Plasmid maintenance system for antigen delivery

Information

  • Patent Grant
  • 8076130
  • Patent Number
    8,076,130
  • Date Filed
    Wednesday, October 4, 2006
    18 years ago
  • Date Issued
    Tuesday, December 13, 2011
    13 years ago
Abstract
The present invention relates generally to a Plasmid Maintenance System for the stabilization of expression plasmids encoding foreign antigens, and methods for making and using the Plasmid Maintenance System. The invention optimizes the maintenance of expression plasmids at two independent levels by: (1) removing sole dependence on balanced lethal maintenance functions; and (2) incorporating at least one plasmid partition function to prevent random segregation of expression plasmids, thereby enhancing their inheritance and stability. The Plasmid Maintenance System may be employed within a plasmid which has been recombinantly engineered to express a variety of expression products.
Description
1. BACKGROUND OF THE INVENTION

1.1 Field of the Invention


The present invention relates generally to expression plasmids stabilized by a Plasmid Maintenance System (as defined herein) capable of expressing a protein or peptide, such as an antigen for use in a live vector vaccine, and methods for making and using the stabilized plasmids. The invention optimizes the maintenance of expression plasmids at two independent levels by: (1) removing sole dependence on catalytic balanced lethal maintenance systems; and (2) incorporating a plasmid partition system to prevent random segregation of expression plasmids, thereby enhancing inheritance and stability.


1.2 Description of Related Art


Set forth below is a discussion of art relevant to the present invention.


1.2.1 Bacterial Live Vector Vaccines


Bacterial live vector vaccines deliver antigens to a host immune system by expressing the antigens from genetic material contained within a bacterial live vector. The genetic material is typically a replicon, such as a plasmid. The antigens may include a wide variety of proteins and/or peptides of bacterial, viral, parasitic or other origin.


Among the bacterial live vectors currently under investigation are attenuated enteric pathogens (e.g., Salmonella typhi, Shigella, Vibrio cholerae), commensals (e.g., Lactobacillus, Streptococcus gordonii) and licensed vaccine strains (e.g., BCG). S. typhi is a particularly attractive strain for human vaccination.


1.2.2 Attenuated Salmonella typhi as a Live Vector Strain



S. typhi is a well-tolerated live vector that can deliver multiple unrelated immunogenic antigens to the human immune system. S. typhi live vectors have been shown to elicit antibodies and a cellular immune response to an expressed antigen. Examples of antigens successfully delivered by S. typhi include the non-toxigenic yet highly immunogenic fragment C of tetanus toxin and the malaria circumsporozoite protein from Plasmodium falciparum.



S. typhi is characterized by enteric routes of infection, a quality which permits oral vaccine delivery. S. typhi also infects monocytes and macrophages and can therefore target antigens to professional APCs.


Expression of an antigen by S. typhi generally requires incorporation of a recombinant plasmid encoding the antigen. Consequently, plasmid stability is a key factor in the development of high quality attenuated S. typhi vaccines with the ability to consistently express foreign antigens.


Attenuated S. typhi vaccine candidates for use in humans should possess at least two well separated and well defined mutations that independently cause attenuation, since the chance of in vivo reversion of such double mutants would be negligible. The attenuated vaccine candidate S. typhi CVD908-htrA possesses such properties. CVD908-htrA contains non-reverting deletion mutations within the aroC and aroD genes. These genes encode enzymes critical in the biosynthetic pathway leading to synthesis of chorismate, the key precursor required for synthesis of the aromatic amino acids phenylalanine, tyrosine, and tryptophan. Chorismate is also required for the synthesis of p-aminobenzoic acid; after its conversion to tetrahydrofolate, p-aminobenzoic acid is converted to the purine nucleotides ATP and GTP. An additional deletion mutation has also been introduced into htrA, which encodes a periplasmic protease involved in the bacterial response to a variety of stresses.


1.2.3 Plasmid Instability


Plasmidless bacterial cells tend to accumulate more rapidly than plasmid-bearing cells. One reason for this increased rate of accumulation is that the transcription and translation of plasmid genes imposes a metabolic burden which slows cell growth and gives plasmidless cells a competitive advantage. Furthermore, foreign plasmid gene products are sometimes toxic to the host cell.


Stable inheritance of plasmids is desirable in the field of attenuated bacterial live vector vaccines to ensure successful continued antigen production, as well as in commercial bioreactor operations in order to prevent bioreactor takeover by plasmidless cells.


Stable inheritance of a plasmid generally requires that: (1) the plasmid must replicate once each generation, (2) copy number deviations must be rapidly corrected before cell division, and (3) upon cell division, the products of plasmid replication must be distributed to both daughter cells.


Although chromosomal integration of foreign genes increases the stability of such sequences, the genetic manipulations involved can be difficult, and the drop in copy number of the heterologous gene often results in production of insufficient levels of heterologous antigen to ensure an optimal immune response. Introduction of heterologous genes onto multicopy plasmids maintained within a live vector strain is a natural solution to the copy number problem; genetic manipulation of such plasmids for controlled expression of such heterologous genes is straightforward. However, resulting plasmids can become unstable in vivo, resulting in loss of these foreign genes.


1.2.4 Plasmid Stabilization Systems


In nature bacterial plasmids are often stably maintained, even though usually present at very low copy numbers. Stable inheritance of naturally occurring lower copy number plasmids can depend on the presence of certain genetic systems which actively prevent the appearance of plasmid-free progeny. A recent review of plasmid maintenance systems can be found in Jensen et al. Molecular Microbiol. 17:205-210, 1995 (incorporated herein by reference).


1.2.5 Antibiotic Resistance


One means for maintaining plasmids is to provide an antibiotic resistance gene on the plasmid and to grow the cells in antibiotic-enriched media. However, this method is subject to a number of difficulties. The antibiotic resistance approach is expensive, requiring the use of costly antibiotics and, perhaps more importantly, the use of antibiotics in conjunction with in vivo administration of vaccine vectors is currently discouraged by the U.S. Food and Drug Administration.


In large-scale production applications, the use of antibiotics may impose other limitations. With respect to commercial bioreactors, antibiotic resistance mechanisms can degrade the antibiotic and permit a substantial population of plasmidless cells to persist in the culture. Such plasmidless cells are unproductive and decrease the output of the bioreactor.


There is therefore a need in the art for a plasmid maintenance system specifically designed for use in bacterial live vector vaccines which does not rely on antibiotic resistance, and preferably which is also useful in commercial bioreactor applications.


1.2.6 Segregational Plasmid Maintenance Functions


Stable lower copy number plasmids typically employ a partitioning function that actively distributes plasmid copies between daughter cells. Exemplary partitioning functions include, without limitation, systems of pSC101, the F factor, the P1 prophage, and IncFII drug resistance plasmids. Such functions are referred to herein as “SEG” functions


1.2.7 Post-Segregational Killing (PSK) Functions


Naturally occurring PSK plasmid maintenance functions typically employ a two component toxin-antitoxin system and generally operate as follows: The plasmid encodes both a toxin and an antitoxin. The antitoxins are less stable than the toxins, which tend to be quite stable. In a plasmidless daughter cell, the toxins and anti-toxins are no longer being produced; however, the less stable antitoxins quickly degrade, thereby freeing the toxin to kill the cell.


The toxins are generally small proteins and the antitoxins are either small proteins (proteic systems such as phd-doc) or antisense RNAs which bind to the toxin-encoding mRNAs preventing their synthesis (antisense systems such as hok-sok).


Balanced lethal systems discussed below in Section 1.2.7.3 are an example of an artificial PSK function.


1.2.7.1 Proteic Maintenance System: The phd-doc System


In proteic PSK functions, both the toxin and antitoxin are synthesized from operons in which the gene encoding the antitoxin is upstream of the gene encoding the toxin. These operons autoregulate transcription levels, and synthesis of the encoded proteins is translationally coupled. The antitoxin is generally synthesized in excess to ensure that toxin action is blocked. The unstable antitoxins are constantly degraded by host-encoded proteases, requiring constant synthesis of antitoxin to protect the cell. Upon loss of the plasmid, antitoxins are no longer produced, and the existing antitoxins rapidly degrade, permitting the toxin to kill the host cell.


The phd-doc system is an example of a proteic PSK function. The phd-doc system occurs naturally within the temperate bacteriophage P1, which lysogenizes Escherichia coli, as an ˜100 kb plasmid. This maintenance locus encodes two small proteins: the toxic 126 amino acid Doc protein causes death on curing of the plasmid by an unknown mechanism, and the 73 amino acid Phd antitoxin prevents host death, presumably by binding to and blocking the action of Doc.


Phd and Doc are encoded by a single transcript in which the ATG start codon of the downstream doc gene overlaps by one base the TGA stop codon of the upstream phd gene. Expression of these two proteins is therefore translationally coupled, with Phd synthesis exceeding synthesis of the toxic Doc protein.


In addition, transcription of this operon is autoregulated at the level of transcription through the binding of a Phd-Doc protein complex to a site which blocks access of RNA polymerase to the promoter of the operon as concentrations of both proteins reach a critical level. Although Doc appears to be relatively resistant to proteolytic attack, Phd is highly susceptible to cleavage. The PSK mechanism of a plasmid-encoded phd-doc locus is therefore activated when bacteria spontaneously lose this resident plasmid, leading to degradation of the Phd antitoxin and subsequent activation of the Doc toxin which causes cell death.


1.2.7.2 Antisense Maintenance System: The hok-sok System


In antisense maintenance systems, the antitoxins are antisense RNAs that inhibit translation of toxin-encoding mRNAs. Like the antitoxin peptides, the antisense RNAs are less stable than the toxin-encoding mRNA. Loss of the plasmid permits existing antitoxins to degrade, thereby permitting synthesis of the toxin which kills the host cell.


An example of an antisense maintenance system is the hok-sok system, encoded by the parB locus of plasmid R1. The system is comprised of three genes: hok, sok and mok.


Hok is a membrane-associated protein which irreversibly damages the cell membrane, killing host cells. Expression of Hok from hok mRNA leads to a loss of cell membrane potential, arrest of respiration, changes in cell morphology, and cell death.


The sok gene encodes a trans-acting RNA which blocks translation of hok mRNA, thereby preventing Hok killing of host cells. The sok RNA is less stable than hok mRNA and is expressed from a relatively weak promoter. (Gerdes et al. Annu. Rev. Genet, 31:1-31, 1997) incorporated herein. The mechanism by which sok RNA blocks translation of Hok in plasmid-containing cells became apparent only after the identification of mok (modulation of killing), a third gene in the parB locus. The mok open reading frame overlaps with hok, and is necessary for expression and regulation of hok translation.


The sok antisense RNA forms a duplex with the 5′ end of the mok-hok message rendering the mok ribosome binding site inaccessible to ribosomes and promoting RNase III cleavage and degradation of the mRNA. In the absence of mok translation, hok is not expressed from intact message, even though its own ribosome binding site is not directly obscured by sok RNA.


When a plasmid-free cell is formed, the unstable sok RNA decays much more rapidly than the stable mok-hok message. When the protection afforded by sok is lost, Mok and Hok are translated and the cell dies.


A limitation of the hok-sok system is that a significant number of plasmidless cells can arise when the hok-sok system is inactivated by mutations within the Hok open reading frame.


1.2.7.3 Balanced Lethal Systems


In a balanced-lethal system (a PSK function), a chromosomal gene encoding an essential structural protein or enzyme is deleted from the bacterial chromosome or is mutated such that the gene can no longer operate. The removed or damaged gene is then replaced by a plasmid comprising a fully operating gene. Loss of the plasmid results in an insufficiency of the essential protein and the death of the plasmidless cell.


A balanced-lethal system has been successfully employed in S. typhimurium based on expression of the asd gene encoding aspartate β.-semialdehyde dehydrogenase (Asd). Asd is a critical enzyme involved in the synthesis of L-aspartic-β-semialdehyde, which is a precursor essential for the synthesis of the amino acids L-threonine (and L-isoleucine), L-methionine, and L-lysine, as well as diaminopimelic acid, a key structural component essential to the formation of the cell wall in Gram-negative bacteria. Loss of plasmids encoding Asd would be lethal for any bacterium incapable of synthesizing Asd from the chromosome, and would result in lysis of the bacterium due to an inability to correctly assemble the peptidoglycan layer of its cell wall.


The asd system (a PSK function) has been successfully employed in attenuated S. typhimurium-based live vector strains for immunization of mice with a variety of procaryotic and eucaryotic antigens, including such diverse antigens as detoxified tetanus toxin fragment C and the LT enterotoxin, synthetic hepatitis B viral peptides, and gamete-specific antigens such as the human sperm antigen SP10.


Murine mucosal immunization with these live vector strains has elicited significant immune responses involving serum IgG and secretory IgA responses at mucosal surfaces.


The asd system has recently been introduced into attenuated Salmonella typhi vaccine strains in an attempt to increase the stability of plasmids expressing synthetic hepatitis B viral peptides. However, when volunteers were immunized with these live vector strains, no immune response to the foreign antigen was detected.


In fact, to date, very few reports have documented an immune response to plasmid-based expression of a foreign antigen from stabilized plasmids after human vaccination with an attenuated S. typhi live vector. In one report, the vaccine strain Ty21a was made auxotrophic for thymine by selecting in the presence of trimethoprim for an undefined mutation in the thyA gene, encoding thymidylate synthetase.


Although in some cases failure of live vector strains may have resulted from over-attenuation of the strain itself, it appears probable that current killing systems for plasmids suffer from additional limitations. In those situations where the chromosomal copy of the gene has been inactivated, rather than removed, may allow for restoration of the chromosomal copy via homologous recombination with the plasmid-borne gene copy if the bacterial strain utilized is recombination-proficient.


Balanced-lethal systems based on catalytic enzyme production are subject to a number of important deficiencies. In particular, since complementation of the chromosomal gene deletion requires only a single gene copy, it is inherently difficult to maintain more than a few copies of an expression plasmid. The plasmidless host strain must be grown on special media to chemically complement the existing metabolic deficiency.


Moreover, plasmidless cells may also benefit from “cross-feeding” effects when a diffusible growth factor is growth limiting.


There is therefore a need in the art for a Plasmid Maintenance System which is not solely reliant on a balanced lethal system, particularly for use in bacterial live vector vaccines.


