harvested feedstock (pretreated or unpretreated), this may be a very effective way of providing beneficial doses of enzyme in corn grain or other grains and seeds.
The net economic value of a plant-expressed enzyme may differ, depending upon where the enzyme is designed to localize and accumulate, and where it is targeted. For example, specific xylanase and cellulase enzymes may have dramatic phenotypic and agronomic effects when targeted to the plant cell wall, but little or no effect when maintained intracellularly or targeted to the vacuole. This may create economic benefits by providing an intracellularly contained source of enzyme for applications where it is desired to mix the enzyme with a substrate. In contrast, while the same enzymes could provide value in an admix application such as in animal feed or the processing of pretreated biomass, these enzymes may provide little or no value in a self-processing application where plant cell wall targeting is preferred to generate fermentable or digestible sugars, but problematic because of the resulting phenotypic or agronomic effects.
As described above, an exogenous enzyme can be expressed in a particular plant, plant organ, plant tissue, plant cell, or plant sub-cellular region or compartment. Embodiments herein include expressing an exogenous enzyme in a plant, a region of a plant, a plant organ, a plant tissue, or a sub-cellular plant region or compartment. Embodiments also include a plant including an exogenous enzyme where the exogenous enzyme can be in the whole plant or localized in a region of the plant, in a plant organ, in plant tissues, or in a plant sub-cellular region or compartment. Transgenic plants adapted to or having cytoplasmic accumulation of an exogenous CWDE may be provided. The design of where in the plant and in what plant the exogenous enzyme is expressed can be but is not limited to a design that takes into account the phenotypic, safety, economic, or regulatory issues set forth above.
Vectors for expression of proteins in plants are provided in embodiments herein. The proteins may be enzymes and the enzymes can be but are not limited to cell wall degrading enzymes. A number of plants designed to express specific cell wall degrading enzymes are provided. The plants may have industrial and/or agricultural applications. Methods and materials for making the expression vectors and for making the plants are provided. Processes for which the plants could be used in industrial and agricultural applications are also provided.
Vectors for expressing in planta either a cell wall degrading enzyme (or CWDE) or a intein-modified CWDE variant are provided. In an embodiment, the vector is suitable for transformation of a dicotyledonous plant. In an embodiment, the vector is suitable for transformation of a monocotyledonous plant. The CWDEs from which the CWDE in a vector or plant may be selected from but are not limited to xylanases, cellulases, cellobiohydrolases, glucosidases, xylosidases, arabinofuranosidases, and ferulic acid esterases. In an embodiment, the CWDE encoding sequence is disrupted by the insertion of an intein sequence. The inserted intein sequence may inactivate the function of the corresponding CWDE. In an embodiment, the vector design permits insertion of at least three to four gene expression and/or gene silencing cassettes. Each cassette could include a CWDE or intein-modified CWDE.
In an embodiment, the genetic elements used in a vector herein or in the construction thereof can provide at least one of the following attributes: the ability to select transgenic events after plant transformation, the ability to affect an optimal level of the gene expression in cells or affect desired sub-cellular enzyme targeting. The vectors may contain a selectable marker, which can be but is not limited to a E. coli phosphomannose isomerase (PMI) gene. Other selectable markers that can be included, in addition to or in place of the PMI marker, are those known in the art (such as but not limited to EPSPS, BAR, npt-II, GUS, etc). The vectors may also include one or more promoters. The promoters may be constitutive or global, tissue specific, seed specific, leaf specific, organ specific, sub-cellular region or compartment specific, or developmental stage specific promoters. Preferred promoters include the rice Ubiquitin 3 gene promoter (OsUbi3P) with the first intron (Accession No. AY954394, SEQ ID NO: 1) or rice Actin 1 gene promoter (Accession No. 544221, SEQ ID NO: 2. Other constitutive promoters, such as but not limited to the maize ubiquitin promoter (SEQ ID NO: 3), could also be used and substituted for OsUbi3P or the rice Actin 1 promoter. The Ubiquitin 3 and rice Actin 1 gene promoters are constitutive and global promoters that can be used to provide gene expression in transgenic plants. The glutelin promoter from the rice GluB-4 gene (Accession No. AY427571, SEQ ID NO: 4) with its own signal sequence may also be provided in the vectors. The glutelin promoter is a seed-specific promoter. Other seed specific promoters (such as but not limited to the maize zein Zc2promoter SEQ ID NO: 5) could be provided in the vectors. In order to deliver the enzymes to their corresponding substrates or to places for high level of enzyme accumulation such as vacuoles, various targeting signal sequences can be provided in the vector. Targeting signal sequences that can be provided in a CWDE or vector encoding a CWDE include but are not limited to PR1a (SEQ ID NO: 6, encoded by the nucleic acid sequence of SEQ ID NO: 7), BAASS (SEQ ID NO: 8, encoded by the nucleic acid sequence of SEQ ID NO: 9), and barley aleurain (SEQ ID NO: 10, encoded by the nucleic acid of SEQ ID NO: 11). Other targeting sequences that can be included include but are not limited to the endoplasmic reticulum (ER) retention sequence SEKDEL (SEQ ID NO: 12, encoded by the nucleic acid of SEQ ID NO: 13), and the abridged sequence KDEL (SEQ ID NO: 10, encoded by the nucleic acid of SEQ ID NO: 16). The enzymes may be provided without a targeting sequence. The enzymes may be provided such that they accumulate in the cytoplasm. A transcription terminator may be provided. The efficient transcription terminator sequence from the nopaline synthase gene of Agrobacterium tumefaciens is used in gene expression cassette examples herein.
In an embodiment, a transgenic plant including a nucleic acid encoding a CWDE or a CWDE modified with at least one of a signal sequence or an intein is provided. The nucleic acid sequence encoding the CWDE may encode any CWDE amino acid sequence. The nucleic acid sequence encoding the CWDE modified with at least one of a signal sequence or an intein may encode any CWDE amino acid sequence and at least one of any signal sequence or any intein. The nucleic acid may encode a protein having at least 70, 72, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to a sequence selected from SEQ ID NOS: 44-115. The nucleic acid may encode a protein having at least 70, 72, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to a sequence selected from SEQ ID NOS: 44-45, 49-54, 57-59, 85-86, 94-96, 104-109 and 113-115. The nucleic acid may encode a protein having at least 70, 72, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to a sequence selected from SEQ ID NOS: 47 and 55. The nucleic acid may encode a protein having at least 70, 72, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to a sequence selected from SEQ ID NOS: 46, 48 and 56. The nucleic acid may encode a protein having at least 70, 72, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to a sequence selected from SEQ ID NOS: 60-67, 70 and 75. The nucleic acid may encode a protein at having least 70, 72, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to a sequence selected from SEQ ID NOS: 68-69, 71-74, 76-77 and 112. The nucleic acid may encode a protein having at least 70, 72, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to a sequence selected from SEQ ID NOS: 78-84. The nucleic acid may encode a protein having at least 70, 72, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to a sequence selected from SEQ ID NOS: 97-103. The nucleic acid may encode a protein having at least 70, 72, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to a sequence selected from SEQ ID NOS: 87-93 and 110-111. The nucleic acid may encode a protein having at least 70, 72, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to a sequence selected from SEQ ID NOS: 44, 45, 49 and 54. The nucleic acid may encode a protein having at least 70, 72, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to a sequence selected from SEQ ID NOS: 45, 87, 104-106 and 113. The nucleic acid may encode a protein having at least 70, 72, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to a sequence selected from SEQ ID NOS: 50-53, 57-59, 94-96, 104-109 and 113-115. The nucleic acid may encode a protein having at least 70, 72, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to a sequence selected from SEQ ID NOS: 54-56 and 60-65. Any of the nucleic acids set for the above that encode a protein having less than 100% identity to the cited reference sequence may encode a protein having the same or substantially the same activity as a protein having 100% identity to the cited reference sequence. Activity may be assessed by assays known in the art for any particular protein. Activity may be assessed by a method set forth in an example or portion thereof herein. Substantially the same activity would be known in the art. In an embodiment, substantially the same activity is within 20% of the activity of a protein having 100% identity to the cited reference sequence. In an embodiment, substantially the same activity is within 15% of the activity of a protein having 100% identity to the cited reference sequence. In an embodiment, substantially the same activity is within 10% of the activity of a protein having 100% identity to the cited reference sequence. In an embodiment, substantially the same activity is within 5% of the activity of a protein having 100% identity to the cited reference sequence. In an embodiment, substantially the same activity is within 1% of the activity of a protein having 100% identity to the cited reference sequence. The above mentioned nucleic acids may be provided in embodiments herein alone, as part of another nucleic acid, as part of a vector or as stated above as part of a transgenic plant. Identity can be measured by the Smith-Waterman algorithm (Smith T F, Waterman M S (1981), “Identification of Common Molecular Subsequences,” Journal of Molecular Biology 147: 195-197, which is incorporated by reference in its entirety as if fully set forth). In an embodiment, the transgenic plant may be derived from one of corn, switchgrass, miscanthus, sugarcane or sorghum. The transgenic plant may be made by agrobacterium mediated transformation using a plasmid having a nucleotide sequence as set forth above. The plasmid have a sequence with at least 70, 72, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to a sequence selected from SEQ ID NOS: 188-283. The plasmid consist essentially of a sequence with at least 70, 72, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to a sequence selected from SEQ ID NOS: 188-283. The plasmid consist of a sequence with at least 70, 72, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to a sequence selected from SEQ ID NOS: 188-283.