2. SUMMARY OF THE INVENTION

The present invention relates generally to a stabilized expression plasmid comprising (1) a Plasmid Maintenance System and (2) a nucleotide sequence encoding a heterologous protein or peptide, such as a foreign antigen, and to methods for making and using such stabilized expression plasmids. The Plasmid Maintenance System of the present invention optimizes viability by using stabilized lower copy number expression plasmids capable of expressing high levels of heterologous antigen. Preferably expression of the heterologous antigen is in response to an environmental signal encountered in vivo after the vaccine organisms have reached an appropriate ecological niche.


The present invention also generally relates to bacterial live vector vaccines, comprising bacteria tranfected with a stabilized expression plasmid of the present invention, and methods of making and using bacterial live vector vaccines.


In a particular aspect, the stabilized expression plasmid is employed in a Salmonella typhi live vector vaccine, such as the strain CVD908-htrA and the strain CVD 909, as well as the Shigella flexneri 2a strain CVD 1208s, and the E. coli strain DH5 alpha.


The invention optimizes the maintenance of expression plasmids at two independent levels by: (1) removing sole dependence on balanced lethal maintenance systems; and (2) incorporating a plasmid partition system to prevent random segregation of expression plasmids, thereby enhancing their inheritance and stability. In one aspect of the invention, the stabilized expression plasmid is recombinantly engineered to express one or more antigens, preferably one or more Shiga toxin 2 (Stx2) antigens or substantial homologues thereof, such as Shiga toxin subunit pentamers or a genetically detoxified Stx 2, one or more proteins expressed by the anthrax bacteria (Bacillus anthracis), or the heavy chain non-toxic fragment of botulinum neurotoxin serotypes A-G.


The stabilized expression plasmid preferably comprises one or more non-catalytic plasmid maintenance functions.


In a preferred embodiment, the stabilized expression plasmid of the present invention comprises a Plasmid Maintenance System which comprises at least one PSK function and at least one SEG function. For example, the Plasmid Maintenance System may comprise a two-component Plasmid Maintenance System comprising one PSK function and one SEG function. Alternatively, the Plasmid Maintenance System may comprise a three-component Plasmid Maintenance System comprising a PSK function, a SEG function and another PSK. In one embodiment, the Plasmid Maintenance System comprises hok-sok+par+parA+phd-doc; wherein any of the stated functions may be replaced by a substantial homologue thereof. In a preferred alternative, the Plasmid Maintenance System comprises ssb+par; wherein any of the stated functions may be replaced by a substantial homologue thereof.


The Plasmid Maintenance Systems can be incorporated into multicopy expression plasmids encoding one or more proteins or peptides of interest. Such multicopy expression plasmids produce a gene dosage effect which enhances the level of expression of the protein or peptide of interest. Where the Plasmid Maintenance System is to be employed in a bacterial live vector vaccine, the protein or peptide of interest may be one or more foreign antigens.


In one aspect, the stabilized expression plasmid is a vaccine expression plasmid comprising a Plasmid Maintenance System and at least one antigen, for example, at least one Shiga toxin 2 (Stx2) antigen, one anthrax antigen, one botulinum neurotoxin antigen, and/or substantial homologues thereof. Where the antigen is a Shiga toxin 2 antigen, the Shiga toxin 2 antigen can, for example, be either a B subunit pentamer or a genetically detoxified Stx 2. When the antigen is an anthrax antigen, the anthrax antigen can be, for example, one or more domains of the anthrax toxin Protective Antigen PA83 moiety, including but not limited to domain 4 (the eukaryotic cell-binding domain; D4), the processed 63 kDa biologically active form of PA83, or full-length PA83. When the antigen is a Clostridium botulinum antigen, the antigen comprises the eukaryotic cell-binding heavy chain fragment of any neurotoxin serotype A, B, C, D, E, F, or G, in any combinantion.


In another aspect the stabilized expression plasmid comprises a Plasmid Maintenance System which incorporates the ssb balanced lethal system, where the ssb locus of the bacterial live vector has been inactivated using a suicide vector comprising a temperature sensitive origin of replication or using lambda red-mediated mutagenesis (Datsenko and Wanner, PNAS USA 97:6640-6645 (2000)). In one aspect, the bacterial live vector is S. typhi and lambda red-mediated mutagenesis is used to inactivate the ssb locus of S. typhi. In another aspect, the bacterial live vector is S. typhi and a suicide vector that is a derivative of pSC101, which carries sacB, is used as further described herein.


In another aspect, the present invention provides a Plasmid Maintenance System incorporating a PSK function involving a silent plasmid addiction system based on antisense RNA control mechanisms that only synthesize lethal proteins after plasmid loss has occurred.


In one aspect the expression plasmid comprises a series of expression plasmids, each comprising self-contained genetic cassettes encoding regulated expression of a heterologous antigen, an origin of replication, and a selectable marker for recovering the plasmid.


In one aspect the expression plasmid comprises a Plasmid Maintenance System which incorporates a PSK function based on the ssb gene. In a related aspect, mutated alleles such as ssb-1, described herein, are incorporated into the expression plasmids to enhance higher copy number plasmids by over-expression of SSB1-like proteins to form the required biologically active tetramers of SSB.


In another aspect, the expression plasmid comprises a promoter. The promoter is preferably an inducible promoter, such as the ompC promoter. In one aspect, the inducible promoter is the mutated PompC1, or the PopmC3 promoter described herein. The promoter exclusively controls the transcription of the downstream heterologous antigen cassette. Transcription of this unit is terminated in the 3′-distal region by a trpA transcriptional terminator.


In another aspect, the expression plasmid incorporates a PSK function based on the ssb gene where the inducible and the constitutive ssb gene promoters are used as the promoters of ssb PSK function. In one embodiment, the ssb post-segregational killing function (also referred to herein as a ssb post-segregational killing locus) comprises a ssb inducible promoter, a ssb constitutive promoter and a ssb coding region. Preferably the ssb post-segregational killing locus is the ssb post-segregational killing locus of any one of Shigella flexneri, Salmonella typhi and E. coli.


In one aspect, the expression plasmid of the present invention comprises a plasmid inheritance (or partition) locus; an origin of replication selected to provide copy number which effectively stabilizes a given antigen; a PSK function; and a nucleotide sequence encoding an antigen and a promoter which ultimately controls translation of the antigen and has a strength which is selected to improve antigen production without killing the cell.


The present invention also provides a method of using the expression plasmid comprising transforming a bacterial cell using said expression plasmid, and culturing the bacterial cell to produce the protein or peptide (e.g., the antigen), and/or administering said transformed cell or cell culture to a subject. Where the transformed bacterial cells are administered to a subject, they are administered in an amount necessary to elicit an immune response which confers immunity to the subject for the protein or peptide. The subject is preferably a human, but may also be another animal, such as a dog, horse, or chicken.


In one aspect, an expression plasmid is provided which comprises at least 3 independently functioning expression cassettes wherein one cassette encodes a protein or peptide of interest and the remaining cassettes each encode a different Plasmid Maintenance Function, such as a partitioning function and at least one post-segregational killing function.


In one aspect, an expression plasmid is provided which encodes (1) a test antigen operably linked to a promoter and (2) a Plasmid Maintenance System.


In another aspect, a regulated test antigen expression cassette is provided which operates such that as induction of antigen expression is increased, a metabolic burden is placed on the bacterium which leads phenotypically to plasmid instability, i.e. a selective advantage is created for all bacteria which can spontaneously lose the offending plasmid. The test antigen can be the green fluorescent protein (GFPuv). The expression cassette encoding the test antigen can also comprise an inducible promoter, such as the ompC promoter, positioned such that the inducible promoter ultimately drives the translation of the test antigen.


In one aspect, a method of making an expression plasmid is provided which comprises synthesizing an expression plasmid comprising at least 3 independently functioning expression cassettes wherein one cassette encodes a protein or peptide of interest and the remaining cassettes each encode a different Plasmid Maintenance Function, such as a partitioning function and at least one post-segregational killing function.


In one aspect, a method of screening Plasmid Maintenance Systems is provided comprising: providing one expression cassette which encodes a protein or peptide of interest, and at least two other expression cassettes, each encoding and capable of expressing in the host bacterial live vector a different Plasmid Maintenance Function, such as a partitioning function and at least one post-segregational killing function; inserting the three expression cassettes into a single expression plasmid; transforming a bacterial live vector with the single expression plasmid; culturing the transformed bacterial live vector; and determining the rate of introduction of plasmidless cells into the culture.


In one aspect, the present invention comprises an attenuated bacterial live vector vaccine comprising an attenuated bacterial live vector which has been transformed with a stabilized expression plasmid comprising a Plasmid Maintenance System, preferably a non-catalytic plasmid maintenance system. In a preferred embodiment, the Plasmid Maintenance System comprising (but not limited to the sole use of) a ssb PSK function and a partitioning function.


In one aspect, the present invention comprises an attenuated bacterial live vector vaccine comprising an attenuated bacterial live vector which has been transformed with an expression plasmid comprising a Plasmid Maintenance System which incorporates at least one PSK system and at least one SEG system. The attenuated bacterial live vector can, for example, be S. typhi CVD908-htrA.


The present invention also provides a method for vaccinating a subject comprising administering to the subject an amount of a bacterial live vector vaccine sufficient to elicit an enhanced immune response. The present invention also provides a method for preventing a disease by vaccinating a subject using an amount of such bacterial live vector sufficient to elicit a protective immune response to one or more pathogens of such disease. The subject is preferably a human but may also be another animal, such as a horse, cow or pig. For example, the present invention provides a method for preventing hemolytic uremic syndrome (HUS) caused by Shiga toxin 2-producing enterohemorrhagic Escherichia coli by administering to a subject an amount of a bacterial live vector transformed with a stabilized plasmid encoding at least one Shiga toxin 2 antigen.


In another aspect, the present invention provides a method for screening Plasmid Maintenance Systems for efficacy, the method comprising: providing expression plasmids comprising the Plasmid Maintenance Systems described herein and encoding for a protein or peptide of interest, said expression plasmids having copy numbers which vary from low copy number (e.g. ˜5 copies per cell) to medium copy number (e.g. ˜15 copies per cell) to high copy number (e.g. ˜60 copies per cell); transforming bacterial live vectors with such expression plasmids; and testing for rate of introduction of plasmidless cells and/or rate of growth of plasmid-containing cells. The modified origins of replication may be origins of replication from the plasmids pSC101 (low copy number), pACYC184 (medium copy number), and pAT153 (high copy number). Independently functioning plasmid replication cassettes can be utilized which permit testing of the efficiency of one or more plasmid stabilization systems as copy number is increased.


In another aspect, the present invention provides stabilized expression plasmids for use in attenuated S. typhi live vectors which contain a selectable marker, or are temperature sensitive, and which can readily be replaced by a non-drug resistant locus or by a gene encoding an acceptable drug resistance marker such as aph encoding resistance to the aminoglycosides kanamycin and neomycin.


The Plasmid Maintenance Systems of the present invention provide improved stability of recombinant plasmids, overcoming prior art problems of plasmid instability, for example, in bioreactor and live vector vaccination uses. The plasmids of the present invention are specifically tailored for vaccine applications though such plasmids are also useful in large scale protein production.


The plasmids of the present invention are a major improvement over the prior art in that they overcome the problems associated with plasmidless takeover and plasmid instability and have wide ranging utility in fields such as commercial protein production and attenuated bacterial live vector vaccine production.


There has long been a need for a solution to the problems of plasmidless takeover and plasmid stability associated with the field of vaccine delivery and protein production. The present invention solves this long felt need.


3. DEFINITIONS

The term “Plasmid Maintenance System” (“PMS”) as used herein refers to a nucleotide sequence comprising at least one post-segregational killing function (“PSK”) and at least one partitioning or segregating system (“SEG”), and optionally including any other Plasmid Maintenance Function.


The term “Plasmid Maintenance Function” is used herein to refer to any plasmid-stability enhancing function associated with a PMS. The term includes both naturally-occuring nucleotide sequences encoding plasmid maintenance functions, as well as nucleotide sequences which are substantially homologous to such naturally-occurring plasmid maintenance functions and which retain the function exhibited by the corresponding naturally-occurring plasmid maintenance function.


The term “Post-Segregational Killing System” (PSK) is used herein to refer to any function which results in the death of any newly divided bacterial cell which does not inherit the plasmid of interest, and specifically includes balanced-lethal systems such as asd or ssb, proteic systems such as phd-doc, and antisense systems such as hok-sok. The term includes both naturally-occuring nucleotide sequences encoding such PSKs, as well as nucleotide sequences which are substantially homologous to such naturally-occurring nucleotide sequences and which retain the function exhibited by the corresponding naturally-occurring nucleotide sequences.


The term “substantially homologous” or “substantial homologue,” in reference to a nucleotide sequence or amino acid sequence, indicates that the nucleic acid sequence or amino acid sequence has sufficient homology as compared to a reference sequence (e.g., a native sequence) to permit the sequence to perform the same basic function as the corresponding reference sequence; a substantially homologous sequence is typically at least about 70 percent sequentially identical as compared to the reference sequence, typically at least about 85 percent sequentially identical, preferably at least about 90 or 95 percent sequentially identical, and most preferably about 96, 97, 98 or 99 percent sequentially identical, as compared to the reference sequence. It will be appreciated that throughout the specification, where reference is made to specific nucleotide sequences and/or amino acid sequences, that such nucleotide sequences and/or amino acid sequences may be replaced by substantially homologous sequences.


The terms “Segregating System” and/or “Partitioning System” (both referred to herein as “SEG”) are used interchangeably herein to refer to any plasmid stability-enhancing function that operates to increase the frequency of successful delivery of a plasmid to each newly divided bacterial cell, as compared to the frequency of delivery of a corresponding plasmid without such a SEG system. SEG systems include, for example, equipartitioning systems, pair-site partitioning systems, and the systems provided in Table 1 of Chapter 5, Partition systems of bacterial plasmids. B. E. Funnell and R. A. Slavcev. In Plasmid Biology. 2004. B E Funnell and G J Phillips, eds. ASM Press, Washington, D.C. The term includes both naturally-occuring nucleotide sequences encoding such SEG systems, as well as nucleotide sequences which are substantially homologous to such naturally-occurring nucleotide sequences and which retain the function exhibited by the corresponding naturally-occurring nucleotide sequences.


The term “detoxified” is used herein to describe a toxin having one or more point mutations which significantly reduce the toxicity of the toxin as compared to a corresponding toxin without such point mutations.


The term “immunizingly effective” is used herein to refer to an immune response which confers immunological cellular memory upon the subject, with the effect that a secondary response (to the same or a similar toxin) is characterized by one or more of the following characteristics: shorter lag phase in comparison to the lag phase resulting from a corresponding exposure in the absence of immunization; production of antibody which continues for a longer period than production of antibody for a corresponding exposure in the absence of such immunization; a change in the type and quality of antibody produced in comparison to the type and quality of antibody produced from such an exposure in the absence of immunization; a shift in class response, with IgG antibodies appearing in higher concentrations and with greater persistence than IgM; an increased average affinity (binding constant) of the antibodies for the antigen in comparison with the average affinity of antibodies for the antigen from such an exposure in the absence of immunization; and/or other characteristics known in the art to characterize a secondary immune response.





4. BRIEF DESCRIPTION OF THE DRAWINGS


FIGS. 1A-1C: Genetic maps of exemplary pGEN expression plasmids (pGEN2, pGEN3, and pGEN4) of the present invention.



FIGS. 2A-2D: Genetic maps of exemplary oriE1-based expression plasmids (pJN72, pJN51, pJN10, and pJN12) of the present invention.



FIGS. 3A-H: Flow cytometry histograms of GFP fluorescence for CVD 908-htrA carrying expression vectors with the hok-sok post-segregational killing system.



FIGS. 4A-D: Complete pGEN2 nucleotide sequence (SEQ ID NO:1), comprising nucleotides 1-4196.



FIGS. 5A-B: Partial pGEN3 nucleotide sequence (SEQ ID NO:2), comprising nucleotides 1201-2397 and showing the sequence of ori15A.



FIGS. 6A-C: Partial pGEN4 nucleotide sequence (SEQ ID NO: 3), comprising nucleotides 1201-3848 and showing the sequence of ori101.



FIGS. 7A-7E: Genetic maps of exemplary ori15A-based pGEN expression plasmids (pGEN91, pGEN111, pGEN121, pGEN193, and pGEN222) of the present invention.



FIGS. 8A-C: Flow cytometry histograms of GFP fluorescence for expression plasmids pGEN91, pGEN111, pGEN121, pGEN193, and pGEN222.



FIG. 9A: Diagrammatic representation of the uvrA and ssb genes and control regions.



FIG. 9B: Ligated products from amplification of control and coding regions of ssb gene.



FIG. 10: PCR comparison of CVD 1208s and Δssb derivatives. In all three panels, lanes 1-4 represent PCR amplifications using CVD 1208sΔssb3.1, CVD 1208sΔssb3.2, CVD 1208sΔssb11.1 and CVD 1208sΔssb11.2 as templates, respectively. Lane 5 represents PCR amplifications using CVD 1208s chromosomal DNA. PCR products were generated using primer pairs CVOL 101 and CVOL 112 (A), CVOL 108 and CVOL 109 (B), and virG1 and virG2 (C). Molecular weight markers (Mw) were Generuler™ 1 kb DNA Ladder (Fermentas). Arrows correspond to Mw bands of 2, 1.5 and 0.75 kb from top to bottom.



FIG. 11: In vitro growth comparison of CVD 1208s and the Δssb derivatives.



FIG. 12: In vitro stability of pBRmSSB in CVD 1208s and the Δssb derivatives.



FIGS. 13A-B: PCR comparison of DH5 alpha and ssb mutant derivatives. Panel A compares PCR products amplified with CVOL 112 and CVOL 139 from unmodified DH5 alpha (lane 7) and 6 Lamda Red-mutated, cml resistant derivatives (lanes 1-6). The top of panel B compares 3 colonies each of lanes 1 and 2 in panel A lacking cml resistance; PCR was performed with CVOL12 and CVOL 139. The bottom of panel B compares PCR products from the same six colonies lacking cml resistance but with primers CVOL 108 and CVOL 109. Molecular weight markers (Mw) were Generuler™ 1 kb DNA Ladder (Fermentas). Arrows correspond to Mw bands of 2, 1.5 and 0.75 kb from top to bottom.



FIGS. 14A-B: PCR comparison of CVD 908-htrA and and ssb mutant derivatives. Panel A compares PCR products amplified with CVOL 140 and CVOL 141 from 4 Lamda Red-mutated, cml resistant derivatives (lanes 1-6) with unmodified CVD 908-htrA (lane 7). The top of panel B compares 3 colonies each of lanes 1 and 2 in panel A lacking cml resistance; PCR was performed with CVOL140 and CVOL 141. The bottom of panel B compares ssb from the same six colonies lacking cml resistance but with primers CVOL 108 and CVOL 109 (lanes 1-6) with ssb amplified from pBRmSSB plasmid DNA (lane 7). Molecular weight markers (Mw) were Generuler™ 1 kb DNA Ladder (Fermentas). Arrows correspond to Mw bands of 2, 1.5 and 0.75 kb from top to bottom.



FIGS. 15A-B: PCR comparison of CVD 909 and and ssb mutant derivatives. Panel A compares PCR products amplified with CVOL 140 and CVOL 141 from 5 Lamda Red-mutated, cml resistant derivatives (lanes 1-5) with unmodified CVD 909 (lane 6) and CVD 908-htrA (lane 7). The top of panel B compares 3 colonies each of lanes 1 and 2 in panel A lacking cml resistance; PCR was performed with CVOL140 and CVOL 141. The bottom of panel B compares ssb from the same six colonies (lanes 1-6) lacking cml resistance but with primers CVOL 108 and CVOL 109 specific for ssb amplified from pBRmSSB, but not ssb in unmodified CVD 909. Molecular weight markers (Mw) were Generuler™ 1 kb DNA Ladder (Fermentas). Arrows correspond to Mw bands of 2, 1.5 and 0.75 kb from top to bottom.



FIG. 16: Genetic map of medium copy test plasmid pGEN222AKS (˜15 copies per cell), encoding resistance to ampicillin (bla) and kanamycin (aph), as well as carrying a complete plasmid maintenance system (hok-sok+parM+parR=hok-sok/parA) and also encoding SSB and UV-fluorescent GFPuv. The sequence of pGEN222AKS is set forth in SEQ ID NO:66.



FIG. 17: Genetic map of pJG9-SSB, a temperature-sensitive replicon derived from pSC101 carrying ssb, gfpuv, the cat chloramphenicol resistance allele, and the counterselectable marker sacB. The sequence of pJG9-SSB is set forth in SEQ ID NO:65.



FIG. 18: Genetic map of pBRmSSB. The sequence of pBRmSSB is set forth in SEQ ID NO:64.





5. DETAILED DESCRIPTION OF THE INVENTION

Bacterial live vector vaccines employ a bacterial live vector to express genes encoding protective antigens of bacterial, viral or parasitic pathogens. The bacterial protective antigens are preferably non-native to the bacterial live vector, i.e. heterologous. The bacterial live vector vaccine is administered to a host, thereby exposing the expressed antigens to the host's immune system, eliciting an immune response of appropriate character to confer immunity to the host.


In order to achieve enhanced immunogenicity, the plasmids expressing such protective antigens must be stabilized. To the inventor's knowledge, no currently available S. typhi-based Plasmid Maintenance System takes advantage of naturally occurring partition mechanisms known to improve the stability of multicopy plasmids in other strains.


The present invention provides a non-catalytic Plasmid Maintenance System for the stabilization of expression plasmids encoding foreign antigens in a S. typhi live vector vaccine strain, a Shigella flexneri live vector vaccine strain or an E. coli live vector vaccine strain. In one aspect the S. typhi strain is CVD 908-htrA or CVD 909. In another aspect the Shigella flexneri strain is 2a. In a further aspect the E. coli strain is DH5 alpha.


In another aspect, the present invention improves and/or optimizes maintenance of expression plasmids by providing Plasmid Maintenance Systems which operate at two independent levels: (1) removing sole dependence on catalytic balanced lethal maintenance systems; and (2) incorporating a plasmid partition system which will prevent random segregation of the expression plasmids, thereby enhancing their inheritance and stability. A critical reason for pursuing this particular approach is that this method of improving plasmid maintenance involves no additional manipulations of the live vector strain, and therefore can improve the immunogenicity of heterologous antigens expressed within any live vector strain.


The non-catalytic Plasmid Maintenance System of the present invention improves the stability of multicopy expression plasmids within a bacterial live vector vaccine, such as CVD908-htrA and the other suitable bacteria described herein.


In one aspect, the present invention incorporates the naturally occurring PSK function hok-sok from the antibiotic-resistance factor pR1, or a substantial homologue thereof, within multicopy expression plasmids. The hok-sok system is a silent plasmid addiction system based on antisense RNA control mechanisms that only results in synthesis of lethal proteins after plasmid loss has occurred.


The present invention also provides a plasmid maintenance system comprising a complementation-based PSK function in which the chromosomal gene ssb, encoding the essential non-catalytic single-stranded binding protein (SSB) required for DNA replication, is specifically deleted and inserted within a multicopy expression plasmid.


The present invention also provides an improved Plasmid Maintenance System comprising an expression plasmid encoding at least one SEG locus and at least one PSK function.


5.1 Suicide Vectors


Heterologous antigens can be expressed within live vector strains, such as CVD908-htrA, from genes residing either on plasmids or integrated within the chromosome. One technique for integrating these genes into the host chromosome involves the use of temperature sensitive “suicide vectors” such as pIB3307 which contains a temperature-sensitive origin of replication from pSC101 (ori101ts). The present invention provides an improved suicide vector for use in CVD908 and CVD908-htrA, derived from pIB307 which allows for easier construction of mutagenesis cassettes to alter the live vector chromosome.


Integration of these suicide vectors into the chromosome by homologous recombination results from temperature inactivation of the plasmid replication protein, RepA, a protein essential to the function of ori101. Spontaneous resolution of the resulting unstable merodiploid intermediates is detected by counter-selection for loss of the sacB gene contained on the resolving suicide vector. The sacB gene contained on all excised plasmids encodes the levansucrase enzyme, which is lethal when expressed within the cytoplasm of enteric bacteria, including S. typhi, growing in the presence of sucrose. Since resolving merodiploids are selected by incubating in the presence of 10% sucrose, excised plasmids will kill host bacteria unless they cure spontaneously.


This system was successfully used to integrate a kanamycin-resistance cassette into the ΔaroC1019 locus of CVD908. However, these experiments were successful because the gene being mobilized into the chromosome of S. typhi encoded a selectable drug-resistance marker. Using these early vectors, replacing the kanamycin-resistance cassette with a non-selectable marker was not successful because, although the incoming marker could be integrated into the chromosome as a merodiploid, resolution of the merodiploid to replace the drug resistance gene was never detected.


The present invention also provides a method for using such suicide vectors to inactivate the ssb locus of attenuated Salmonella typhi strains such as CVD908-htrA.


The present invention allows such suicide vectors to permit efficient mobilization of genes expressing proteins or peptides of interest, such as heterologous antigens, into the chromosome of S. typhi CVD908-htrA in two stages. For example, the present inventor introduced a sacB-aph cassette into the ΔaroC1019 locus, which was then selected using kanamycin. Generation of this S. typhi CVD908-htrAΔaroC1019::sacB-aph strain produced a valuable intermediate strain into which, in theory, any structural gene can be efficiently inserted into the aroC locus by marker-exchange. The sacB gene is used as a counter-selectable marker by passing merodiploids in the presence of 10% sucrose to select for replacement of the sacB-aph cassette with the incoming antigen cassette, since resolution of merodiploids in the presence of sucrose will result in loss of the sacB gene, in order to produce viable progeny. This intermediate strain was employed to efficiently integrate the non-toxigenic mutant LT-K63 of the E. coli heat-labile enterotoxin, creating CVD908ΔaroC1019::LT-K63.


5.1.1 Lambda Red-Mediated Mutagenesis


The host gene to be inactivated in bacterial live vectors may also be inactivated using lambda red-mediated mutagenesis (Datsenko and Wanner, PNAS USA 97:6640-6645 (2000)). Briefly, in step 1 host bacteria targeted for mutation are transformed with a temperature sensitive plasmid encoding λ Red recombinase. These bacteria are grown in the presence of arabinose to induce λ Red production. Chromosomal mutagenesis of a target sequence is accomplished by electroporation of the host with linear DNA in which the target gene is replaced with an antibiotic resistance marker. This DNA also encodes short regions of flanking chromosomal sequences to allow for chromosomal integration of the resistance marker by λ Red-mediated homologous recombination. Recombinants are selected for on solid media containing the appropriate antibiotic, and incubated at a temperature facilitating the loss of the plasmid encoding λ Red recombinase. For step 2, removal of the chromosomal resistance marker is facilitated by transforming the bacteria with a temperature sensitive plasmid encoding FLP recombinase, which targets unique sequences within the antibiotic resistance marker now present in the host chromosome. Transformants are grown at temperatures permissive for the presence of the FLP recombinase which is expressed constitutively. Deletants are screened via PCR, regrown at a temperature to facilitate loss of the plasmid encoding FLP recombinase, and selected for storage.


5.2 Plasmid-Based Expression of Heterologous Antigens


Although chromosomal integration of foreign genes confers stability to such sequences, the genetic manipulations involved can be difficult, and the drop in copy number of the heterologous gene often results in production of insufficient levels of heterologous antigen to ensure an optimal immune response.


In contrast, plasmid stability is a complex phenomenon which depends on multiple factors including (1) copy number of the plasmid; (2) appropriately regulated expression of genes contained within the plasmid; and (3) selective pressure for ensuring the proper segregation and inheritance of the plasmid.


To ensure stability, plasmids must be replicated in a regulated manner to prevent their copy number from rising to lethal levels.


In addition, plasmids must segregate during the division of a growing bacterium to ensure that each daughter cell receives at least one copy of the plasmid. Segregation can be a passive, random event or an active process involving synthesis of novel proteins which aid in plasmid segregation and inheritance. Successful inheritance of randomly segregating plasmids relies on a high enough copy number of randomly distributed plasmids within a dividing bacterium to virtually guarantee inheritance of at least one plasmid by each daughter cell.


The commonly used plasmid cloning vectors, including medium copy number pBR322 derivatives and high copy number pUC plasmids, are inherited by random segregation.


Active segregation involves the synthesis of proteins which are proposed to bind to such plasmids and further coordinate with the membranes of dividing bacteria to ensure that each daughter receives at least one plasmid copy. Plasmids employing such active partitioning systems are typically very low copy number plasmids such as the F sex factor of E. coli or antibiotic resistance R-factors such as pR1 and pRK2.


The present invention exploits naturally occurring SEG functions to enhance inheritance of multicopy expression plasmids, which would otherwise be inherited by random segregation, to increase the stability of these plasmids.