In an embodiment, a transgenic plant including a nucleic acid hybridizing to a reference nucleic acid encoding a CWDE or a CWDE modified with at least one of a signal sequence or an intein is provided. The reference nucleic acid sequence encoding the CWDE may encode any CWDE amino acid sequence. The reference nucleic acid sequence encoding the CWDE modified with at least one of a signal sequence or an intein may encode any CWDE amino acid sequence and at least one of any signal sequence or any intein. The nucleic acid included in the transgenic plant may be referred to as a first nucleic acid. The first nucleic acid may be capable of hybridizing under conditions of low stringency to a second nucleic acid consisting of a nucleotide sequence selected from SEQ ID NOS: 116-187 or the complement thereof. The first nucleic acid may be capable of hybridizing under conditions of moderate stringency to a second nucleic acid consisting of a nucleotide sequence selected from SEQ ID NOS: 116-187 or the complement thereof. The first nucleic acid may be capable of hybridizing under conditions of high stringency to a second nucleic acid consisting of a nucleotide sequence selected from SEQ ID NOS: 116-187 or the complement thereof. The first nucleic acid may be capable of hybridizing under conditions of low, moderate or high stringency to a second nucleic acid consisting of a nucleotide sequence selected from SEQ ID NOS: 116-117, 121-126, 129-131, 157-158, 166-168, 176-181 and 185-187 or the complement thereof. The first nucleic acid may be capable of hybridizing under conditions of low, moderate or high stringency to a second nucleic acid consisting of a nucleotide sequence selected from SEQ ID NOS: 119 and 127 or the complement thereof. The first nucleic acid may be capable of hybridizing under conditions of low, moderate or high stringency to a second nucleic acid consisting of a nucleotide sequence selected from SEQ ID NOS: 118, 120 and 128 or the complement thereof. The first nucleic acid may be capable of hybridizing under conditions of low, moderate or high stringency to a second nucleic acid consisting of a nucleotide sequence selected from SEQ ID NOS: 132-139, 142 and 147 or the complement thereof. The first nucleic acid may be capable of hybridizing under conditions of low, moderate or high stringency to a second nucleic acid consisting of a nucleotide sequence selected from SEQ ID NOS: 140-141, 143-146, 148-149 and 184 or the complement thereof. The first nucleic acid may be capable of hybridizing under conditions of low, moderate or high stringency to a second nucleic acid consisting of a nucleotide sequence selected from SEQ ID NOS: 150-156 or the complement thereof. The first nucleic acid may be capable of hybridizing under conditions of low, moderate or high stringency to a second nucleic acid consisting of a nucleotide sequence selected from SEQ ID NOS: 169-175 or the complement thereof. The first nucleic acid may be capable of hybridizing under conditions of low, moderate or high stringency to a second nucleic acid consisting of a nucleotide sequence selected from SEQ ID NOS: 159-165 and 182-183 or the complement thereof. The first nucleic acid may be capable of hybridizing under conditions of low, moderate or high stringency to a second nucleic acid consisting of a nucleotide sequence selected from SEQ ID NOS: 116, 117, 121 and 126 or the complement thereof. The first nucleic acid may be capable of hybridizing under conditions of low, moderate or high stringency to a second nucleic acid consisting of a nucleotide sequence selected from SEQ ID NOS: 117, 159, 176-178 and 185 or the complement thereof. The first nucleic acid may be capable of hybridizing under conditions of low, moderate or high stringency to a second nucleic acid consisting of a nucleotide sequence selected from SEQ ID NOS: 122-125, 129-131, 166-168, 176-181 and 185-187 or the complement thereof. The first nucleic acid may be capable of hybridizing under conditions of low, moderate or high stringency to a second nucleic acid consisting of a nucleotide sequence selected from SEQ ID NOS: 126-128 and 132-137 or the complement thereof. Examples of hybridization protocols and methods for optimization of hybridization protocols are described in the following books: Molecular Cloning, T. Maniatis, E. F. Fritsch, and J. Sambrook, Cold Spring Harbor Laboratory, 1982; and, Current Protocols in Molecular Biology, F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, K. Struhl, Volume 1, John Wiley & Sons, 2000, which are incorporated herein by reference as if fully set forth. By way of example, but not limitation, procedures for hybridization conditions of moderate stringency are as follows: filters containing DNA are pretreated for 2-4 h at 68° C. in a solution containing 6×SSC (Amresco, Inc., Solon, Ohio), 0.5% SDS (Amersco, Inc., Solon, Ohio), 5×Denhardt's solution (Amersco, Inc., Solon, Ohio), and 100 μg/mL denatured, salmon sperm DNA (Invitrogen Life Technologies, Inc., Carlsbad, Calif.). Approximately 0.2 mL of pretreatment solution are used per square centimeter of membrane used. Hybridizations are carried out in the same solution with the following modifications: 0.01 M EDTA (Amersco, Inc., Solon, Ohio), 100 μg/ml salmon sperm DNA, and 5-20×106 cpm 32P-labeled or fluorescently labeled probes can be used. Filters are incubated in hybridization mixture for 16-20 h at 68° C. and then washed for 15 minutes at room temperature (within five degrees of 25° C.) in a solution containing 2×SSC and 0.1% SDS, with gentle agitation. The wash solution is replaced with a solution containing 0.1×SSC and 0.5% SDS, and incubated an additional 2 h at 68° C., with gentle agitation. Filters are blotted dry and exposed for development in an imager or by autoradiography. If necessary, filters are washed for a third time and re-exposed for development. By way of example, but not limitation, low stringency refers to hybridizing conditions that employ low temperature for hybridization, for example, temperatures between 37° C. and 60° C. By way of example, but not limitation, high stringency refers to hybridizing conditions as set forth above but with modification to employ high temperatures, for example, hybridization temperatures over 68° C. Any of the nucleic acids set for the above that have less than 100% identity to the cited reference sequence may encode a protein having the same or substantially the same activity as a protein encoded by a nucleic acid sequence having 100% identity to the cited reference sequence. Activity may be assessed by assays known in the art for any particular protein. Activity may be assessed by a method set forth in an example or portion thereof herein. Substantially the same activity would be known in the art. In an embodiment, substantially the same activity is within 20% of the activity of a protein encoded by a nucleic acid sequence having 100% identity to the cited reference sequence. In an embodiment, substantially the same activity is within 15% of the activity of a protein encoded by a nucleic acid sequence having 100% identity to the cited reference sequence. In an embodiment, substantially the same activity is within 10% of the activity of a protein encoded by a nucleic acid sequence having 100% identity to the cited reference sequence. In an embodiment, substantially the same activity is within 5% of the activity of a protein encoded by a nucleic acid sequence having 100% identity to the cited reference sequence. In an embodiment, substantially the same activity is within 1% of the activity of a protein encoded by a nucleic acid sequence having 100% identity to the cited reference sequence. The transgenic plant may be derived from one of corn, switchgrass, miscanthus, sugarcane or sorghum. The transgenic plant may be made by Agrobacterium mediated transformation using a plasmid including any of the above nucleic acids.
In an embodiment, a vector including a nucleic acid encoding a CWDE or a CWDE modified with at least one of a signal sequence or an intein is provided. The nucleic acid sequence encoding the CWDE may encode any CWDE amino acid sequence. The nucleic acid sequence encoding the CWDE modified with at least one of a signal sequence or an intein may encode any CWDE amino acid sequence and at least one of any signal sequence or any intein. The nucleic acid may encode a protein having least 70, 72, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to a sequence selected from SEQ ID NOS: 44-115. The nucleic acid sequence may hybridize under conditions of low stringency to a reference nucleic acid consisting of the sequence of one of SEQ ID NOS: 116-187 or the complement thereof. The nucleic acid sequence may hybridize under conditions of moderate stringency to a reference nucleic acid consisting of the sequence of one of SEQ ID NOS: 116-187 or the complement thereof. The nucleic acid sequence may hybridize under conditions of high stringency to a reference nucleic acid consisting of the sequence of one of SEQ ID NOS: 116-187 or the complement thereof. The vector may include a sequence having 70, 72, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to a sequence selected from SEQ ID NOS: 188-283. The vector may consist essentially of a sequence having 70, 72, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to a sequence selected from SEQ ID NOS: 188-283. The vector may consist of a sequence having 70, 72, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to a sequence selected from SEQ ID NOS: 188-283.
In an embodiment, an isolated nucleic acid, polynucleotide, or oligonucleotide encoding at least a portion of any of the amino acid sequences of SEQ ID NOS: 44-115 can be used as a hybridization probe or primer. In an embodiment, the complement of said isolated nucleic acid, polynucleotide or oligonucleotide may be used as a hybridization probe or primer. In an embodiment, an isolated nucleic acid having a sequence that hybridizes under conditions of low, moderate or high stringency to at least a portion of a nucleic acid having the sequence of any one of SEQ ID NOS: 116-187 and 188-283 or the complement thereof may be used as a hybridization probe or primer. These isolated nucleic acids, polynucleotides, or oligonucleotides are not limited to but may have a length in the range from 10 to 100, 10 to 90, 10 to 80, 10 to 70, 10 to 60, 10 to 50, 10 to 40, 10 to 35, 10 to 30, 10 to 25, 10 to 20 or 10 to 15 nucleotides, or from 20 to 30 nucleotides, or be 25 nucleotides in length. A range of nucleotide sequence lengths recited herein includes every length of nucleotide sequence within the range, endopoints inclusive. The recited length of nucleotides may start at any single position within a reference sequence where enough nucleotides follow the single position to accommodate the recited length. In an embodiment, a hybridization probe or primer is 85 to 100%, 90 to 100%, 91 to 100%, 92 to 100%, 93 to 100%, 94 to 100%, 95 to 100%, 96 to 100%, 97 to 100%, 98 to 100%, 99 to 100%, or 100% complementary to a nucleic acid with the same length as the probe or primer and having a sequence chosen from a length of nucleotides corresponding to the probe or primer length within a nucleic acid encoding one of the proteins of SEQ ID NOS: 44-115 or the complement of said nucleic acid. In an embodiment, a hybridization probe or primer is 85 to 100%, 90 to 100%, 91 to 100%, 92 to 100%, 93 to 100%, 94 to 100%, 95 to 100%, 96 to 100%, 97 to 100%, 98 to 100%, 99 to 100%, or 100% complementary to a nucleic acid with the same length as the probe or primer and having a sequence chosen from a length of nucleotides corresponding to the probe or primer length within a nucleic acid with the sequence of one of SEQ ID NOS: 116-283. In an embodiment, a hybridization probe or primer hybridizes along its length to a corresponding length of a nucleic acid encoding the sequence of one of SEQ ID NOS: 44-115 or the complement said nucleic acid. In an embodiment, a hybridization probe or primer hybridizes along its length to a corresponding length of a nucleic acid having the sequence of one of SEQ ID NOS: 116-187 or the complement thereof. In an embodiment, hybridization can occur under conditions of low stringency. In an embodiment, hybridization can occur under conditions of moderate stringency. In an embodiment, hybridization can occur under conditions of high stringency.
The isolated nucleic acids, polynucleotides, or oligonucleotides of embodiments herein may include natural nucleotides, natural nucleotide analogues, or synthetic nucleotide analogues. Nucleic acids, polynucleotides, or oligonucleotides of embodiments herein may be any kind of nucleic acid including deoxyribonucleic acid (DNA), ribonucleic acid (RNA), or peptide nucleic acid (PNA). The nucleic acid sequences listed herein are listed as DNA sequences but other nucleic acids are contemplated as embodiments herein, including RNA sequences where U replaces T.
Although non-labeled hybridization probes or primers can be used in the embodiments herein, the hybridization probes or primers may be detectably labeled and could be used to detect, sequence, or synthesize nucleic acids. Exemplary labels include, but are not limited to, radionuclides, light-absorbing chemical moieties, dyes, and fluorescent moieties. The label may be a fluorescent moiety, such as 6-carboxyfluorescein (FAM), 6-carboxy-4,7,2′,7′-tetrachlorofluoroscein (TET), rhodamine, JOE (2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein), HEX (hexachloro-6-carboxyfluorescein), or VIC.