The present invention also takes advantage of other naturally occurring genetic systems in which daughter cells which do not successfully inherit an expression plasmid will be killed and removed from the growing population, i.e., PSK functions. The incorporation of more than one category of plasmid stabilization function is referred to herein as a Plasmid Maintenance System. For example, the incorporation of both a SEG function such as a partition locus and a PSK function into a single expression plasmid yields a Plasmid Maintenance System.


It should be noted that a gene conferring resistance to a bactericidal antibiotic, such as the aph gene encoding resistance to kanamycin and neomycin, is also considered a PSK function, as is the asd-based balanced-lethal system.


5.3 Balanced Lethal Systems


One method of ensuring the inheritance of expression plasmids involves the construction of a PSK system or a substantial homologue thereof, referred to as a balanced lethal system, for plasmids expressing heterologous antigens. In a plasmid-based balanced lethal system, plasmids replicating in the cytoplasm of the bacterium express a critical protein required by the bacterium to grow and replicate. Loss of such plasmids removes the ability of the bacterium to express the critical protein and results in cell death.


The asd system has recently been introduced into attenuated S. typhi vaccine strains in an attempt to increase the stability of plasmids expressing synthetic hepatitis B viral peptides.


However, when volunteers were immunized with these live vector strains, no immune response to the foreign antigen was detected. See Tacket et al., Infection and Immunity, 65:3381, 1997 (incorporated herein by reference). In fact, to date, few reports have documented an immune response to plasmid-based expression of a foreign antigen from plasmids (stabilized or otherwise) after vaccination of humans with an attenuated S. typhi live vector.


Although in some cases failure of live vector strains may have resulted from over-attenuation of the strain itself, the inventor's conclusion is that currently used PSK functions for plasmids suffer from additional limitations, in particular, from segregation limitations and catalytic activity limitations. The present invention provides improved expression plasmids comprising enhanced segregation capabilities by incorporating at least one partitioning system along with at least one PSK system.


5.4 Segregation Limitations


One limitation of plasmid maintenance functions such as the asd function (as well as the thyA function) is that they do not enhance the inheritance of resident plasmids, which continue to segregate randomly with or without the presence of the asd function. Therefore, if resident expression plasmids carrying asd genes are inherently unstable, they will be lost, regardless of the requirement of the bacterium for Asd.


The inherent stability of an asd expression plasmid can be defined by growing plasmid-bearing strains in the presence of DAP, which removes the selective pressure that ensures that all viable bacteria contain the expression plasmid. If a given plasmid is inherently unstable, it will be lost from bacteria at a high rate and such plasmidless bacteria will lyse in the absence of growth supplements; the overall result of this effect will be a population of bacteria that grows much slower than wildtype unaltered strains.


The present invention improves plasmid stability by incorporating a SEG function, such as a partition locus, or a substantial homologue of a SEG function, onto the expression plasmid to enhance the inheritance of such plasmids by actively dividing bacteria. Partition loci are naturally present on the virulence plasmids of S. typhimurium. Tinge and Curtiss, Journal of Bacteriology, 172:5266, 1990 (incorporated herein by reference) reported that such partition loci were well conserved among S. typhimurium virulence plasmids, and that when a 3.9 kb restriction fragment encoding this locus was introduced onto the lower copy number plasmid pACYC184 (˜15 copies per cell), the observed plasmid stability increased from 34% plasmid-containing cells to 99% plasmid-bearing cells after 50 generations. The nucleotide sequence of this locus was later determined by Cerin and Hackett, Plasmid, 30:30, 1993 (incorporated herein by reference), (GenBank Accession Number M97752).


5.5 Catalytic Activity Limitations


Another potential limitation of a plasmid maintenance function such as the asd function (as well as the thyA system) is its reliance on an enzyme with catalytic activity. Given that complementation with only a single copy of the asd gene is sufficient to remove auxotrophy, it is not clear why all copies of a multicopy plasmid should remain stable, especially if they encode an especially problematic heterologous antigen which inhibits growth of the bacterium.


Further, although higher copy number expression plasmids may express appreciable levels of a given heterologous antigen in vitro, such plasmids may not be maintained at the expected copy numbers in vivo due to toxicity and may in fact be present at much lower copy numbers, which would be expected to reduce any observed immune response specific for the heterologous antigen. Accordingly, the present invention thus provides stably maintained low and medium copy number plasmids for expressing heterologous antigens.


5.6 The Non-Catalytic ssb PSK Function


The potential limitation of catalytic activity associated with balanced lethal systems is addressed here through the use of plasmids expressing the single-stranded binding protein (SSB) from S. typhi to trans-complement an otherwise lethal mutation introduced into the chromosomal ssb gene. The biochemistry and metabolic roles of the E. coli SSB protein have been extensively reviewed in Lohman et al., Annual Reviews in Biochemistry 63:527, 1994 and Chase et al., Annual Reviews in Biochemistry 55:103, 1986 (the disclosures of which are incorporated herein by reference).


SSB is a non-catalytic 177 amino acid protein, with a relative molecular weight of 19 kDa, that binds with high affinity to single-stranded DNA (ssDNA), and plays an essential role as an accessory protein in DNA replication, recombination, and repair. SSB expression can occur via two promoters, one constitutive and the other inducible (Brandsma et al. Nucleic Acids Research 13:5095-5109). Expression from the inducible promoter is regulated by LexA, which is a repressor protein that is induced as part of the bacterial “SOS response” to DNA damage (recently reviewed by Foster, Mutation Research 569(1-2):3-11 (2005)). LexA binding upstream of ssb also represses the divergent promoter that governs UvrA expression, another protein involved in the repair of DNA damage (recently reviewed by Van Houten et al. Mutat Res. 577:92-117 (2005).


The biologically relevant form of SSB involved in binding to ssDNA is a tetramer, which binds in two modes to ssDNA, intimately associating with an average of either 35 (SSB35-binding mode) or 65 bases (SSB65-binding mode). The specific conditions controlling the preferred mode of binding are complex and depend on the surrounding concentration of monovalent and divalent salts, pH, and temperature, as well as the amount of SSB protein present. Under given conditions, high concentrations of SSB favor the SSB35-binding mode, with lower SSB concentrations favoring the SSB65-mode. However, it must be emphasized that in both binding modes, the required conformation of SSB is a tetramer.


Spontaneously occurring temperature-sensitive point mutations within the ssb gene have now been characterized at the biochemical, physiological, and nucleotide level; one such mutant, ssb-1, contains the point mutation His 55 to Tyr, and has been found to be unable to assemble correctly into tetramers at non-permissive temperatures and natural expression levels. These mutant strains exhibit temperature-sensitive lethal defects in DNA replication and recombination.


The segregation frequencies of plasmids carrying ssb which complement chromosomal ssb mutations in E. coli bacteria were examined by Porter et al. Bio/Technology 8:47, 1990 (incorporated herein by reference). They observed that in experiments involving bioreactors, the segregation frequency in plasmid-bearing strains growing in continuous culture under non-selective conditions for 150 hours was less than 1×10−7; this segregation frequency was independent of copy number, as both lower copy number pACYC184 plasmids and very high copy number pUC19 plasmids were maintained at the same frequency. However, it must be noted that the plasmids involved expressed only a drug-resistance marker in addition to the SSB protein. A detailed examination of the manner in which the E. coli bacteria were constructed reveals portions of both uvrA and ssb, and their corresponding regulatory elements, deleted. Salmonella lacking genes required for DNA repair, namely recA and recBC, are highly attenuated and are unusable as live-attenuated bacterial live vectors (Buchmeier et al. J Clin Invest. 95(3):1047-53 (1995); and Mol Microbiol. 7(6):933-6 (1993)). Thus, although there were no problems reported by Porter et al. regarding growth of these modified E. coli in biorectors, a deletion in uvrA would be debilitating for live-attenuated bacterial vectors destined for use vaccines. That is to say, the uvrA deleted live vectors would not survive long enough within the host to engender the appropriate immune response.


The present invention provides an improved plasmid maintenance system which incorporates a partition locus such as that present on pSC101, or a substantial homologue of such partition locus, and may also incorporate an active partitioning system, or a substantial homologue thereof, such as that described above for the virulence plasmid of S. typhimurium.


The present invention removes dependence on catalytic enzymes to confer plasmid stability. In one aspect, mutated alleles similar to ssb-1 are introduced into the expression plasmids to enhance higher copy number plasmids by overexpression of SSB1-like proteins to form the required biologically active tetramers of SSB. In another aspect the present invention provides a PSK function involving a silent plasmid addiction system based on antisense RNA control mechanisms that only synthesize lethal proteins after plasmid loss has occurred.


5.7 Expression Plasmids and Self-Contained Genetic Cassettes


The present invention also comprises a series of expression plasmids which are referred to herein as pGEN plasmids. pGEN plasmids comprise self-contained genetic cassettes encoding regulated expression of a heterologous antigen, an origin of replication, and a selectable marker for recovering the plasmid. This vector series has been specifically designed to test whether any Plasmid Maintenance System can increase the stability of plasmids, for example within an attenuated S. typhi vaccine background.


The basic structure of these vectors is represented in FIG. 1, and the composite gene sequence for the vector pGEN2 (SEQ ID NO: 1) is represented in FIG. 4; FIGS. 5 & 6 show specific composite sequences for the origins of replication in pGEN3 and pGEN4 respectively.


It is critical to note that the pGEN plasmids are designed to comprise 3 independently functioning genetic cassettes. These cassettes have been constructed such that individual components can be optimized by replacement as necessary. Accordingly, in addition to the various Plasmid Maintenance Systems described herein, the cassettes can test other promising systems now in existence or which may become available in the future. Further, the optimized plasmid(s) can be adapted to express relevant protective heterologous antigens within attenuated vaccine strains for immunization of humans.


The pGEN plasmids provide a regulated test antigen expression cassette which operates such that as induction of antigen expression is increased, a metabolic burden is placed on the bacterium which leads phenotypically to plasmid instability, i.e. a selective advantage is created for all bacteria which can spontaneously lose the offending plasmid. Thus one aspect of the present invention provides a conditionally unstable plasmid which can be examined for stability as plasmid maintenance systems are incorporated.


In a preferred mode, the regulated test antigen expression cassette contained within the pGEN plasmids comprises the inducible ompC promoter, or a substantial homologue thereof, driving expression of a detectable protein, such as the codon-optimized green fluorescent protein (GFPuv, available from Clontech), overexpression of which is toxic to E. coli and S. typhi.


The present invention also comprises a series of plasmid replicons having copy numbers which vary from low copy number (i.e., ˜1 to ˜10, preferably ˜5 copies per cell) to medium copy number (i.e., ˜11 to ˜25, preferably ˜15 copies per cell) to high copy number (i.e., ˜26 to ˜100, preferably ˜60 copies per cell). To accomplish this, origins of replication from the well-characterized plasmids pSC101, pACYC184, and pAT153 have been modified using polymerase chain reaction (PCR) techniques to create independently functioning plasmid replication cassettes. These replication cassettes permit testing of the efficiency of a plasmid maintenance system as copy number is increased.


The present invention also comprises selectable expression plasmids for use in attenuated S. typhi live vectors. These expression plasmids contain a selectable marker which can ultimately be replaced either by a non-drug resistant locus, such as ssb, or by a gene encoding an acceptable drug resistance marker such as aph encoding resistance to the aminoglycosides kanamycin and neomycin.


To accomplish this, resistance cassettes encoding resistance to carbenicillin and tetracycline have been constructed, with transcription being efficiently terminated by an rrnB T1T2 terminator. A detailed description of the individual components comprising the expression and replication cassettes follows.


Specific components of the Plasmid Maintenance System can be systematically inserted into the basic expression replicons to assess any individual or synergistic influence of these functions on plasmid stability in the presence and absence of selection. For example, a post-segregational killing function (e.g., the hok-sok locus) can be inserted as an EcoRI-XbaI cassette, such that flanking transcription from surrounding loci, such as the antigen and selection cassettes, is divergent and will not significantly disturb the wild type transcription levels which control the lethality of this locus (FIG. 7B, PGEN111).


Similarly, the par passive partition locus can be inserted as a BamHI-BglII fragment between the origin of replication and selection cassettes (FIG. 7C, pGEN 121). Interestingly, in the work leading to the present invention, it was observed that the orientation of the par locus enhances synthesis of GFPuv on solid medium when inserted in the natural orientation found within ori101 of pSC101; this orientation was adopted for all of the expression plasmids. The function of the par locus appears to be related to increasing plasmid supercoiling at the origin of replication, which is also the binding site for DNA gyrase. The par locus does not encode any known protein or RNA transcript (Conley et al. Nucleic Acids Res. 23:701-7 (1995)).


An exemplary par sequence is that of E. coli, set forth in SEQ ID NO:62 (Miller et al. Nucleotide sequence of the partition locus of Escherichia coli plasmid pSC101. Gene 24:309-15 (1983); GenBank accession no. X01654, nucleotides 4524-4890).


The active partitioning locus is preferably the parA locus, constructed as an XhoI-EcoRI cassette from the same pR1 resistance plasmid from which hok-sok was adapted. To preserve natural transcription levels and regulation within this locus, the cassette is preferably positioned within an area of the expression plasmids such that flanking transcription progresses away from parA (FIGS. 7D and 7E, pGEN193 and pGEN222). An exemplary parA sequence is set forth in SEQ ID NO:63 (bases 1-1686 of GenBank accession no. X04268).


5.7.1 Stabilized Expression Plasmids


The present invention also comprises stabilized expression plasmids for use in the live bacterial vectors vaccines of the present invention. These expression plasmids contain a origin of replication and a Plasmid Maintenance System (PMS). As defined herein, the PMS comprises at least one post-segregational killing (PSK) function and at least one partitioning or segregating system (SEG). In a preferred embodiment, the PSK function is the ssb balanced lethal system described herein and the SEG is parA also described herein.


The plasmids on which the stabilized expression plasmids of the present invention are based may be either medium copy ori15A (˜15 copies per chromosomal equivalent) or low copy number ori101 (˜5 copies per chromosomal equivalent) expression plasmids, engineered to encode wildtype ssb. These modified plasmids are intended to be used to express one or more of the following antigens: 1) one or more domains of the anthrax toxin Protective Antigen PA83 moiety, including but not limited to domain 4 (the eukaryotic cell-binding domain; D4), the processed 63 kDa biologically active form of PA83, or full-length PA83; 2) one or more of the eukaryotic cell-binding heavy chain fragment of any Clostridium botulinum neurotoxin serotype A, B, C, D, E, F, or G, in any combinantion.