In an embodiment, a method of processing plant biomass is provided. The method may include pretreating a plant or part thereof through mixing the plant or part thereof with liquid to form a mixture having a liquid to solid ratio of less than or equal to 15. Pretreating may include providing conditions to maintain the mixture at a temperature less than or equal to 100° C. The method may include providing one or more enzyme. The plant biomass may be or be derived from any plant or part thereof. The plant biomass may be or be derived from any transgenic plant or part thereof described, illustrated or claimed herein. The method may include a plant or part thereof other than any transgenic plant or part thereof described, illustrated or claimed herein, and combining it with any transgenic plant or part thereof described, illustrated or claimed herein. The liquid to solid ratio in the mixture may be a value less than or equal to 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. The liquid to solid ratio may be 8 or less. The liquid to solid ratio may be 8. The step of pretreating may include maintaining the temperature of less than or equal to 100° C. for at least four hours. The step of pretreating may include maintaining the temperature of 40° C. to 90° C. The liquid provided to make the mixture may be any liquid. In an embodiment, the liquid is water. In an embodiment, the liquid includes water, ammonium bisulfite and ammonium carbonate. The ammonium bisulfite may be at any suitable concentration. In an embodiment, the ammonium bisulfite concentration is a value within 8% to 38% (endpoints inclusive) on a wt./wt. basis with the plant or part thereof. The ammonium carbonate may be at any suitable pH. In an embodiment, the ammonium carbonate pH is a pH in the range of 7.6 to 8.5, enpoints inclusive. The ammonium carbonate concentration may be any suitable concentration. In an embodiment, the ammonium carbonate concentration is a value within 4% to 19% (endpoints inclusive) on a wt./wt. basis with the plant or part thereof. The step of providing one or more enzyme may include providing any enzyme suitable for processing plant biomass. In an embodiment, the one or more enzyme includes at least one enzyme capable hydrolyzing lignocellulosic material. In an embodiment, the one or more enzymes include at least one of an endoglucanase, a β-glucosidase, a cellobiohydrolase or a xylanase. In an embodiment, the one or more enzymes include at least one of a xylanase, a cellulase, a cellobiohydrolase, a glucosidase, a xylosidase, an arabinofuronosidase or a ferulic acid esterase. In an embodiment, the method includes a step of providing one or more enzyme where the one or more enzyme is not a xylanase, and then adding a xylanase as an additional step.
Any single embodiment herein may be supplemented with one or more element from any one or more other embodiment herein.
The following non-limiting examples are provided to illustrate particular embodiments. The embodiments throughout may be supplemented with one or more detail from any one or more example below.
Referring to
Referring to
pAG1000 was further modified by removal of EcoRI site (nucleotide position #7) to generate pAG1001 (
Referring to
The pAG2000 vector was further modified in order to develop a cloning vector amenable of accepting GOI expression cassettes while providing enhanced expression of the PMI selectable marker for plant transformation. The optimization of PMI expression included replacement of original junction sequence connecting the OsUbi3 intron with the start PMI gene codon in pAG2000 (shown in SEQ ID NO: 18, below) by a new 9 nt sequence. The original junction sequence is underlined and the start codon is in bold in the version of SEQ ID NO: 18 presented below. The new 9 nt sequence is shown as boxed in the version of SEQ ID NO: 19 presented below. The boxed sequence was validated as the efficacious sequence in providing a high level of transient GUS expression in pRESQ48 by E. Sivamani and R. Qu (2006), which is incorporated herein by reference as if fully set forth. This 9 nt sequence represents the three initial codons of the rice Ubiquitin 3 gene, where the start codon ATG has been modified to ATC in order to eliminate an additional translation initiation site. To achieve this modification, the BglII-XcmI fragment of pAG2000 (nucleotide positions 9726-105) was replaced by the PCR synthesized fragment, which contained the required 9 nt junction sequence and was generated in successive reactions using primers P64/P68, P64/P66, and P64/P67.
ATGCAAAAACTCATTAACTCAGTGCAAAACTATGCCTGGGGCAGCAAAACGGCGTTGACT
Referring to
The sequence of pAG2005 is given in SEQ ID NO: 24, which is set forth below:
Promoters
Vectors were made to include a 2014 bp sequence of rice Ubiquitin 3 gene promoter with the first intron (OsUbi3P, Accession # AY954394, SEQ ID NO: 1, shown below) for constitutive or “global” gene expression. The first intron sequence of OsUbi3P is shown as lower case letters in the presentation of SEQ ID NO: 1 below. Vectors herein can include different or additional promoters. Vectors were made including the rice Actin1 gene promoter with the first gene intron (OsAct1P, Accession No. 544221, SEQ ID NO: 2), which is a constitutive promoter. The rice Actin1 gene promoter may be utilized for PMI gene expression in vectors herein. For example, vectors pAG3000-pAG3003 include the rice Actin1 gene promoter with the first gene intron. Some vectors were made to include the 1474 bp rice Glutelin B-4 gene promoter (OsGluB4P, Accession # AY427571, SEQ ID NO: 4), which may be used for the seed specific gene expression and has been used to express enzymes and intein-modified enzymes.
The rice Ubiquitin 3 gene promoter was cloned from the pRESQ101, as it is described above, while the rice Act1 and GluB-4 gene promoters were synthesized. With rice Act1 gene promoter is fused to PMI selectable marker, up to 23% transformation efficiency was observed in stable transformation of maize using mannose selection medium during plant tissue culture.
Signal Sequences
Signal sequences can be included with a CWDE sequence (with or without further modification; e.g., with an intein) or in a vector to direct enzymes expressed in planta to specific locations within, or external to, the plant cell. In some examples, described below, the tobacco PR1a (amyloplast targeting) and barley alpha amylase BAASS [SEQ ID NO: 8] (cell wall targeting) signal sequences were included in CWDEs or vectors herein. These signal sequences can direct enzymes to their respective targeting locations. In some examples, described below, the barley aleurain HvAleSP (vacuole targeting), rice GluB4 (seed expression) and ER retaining (SEKDEL) signal sequences were included, and these sequences can localize protein to the respective cellular compartments or specific tissues. A goal of such targeting may be achieving high levels of protein accumulation while avoiding potential detrimental effects on plant growth and development. Signal sequences used in examples herein and their corresponding encoding nucleotide sequences are presented below:
Targeting sequences can be modified from their original versions to reflect the codon usage frequencies for optimal gene expression in monocot plants. In an embodiment, the host codon usage frequencies are from maize. Each signal sequence can be synthesized by PCR using specific primers and connected to the 3′ ends of a sequence; for example, either the OsUbi3 or OsGluB4 promoter, using a fusion PCR approach.
Transcription Terminator
A transcription terminator can be included in the vectors herein. In an embodiment, the efficient transcription terminator sequence (NosT) from the nopaline synthase gene of Agrobacterium tumefaciens is used in gene expression cassettes cloned in plant transformation vectors. The sequence is presented below:
This sequence appears twice in pAG2005 (SEQ ID NO: 24). The second appearance at positions 12034 to 12288 follows the second OsUbi3 promoter plus intron sequence and XmaI site, and is followed with an EcoRI restriction site (GAATTC, positions 12310 to 5 of SEQ ID NO: 24). The Nos terminator sequence can be PCR amplified from pNOV2819 as 276 bp fragment. Other transcription terminators known in the art could be substituted and used in place of the Nos terminator. One other terminator that could be used in place of the Nos terminator is the 35S terminator.
Referring to
Connection of Signal Sequence to a Coding Region of Mature Enzyme
A signal sequence—protein of interest junction can be determined experimentally or through models. For this example, the SignalP 3.0 server publically available through the Center for Biological Sequence Analysis of the Technical University of Denmark (http://www.cbs.dtu.dk/index.shtml) was used to predict the best junction between the signal peptide and the wild type P77853 xylanase enzyme. The method utilized in SignalP 3.0 incorporates a prediction of cleavage sites and a signal peptide/non-signal peptide prediction based on a combination of several artificial neural networks and hidden Markov models. The program output provides a confidence score for the cleavage of signal peptide from the mature protein. Three variant junctions were evaluated; a first with a direct connection between BAASS [SEQ ID NO: 8] and P77853 ( . . . GQV QTS . . . ), a second with removal of one amino acid from the carboxy terminus of BAASS ( . . . GQ QTS . . . ), and a third with the removal of one amino acid from the carboxy terminus of BAASS [SEQ ID NO: 8] and removal of one amino acid from the amino terminus of P77853 ( . . . GQ TS . . . ). The variant with the highest score was advanced to molecular cloning. The sequences of BASS, P77853, and the first, second and third junctions are below with the junction underlined:
BAASS from Barley Alpha Amylase (Acc. #X15226) 78 bp
SignalP3.0 Server Prediction: Signal peptide
Most likely cleavage site between pos. 24 and 25: ASG-QV
Signal peptide probability: 1.000
Max cleavage site probability: 0.740 between pos. 24 and 25
SignalP3.0 Server Prediction: Signal peptide
Most likely cleavage site between pos. 24 and 25: ASG-QQ
Signal peptide probability: 1.000
Max cleavage site probability: 0.768 between pos. 24 and 25
SignalP3.0 Server Prediction: Signal peptide
Most likely cleavage site between pos. 24 and 25: ASG-QT
Signal peptide probability: 1.000
Max cleavage site probability: 0.582 between pos. 24 and 25
In this example, the 2nd variant of connection between BAASS [SEQ ID NO:8] and P77853 ( . . . GQ QTS . . . ), was selected for pAG2014 vector development based on the maximum cleavage site probability output results from the ServerP 3.0.
The individual genetic elements for pAG2014 construction were assembled in primary PCR reactions as depicted below. The first PCR reaction (PCR-1) was used to amplify 372 bp of the 3′ end of the rice Ubiquitin 3 gene first intron (shown in low case letters) starting from its own BglII site (underlined). The fragment was linked to the 9nt sequence (presented as Italics capital letters) representing modified three initial codons of the rice Ubiquitin 3 gene (detailed description is provided above), BAASS (shown in capital letters) and 27 nt sequence (boxed) of the 5′ end of the coding region of P77853 mature protein. The second PCR reaction (PCR-2) was performed to amplify the entire coding region of P77853 mature protein fused to the TAG stop codon followed by the AvrII restriction site (underlined).
PCR-1 Product
Agatctgttgtcctgtagttacttatgtcagttttgttattatctgaagatatttttggttgttgcttgttgatgtggtgtgagct
Primers
agatctgttgtcctgtagttacttatgtc
ovb101:
PCR-2 Product
Primers
CCTAGGTCACTGTATCACCAGGTAGTCGGCAT
The subsequent “fusion PCR” approach (Yon and Fried, 1989) was utilized to “stitch” together genetic elements prepared in PCR-1 and PCR-2. This approach generated the expected 1362 bp BglII-AvrII sequence consisting of 261 bp of the 3′ end of rice Ubiquitin 3 gene first intron with its native 3′ end BglII site, 9 nt connecting sequence between the intron and the ATG codon of the 75 bp BAASS signal sequence, and 1011 bp mature P77853 xylanase coding region terminating in TGA stop codon that is flanked by the AvrII restriction site:
3′OsUbi3Pint:BAASS:P77853 as BglII-AvrII
agatctgttgtcctgtagttacttatgtcagttttgttattatctgaagatatttttggttgttgcttgttgatgtggtgtgagctg
CCTAGG
The fusion PCR product was subsequently excised from the gel, gel purified using QIAquick Gel Extraction Kit (Cat. #28706) and ligated to the pPCR-Blunt II TOPO vector. The fusion PCR product was completely sequenced using vector specific and gene specific primers. The sequence verified fusion PCR fragment was released from the pPCR-Blunt II TOPO vector with BglII-AvrII digestion and cloned into pBluescript that was prepared in the following manipulations:
pBSK:OsUbi3P:XmaI:AvrII:NosT:L1 readily accepts BglII-AvrII digested DNA fragments. In this manner, cloning fusion PCR products similar to that described in the above example, would lead to reconstruction of the entire expression cassette for the gene of interest. For example, the 1362 bp BglII-AvrII digested fusion PCR product described above for P77853 was inserted in the BglII-AvrII digested pBSK:OsUbi3P:XmaI:AvrII:NosT:L1 to create the OsUbi3P:BAASS:P77853:NosT expression cassette.
The entire expression cassette OsUbi3P:BAASS:P77853:NosT was further excised as a KpnI-EcoRI fragment using restriction enzymes and cloned into pAG2005 to generate the pAG2014. The pAG2014 vector can be used for expressing the wild type P77853 xylanase in transgenic plants from the rice Ubiquitin 3 gene promoter, and targeting expressed enzyme to the plant cell wall by the barley alpha amylase signal sequence (BAASS). Using the same process, vectors in the following list were generated. The list below also includes pAG1000, 1002, 1003, 1004, 1005, 2000, 2004. The vectors below may be utilized for plant transformation and expression of the transgenes.
Embodiments herein include but are not limited to the gene sequences under the heading “Nucleotide sequence” in Table 1, below, the amino acid sequences under the heading “Protein sequence” in Table 1, plants including the gene sequences in Table 1, vectors including the gene sequences in Table 1, the vectors under the heading “pAG vector” in Table 1, plants including the vectors in Table 1, plants including proteins encoded by the Nucleotide sequences in Table 1 and plants including the Protein sequences in Table 1. For the vectors in Table 1, each entry under the “pAG vector” heading includes a number. The number is added to “pAG” to complete the vector name. For example, the listing “2014” is for the vector pAG2014.
Maize Transformation
Agrobacterium-mediated transformation of immature maize embryos was performed as described in Negrotto et al., (2000) Plant Cell Reports 19: 798-803, which is incorporated herein by reference as if fully set forth. Transformation plasmids and selectable marker genes used for transformation were cloned into a pAG-series vector suitable for monocot transformation as described above. The vectors utilized for this example contained the phosphomannose isomerase (PMI) gene (Negrotto et at (2000) Plant Cell Reports 19: 798-803) as a selectable marker, but other markers could be used in the same capacity.
Transformation Vector and Agrobacterium Strains
Agrobacterium tumefaciens transformation vectors were constructed using standard molecular techniques known in the art, as described above. The plasmids were introduced into Agrobacterium strains LBA4404+pSB1 (Ishida et al. (1996) Nature Biotechnology 14:745-750, which is incorporated herein by reference as if fully set forth).
Overnight cultures of the Agrobacterium strain containing the plasmid were grown for two days on plates with solid YP medium for 2 to 4 days at 28° C. containing 100 mg/L spectinomycin and 10 mg/L tetracycline.
Agrobacterium was re-suspended in LS-inf media supplemented with 100 mM acetosyringone (As) (LSAs medium) (Negrotto et al., (2000) Plant Cell Rep 19: 798-803, which is incorporated herein by reference as if fully set forth) until the Agrobacterium cells were uniformly dispersed in the suspension. The Agrobacterium suspension was then diluted to an OD660 in the range of 0.5 to 0.8 and vortexed for about 15 seconds.
Infection and Co-Cultivation of Maize Immature Embryos
Maize (Zea maize cultivars HiII, A188 or B73) stock plants were grown in a greenhouse under 16 hours of daylight at 28° C. Immature ears were collected 7 to 15 days after pollination and sterilized by immersing in 20% chlorine bleach (available under the registered trademark CHLOROX®) for 15-20 minutes. Sterilized ears were then rinsed thoroughly with sterile water.
Immature zygotic embryos were isolated from the kernels and collected into a sterile eppendorf tube containing liquid LS-inf+100 p1M As (LSAs) media. Embryos were vortexed for 5 seconds and rinsed once with fresh infection medium. Infection media was removed, Agrobacterium solution was added and embryos were vortexed for 30 seconds and allowed to settle with the bacteria for about 5 minutes.
After inoculation, immature embryos were then transferred scutellum side up to LSAs medium and cultured in the dark for two to three days at 22 C.
Recovery, Selection of Transformed Maize Embryogenic Tissue and Plant Regeneration
After co-cultivation, immature embryos were transferred onto LSDc medium supplemented with 200 mg/l of timentine and 1.6 mg/l silver nitrate (Negrotto et al. 2000). The plates were incubated for 5 to 15 days at 28° C. in the dark.
Embryos producing embryogenic callus were transferred to LSD1M0. 5S medium (LSDc with 5 mg/l Dicamba, 10 g/l mannose, 5 g/l sucrose). The cultures were selected on this medium for 6 weeks with 3 week subculture intervals. Surviving cultures were transferred either to LSD1M0.5S medium to be bulked-up or to Reg1 medium (as described in Negrotto et al., 2000). Following culturing in the light (16 hour light/8 hour dark regiment), green tissues were then transferred to Reg2 medium without growth regulators (as described in Negrotto et al., 2000) and incubated for 1-2 weeks. Well-developed seedlings with leaves and roots were transferred to Reg3 medium (as described in Negrotto et al., 2000) and grown in the light.
Leaves were sampled for PCR analysis to identify transgenic plants containing the selectable marker gene according to Negrotto et al. (2000), and gene of interest. PCR positive and rooted plants were rinsed with water to wash off the agar medium, and transplanted to soil and grown in the greenhouse for seeds.
Switchgrass Transformation
Media used in developing the Agrobacterium-mediated transformation protocol, employed to transform switchgrass plants, were prepared using standard methods known to one of ordinary skill in the art. The following media were used in the Examples described herein.
Somatic Embryo Induction Medium (SEI)
SEI medium was prepared using 4.3 g of MS basal salt mixture, B5 vitamins (100 mg of myo-Inositol, 1 mg of nicotinic acid, 1 mg of pyridoxine HCl and 10 mg of thiamine HCl), 30 g sucrose, 5 mg 2,4-D and 10 mg BAP, 1.2 g/l Gelrite (Sigma, St. Louis, Mo., USA). These reagents were mixed in sterile water, which was taken up to a final volume of 1 L. The pH was adjusted to 5.8 prior to autoclaving.
Regeneration Medium
Regeneration medium was prepared using 4.3 g of MS basal salt mixture, MS vitamins (100 mg of myo-Inositol, 1 mg of nicotinic acid, 1 mg of pyridoxine HCl and 10 mg of thiamine HCl), 30 g sucrose, and 1.2 g Gelrite (Sigma, St. Louis, Mo., USA). These reagents were mixed in sterile water and taken up to a final volume of 1 L. The pH was adjusted to 5.8 prior to autoclaving.
Inoculation Medium (SW-1)
SW-1 medium was prepared using 4.3 g MS salts, B5 vitamins (100 mg of myo-Inositol, 1 mg of nicotinic acid, 1 mg of pyridoxine HCl and 10 mg of thiamine HCl), 68.5 g sucrose, 36 g glucose, and 1 g casamino acids. These reagents were mixed in sterile water and taken up to a final volume of 1 L. The pH was adjusted to 5.8 prior to autoclaving.
Co-Cultivation Medium (SW-2)
SW-2 medium was prepared using 4.3 g MS salts, B5 vitamins (100 mg of myo-Inositol, 1 mg of nicotinic acid, 1 mg of pyridoxine HCl and 10 mg of thiamine HCl), 0.7 g L-proline, 10 mg BAP, 5 mg 2,4-D, 0.5 g MES, 20 g sucrose, 10 g glucose and 1.2 g Gelrite. These reagents were mixed in sterile water and taken up to a final volume of 1 L. The pH was adjusted to 5.8 prior to autoclaving.
Resting Medium (SW-3)
SW-3 medium was prepared using 4.3 g MS salts, B5 vitamins (100 mg of myo-Inositol, 1 mg of nicotinic acid, 1 mg of pyridoxine HCl and 10 mg of thiamine HCl), 10 mg BAP, 5 mg 2,4-D, 30 g sucrose and 1.2 g Gelrite. These reagents were mixed in sterile water and taken up to a final volume of 1 L. The pH was adjusted to 5.8 prior to autoclaving.
Selection Medium 1 (S1)
51 medium was prepared using 4.3 g MS salts, B5 vitamins (100 mg of myo-Inositol, 1 mg of nicotinic acid, 1 mg of pyridoxine HCl and 10 mg of thiamine HCl), 10 mg BAP, 5 mg 2,4-D, 5 g sucrose, 10 g mannose and 1.2 g Gelrite. These reagents were mixed in sterile water and taken up to a final volume of 1 L. The pH was adjusted to 5.8 prior to autoclaving. Regeneration medium (R1). R1 medium was prepared using 4.3 g MS salts, B5 vitamins (100 mg of myo-Inositol, 1 mg of nicotinic acid, 1 mg of pyridoxine HCl and 10 mg of thiamine HCl), 30 g sucrose and 1.2 g Gelrite. These reagents were mixed in sterile water and taken up to a final volume of 1 L. The pH was adjusted to 5.8 prior to autoclaving.
Initiation of Embryogenic Callus Cultures
Mature switchgrass seeds (Panicum virgatum, cv. Alamo) were prepared for transformation by removing their seed coat using sand paper. With the seed coat removed, individual seeds were selected for sterilization. Switchgrass seeds were sterilized by immersing in 20% chlorine bleach (available under the registered trademark CHLOROX®) for 5-10 minutes. Sterilized seeds were then rinsed thoroughly with sterile water. Sterile seeds were placed onto somatic embryo induction medium (SEI) and were incubated at 28° C. in the dark for about 3-4 weeks. Resulting embryogenic callus clusters were transferred to fresh SEI medium and cultured for additional 6 weeks with 3 weeks subculture intervals at 28° C. in the dark.