Since SSB is essential to DNA metabolism and must be continuously available to CVD 908-htrAssb to allow live vector replication, SSB-selected plasmids encoding one or more heterologous antigens are expected to be stable in vivo as well as in vitro, enhancing foreign antigen-specific protective immune responses. Since SSB is expected to function in vivo as a PSK system, the hok-sok system may be unnecessary.


Since the wildtype copy number of ssb per chromosomal equivalent is one, it is theoretically necessary for only one SSB-stabilized plasmid copy to be maintained within the CVD 908htrAssb live vector. If true, multicopy SSB-stabilized expression plasmids may not achieve their maximum intended copy numbers in vivo, resulting in lower immune responses against the foreign antigen. The required conformation of SSB is a tetramer, and mutated alleles similar to ssb-1 destabilizes formation of this tetramer. However, when present on high copy number pUC plasmids, the lethality of these mutations is suppressed (Chase et al. J. Mol. Biol. 164:193-211 (1983)). Therefore, in a preferred embodiment, the multicopy expression plasmids will be stabilized with an ssb-1 allele (or any mutation functionally equivalent to this allele, such as W54S; Carlini et al. Mol. Microbiol. 10:1067-1075 (1993)) known to be suppressed by over-expression of the mutant allele from higher copy number plasmids.


5.8 Components of the Antigen Expression and Replication Cassettes


5.8.1 Promoter


It will be appreciated by one of skill in the art that a wide variety of components known in the art may be included in the expression cassettes of the present invention, including a wide variety of transcription signals, such as promoters and other sequences that regulate the binding of RNA polymerase to the promoter. The operation of promoters is well known in the art and is described in Doi, Regulation of Gene Expression, Modern Microbial Genetics pages 15-39 (1991) (the entire disclosure of which is incorporated herein by reference). The ensuing description uses the ompC promoter for heterologous antigen expression, by way of example, and is not meant to delimit the invention.


The promoter is preferably an environmentally regulatable promotor controlled by a biologically relevant signal such as osmolarity. In a preferred mode, the promoter is the ompC promoter. The ompC gene encodes a porin protein which inserts as a trimer into the outer membrane of a bacterial cell. Expression and control of ompC is complex and has recently been reviewed in considerable detail in Pratt et al., Molecular Microbiology 20:911, 1996 and Egger et al., Genes to Cells 2:167, 1997 (the disclosures of which are incorporated herein by reference).


Synthesis of the ompC protein is ultimately controlled at the level of transcription by the osmolarity of the surrounding environment such that increases in osmolarity are accompanied by increases in the transcription of ompC. However, increases in osmolarity do not directly mediate increases in the transcription of ompC. Rather, the bacterium senses the surrounding osmolarity using a two-component signal transduction system encoded by the ompB operon. This operon is composed of two genes transcribed in the order envZ-ompR. The envZ gene encodes a 450 amino acid (a.a.) protein, containing two transmembrane regions, which inserts into the bacterial inner membrane (perhaps as a dimer) with an N-terminal 118 a.a. osmotic-sensing domain extending into the periplasmic space and a C-terminal 270 a.a. catalytic domain extending into the cytoplasm. The C-terminal catalytic domain possesses both kinase and phosphatase activities which are modulated by osmolarity such that as osmolarity increases, kinase activity predominates, and as osmolarity drops, phosphatase activity predominates.


EnvZ kinase activity phosphorylates aspartic acid residue 55 of the 239 a.a. cytoplasmic protein OmpR, creating OmpR-P. It is the OmpR-P modified protein which binds to the ompC promoter and activates transcription by RNA polymerase; therefore, as osmolarity increases, increasing kinase activity of EnvZ produces higher levels of OmpR-P, which in turn lead to greater transcription of ompC. OmpR-P binds to a region of the ompC promoter spanning bases −41 (relative to the transcriptional start site of +1) to −102, with initial binding of OmpR-P to bases −78 through −102 being followed by additional binding to bases extending to −41 as the concentration of OmpR-P increases with osmolarity. In addition, OmpR-P has been shown to bind to an AT-rich upstream region extending back to base −405 which further enhances ompC transcription.


In a preferred embodiment the ompC promoter fragment from E. coli spans nucleotides +70 through −389. This promoter can direct transcription within attenuated S. typhi strains of an antibiotic resistance gene, such as the kanamycin resistance gene in an osmotically sensitive manner. For example, experiments have demonstrated that when the concentration of NaCl in liquid growth medium was increased from 0 mM to 300 mM, resistance to kanamycin increased from 0 μg/ml to >800 μg/ml.


5.8.2 Origin of Replication


Due to varying degrees of toxicity associated with different heterologous antigens (i.e. higher toxicity for antigens derived from parasitic organisms such Plasmodium falciparum vs. virtually no toxicity for the fragment C of tetanus toxin), the present invention provides live vector vaccines which preferably express such antigens from either low or medium copy plasmids. It will be appreciated by one skilled in the art that the selection of an origin of replication will depend on the degree of toxicity, i.e., the copy number should go down as toxicity to the bacterial strain goes up. In a preferred mode, the Plasmid Maintenance System(s) used are capable of stabilizing replicons of low or medium copy numbers.


It is preferable for the origin of replication to confer an average copy number which is between about 2 and about 75. In a preferred mode the origin of replication is selected to confer an average copy number which is between about 5 and about 60. More preferably the range is from about 5 to about 30. Optimally, the range is from about 5 to about 15. The origins of replication contemplated here are derived from pAT 153 (oriE1, ˜60 copies per chromosomal equivalent), pACYC184 (ori15A, ˜15 copies per chromosomal equivalent), and pSC101 (ori101, ˜5 copies per chromosomal equivalent).


In one aspect, the origin of replication is the oriE1 locus from pSC101, conferring a copy number of approximately 5 per genome equivalent.


The oriE1 locus specifies synthesis of a 555 base transcript called RNA I and synthesis of a 110 base antisense RNA transcript called RNA II. As RNA I is synthesized, the 5′-proximal region of the transcript adopts a stem-loop structure composed of 3 domains which can hybridize to a complementary stem-loop structure formed by RNA II, resulting in a double stranded RNA-RNA structure forming which causes plasmid replication to abort.


As synthesis of RNA I continues, generating the full-length 555 base transcript, a rearrangement of the secondary structure of the transcript destroys the initial 3 domain stem-loop structure to form an alternate stem-loop configuration which no longer hybridizes to RNA II. Formation of this alternate structure allows the transcript to hybridize to one DNA strand of the plasmid itself, forming an RNA-DNA complex which is nicked by endogenous RNAse H to trigger synthesis of the first DNA strand of the plasmid and plasmid replication.


Plasmid replication is therefore controlled by synthesis of RNA I, which undergoes a cascade of structural configurations leading to initiation of replication. The necessary progression of the RNA I folding cascade (and resulting replication initiation) is interrupted by competition of the domains with RNA II. This mechanism is essentially the same in plasmids containing either oriE1 or ori15A.


The reason these two types of plasmids can coexist within the same bacterium is due to sequence divergence within the region of hybridization between RNA I and RNA II, such that the RNA II from ori15A will not hybridize to RNA I from oriE1; this sequence divergence also affects the stability of the RNA I: RNA II hybrid, accounting for the differences in copy number between plasmids carrying the oriE1 or ori15A origins of replication.


The structural organization of the engineered origins of replication cassettes for pSC101 (ori101; ˜5 copies per genome equivalent), pACYC184 (ori15A derivative; ˜15 copies per genome equivalent), and pAT153 (oriE1 derivative; ˜60 copies per genome equivalent) are analogous in structure and function.


Thus, in preferred embodiments of the present invention, the stabilized expression plasmids utilize an origin of replication is selected from ori101 from pSC101, ori15A from pACYC184, and oriE1 from pAT153.


5.8.3 Expressed Protein or Peptide


When the expression cassette is used to screen Plasmid Maintenance Systems, it preferably expresses a protein or peptide with no metabolic activity. A preferred protein is the green flourescent protein (GFP) of the bioluminescent jellyfish Aequorea victoria, a 238 amino acid protein which undergoes a post-translational modification in which 3 internal amino acids (65Ser-Tyr-Gly67) are involved in a cyclization and oxidation reaction. The resulting fluorophore emits blue-green light maximally at a wavelength of 509 nm upon irradiation with long-wave ultraviolet light at a wavelength of 395 nm. In addition, fluorescence activity is remarkably constant over a wide range of pH from 5.5-12 and at temperatures up to 70° C.


Since GFP has no known catalytic activity, the level of observed fluorescence within individual bacteria expressing GFP can provide a direct indication of transcription levels of the gfp gene carried by each bacterium. Expression of the GFP protein has now been quantitated in a variety of both prokaryotic and eukaryotic cells and requires no additional cofactors or enzymes from A. victoria. Fluorophore formation is apparently dependent either on ubiquitous enzymes and cofactors, or is an autocatalytic event.


Individual bacteria expressing GFP can be quantitated either alone or within macrophages, epithelial cell lines, and infected animal tissues using flow cytometry. GFP fluorescence is absolutely dependent on residues 2-232 of the undenatured protein. However, fusion of unrelated biologically active protein domains to the N-terminus of GFP has still resulted in fusion proteins with the expected heterologous biological activity which continue to fluoresce as well.


It has been confirmed by sequence analysis (Clontech) that the gfp allele preferred here (i.e. gfpuv) expresses a GFP mutant (GFPuv) containing 3 amino acid substitutions (not involving the fluorophore) which increase fluorescence 18-fold over that of wildtype GFP.


In addition, 5 rarely used arginine codons have been optimized for efficient expression of GFP in E. coli. Since comparison of expression levels of various heterologous proteins in E. coli and CVD908 has demonstrated equivalent or superior expression within CVD908, it was expected that gfpuv will function efficiently in CVD908-htrA.


A coding sequence is inserted in a correct relationship to a promoter where the promoter and the coding sequence are so related that the promoter drives expression of the coding sequence, so that the encoded peptide or protein is ultimately produced. It will be understood that the coding sequence must also be in correct relationship with any other regulatory sequences which may be present.


5.8.4 Heterologous Antigens


The expression plasmids of the present invention preferably express an antigen for presentation to a host to elicit an immune response resulting in immunization and protection from disease. While Shiga toxins are presented herein as examples of antigens usefully expressed by the vaccine expression plasmids disclosed herein, the invention is broad in scope and encompasses the expression of any antigen which does not destroy the bacterial live vector and which elicits an immune response when the bacterial live vector containing said expression plasmid(s) is administered to a host, i.e., a human or other animal.


The vaccine expression plasmids provided herein are used to genetically transform attenuated bacterial strains, preferably strains used for human vaccination and most preferably used to transform attenuated S. typhi vaccine strains such as CVD908-htrA, and preferably encode either the B subunit of Stx2 or a genetically detoxified Stx2 holotoxin.


A subset of STEC most often referred to as enterohemorrhagic E. coli (EHEC) are capable of causing severe clinical syndromes including hemorrhagic colitis, hemolytic uremic syndrome (HUS) and thrombotic thrombocytopenic purpura (TTP) in a small proportion of infected individuals, in addition to causing non-bloody diarrhea in most others.


Hemorrhagic colitis is characterized by copious bloody diarrhea, usually without fever or with only low-grade fever and a relative paucity of fecal leukocytes demonstrable in the diarrheal stools. These features differentiate hemorrhagic colitis from dysentery caused by Shigella which is typically scanty stools of blood and mucus, preceded by high fever and with large numbers of fecal leukocytes visible by microscopy.


HUS, a potentially fatal disease that most often affects young children but may afflict individuals of any age, is characterized by the triad of microangiopathic hemolytic anemia, thrombocytopenia and uremia. Currently in North America, HUS is the most frequent cause of acute renal failure in infants and young children. In a study by Siegler et al. of 288 patients treated for postdiarrheal HUS in Utah from 1970-1994, severe disease (defined as anuria lasting longer than 7 days, oliguria lasting for longer than 14 days, or extrarenal structural damage such as stroke) occurred in 25% of cases and was associated with children less than two years of age; about one third of these severe cases of HUS resulted in death (5%) or severe sequelae including end-stage renal disease (5%) or chronic brain damage (3-5%), with less severe chronic problems involving hypertension, proteinuria, or azotemia.


TTP, which most often affects adults, is characterized by neurologic complications such as stroke, in addition to thrombocytopenia, hemolytic anemia and renal disease.


By far the most common EHEC serotype is O157:H7. Nevertheless, other EHEC serotypes also cause HUS and hemorrhagic colitis, including O26:H11, O111:H8 and a number of others. EHEC strains associated with HUS always elaborate one or more Shiga toxins and carry a 60 MDa virulence plasmid. In addition, most also harbor a chromosomal pathogenicity island (so-called LEE) having a set of genes that encode the ability to attach and efface. It is well accepted that Shiga toxins elaborated by EHEC play a key role in the pathogenesis of hemorrhagic colitis and HUS.


As described in detail below, the Shiga toxin family is comprised of two groups of toxins, Stx1 (which is essentially identical to cytotoxin/neurotoxin/enterotoxin produced by Shigella dysenteriae type 1, the Shiga bacillus) and Stx2 (which is immunologically distinct from Stx1 and has several related variants). In the USA, the overwhelming majority of EHEC associated with cases of HUS express Stx2, either alone or in conjunction with Stx1.


The most important reservoir of EHEC infection are bovines. The single most important mode of transmission of EHEC to humans is via the consumption of under-cooked contaminated beef, most often ground beef. Less commonly, a variety of other food vehicles and other modes of transmission have been incriminated. Most notably, EHEC are one of the handful of bacterial enteric pathogens, which, like Shigella, can be transmitted by direct contact or by contact with contaminated fomites.


There is great anticipation and optimism on the part of most epidemiologists that irradiation of meat sold in the USA will drastically curtail the transmission of EHEC to humans, since it will curtail the single most important mode of transmission. Nevertheless, certain risk groups exposed to other modes of transmission of EHEC will not benefit from this intervention. For example, the exposure of abattoir workers to EHEC, an occupational hazard, occurs at a point in the meat processing cycle prior to when irradiation would be utilized. For such special groups such as these for whom risk will remain even after irradiation of meat becomes commonplace, anti-EHEC vaccines can be useful. The present invention provides vaccines against EHEC useful for the prevention of infection (in the animal reservoirs or in humans) and for preventing the severe complications of EHEC infection by stimulating neutralizing Shiga antitoxin.