Transformation Vector and Agrobacterium Strains
Agrobacterium tumefaciens transformation vectors were constructed as described above using standard molecular techniques known in the art. The plasmids were introduced into Agrobacterium strains LBA4404+pSB1 (Ishida et al. (1996) Nature Biotechnology 14:745-750).
Overnight cultures of the Agrobacterium strain containing the plasmid were grown for two days on plates with YP medium containing 100 mg/L spectinomycin and 10 mg/L tetracycline.
Preparation of Agrobacterium for Transformation
Agrobacterium culture was initiated weekly from a glycerol stock stored at −80° C., on YP semi-solid medium containing appropriate antibiotics and grown at 28° C. in an incubator.
The Agrobacterium was streaked onto fresh YP medium containing appropriate antibiotics the day before the inoculation and was grown in a 28° C. incubator. For plant transformation use, the Agrobacterium was collected from the plate using a disposable plastic inoculation loop and suspended in liquid inoculation medium, such as SW1, in a sterile 15 ml disposable polypropylene centrifugation tube. Agrobacterium was resuspended in the tube by vortexing for about 3 to 5 minutes until the Agrobacterium cells were uniformly dispersed in the suspension. The Agrobacterium suspension was then diluted to an OD660 in the range of 0.5 to 0.8 and vortexed for about 15 seconds.
Infection and Co-Cultivation of Switchgrass Embryogenic Callus Cultures
The switchgrass type II repetitive somatic embryogenic callus clusters, 2 mm to 3 mm in diameter, were infected with Agrobacterium by mixing the explants with bacterial suspension as prepared above, and vortexed for 30 sec. The mixture was incubated with the prepared explants for about 3 to 15 minutes at room temperature.
Following infection, the Agrobacterium suspension explants were placed on co-cultivation medium (SW-2) in 100×15 mm Petri plates and were incubated for 2 to 3 days at 22° C. in the dark.
Regeneration and Selection of Transgenic Plants
After co-cultivation, the explants were transferred onto recovery medium with antibiotics to kill Agrobacterium or to inhibit Agrobacterium growth, without selection agent, such as recovery medium (SW3) supplemented with 200 mg/L timentin. The plates were incubated for 5 to 15 days at 28° C. in the dark. The explants were then transferred to S1 solid medium (10 g/L mannose and 5 g/l sucrose) supplemented with antibiotics for about 14 to 21 days. The explants were then transferred to fresh S1 medium (10 g/L mannose and 5 g/l sucrose) for about 14 to 21 days. Resistant clones were transferred to embryo differentiation medium R1 (5 g/l mannose and 10 g/l sucrose) and were incubated at 28° C. in the dark for about 2 to 3 weeks.
Differentiating plant tissues were transferred to fresh embryo differentiation medium R1 (5 g/l mannose and 10 g/l sucrose) and were incubated at 26° C. in the light for about 2 to 3 weeks.
Well-developed seedlings with leaves and roots were transferred to rooting medium. Leaves were sampled for PCR analysis to identify transgenic plants containing the selectable marker gene according to Negrotto et al. (2000), and gene of interest. PCR positive and rooted plants were rinsed with water to wash off the agar medium, and transplanted to soil and grown in the greenhouse for seeds.
Sorghum Somatic Embryogenic Culture Transformation
Materials and Methods
Media used in the Agrobacterium-mediated transformation protocol employed to develop transformed sorghum plants were prepared using standard methods known to one of ordinary skill in the art. The following media were used in the Examples described herein.
Somatic Embryo Induction Medium (SGWT-SEI)
4.3 g of MS basal salt mixture, B5 vitamins (100 mg of myo-Inositol, 1 mg of nicotinic acid, 1 mg of pyridoxine HCl and 10 mg of thiamine HCl), 1.2 g KH2PO4, 2.0 g L-proline, 0.9 g L-asparagine, 30 g sucrose, 1.5 mg 2,4-D, and 8 g Agar (Sigma, St. Louis, Mo., USA) were combined in sterile water. The final volume of the mixture was taken up to 1 L using sterile water. The pH was adjusted to 5.8 prior to autoclaving.
Regeneration Medium (SGWT-R)
4.3 g of MS basal salt mixture, B5 vitamins (100 mg of myo-Inositol, 1 mg of nicotinic acid, 1 mg of pyridoxine HCl and 10 mg of thiamine HCl), 1.2 g KH2PO4, 2.0 g L-proline, 0.9 g L-asparagine, 30 g sucrose, 1.0 mg IAA, 0.5 mg kinetin and 2.4 g Gelrite (Sigma, St. Louis, Mo., USA) were combined in sterile water. The final volume of the mixture was taken up to 1 L using sterile water. The pH was adjusted to 5.8 prior to autoclaving.
Inoculation Medium (SGI-1)
4.3 g MS salts, B5 vitamins (100 mg of myo-Inositol, 1 mg of nicotinic acid, 1 mg of pyridoxine HCl and 10 mg of thiamine HCl), 68.5 g sucrose, 36 g glucose, 1.0 g casamino acids, and 1.5 mg 2,4-D were combined in sterile water. The mixture was taken up to a final volume of 1 L using sterile water. The pH was adjusted to 5.2 prior to autoclaving.
Co-Cultivation Medium (SGC-2)
4.3 g of MS basal salt mixture, B5 vitamins (100 mg of myo-Inositol, 1 mg of nicotinic acid, 1 mg of pyridoxine HCl and 10 mg of thiamine HCl), 1.2 g KH2PO4, 2.0 g L-proline, 0.9 g L-asparagine, 20 g sucrose, 10 g glucose, 0.5 g MES, 1.5 mg 2,4-D, 40 mg acetosyringone, and 8 g agar were combined in sterile water. The mixture was taken up to a final volume of 1 L using sterile water. The pH was adjusted to 5.8.
Somatic Embryo Induction Medium (SGCI-3)
4.3 g of MS basal salt mixture, B5 vitamins (100 mg of myo-Inositol, 1 mg of nicotinic acid, 1 mg of pyridoxine HCl and 10 mg of thiamine HCl), 1.2 g KH2PO4, 2.0 g L-proline, 0.9 g L-asparagine, 30 g sucrose, 1.5 mg 2,4-D, and 8 g agar (Sigma, St. Louis, Mo., USA) were combined in sterile water. The mixture was taken up to a final volume of 1 L using sterile water. The pH was adjusted to 5.8. After autoclaving timentin was added to the final concentration of 200 mg/l.
Selection Medium 1 (SGS1-4)
4.3 g of MS basal salt mixture, B5 vitamins (100 mg of myo-Inositol, 1 mg of nicotinic acid, 1 mg of pyridoxine HCl and 10 mg of thiamine HCl), 1.2 g KH2PO4, 2.0 g L-proline, 0.9 g L-asparagine, 5 g sucrose, 10 g mannose, 1.5 mg 2,4-D, and 8 g agar (Sigma, St. Louis, Mo., USA) were combined in sterile water. The mixture was taken up to a final volume of 1 L using sterile water. The pH was adjusted to 5.8. After autoclaving timentin was added to the final concentration of 200 mg/l.
Selection Medium 2 (SGS2-5)
4.3 g of MS basal salt mixture, B5 vitamins (100 mg of myo-Inositol, 1 mg of nicotinic acid, 1 mg of pyridoxine HCl and 10 mg of thiamine HCl), 1.2 g KH2PO4, 2.0 g L-proline, 0.9 g L-asparagine, 5 g sucrose, 9.0 g mannose, 1.5 mg 2,4-D, and 8 g agar (Sigma, St. Louis, Mo., USA) were combined in sterile water. The mixture was taken up to a final volume of 1 L using sterile water. The pH was adjusted to 5.8. After autoclaving timentin was added to the final concentration of 200 mg/l.
Regeneration Medium (SGR1-6)
4.3 g of MS basal salt mixture, B5 vitamins (100 mg of myo-Inositol, 1 mg of nicotinic acid, 1 mg of pyridoxine HCl and 10 mg of thiamine HCl), 1.2 g KH2PO4, 2.0 g L-proline, 0.9 g L-asparagine, 20 g sucrose, 5.0 g mannose, 1.0 mg IAA, 0.5 mg kinetin and 2.4 g Gelrite (Sigma, St. Louis, Mo., USA) were combined in sterile water. The mixture was taken up to a final volume of 1 L using sterile water. After autoclaving timentin was added to the final concentration of 200 mg/l.
Initiation of Somatic Embryogenic Cultures from Immature Zygotic Embryos
Sorghum (Sorghum bicolor (L.) Moench) immature caryopses were sterilized by immersing in 20% chlorine bleach (CHLOROX®) for 20 minutes. Sterilized caryopses were then rinsed thoroughly with sterile water.
Immature embryos were isolated from caryopses and were placed onto somatic embryo induction medium (SGWT-SEI). Plates were incubated at 26 to 28° C. in the dark for about 2 to 4 weeks. The resulting somatic embryogenic clusters were used for transformation experiments or transferred to fresh SEI medium and cultured for additional 3 to 6 weeks with 3 weeks subculture intervals at 28° C. in the dark prior to use in transformation experiments.
Transformation Vector and Agrobacterium Strains
Agrobacterium tumefaciens transformation vectors were constructed as described above using standard molecular techniques known in the art. The plasmids were introduced into Agrobacterium strains LBA4404+pSB1 (Ishida et al. (1996) Nature Biotechnology 14:745-750).
Overnight cultures of the Agrobacterium strain containing the plasmid were grown for two days on plates with YP medium containing 100 mg/L spectinomycin and 10 mg/L tetracycline.
Preparation of Agrobacterium for Transformation
Agrobacterium culture was initiated weekly from glycerol stocks, stored at −80° C., onto YP semi-solid medium containing appropriate antibiotics and grown at 28° C. in an incubator.
The Agrobacterium was streaked onto fresh YP medium containing appropriate antibiotics the day before the inoculation and was grown in a 28° C. incubator. For plant transformation use, the Agrobacterium was collected from the plate using a disposable plastic inoculation loop and suspended in liquid inoculation medium, such as SW1, in a sterile 15 ml disposable polypropylene centrifugation tube. Agrobacterium was resuspended in the tube by vortexing for about 3 to 5 minutes until the Agrobacterium cells were uniformly dispersed in the suspension. The Agrobacterium suspension was then diluted to an OD660 of 0.5 to 0.8 and vortexed for about 15 seconds.
Infection and Co-Cultivation of Sorghum Somatic Embryogenic Cultures
The sorghum somatic embryogenic clusters were infected with Agrobacterium by mixing the explants with bacterial suspension prepared as described above, and vortexed for 30 sec. The mixture was incubated with the prepared explants for about 3 to 15 minutes at room temperature.
Following infection, the Agrobacterium suspension explants were placed on co-cultivation medium (SGC-2) in 100×15 mm Petri plates and were incubated for 2 to 3 days at 22° C. in the dark.
Regeneration and Selection of Transgenic Plants
After co-cultivation, the explants were transferred onto recovery medium with antibiotics to kill Agrobacterium, or to inhibit Agrobacterium growth, without a plant selection agent, such as recovery medium (SGCI-3) supplemented with 200 mg/L timentin. The plates were incubated for 5 to 15 days at 28° C. in the dark.
The explants were then transferred to SGS1-4 solid medium (10 g/L mannose and 5 g/l sucrose) supplemented with antibiotics for about 14 to 21 days.
The explants were then transferred to fresh SGS2-5 medium (10 g/L mannose and 5 g/l sucrose) for about 14 to 21 days.
Resistant clones were transferred to embryo differentiation medium SGR1-6 (5 g/l mannose and 10 g/l sucrose) and were incubated at 28° C. in the dark for about 2 to 3 weeks.
Differentiating plant tissues were transferred to fresh embryo differentiation medium R1 (5 g/l mannose and 10 g/l sucrose) and were incubated at 26° C. in the light for about 2 to 3 weeks.
Well developed seedlings with leaves and roots were transferred to rooting medium.
Leaves were sampled for PCR analysis to identify transgenic plants containing the selectable marker gene according to Negrotto et al. (2000), and gene of interest. PCR positive and rooted plants were rinsed with water to wash off the agar medium, and transplanted to soil and grown in the greenhouse for seeds.
Microbial Production of Enzymes
As part of the analysis of transgenic plants, microbial production can be utilized to generate enzyme standards. Although the microbially produced enzymes may have different glycosylation patterns, or other post-translational modifications, than the protein expressed in plants, the microbial protein is an acceptable standard for generating antibodies, for assay measurements, and for western blots.
Genes encoding enzymes of interest were cloned into expression vectors and transformed into suitable expression hosts. Pichai pastoris expression was performed in YPD media at 30° C. and 300 rpm. Culture supernatants were harvested after three to five days of expression corresponding to the time point of highest enzyme activity per ml of clarified supernatant. The supernatant was concentrated by tangential flow filtration with a 10 kDa MWCO membrane and exhaustively buffered exchanged with appropriate reaction buffer.
The amount of enzyme present in the concentrated culture supernatants was determined by treating a 10 μl sample with PNGaseF (NEB) according to the manufacture's protocol to remove N-linked glycans from the target protein. The sample was serially diluted and 10 μl of each dilution was fractionated by SDS-PAGE and stained with Simply Blue Safe stain (Invitrogen) according to the manufacture's guidelines. The concentration of the sample was designated as the highest dilution factor in which the target protein was still detectable after staining.
Rabbit Antiserum Generation
Antibodies that cross react with specific proteins were generated by New England Peptide. Proteins of interest were expressed in Pichia pastoris. The resulting culture supernatant was concentrated by tangential flow filtration using a 10 kDa MWCO filter (Millipore) and in some case further purified by column chromatography. The sample concentrate was further polished using centricon filtration device with a 10 kDa MWCO (Millipore) then fractionated by SDS-PAGE. The protein band corresponding to the predicted molecular weight of the target protein was excised from the gel using a razor blade and sent to New England Peptide for anti-sera generation. Upon receipt, the specificity of each antiserum was validated by Western Blot, aliquoted and stored at 4° C. or −20° C. Western Blot analysis was performed under standard conditions known in the art.
Xylanase activity was determined using birch wood xylan as a substrate and measuring the production of reducing sugar ends with the Nelson-Somogyi reducing sugar microassay (Green et al. 1989, Adaptation of the Nelson-Somogyi reducing-sugar assay to a microassay using microtiter plates, Anal Biochem. 1989 Nov. 1; 182(2):197-9, which is incorporated by reference herein as if fully set forth). A 2% (w/v) substrate solution was prepared by dissolving birchwood xylan (Sigma) in boiling water. 0.02% azide (final concentration) was added as a preservative. Reagents for the Nelson-Somogyi reducing sugar assay were prepared as previously described (Green et al. 1989). Protein concentrations were determined using the BCA protein assay kit (Thermo Scientific) or represented as a dilution factor as described above.
Assays consisted of 250 μl of 2% birchwood xylan, 250 μl buffer, and varying volumes of xylanase preparation (or xylanase standards used to generate a standard curve) in a total reaction volume of one milliliter. Assays were conducted at 60° C. for 20 minutes then placed on ice to stop the reaction. From each reaction, 50 μl of each reaction were assayed for the presence of reducing sugars using the Nelson-Somogyi reducing sugar assay as previously described. Xylanase activity units were determined from results corresponding to the linear range of the analysis. The specific activity of the enzyme preparations was calculated by the following equation: Specific Activity=(mM reducing ends produced)/(dilution factor concentration).
Referring to
Transgenic plants were assayed to determine the levels of accumulated active enzyme. For these assays, samples of liquid nitrogen frozen leaf tissue were ground in a mortar and pestle and the grindate collected. 10 mg of frozen leaf grindate was distributed into each well of a microtiter. To each well 200 μl of 100 mM buffer was added and the reactions mixed by pipetting. The plates were sealed and placed into a shaking incubator (200 rpm) at 55° C. for 16 hours. Post incubation, each reaction was applied to a Multiscreen HTS filterplate with a 1.2 μm glass fiber filter (Millipore, Billerica Mass.) and filtered by centrifugation at 500×g for 3 minutes. Enzyme activity was assessed by assaying 50 μl of the resulting filtrate using the Nelson-Somogyi reducing sugar assay as previously described. Extracted protein was determined using the BCA protein assay kit (Thermo). Levels of activity were presented as mM reducing sugar ends produced per mg of extracted protein.
Referring to
In order to characterize the enzymatic range of activities of particular xylanases several assays were performed using p-nitrophenol (pNP)-conjugated glycosides. One molar stocks of the substrates were made in dimethylsulfoxide. Reactions consisted of 5 mM (final concentration) substrate, 100 mM buffer in 50 μl and 1-10 μl of enzyme preparation. Reactions were prepared then incubated at 60° C. for one hour. The reactions were stopped and developed upon addition of 100 μl of 0.1M carbonate buffer pH 10.5. Hydrolysis of the substrate, which was indicated by the formation of pNP, was detected as an increase of absorbance at 400 nm.
Polysaccharide endohydrolysis substrates was also determined using AZCL conjugated substrates supplies (Megazyme) and used according to the manufacture's standard protocol. Briefly, 250 μl of a specific buffer was mixed with 100 μl of enzyme preparation and 150 μl of water. The reaction was placed in a water bath incubator set at the desired temperature (usually between 37° C. and 70° C.) for five minutes after which one tablet of either xylazyme AX or cellazyme C was added. The reaction were incubated for 10 minutes then removed from the incubator and stopped with 10 ml of 2% (w/v) Tris Base (Sigma®). Endohydrolysis of the polyscaahride substrate was indicated by the release of soluble blue dye. The amount of released dye was quantified by measuring absorbance of the reaction supernatant at 590 nm. Controls for these reactions include protein extracts from the P. pastoris or E. coli wild type strain and recombinant enzyme producing strain.
Table 1, below, demonstrates the detected activities of several xylanases. As indicated endo-xylanase activity was detected for the P77853, O30700 and P40942 samples. Cellobiohydrolase and β-glucosidase activities were detected in samples contain P40942 indicating that this enzyme is capable of endohydrolysis of xylan and exohydrolysis of cellulose and cellobiose.
P. pastoris
E. coli
Thermal stability of enzymes was assessed by recovery of enzymatic activity after incubation at elevated temperatures. Briefly, preparations of xylanase P77, 030 or 040 were incubated at 4° C., 50° C., 60° C., 70° C. or 80° C. for one hour then assayed using the xylazyme AX substrate as described above. Referring to
The thermal stability of the enzyme is one characteristic that may impact its utility in different applications. For example, in processing lignocellulosic bioimass; e.g., that derived from corn (stover), switchgrass, miscanthus, sorghum, or sugarcane, if the transgenic biomass material is to be treated at 70° C. for one hour, P40942 may be a better enzyme to deliver xylanase activity than O30700 or P77853 because of its increased stability at that temperature. In contrast, if transgenic grain; e.g., from transgenic corn or sorghum, is going to be used in formulating an animal feed ration, where the feed is ground and mixed at a temperature of 50° C., then any of these enzymes may be sufficiently thermal stable. However, these uses of particular enzymes do not preclude other uses of the same particular enzymes.
Various process configurations may be used to process biomass and certain plant tissues. One process configuration is referred to as a macro-scale process, which can be scaled up, and is described directly below. Another process configuration is referred to as a micro-scale process, which can be used for plant evaluation, and is detailed below, following the description of a macro-scale process.
Macro-scale sequential low temperature chemi-mechanical pretreatment (CMPT) and one-stage enzymatic hydrolysis:
Referring to
Biomass Substrate Preparation:
Corn stover was transformed with the noted plasmid containing either a β-glucosidase, endoglucanase, cellobiohydrolase, FAE, or xylanase, or combination of enzymes. The vector used may be any vector encoding a CWDE or derivative thereof, including any one or more of the vectors disclosed herein. In this example, the vector was pAG2015, pAG2042, and pAG2063. The stover was dried in an air-circulator at 37° C. for about 2 weeks. The dried corn stover 1010 was cut to 1.0-1.5 inch long.
Pretreatment:
The cut dried corn stover 1010 was pretreated at step 1020 by using either pure water or a combination of 8%-38% (wt./wt. on corn stover) ammonium bisulfite and 4%-19% (wt./wt. on corn stover) ammonium carbonate (pH 7.6-8.5). The biomass was added to a flask with pretreatment solution at a liquid-to-solid (L/S) ratio of 8. The mixture was shaken at temperatures of 40° C.-90° C. for four to 19 hours. The pretreated material was filtered using VWR grade 415 filter paper, and the material 1025 was collected for further analysis.
Refining:
The pretreated biomass was refined at step 1030 in a blend with DI water at 40° C.-90° C. After blending, the biomass was filtered using VWR grade 415 filter paper. The refined biomass (pulp) that did not pass through was washed with DI water at 40° C.-90° C. DI water. The pulp 1035 was stored at 4° C. for moisture balance and further enzymatic hydrolysis.