Studies with attenuated Vibrio cholerae O1 expressing Stx1 B subunit have demonstrated the feasibility of eliciting neutralizing Shiga antitoxin by mucosal immunization with live vectors. However, since virtually all EHEC associated with HUS cases in the USA express Stx2, alone or in conjunction with Stx1, it is preferable that a vaccine for preventing the severe complications of EHEC infection via elicitation of toxin-neutralizing antibodies should stimulate anti-Stx2 as well as Stx1. It is within the broad scope of the present invention to provide a stabilized plasmid system for expressing Stx2 antigens, alone or in conjunction with Stx1, in an attenuated S. typhi live vector.


Other antigens which may be suitably delivered according to the compositions and methods of the present invention include, for example, those for hepatitis B, Haemophilus influenzae type b, hepatitis A, acellular pertussis (acP), varicella, rotavirus, Streptococcus pneumoniae (pneumococcal), and Neisseria meningitidis (meningococcal). See Ellis et al., Advances in Pharm., 39: 393423, 1997 (incorporated herein by reference). Further antigens of relevance to biodefense include: 1) one or more domains of the anthrax toxin Protective Antigen PA83 moiety, including but not limited to domain 4 (the eukaryotic cell-binding domain; D4), the processed 63 kDa biologically active form of PA83, or full-length PA83; and 2) Clostridium botulinum antigens comprising the eukaryotic cell-binding heavy chain fragment of any neurotoxin serotype A, B, C, D, E, F, or G, in any combinantion.


In one aspect, the antigens encoded by the expression plasmids of the present invention are cancer vaccines.


In another aspect, the antigens encoded by these plasmids are designed to provoke an immune response to autoantigens, B cell receptors and/or T cell receptors which are implicated in autoimmune or immunological diseases. For example, where inappropriate immune responses are raised against body tissues or environmental antigens, the vaccines of the present invention may immunize against the autoantigens, B cell receptors and/or T cell receptors to modulate the responses and ameliorate the diseases. For example, such techniques can be efficacious in treating myasthenia gravis, lupus erythematosis, rheumatoid arthritis, multiple sclerosis, allergies and asthma.


5.8.4.1 The Shiga Toxin Family


Conradi in 1903 first reported that S. dysenteriae 1 produced a powerful exotoxin. Because injection of this toxin led to hind limb paralysis of rabbits it was originally called a neurotoxin. Subsequently this toxin, Shiga toxin, was shown to be lethal for certain cells in tissue culture (i.e., it was a cytotoxin). Vicari et al. and then Keusch et al. demonstrated that it also functioned as an enterotoxin.


Scientists now recognize the existence of a family of Shiga cytotoxins which inhibit protein synthesis, leading to cell death for susceptible cells. For many years after the revelation that such toxins were produced by certain E. coli strains in addition to the original Shiga toxin produced by Shigella dysenteriae type 1, the nomenclature for this family of toxins was confusing. Since early reports described the activity of these toxins on Vero cells (a cell line derived from African green monkey kidney epithelial cells), many investigators called them verotoxins. Others referred to these toxins expressed in E. coli as Shiga-like toxins.


The protein toxins are collectively referred to herein as Shiga toxins (Stx), and the genes encoding these toxins are designated as stx with subscripts denoting the group and variant [i.e. stx1 for the Shiga toxin produced by E. coli that is essentially identical to that of Shigella dysenteriae type 1 (stx), and stx2, Stx2c, Stx2d, Stx2e for the antigenically distinct group of related toxins].


The structure, biochemistry and antigenicity of Shiga toxins are well described in Melton-Celsa et al., Eschericia coli O157:H7 and Other Shiga Toxin-producing E. coli Strains, 1998; Takeda, Bacterial Toxins and Virulence Factors in Disease, 1995; Gyles, Canadian J. of Microbiology, 38:734, 1992; and O'Brien et al., Current Topics in Microbiology and Immunology, 180:165, 1992 (the disclosures of which are incorporated herein by reference).


These Shiga cytotoxins are composed of a single catalytic A subunit of approximately 32 kDa non-covalently associated with a pentameric receptor binding domain of approximately 7.7 kDa B subunits. These subunits are encoded by a single operon of the order stxA-stxB; transcription of the stx and stx1 operons are iron-regulated in both S. dysenteriae type 1 and E. coli, but no environmental control signals have as yet been determined for any stx2 operon. None of these toxins is encoded on a plasmid; rather they are phage-encoded (Stx1, Stx2, Stx2c, and Stx2d) or are chromosomally encoded (Stx, Stx2e).


As mentioned above, all members of the Shiga toxin family are cytolytic toxins which inhibit protein synthesis within susceptible cells by blocking the binding of elongation factor 1-dependent aminoacyl-tRNA to ribosomes. For all toxins identified from human infections, penetration of susceptible cells by endocytosis follows binding of the holotoxin to the necessary cell surface glycolipid receptor globotriaosyl ceramide (Gb3), traffiking of the toxin to the Golgi apparatus and endoplasmic reticulum, followed by release into the cytoplasm. Shiga toxins are RNA N-glycosidases which depurinate a single adenine from the 28S RNA of the eukaryotic 60S ribosomal subunit, thus inactivating the 60S subunit and eventually leading to cell death.


There are six prototypic members of the Shiga toxin family: Stx, Stx1, Stx2, Stx2c, Stx2d, and Stx2e, which differ from one another immunologically and in toxic activity. Significant detail has been included here to provide background for understanding the significance of point mutations discussed below, which are required for the genetically detoxified holotoxins. The members of the Shiga toxin family differ from one another in 3 fundamental ways, as recently summarized by Melton-Celsa et al., Eschericia coli O157:H7 and Other Shiga toxin-producing E. coli strains, 1998.


(1) Immunologically: The Shiga toxin family is composed of two serogroups, Stx/Stx1 and Stx2; antisera raised against Stx/Stx1 do not neutralize members of the Stx2 serogroup, as judged by the Vero cell cytotoxicity assay.


(2) Structurally: Stx and Stx1 are essentially identical, differing in a single amino acid at position 45 of the mature A subunit, and the crystal structure for the Stx holotoxin has been solved. The prototype Stx2 is only 55% homologous to residues of the mature A subunit of Stx/Stx1 and 57% homologous to the mature B subunit, which explains why antisera raised against Stx/Stx1 do not neutralize members of the Stx2 group. Within the Stx2 group, Stx2e is most distantly related, sharing 93% amino acid homology to the mature A subunit of Stx2 and 84% homology to the mature B subunit; Stx2c and Stx2d are very similar to Stx2, sharing 99-100% homology in mature A subunit residues and 97% homology in mature B subunit residues.


(3) Cytotoxicity: Stx2 is among the most lethal of the Shiga toxins, with an LD50 for mice injected intraperitoneally of 0.5-2 ng. The LD50 for Stx1 and Stx2e is 200-400 ng, and 1-5 ng for Stx2d; however, Stx2d is unusual in that this toxin can become activated by murine intestinal mucus to increase the toxicity of the toxin, lowering the LD50 to 0.5 ng.


5.8.5 Site-Specific Mutagensis of Shiga Toxins


In one aspect, the invention provides a genetically detoxified Shiga toxin. The detoxification is accomplished by site-specific mutagenesis, introducing two defined and well-separated point mutations altering critical residues within the catalytic site of the A subunit. The invention also introduces two additional defined and well-separated point mutations within the B subunit to alter critical residues within the primary binding site (i.e. SITE I) residing within the cleft formed by adjacent B subunits of the holotoxin pentameric ring.


Prior attempts have been made to alter the lower affinity binding SITE II. However, this binding site has only been identified from molecular modeling studies, and is not extensively supported by mutational studies which favor SITE I binding of the Gb3 receptor. Even if SITE II is an alternate low-affinity binding site allowing entry of mutant holotoxin into susceptible cells, the inactivation of the catalytic domain will still prevent cell death.


Based on amino acid sequence alignments, X-ray crystallography studies, and molecular modeling studies, essential amino acids have been identified comprising the active site within the catalytic A subunit of Stx, as well as those residues comprising the binding SITE I within the B subunit pentamer of Stx/Stx1. It is the inventor's conclusion that the amino acids essential to the active site are selected from the group consisting of Tyr 77, Tyr 114, Glu 167, Arg 170, and Trp 203. The residues believed to be required for receptor binding to the clefts formed by adjacent B subunits include Lys 13, Asp 16, Asp 17, Asp 18, Thr 21, Glu 28, Phe 30, Gly 60, and Glu 65. These site predictions are consistent with functional studies and in vivo experiments using defined single and double mutations, within individual domains of the holotoxin, introduced by site-specific mutagenesis. A summary of such mutations is presented in Table 1. Based on these data and crystallographic predictions, it is within the broad practice of the invention to provide expression plasmids encoding Shiga toxins having two specific sets of point mutations within both the A and B subunits to create non-toxic mutant Stx2 holotoxins for use as vaccines, such as by expression within attenuated S. typhi live vectors such as CVD908-htrA.









TABLE 1







SITE-SPECIFIC MUTAGENESIS STUDIES















DROP IN
DROP IN
NEUTRALIZING


SUBUNIT
TOXIN
MUTATION
CYTOTOXICITY
LETHALITY
ANTIBODIES





A
Stx1
Leu201 → Val +
NO cytotoxicity






of residues 202-213



Stx1
Glu167 → Asp
103





Stx1
Arg170 → Leu
103





Stx2
Glu167 → Asp
103





Stx2e
Glu167 → Asp
104





Stx2e
Arg170 → Lys
10





Stx2e
Glu167 → Asp
104






Arg170 → Lys



Stx2e
Glu167 → Gln
106
104
Y


B
Stx
Asp16 → His +
NO cytotoxicity






Asp17 → His



Stx
Arg33 → Cys
108





Stx
Gly60 → Asp
106





Stx1
Phe30 → Ala
105
10
Y



Stx2
Ala42 → Thr
103-104
Y
Y



Stx2
Gly 59 → Asp
103-104
Y
Y









5.9 Live Bacterial Vectors


Bacterial live vectors for use in delivering antigens to a host immune system include attenuated enteric pathogens (e.g., Salmonella typhi, Shigella, Vibrio cholerae), commensals (e.g., Lactobacillus, Streptococcus gordonii) and licensed vaccine strains (e.g., BCG). S. typhi is a particularly attractive strain for human vaccination.


In a particular aspect, the stabilized expression plasmids are employed in attenuated bacterial strains having successfully completed Phase I clinical trials, including Salmonella typhi vaccine strains such as CVD908-htrA and CVD 909, as well as the Shigella flexneri 2a strain CVD 1208s, and attenuated Vibrio cholerae CVD 103-HgR.


5.10 Pharmaceutical Formulations


It is contemplated that the bacterial live vector vaccines of the present invention will be administered in pharmaceutical formulations for use in vaccination of individuals, preferably humans. Such pharmaceutical formulations may include pharmaceutically effective carriers, and optionally, may include other therapeutic ingredients, such as various adjuvants known in the art.


The carrier or carriers must be pharmaceutically acceptable in the sense that they are compatible with the therapeutic ingredients and are not unduly deleterious to the recipient thereof. The therapeutic ingredient or ingredients are provided in an amount and frequency necessary to achieve the desired immunological effect.


The mode of administration and dosage forms will affect the therapeutic amounts of the compounds which are desirable and efficacious for the vaccination application. The bacterial live vector materials are delivered in an amount capable of eliciting an immune reaction in which it is effective to increase the patient's immune response to the expressed mutant holotoxin or to other desired heterologous antigen(s). An immunizationally effective amount is an amount which confers an increased ability to prevent, delay or reduce the severity of the onset of a disease, as compared to such abilities in the absence of such immunization. It will be readily apparent to one of skill in the art that this amount will vary based on factors such as the weight and health of the recipient, the type of protein or peptide being expressed, the type of infecting organism being combatted, and the mode of administration of the compositions.


The modes of administration may comprise the use of any suitable means and/or methods for delivering the bacterial live vector vaccines to a corporeal locus of the host animal where the bacterial live vector vaccines are immunostimulatively effective.


Delivery modes may include, without limitation, parenteral administration methods, such as subcutaneous (SC) injection, intravenous (IV) injection, transdermal, intramuscular (IM), intradermal (ID), as well as non-parenteral, e.g., oral, nasal, intravaginal, pulmonary, opthalmic and/or rectal administration.


The dose rate and suitable dosage forms for the bacterial live vector vaccine compositions of the present invention may be readily determined by those of ordinary skill in the art without undue experimentation, by use of conventional antibody titer determination techniques and conventional bioefficacy/biocompatibility protocols. Among other things, the dose rate and suitable dosage forms depend on the particular antigen employed, the desired therapeutic effect, and the desired time span of bioactivity.


The bacterial live vector vaccines of the present invention may be usefully administered to the host animal with any other suitable pharmacologically or physiologically active agents, e.g., antigenic and/or other biologically active substances.


Formulations of the present invention can be presented, for example, as discrete units such as capsules, cachets, tablets or lozenges, each containing a predetermined amount of the vector delivery structure; or as a suspension.


6. EXAMPLES

An isogenic series of expression plasmids composed of individual cassettes has been constructed for use in bacterial live vector vaccines, such as E. coli and Salmonella. With the exception of ribosomal binding sites (RBS), the key genetic loci controlling transcription initiation and termination, plasmid replication, or encoding expressed proteins are contained within defined restriction fragments, as depicted by the representative plasmid diagram of pGEN2 seen in FIG. 1A. The basic structure of these expression plasmids will first be highlighted and then the data demonstrating the function of each locus within the attenuated vaccine strain CVD908-htrA will be summarized.


6.1 pGEN Structure


Transcription of any heterologous antigen to be expressed within CVD908-htrA is primarily controlled by an inducible promoter contained on an EcoRI-BglII cassette. Since the expression plasmids were initially modeled after pTETnir15, early versions carried the anaerobically-activated nir15 promoter (Pnir15). However, this promoter has been replaced with a more tightly regulated osmotically controlled promoter PompC which is easily manipulated in vitro by varying the concentration of NaCl.


Heterologous antigens are contained on a BglII-AvrII cassette, flanked by an optimized RBS at the 5′-proximal end and a trpA transcriptional terminator at the 3′-distal end of this cassette. The origin of replication for these expression plasmids has been designed as an AvrII-BglII cassette, and is protected from read-through transcription originating in flanking regions. These cassettes carry an extremely efficient derivative of the T1T2 transcriptional terminator at one terminus with the trpa transcriptional terminator from the heterologous antigen cassette at the opposite end of the replication cassette.