Enzymes:
Accellerase™ 1000 enzyme (Genencor International, Rochester, N.Y.), was used. The endoglucanase activity was 2500 CMC U/g (minimum). The beta-glucosidase activity was 400 pNPG U/g (minimum). The appearance was brown liquid. The pH was 4.8-5.2.
Alternatively, a cocktail of enzymes were used, which contained: Endoglucanase (C8546), β-glucosidase (49291), and xylanase (X2753) all purchased from Sigma (St. Louis, Mo.), and a cellobiohydrolase (E-CBHI) that was purchased from Megazyme (Wicklow, Ireland).
Enzymatic Hydrolysis:
The NREL standard protocol (LAP-009) was followed. At step 1040, the pretreated and refined stover was hydrolyzed in 0.1 M sodium citrate (pH 5.0) at a biomass solid content of 6.0% at an enzyme loading of 0.2-0.4 ml per g corn stover to release sugar 1045. The reaction occurred in a 250 mL erhlenmeyer flask at 250 rpm for 0-48 hr period at 45° C.-55° C. Depending upon the enzyme mixture and enzyme expressed in the plant, the pH was varied from 5 to 9. The preferred pH for these enzyme mixtures was usually 5.
Tetracycline or an equivalent antibiotic may optionally be added to the hydrolysis to prevent the growth of any potential microbial contamination.
Analysis of Fermentable Sugars:
The hydrolysate samples were heated at 95° C. for 20 min and then centrifuged at 9,000×g, following which the supernatants were clarified by passage through 0.20 μm PVDF filters (Cat.#: 09-910-13, Fisher Scientific, Pittsburgh, Pa.). Monosaccharide and disaccharide concentrations were determined by high performance liquid chromatography (HPLC), using a Shimadzu LC-20 AD binary pump with LC solutions software (Shimadzu, Kyoto, Japan). Sugar concentrations were determined using an Aminex HPX-87P sugar column (Bio-Rad Laboratories, Hercules, Calif.) operating at 0.6 ml/min and 85° C. with degassed water as the mobile phase. Peak areas for all samples, analyzed with an RI detector (RID LOAD), were integrated and the values were compared to standard curves for quantification.
Results of Macro-Scale Processing
1—Corn Stover from Wild Type AxB Plants.
For corn stover, the theoretical yield of sugar is 33.5% (wt/wt) glucose and 16.3% (wt/wt) xylose.
Pretreatment: conducted as described above with either 8% ammonium bisulfate and 4% ammonium carbonate or 38% ammonium bisulfate, 19% ammonium carbonate at a temperature of 70° C. for 4 hrs.
Enzyme hydrolysis: conducted as described above for 24 or 48 hrs.
The results are presented in Table 2, below. 54.5% (24 hours) and 62.3% (48 hours) glucose recovery yields as well as 20% (24 hours) and 27.5% (48 hours) of xylose recovery yields can be achieved in one-day and two-day enzymatic hydrolysis from diluted chemical pretreatment. The results demonstrate the efficiency of low temperature CMPT on enzymatic hydrolysis.
2—Stover.
Oven-dried, wild type AxB corn stover was tested and compared against a mixture of stover from nine pAG2015 transgenic corn plants (referred to in this example as “2015M”).
Pretreatment: conducted as described above with 16% ammonium bisulfate and 8% ammonium carbonate (pH 7.6) at 70° C. for 4 hrs.
Enzyme hydrolysis: conducted as described above for 0 or 24 hrs.
The results are presented in Table 3, below. Better hydrolysis performance in terms of sugar yields were observed from the pAG2015 transgenic corn plants than wild-type AxB plants.
Referring to
Biomass Substrate Preparation:
Corn stover 1110 from corn transformed with the desired vector containing either a beta-glucosidase, endoglucanase, cellobiohydrolase, FAE, or xylanase, or combination of enzymes was obtained. The stover was dried in an air-circulator at 37° C. for about 2 weeks. After drying, the corn stover was cut to 1.0-1.5 inch long. The stover was milled at step 1120 using UDY mill (Model 014, UDY Corporation, Fort Collins, Co) with a screen of 0.5 mm.
Pretreatment:
The milled corn stover was pretreated at step 1130 by using either pure water or chemicals. The biomass was added to 2-mL tubes with pretreatment solution at a liquid-to-solid ratio of 10. 20 mg of biomass could be utilized. The mixture was shaken at temperature of 40° C.-90° C. for 15-19 hrs. The pre-treated material was subject to enzymatic hydrolysis without inter-stage washing.
Enzymes:
Endoglucanase (C8546), beta-glucosidase (49291), and xylanase (X2753) were all purchased from Sigma® (St. Louis, Mo.). The cellobiohydrolase (E-CBHI) was purchased from Megazyme® (Wicklow, Ireland).
Enzymatic Hydrolysis:
The process is based on the NREL standard protocol (LAP-009).
One-Stage Hydrolysis:
The milled, pretreated stover was suspended at a 2% (w/v) glucan loading in polybuffer (50 mM Na citrate, 20 mM K-phosphate, dibasic, 17 mM arginine, 40 mM glycine, 25 mM EPPS, 20 mM HEPES, 0.02% sodium azide) with pH values ranging from 3.5 to 5.0. The pH used was based on final pH of the suspended pretreated stover. The cocktail enzyme loading was based on experiments using 10 mg stover and are given in Table 4, below. Analysis was done on the biomass without any added enzymes (no-cocktail), and with the cocktail missing the xylanse, endoglucanase, or other enzymes that were expressed in the plant (cocktail minus xylanase or endoglucanase depending on the enzyme expressed in plants), in the hydrolysis. This was done to evaluate the effect of the in planta expressed enzymes on hydrolysis. Samples were hydrolyzed at 40° C. or 50° C. for 48-96 hrs at 200 rpm (1 mL reaction volume).
Tetracycline or an equivalent antibiotic may optionally be added to the hydrolysis to prevent the growth of any potential microbial contamination.
Two-Stage Hydrolysis:
The first-stage enzymatic hydrolysis was named depending on the enzymes expressed in plant (for example, “xylanase hydrolysis” or “glucanase hydrolysis”). The second-stage enzymatic hydrolysis that followed was named “enzyme cocktail hydrolysis.”
For the first-stage, milled, pretreated stover was suspended at a 3% (w/v) glucan loading in polybuffer with pH's ranging from 5.0 to 8.4. The pH used was based on the optimal pH for the plant expressed enzyme. This hydrolysis was conducted at 55° C., 300 rpm for 24-48 hrs.
For the enzyme cocktail hydrolysis, the pH was adjusted to 5.0 using concentrated HCl as needed. Then cocktail enzymes were added to samples as noted in one-stage enzymatic hydrolysis, resulting in samples with no cocktail, the full cocktail, and the cocktail minus xylanase or endo-glucanase. Polybuffer pH 5.0 was added for a final solid content of 2%. Samples were hydrolyzed at 50° C. at 200 rpm for 48-96 hrs.
Tetracycline or an equivalent antibiotic may optionally be added to the hydrolysis to prevent the growth of any potential microbial contamination.
Analysis of Fermentable Sugar:
The hydrolysate samples were incubated at 95° C. for 20 min and then centrifuged at 9,000×g, following which the supernatants were clarified by passage through 0.20 μm PVDF filters. Monosaccharide and disaccharide concentrations were determined by high performance liquid chromatography (HPLC), using a Shimadzu LC-20 AD binary pump with LC solutions software (Shimadzu, Kyoto, Japan). Sugar concentrations were determined using an Aminex HPX-87P sugar column (Bio-Rad Laboratories, Hercules, Calif.) operating at 0.6 ml/min and 85° C. with degassed water as the mobile phase. Peak areas for all samples, analyzed with an RI detector (RID LOAD), were integrated and the values were compared to standard curves for quantification.
Results of Micro-Scale Processing
1—One-Stage Enzymatic Hydrolysis, pAG2015.
Plant stover analyzed: a transgenic corn plant designated 2015.05 (made by transforming corn with pAG2015, which expresses a xylanase) was used to provide stover. Control plant: a transgenic corn plant designated 2004.8.4 (a T1 generation plant, descended from a parent that was made by transforming corn with pAG2004, which does not encode a xylanase enzyme) was used to provide control stover. Theoretical sugar yield: 2015.05: 33.35% glucose, 18.69% xylose; 2004.8.4: 2015.05: 34.68% glucose, 20.6% xylose.
Pretreatment: conducted as described above with 1:19 (v/v) 15% NH4OH, 20% NH4Cl at 40° C. or 60° C. for 15 hrs, 300 rpm.
One-stage enzymatic hydrolysis: As described above with 0.02% sodium azide at 50° C. for 48 hours, 250 rpm.
2—One-Stage Enzymatic Hydrolysis, pAG2063
Plant stover analyzed: transgenic plants designated 2063.13 and 2063.17 (made by transforming corn with pAG2063, which expresses a xylanase) were used to provide stover. Control plant designated 2004.8.4 (a transgenic plant made by transforming corn with pAG2004; no xylanase enzyme expressed) was used to provide control stover.
Pretreatment: conducted as described above with 1:19 (v/v) 15% NH4OH, 20% NH4Cl, at either 40° C. or 60° C. for 15 hrs, 300 rpm.
One-stage enzymatic hydrolysis: conducted as described above with 1.0 mg/ml tetracycline at 50° C. for 48 hours, 250 rpm.
3—Two-Stage Enzymatic Hydrolysis, pAG2014.
Plant stover analyzed: transgenic plant 2015.05 was used to provide stover; and control plant 2004.8.4 was used to provide control stover. As used herein, a T0 plant is the 1st generation; and a T1 plant is the 2nd generation, created from the T0 plant seeds.
Pretreatment: conducted as described with DI water at 55° C. for 16 hrs, 300 rpm.
First-stage enzymatic hydrolysis (Xylanase hydrolysis): conducted as described previously at 55° C., for 24 hrs with 0.02% sodium azide, 250 rpm.
Second-stage hydrolysis (enzyme cocktail hydrolysis): conducted as described at 50° C. using cocktail for 48 hrs.
4—Two-Stage Enzymatic Hydrolysis, pAG2063.
Plant stover analyzed: A transgenic plant designated 2063.17 (made by transforming corn with pAG2063) was used to provide stover. A control plant designated 2004.8.4 (made by transforming core with pAG2004) was used to provide control stover.
Pretreatment: conducted as described with DI water at 55° C. for 16 hrs, 300 rpm.
First-stage enzymatic hydrolysis (Xylanase hydrolysis): conducted as described previously at 55° C., for 24 hrs with 0.02% sodium azide, 250 rpm.
Second-stage hydrolysis (enzyme cocktail hydrolysis): conducted as described at 50° C. using cocktail for 96 hrs.
In
5—One-Stage Enzymatic Hydrolysis, pAG2042.