The flanking BglII and SpeI sites (see FIG. 2) between the replication cassette and the selection cassette are intended for insertion of a plasmid maintenance function, such as the par locus from pSC101. The selection cassettes contained within the plasmids are contained within SpeI-XbaI cassettes, and can, for example, be used to encode resistance to carbenicillin (the bIa gene) or resistance to tetracycline (the tetA gene, see FIG. 1).


The drug resistance cassette can be replaced with the ssb gene encoding the essential single stranded binding protein of Salmonella typhi CVD908-htrA.


The flanking XbaI and EcoRI sites between the selection cassette and PompC are intended for insertion of additional maintenance functions, including a PSK locus such as hok-sok (see FIGS. 1 and 2), or an additional partition function such as the parA locus from pR1 (see FIGS. 7D & E).


6.2 Modified ompC Promoter


It was intended that any promoter controlling transcription of a heterologous gene be responsive to an environmental signal of biological relevance. For the expression plasmids described here, an ompC promoter cassette (PompC) from E. coli was used (SEQ ID NO:67), which is induced by increases in osmolarity. Construction of this cassette was based on the published sequence of PompC published by Norioka et al (Norioka et al. J. Biol. Chem. 261:17113-9 (1986); GenBank accession no. K00541) and was carried out using synthetic primers to create a 459 bp EcoRI-BglII cassette in which the natural RBS was removed.


To confirm that this promoter was osmotically controlled within CVD 908-htrA, a derivative of pTETnir15 was constructed in which Pnir15-toxC was replaced by a cassette comprised of PompC driving expression of a promoterless aphA-2 cassette conferring resistance to kanamycin. This plasmid, designated pKompC, was introduced into CVD 908-htrA by electroporation, and recipients were screened for resistance to kanamycin on LB medium. The osmotically regulated expression of aphA-2 was determined by inoculating CVD 908-htrA(pKompC) into 50 ml of supplemented nutrient broth (NB) containing increasing concentrations of kanamycin from 0 to 300 μg/ml; a parallel set of cultures were set up with the identical ranges of kanamycin added, but also containing 10% sucrose to induce P.sub.ompCompC. Cultures were incubated overnight at 37° C., and the O.D.600 was measured. Results are reported in the Table 2, Experiment 1.


TABLE 2 shows induction with osmolarity of the promoter PompC, controlling expression of resistance to kanamycin, within the attenuated S. typhi live vector CVD 908-htrA.










TABLE 2







EXPERIMENT 11
EXPERIMENT 22












Concen-


Concen-




tration


tration


of
Low
10%
of
Low
300 mM


kanamycin
osmolarity
sucrose
kanamycin
osmolarity
NaCl


(μg/ml)
(O.D.600)
(O.D.600)
(μg/ml)
(O.D.600)
(O.D.600)















0
0.92
0.35
0
0.95
1.04


50
0.13
0.35
200
0.04
0.99


100
0.07
0.31
400
0.02
0.96


200
0.03
0.21
600
0.01
0.92


300
0.02
0.19
800
0.01
0.92






1A culture of CVD908-htrA(pKompC) was set up in LB broth supplemented with 0.0001% (w/v) 2,3-dihydroxybenzoic acid (DHB) and 50. μg/ml of kanamycin, and was incubated for 16 hr at 37° C. This initial culture was then diluted 1:10 into fresh medium and incubated at 37° C. for two hrs to provide a seed culture of exponentially growing bacteria. 50 μl of this culturewere then inoculated into 50 ml Nutrient Broth (NB) cultures supplemented with DHB as above, but with increasing concentrations of kanamycin; a parallel set of cultures were set up with the identical ranges of kanamycin added, but also containing 10% sucrose to hopefully induce PompC. Cultures were incubated overnight at 37° C., and the O.D600 was measured.




2A culture of CVD908-htrA(pKompC) in supplemented LB broth and kanamycin was incubated for 16 hr at 37° C., diluted 1:10 into fresh medium, and incubated at 37° C. for two hrs to provide a seed culture of exponentially growing bacteria. 100 μl aliquots of this culture were then inoculated into 50 ml NB broth cultures containing increasing concentrations of kanamycin from 200 to 800 μg/ml; aparallel set of cultures were set up containing 300 mM NaCl, and all cultures were incubated at 37° C. for 16 hr. and the O.D.600 was measured.







Regardless of selective pressure using kanamycin, the presence of 10% sucrose had an inhibitory effect on the growth of CVD 908-htrA(pKompC). However, the results suggested that E. coli PompC was osmotically controlled when driving aphA-2 gene expression within CVD 908-htrA(pKompC). To confirm this, CVD 908-htrA(pKompC) was inoculated into 50 ml of supplemented NB broth, containing increasing concentrations of kanamycin from 200 to 800 μg/ml; a parallel set of cultures was again set up containing 300 mM NaCl to induce PompC. Cultures were incubated at 37° C. for 16 hr, and results are reported in Table 2, Experiment 2. It was confirmed that PompC-driven expression of the aphA-2 gene within CVD 908-htrA confers resistance to kanamycin at levels up to 800 μg/ml in an osmotically regulated manner.


The aph gene cassette was then replaced with a 756 bp BglII-NheI cassette containing the gfpuv allele encoding GFPuv. During the visual screening of E. coli colonies sub-illuminated with ultraviolet light, one very brightly fluorescing colony and another representative fluorescent colony were chosen for further study, designated clone 1 and clone 3, respectively. Upon purification of the plasmids involved, it was determined that clone 1 contained a plasmid that no longer carried a BglII site separating PompC and gfpuv, while clone 3 carried the expected BglII site. The induction of GFP expression was examined when clones 1 and 3 were grown on nutrient agar in the presence or absence of NaCl, and determined by visual inspection that clone 3 displayed very little fluorescence when grown on nutrient agar containing no NaCl but fluoresced brightly when plated on nutrient agar containing 300 mM NaCl (data not shown). Clone 1, however, had a higher background level of fluorescence when uninduced, but fluoresced intensely when induced with 300 mM NaCl. To rule out mutations within the gfpuv gene which might affect fluorescence, PompC from clone 1 was replaced with PompC from clone 3, and confirmed the expected decrease in fluorescence as judged by sub-illumination (data not shown). It was concluded that differences in observed fluorescence were controlled by two genetically distinct versions of the PompC promoter, which were designated as PompC (higher transcription levels with less osmotic control) and PompC3 (moderate transcription levels with osmotic control similar to that observed for the PompC-aph cassette described above); the plasmids containing these expression cassettes were designated as pGFPompC1 and pGFPompC3, respectively.


To quantify the differences in induced and uninduced expression of gfpuv controlled by PompC1 and PompC3, GFPuv synthesis was monitored within both E. coli DH5α and S. typhi CVD 908-htrA using flow cytometry. This powerful technique has the unique advantages of allowing rapid measurement of GFPuv expression within large numbers of individual bacteria, as well as accurately determining the mean intensity of fluorescence due to GFPuv synthesis within each bacterial population analyzed. To accomplish this, pGFPompC1 and pGFPompC3 were introduced by electroporation, and colonies were isolated on supplemented 1×LB agar containing 100 μg/ml of carbenicillin grown at 30° C. for 48 hr. Isolated colonies were then grown up and cultures frozen down as master stocks. Fresh colonies were then inoculated into either supplemented nutrient broth or supplemented nutrient broth containing 150 mM NaCl, and grown at 37° C./250 rpm for 24 hr; the difference in O.D.600 for any culture was never greater than 0.07. Induction of expression of gfpuv, controlled by PompC1 and PompC3, was analyzed by flow cytometry, and results are presented in Table 3.


TABLE 3 shows a comparison of induction of PompC1 and PompC3, controlling expression of GFPuv, within the host strains E. coli DH5α and CVD 908-htrA.1














TABLE 3







Mean

Mean




Low
Fluores-
150 mM
Fluores-
Induc-



osmolarity
cence
NaCl
cence
tion


STRAIN
(O.D.600)
Intensity
(O.D.600)
Intensity
Ratio2




















DH5α
0.61
0.28
0.95
0.29
NA3


DH5α
0.56
4.45
0.72
7.69
1.7


(pGFPompC1)


DH5α
0.58
1.77
0.73
4.21
2.4


(pGFPompC3)


CVD 908-htrA
0.58
0.27
0.65
0.26
NA


CVD 908-htrA
0.60
5.37
0.54
23.4
4.4


(pGFPompC1)


CVD 908-htrA
0.54
2.56
0.53
17.1
6.7


(pGFPompC3)






1All strains were streaked from frozen master stocks onto 2× LB agar supplemented with DHB and 50 μg/ml of carbenicillin, and incubated for 36 hr at 30° C. Isolated colonies were pooled into 300 μl of NB broth supplemented with DHB and carbenicillin,from which 25 μl were inoculated into 25 ml supplemented NB broth, with and without 150 mM NaCl, and incubated at 37° C., 250 rpm for 24 hr. Bacteria were then pelleted, resuspended in 1 ml PBS pH 7.4, and then diluted 1:1000 into PBS for analysis by flow cytometry.




2Defined as the ratio of mean fluorescent intensity measured after induction with 150 mM NaCl, divided by basal level of mean fluorescent intensity measured at low osmolarity.




3NA = not applicable.







The basal level of expression for the PompC1-gfpuv cassette is 2.5 times higher than for the PompC3-gfpuv cassette, when expressed in DH5α, and 2.1 times higher when expressed within CVD 908-htrA; however, the basal level of fluorescence detected for synthesis of GFPuv never exceeded a mean fluorescent intensity of 5.37, regardless of host background. If induction ratio is defined as the ratio of mean fluorescent intensity measured after induction, divided by basal level of mean fluorescent intensity, it was observed that when induced with 150 mM NaCl, PompC1 and PompC3 displayed within DH5α induction ratios of 1.7 and 2.4 respectively. Surprisingly, the induction ratio for PompC1 when measured in CVD 908-htrA was 4.4, and produced a maximum mean fluorescence intensity of 23.4 for these experiments. Although the induction ratio for PompC3 within CVD 908-htrA was 6.7, the mean fluorescence intensity of 17.1 was lower than measured for PompC1. Based on these data, it appears that PompC1 is the strongest and yet osmotically controlled of the two ompC promoters. PompC1 was therefore chosen for synthesis of the widest possible range of heterologous test antigen to examine the effects of such synthesis on plasmid stability.


These data clearly show that when driving expression of gfpuv within the live vector strain CVD 908-htrA, PompC1 and PompC3 are inducible with increasing osmolarity, although the basal level of transcription is still noteworthy in both cases. The results observed under conditions of low osmolarity further support observations using solid media that PompC1 drives higher heterologous antigen expression than PompC3. Since PompC3 was noted to possess the intended 3′-terminal BglII site, which was not detected for PompC1, the nucleotide sequence for PompC1 was determined to perhaps detect point mutation(s) which might explain the strength of PompC1. The only differences identified were located at the 3′-terminus of the cassette. The intended sequence within this region was 5′- . . . catataacAGATCTtaatcatccacAGGAGGatatctgATG-3′ (SEQ ID NO: 4) (from left to right, upper case denotes the BglII site, ribosome binding site, and GFPuv start codon respectively); the actual sequence proved to be 5′- . . . catataacAGATCGATCTtaaAcatccacAGGAGGAtAtctgATG-3 (SEQ ID NO: 5) (inserted or changed bases denoted with underlined bold upper case). These changes detected within the ompC1 promoter sequence are apparently responsible for increasing the observed strength of PompC1 by an unknown mechanism, since neither the basic ompC promoter sequence, nor the optimized ribosome binding site have been spontaneously altered.


6.3 Origins of Replication and Selection Cassettes


The success of expressing potentially toxic or otherwise problematic heterologous antigens within CVD908-htrA depends on the copy number of the expression plasmid. In addition, observed immune responses to a given heterologous antigen are affected by the copy number of the gene(s) encoding the antigen, with chromosomally expressed antigens eliciting poorer immune responses when compared to plasmid-based expression.


An optimized immune response will depend on multicopy plasmid-based expression of the heterologous antigen(s) from plasmids with the appropriate copy number.


Since the appropriate copy number for a given heterologous gene cannot be known a priori, the present invention provides a set of expression plasmids which contain the origins of replication oriE1 (amplified from pAT153; copy number ˜60), ori15A (amplified from pACYC184; copy number ˜15), and ori101 (amplified from pSC101; copy number ˜5). These self-contained replication cassettes are all carried on BglII-BamHI fragments, and are depicted for a set of 3 tetracycline-resistance expression plasmids shown in FIGS. 1A-1C.


Expression of the PompC1-controlled gfpuv expression cassette contained on these expression plasmids was analyzed using flow cytometry. These experiments were designed to detect whether differences in the level of observed fluorescence could be correlated with the expected copy number of a given expression plasmid. CVD908-htrA strains carrying pGEN2, pGEN3, and pGEN4 were streaked onto the rich medium SuperAgar supplemented with DHB and 20 μg/ml tetracycline where appropriate. SuperAgar was used because it is a very rich medium (3×LB agar). Plates were incubated at 30° C. to reduce the toxicity of GFP synthesis and allow bacteria to grow luxuriously on the plates. Isolated colonies were then inoculated into 45 ml of SuperBroth supplemented with DHB and 20 μg/ml tetracycline where appropriate, and incubated at 37° C. for 16 hr. Bacteria were concentrated by centrifugation and resuspended in 1 ml of sterile PBS, pH=7.4, and diluted 1:100 in PBS, pH=7.4 prior to FACS analysis. Bacteria were analyzed by flow cytometry, as described above, for two independent growth experiments, and results are displayed in Table 4 at the end of this section.


These data support the conclusion that overexpression of GFPuv within CVD908-htrA is toxic to the bacteria. As the theoretical copy number increases for the plasmids pGEN4, pGEN3, and pGEN2 expressing GFPuv under identical growth conditions from the identical PompC1 promoter, the percentage of the growing population which fluoresces declines. It is expected that the “dim” bacteria are not viable bacteria and may no longer contain the expression plasmid, since these cultures were grown in the presence of 20 μg/ml tetracycline. It is noted, however, that when streaked onto solid medium and grown at 37° C. for 24-36 hr, CVD908-htrA(pGEN2) grows poorly and fails to produce isolated colonies, while CVD908-htrA(pGEN3) and CVD908-htrA(pGEN4) grow quite well and produce intensely fluorescing isolated colonies.


GFPuv is employed herein as representative of other problematic heterologous antigens which would be of interest to include in a bacterial live vector, such as the S. typhi-based live vector; however, it will be appreciated that GFPuv can be replaced by any non-metabolic protein or peptide antigen.