Plant stover analyzed: Transgenic plants designated 2042.2, 2042.3, and 2042.6 (made by transforming corn with pAG2042) were used to provide stover. Control corn plant 2004.8.4 was used to provide control stover.
Pretreatment: conducted as described above with 0.3 M ammonium bisulfite/0.34 M ammonium carbonate at temperatures of either 40° C. or 60° C. for 19 hrs, 300 rpm.
One-stage enzymatic hydrolysis: conducted as described above with 1.0 mg/ml tetracycline at 50° C. for 48 hours, 250 rpm.
Referring to
Ten milligrams (+1-1 mg) of ground sample was applied to a 1.5 ml microfuge tube. The ground sample was resuspended in 1 ml of 100 mM sodium phosphate buffer containing 40 μg tetracycline and 30 μg of cycloheximide. The reactions were incubated for 64 hours at 60° C. with end-over-end mixing (18 rpm). The reaction supernatant was collected and assayed for the presence of reducing sugars using the Nelson-Somogyi reducing sugar assay. The results from this assay were reported as mM xylose equivalent reducing ends produced/mg stover by comparison to a xylose standard curve.
In general, for each transformation vector, at least 20 events were made. In some case many more (up to 90) transgenic events were made and all events were used to evaluate the effect of the transformation process and gene expression.
Transgenic Plants Constructed Using pAG3000 and pAG3001
Referring to
Transgenic plants expressing pAG3000 and pAG3001 were regenerated as described above. Based on experimental results and following the procedures above, transgenic plants having pAG3000 and pAG3001 were selected at an average rate of 22.6% and 12.3%, respectively in maize. In other species, transformation efficiency (as defined by the number of transgenic plants divided by the number targets for transformation, where no more than one transgenic event can be generated per target) is not easily calculated because target calli are not readily enumerated as discrete targets. The maximum efficiency observed in any single experiment was 28% for pAG3000 and 14% for pAG3001. Based on these data, using the partial eukaryotic translation initiation site consensus sequence provided increased transformation efficiency compared to the complete eukaryotic translation initiation sequence. Although the rice actin 1 promoter is considered a relatively strong constitutive promoter, the transformation efficiencies obtained by linking it to PMI were unknown and it was uncertain how much better they could be improved relative to the CMPS:PMI construct obtained originally. Based on these results, the average transformation selection efficiency using CMPS:PMI was 1.5%, with a maximum of 14%, but efficiencies of 0%, 2%, 3%, 6%, 7%, 13%, and 14% were observed in individual experiments. Ranges in transformation efficiency can be impacted by the quality of the transformation target material, but these averages and ranges help define what could be expected from transformation using these constructs. Based on these results, linking PMI to the rice actin 1 promoter improved PMI transformation efficiency using the procedures described above. Furthermore, using the junction between the rice actin 1 promoter and PMI in pAG3000, improved the average transformation efficiency above the level of improvement when using the junction employed in pAG3001.
As shown in
Referring to
The rice ubiquitin 3 promoter fused to PMI significantly increased transformation efficiencies that were observed relative to CMPS:PMI, using the method described above. Furthermore, the average transformation efficiency was greater than that using pAG3001, and similar to the efficiency observed using pAG3000. Because the maximum efficiencies obtained using pAG2004 and pAG2005 were greater than those obtained using pAG3000, the pAG2004 and pAG2005 selection cassettes were used for further development of transgenic plants, as described above.
The transformation vector pAG2016 was used in transformation to regenerate transgenic plants. This transformation vector was derived from pAG2005 and contains an expression cassette for the production of beta-glucoronidase (GUS). In this expression cassette, GUS is fused to the maize codon optimized PR1a signal peptide, which directs GUS to the apoplast intercellular space. The transformation efficiency of this vector has an average of 16%, and was in the expected range for the PMI selection cassette used.
Referring to
The transformation vectors pAG2014, pAG2015, pAG2020, pAG2025 were used in transformation to regenerate transgenic plants. Transformation vectors pAG2014, pAG2015, and pAG2020 were derived from pAG2005 and each contains an expression cassette for the production of a xylanase (accession number P77853). In pAG2014, the P77853 gene is fused to the barley alpha amylase signal sequence (BAASS; SEQ ID NO: 8) for cell wall targeting. In pAG2015, the P77853 gene is not fused to any signal peptide and therefore should accumulate in the cytoplasm of cells. In pAG2020, P77853 is fused to the PR1a signal peptide for targeting of the enzyme to the apoplast. In contrast, pAG2025 was derived from pAG2012, which uses the rice glutelin GluB-4 promoter and GluB-4 signal sequence to direct seed tissue specific expression of P77853. The average transformation efficiency for pAG2014 was 30%, for pAG2015 it was 34%, for pAG2020 it was 24%, and for pAG2025 it was 10%. All of these efficiencies were within the expected range of transformation efficiency when using the rice ubiquitin 3 promoter and PMI selection cassette.
Activity measurements were made from transgenic events generated using methods described above. The following figures show the results of the activity measurements.
Referring to
Referring to
Referring to
As shown in
The P77853 xylanase is interesting because transgenic maize plants made using pAG2014, pAG2015, pAG2020 and pAG2025 all had normal growth phenotypes, but some had different seed phenotypes. That the plants develop normally is somewhat surprising because xylanase hydrolyzes xylan in the hemicellulose component of plant cell walls
Referring to
Referring to
Referring to
Referring to
The transformation vectors pAG2017, pAG2019, and pAG2027 were used in transformation to regenerate transgenic plants. Transformation vectors pAG2017 and pAG2019 were derived from pAG2005, and each contains an expression cassette for the production of a xylanase (accession number P40942). Vector pAG2027 was derived from pAG2012 and expresses the P40942 xylanase from the GluB-4 promoter, which is expressed predominantly in the seed. In pAG2017, the P40942 xylanase is fused to the PR1a signal peptide for targeting of the enzyme to the apoplast. In pAG2019, the P40942 gene is fused to the barley alpha amylase signal sequence (BAASS; SEQ ID NO: 8) for cell wall targeting. The average transformation efficiency for pAG2017 was 16%, for pAG2019 it was 13%, and for pAG2027 it was 29%.
In contrast to transgenic plants expressing P77853, which were all phenotypically normal except for the above described seed abnormalities, plants expressing the P40942 xylanase were severely stunted, except for those made from pAG2027. Referring to
In addition to the growth phenotype in the pAG2017 plants, the seeds from these plants, or outcrosses of these plants on to AxB non-trangenic plants, also displayed a similar shriveled phenotype as observed in the seeds of transgenic plants made with pAG2014, as well as showing some discoloration of the seeds. Approximately 20 shriveled seeds were collected from the pAG2017 plants and all tested positive for xylanase activity, while plump seeds did not have detectable increases in xylanase activity as determined using the methods described above.
Referring to
Referring to
The transformation vectors pAG2018 and pAG2026 were used in transformation to regenerate transgenic plants. Vector pAG2018 was derived from pAG2005 and contains an expression cassette for the production of a xylanase (accession number O30700), fused to the BAASS [SEQ ID NO: 8] signal sequence. Vector pAG2026 was derived from pAG2012 and expresses the O30700 xylanase from the GluB-4 promoter, which is expressed predominantly in the seed. The average transformation efficiency for pAG2018 was 13% and for pAG2026 it was 18%.
As described above, transgenic plants expressing P77853 were all phenotypically normal except for the above described seed abnormalities. In contrast, referring to
In contrast to transgenic plants made with pAG2018 transgenic plants made with pAG2026, which express O30700 from the rice GlutB promoter, are phenotypically normal with regards to growth. See
The transformation vectors pAG2021, pAG2023, pAG2022, and pAG2024 were used in transformation to regenerate transgenic plants. These vectors were all derived from pAG2005 and contain an expression cassette for the production of an intein-modified xylanase (referred to as P77853m3). In transformation vectors pAG2021 and pAG2022, the intein-modified P77853m3 protein was fused to the PR1a signal peptide, while in pAG2023 and pAG2024, P77853m3 was fused to the BAASS signal peptide [SEQ ID NO: 8]. Vectors pAG2022 and pAG2024 also have a SEKDEL endoplasmic reticulum retention sequence [SEQ ID NO: 12] appended to the P77853m3, whereas pAG2021 and pAG2023 lack the SEKDEL sequence [SEQ ID NO:12]. The average transformation efficiency for pAG2021 was 19%, for pAG2022 it was 21%, for pAG2023 it was 24%, and for pAG2024 it was 38%.
None of the transgenic plants made with pAG2021, pAG2022, pAG2023, and pAG2024 have an abnormal phenotype. See
Referring to
Embodiments herein include but are not limited to the plants described above and/or illustrated in the drawings or parts thereof, vectors encoding any amino acid sequence herein, vectors including any nucleic acid sequence herein, any amino acid sequence herein, any nucleic acid herein, any plant including a vector herein, any plant including a nucleic acid herein, any plant including an amino acid sequence herein, and any method of using any plant, plant part, vector, amino acid sequence or protein sequence herein.
The sequence of pAG2015 is:
The references cited throughout this application, are incorporated for all purposes apparent herein and in the references themselves as if each reference was fully set forth. For the sake of presentation, specific ones of these references are cited at one or more particular location herein. A citation of a reference at a particular location indicates a manner(s) in which the teachings of the reference are incorporated. However, a citation of a reference at a particular location does not limit the manner in which all of the teachings of the cited reference are incorporated for all purposes.
It is understood, therefore, that this invention is not limited to the particular embodiments disclosed, but is intended to cover all modifications which are within the spirit and scope of the invention as defined by the appended claims; the above description; and/or shown in the attached drawings.
This application is a continuation of U.S. application Ser. No. 13/508,280 which was filed on Sep. 20, 2012 as a 35 U.S.C. §371 national phase application of PCT/US10/55746 which was filed on Nov. 5, 2010 and claimed the benefit of U.S. provisional application No. 61/280,635 filed Nov. 6, 2009 and U.S. provisional application No. 61/398,589 filed Jun. 28, 2010. U.S. application Ser. No. 13/508,280 is a continuation-in-part of U.S. application Ser. No. 12/590,444 filed Nov. 6, 2009 and issued on Apr. 16, 2013 as U.S. Pat. No. 8,420,387 All of the above applications are incorporated herein by reference as if fully set forth. The sequence listing electronically filed with this application titled “Sequence Listing,” which was created on Feb. 17, 2016 and had a size of 2,226,296 bytes is incorporated by reference herein as if fully set forth.
| Number | Date | Country | |
|---|---|---|---|
| 61280635 | Nov 2009 | US | |
| 61398589 | Jun 2010 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 13508280 | Sep 2012 | US |
| Child | 15046064 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 12590444 | Nov 2009 | US |
| Child | 13508280 | US |