The data above show that although use of medium-copy expression plasmids containing oriE1 replicons can be of use in expression of some antigens, expression of antigens of higher toxicity will be more successfully expressed from lower copy number plasmids which employ origins of replication yielding average copy numbers between 2 and 30, such as ori101 or ori15A origins of replication.












TABLE 4









Experiment 1
Experiment 2

















Mean



Mean






Fluorescence
Percentb
Mean

Fluorescence
Percent
Mean



Percent
Of Dim Bacteria
Fluorescing
Fluorescence
Percent
Of Dim Bacteria
Fluorescing
Fluorescence


Strain
Dim Bacteria
(Relative Units)
Bacteria
(Relative Units)
Dim Bacteria
(Relative Units)
Bacteria
(Relative Units)


















CVD908-htrA
100
0.6
0
0
100
0.3
0
0


CVD908-
19.9
0.1
80.1
38.5
37.2
0.3
62.8
10.1


htrA(pGEN2)


CVD908-
17.1
0.1
82.9
28.1
4.9
0.2
95.1
8.28


htrA(pGEN3)


CVD908-
12.1
0.1
88.0
22.4
9.4
0.3
90.6
4.25


htrA(pGEN4)









6.4 The hok-sok Antisense Post-Segregational Killing Locus


Using the polymerase chain reaction, the hok-sok PSK genes were amplified using the multiple antibiotic resistance R-plasmid pR1 as the template in these reactions. All initial attempts to clone this locus onto either high or medium copy number plasmids were unsuccessful. In order to directly select for the hok-sok locus during subcloning, a set of primers was designed for use in overlapping PCR reactions such that the final product was a fragment containing a genetic fusion of the hok-sok locus from pR1 and a promoterless tetA gene from pBR322 encoding resistance to tetracycline. This cassette was engineered such that transcription of the hok gene would continue into tetA; the two loci within this cassette were separated by an XbaI restriction site for future manipulations.


Construction of this cassette not only allowed for direct selection of the hok-sok locus, but also allowed for confirmation that the PSK function would operate in S. typhi CVD908-htrA. After electroporation of plasmids carrying the cassette into CVD908-htrA, transformants could be selected using tetracycline. Successful recovery of isolated colonies indicates successful synthesis of the hok-tetA mRNA, and successful synthesis of the antisense sok RNA to prevent translation and synthesis of Hok, which would kill the bacteria. Recovery of the hok-sok-tetA cassette then became straightforward, and was easily incorporated into expression plasmids to create the selectable marker cassette of the plasmids pGEN2, pGEN3, and pGEN4 depicted in FIGS. 1A-1C.


Experiments were then initiated to determine the effect of the hok-sok PSK function on the stability of expression plasmids containing oriE1 and the resistance marker bla encoding β.-lactamase which confers resistance to carbenicillin. The hok-sok cassette was inserted into the pAT153-based expression plasmid pTETnir15, in which the Pnir15-toxC heterologous antigen cassette was replaced with the PompC1-gfpuv cassette, creating the plasmids pJN72 (without hok-sok) and pJN51 (with hok-sok). An additional set of plasmids was created by replacing P.sub.ompC1 with the weaker promoter PompC3, creating pJN10 and pJN12; the structures of these four isogenic plasmids are represented in FIG. 2. CVD908-htrA strains carrying either pJN72, pJN51, pJN10, or pJN12 were streaked onto the rich medium SuperAgar supplemented with DHB and 100 μg/ml carbenicillin, and plates were incubated as above for the pGEN plasmids at 30° C. to reduce the toxicity of GFPuv synthesis and allow bacteria to grow luxuriously on the plates.


Isolated colonies were then inoculated into 45 ml of Super broth supplemented with DHB and 100 μg/ml carbenicillin and grown at 37° C. for 24 hours for analysis by flow cytometry of fluorescence. A second independent experiment was carried out exactly as the first, except isolated colonies were suspended in 500 μl of Super broth and 250 μl each inoculated into 45 ml paired Super broth cultures with or without 300 mM NaCl added to induce the PompC-gfpuv cassettes; cultures were incubated at 37° C. for 48 hrs and again analyzed by flow cytometry; and results for both experiments are displayed in Table 5. Fluorescence histograms for uninduced and induced expression plasmids from experiment 2 are represented in FIGS. 3A-3H.












TABLE 5









Experiment 1
Experiment 2



















Mean





Mean





Percent
Fluorescence
Percent




Fluorescence
%



Dim
Of Dim
Fluorescing
Mean

+/−300
% Dim
Of Dim
Fluorescing
Mean


Strain
Bacteria
Bacteria
Bacteria
Fluorescence
OD.600
mM NaCl
Bacteria
Bacteria
Bacteria
Fluorescence




















CVD908-htrA
100
0.3


0.73

100
0.3
0
0


CVD908-
3.1
0.2
96.9
10.2
0.75

2.3
0.3
97.7
11.7


htrA(pJN72)




0.89
+
22.2
0.3
77.8
22.5


CVD908-
58.1
0.3
41.9
6.29
0.62

56.3
0.3
43.7
18.4


htrA(pJN72)




0.82
+
95.4
0.3
4.6
21.0


CVD908-
5.4
0.2
94.6
7.43
0.72

1.7
0.3
98.3
8.3


htrA(pJN10)




0.96
+
29.9
0.3
70.1
19.8


CVD908-
18.9
0.2
81.1
6.60
0.47

45.2
0.3
54.8
16.4


htrA(pJN12)




0.68
+
95.6
0.3
4.4
13.2









These flow cytometry results can be explained as follows: expression of GFPuv (or other potentially detrimental heterologous antigen) from a multicopy expression plasmid such as pJN72 increases the metabolic stress on the CVD 908-htrA(pJN72) live vector, and increases plasmid instability in the absence of selection. Since the selectable marker of the expression plasmid encodes the secreted enzyme .beta.-lactamase, then as time increases the concentration of carbenicillin in the surrounding medium declines, selective pressure decreases, and the frequency of plasmid loss increases; however, since multicopy plasmids are involved, relatively few bacteria succeed in losing all resident plasmids, but the average copy number of pJN72 per bacterium drops.


Quantitation by flow cytometry of GFPuv production for an uninduced population of healthy growing CVD 908-htrA(pJN72) indicates that the majority of bacteria express GFPuv and few non-fluorescing cells are detected (FIG. 3A). However, increasing production of GFPuv by induction of the PompC1-gfpuv cassette increases the metabolic stress on CVD 908-htrA(pJN72), and although the production of GFP doubles, the percentage of non-fluorescent bacteria increases as more plasmids are lost from the population (FIG. 3B).


In a similar population of growing CVD 908-htrA(pJN51), each bacterium carries multicopy plasmids encoding both GFPuv and a PSK function. The frequency of plasmid loss for pJN51 remains the same as for pJN72, but in this case as individual bacteria lose copies of the expression plasmid, the 1:1 stoichiometry between the mRNA levels of hok and sok is disturbed, and production of Hok leads to cell death; therefore, the only CVD 908-htrA(pJN51) bacteria that will grow rapidly will be those which retain all of their expression plasmids. Accordingly, it is not surprising that quantitation by flow cytometry of GFPuv production for an uninduced population of healthy growing CVD 908-htrA(pJN51) now detects a population of fluorescing bacteria which displays levels of GFPuv fluorescence equivalent to those observed for CVD 908-htrA(pJN72) grown under inducing conditions (FIG. 3C vs FIG. 3B); however, the percentage of non-fluorescing bacteria rises to over half the overall population of organisms.


Increasing production of GFPuv in this population by induction of the PompC1-gfpuv cassette in CVD 908-htrA(pJN51) again increases the metabolic stress on the live vector, but now the percentage of non-fluorescent bacteria almost completely overtakes the few fluorescing bacteria as many plasmids are presumably lost from the population and bacteria are killed (FIG. 2D).


One would expect that if a weaker promoter is used to control expression of GFPuv, the overall fluorescence of the population would be decreased (compared to that observed for a similar population of organisms grown with a strong promoter expressing GFPuv under identical conditions), and the percentage of non-fluorescent bacteria should drop due to the overall drop in GFPuv synthesis. However, as seen in FIGS. 3E-3H, use of the weaker PompC3-gfpuv cassette did not significantly improve the viability of induced bacteria carrying a killing system, even though overall expression of GFPuv was reduced.


It is concluded that in order to maximize the percentage of a population of live vectors expressing the heterologous antigen of choice, it is not sufficient only to incorporate a PSK function into a given expression plasmid, whether it be a drug resistance marker, the asd system, an alternate ssb system, or the hok-sok killing system. In addition to optimizing copy number and expression levels, the segregation frequencies of these plasmids must also be improved to ensure that each daughter cell in an actively growing population will inherit at least one expression plasmid and those that do not will be killed and removed from the population. It is therefore within the scope of the present invention to provide an expression plasmid having a PSK function and further having optimized copy number and/or expression levels, coupled with incorporation of one or more SEG functions.


6.5 Complementation-Based Killing System


It is also within the broad scope of the present invention to provide an expression plasmid comprising a complementation-based killing system, for example, a system involving the deletion of the chromosomal ssb locus of CVD908-htrA by homologous recombination, and trans-complementation of this lesion using multicopy plasmids carrying functional ssb.


To carry out such constructions requires cloning the relevant section of the S. typhi chromosome encompassing the ssb gene and flanking sequences, into which specific deletions can be introduced for chromosomal mutagensis.


Since the original submission, substantial progress has been made in the sequenceing of the Salmonella typhi chromosome at the Sanger Centre in London. The Sanger Centre is a genome research center set up in 1992 by the Wellcome Trust and the Medical Research Council in order to further knowledge of genomes. Among other projects, the Sanger Centre is sequencing the 4.5 Mb genome of S. typhi, in collaboration with Gordon Dougan of the Department of Biochemistry, Imperial College, London. They are sequencing strain CT18, a highly pathogenic, multiple drug resistant strain isolated from a typhoid patient in Cho Quan Hospital, Ho Chi Minh City, Vietnam. This strain is known to harbor pVN100 (a 130 kb multidrug resistance plasmid) and a cryptic 80 kb plasmid. The genome is being sequenced by a whole genome shot gun approach using a 2 kb pUC library, generated inhouse from chromosomal DNA supplied by Prof. Dougan's lab. Each insert is being sequenced once from each end. The shotgun phase is now complete, and finishing has begun. At present there are 60 contigs over 1 kb in the database; a total of 5.106 Mb of sequence assembled from 87,331 reads.


Based on updated results posted Oct. 4, 1999, Contig 343 was identified, which contains the S. typhi ssb locus and critical flanking sequences within a 205,199 bp region. Primers1 and 4 (listed below) were designed to amplify by PCR a 3535 bp fragment of the S. typhi chromosome in which the ssb locus is flanked by 1.5 kb of chromosomal sequence; this flanking symmetry is required for optimal crossover frequenceis to introduce the counter-selectable sacB-neo cassette and replace ssb. Using the methodology previously filed, primers 1 and 2 are used to engineer a 5′-proximal 1.5 kb Eco RI-Xma I cassette, upstream of ssb. Primers 3 and 4 are used to generate the 3′-distal 1.5 kb Xma I-Eco RI cassette, downstream of ssb; both 1.5 kb cassettes will be ligated together, forming the 3 kb Eco RI fragment containing a unique Xma I site exactly in the middle of the cassette. The sacB-neo cassette can now easily be inserted into the Xma I site, to complete construction of the mutagenesis cassette to be inserted into pCON (previously described in an earlier application). The required complementing ssb-1 cassette will be constructed using primers 5 and 6 as a Nhe I cassette for replacement of drug resistance markers within the Xba I-Spe I cassettes of pGEN 211, pGEN 222, pGEN 206, or any later version of the expression plasmids detailed herein.










PRIMER 1:









(SEQ ID NO: 6)









5′-gaattcGCGCGCTTCGCGATTCAGTCGCGTTCCTTCACAGCTGGCGC






AGGGGCGATTACTGATGAA-3′





PRIMER 2:








(SEQ ID NO: 7)









5′-cccggGAGTCTCCTGAATACGTTTCATAAAAGTGTAAACGCGTGAGT






GTACCATTTCCACGTAGC-3′





PRIMER 3:








(SEQ ID NO: 8)









5′-cccggGTAAAAAACTCAAAGCGTTATTTGCATTTTCGCTATAGTTCT






CGTCTGCTGAAATGCCTGGTGT-3′





PRIMER 4:








(SEQ ID NO: 9)









5′-gaattcCATTTCTATCAATAAATTACTATTAGTTTTGTCTTCTAACC






AAGCCTCTATTTTATGAGTATCCTCTTCAG-3′





PRIMER 5:








(SEQ ID NO: 10)









5′-gctagcATGGCCAGCAGAGGCGTAAACAAGGTGATTCTCGTTGGTAA






TCTGGGCCAGGACCCGGAAGTACGC-3′





PRIMER 6:








(SEQ ID NO: 11)









5′-gctagcTCAGAACGGAATGTCGTCGTCAAAATCCATTGGCGGTTCGT






TAGACGGCGCTGGCGCG-3′






6.6 Stability of Expression Plasmids in the Absence of Selection


In order to develop a non-catalytic plasmid maintenance system to enhance the stability of multicopy expression plasmids encoding foreign antigens within CVD 908-htrA, experiments were initiated to monitor plasmid stability by quantitating expression of GFPuv by flow cytometry when strains were passaged in the absence of antibiotic selection. These experiments were designed to address 3 fundamental questions: 1] What is the effect of the induction level of PompC1 on the stability of plasmids encoding a heterologous antigen such as GFPuv? 2] What is the effect of copy number on the stability of plasmids expressing GFPuv? 3] How do the hok-sok, par, and parA maintenance functions affect plasmid retention, both as individual components and synergistically?


Initial flow cytometry experiments were carried out in which CVD 908-htrA carried replicons with either the oriE1, ori15A, or ori101 origin of replication. It was quickly determined that replicons carrying the higher copy number oriE1 origins were very unstable, even when strains were grown in the presence of antibiotic selection. Flow cytometry results indicated that even when cultured in the presence of carbenicillin, the percentage of the bacterial populations no longer expressing detectable GFPuv ranged from approximately 50% for pGEN71 (carrying hok-sok) and pGEN84 (hok-sok+par) to 62% for pGEN211 (hok-sok+par+parA). Since replicons carrying an oriE1 origin clearly did not allow for optimal synthesis of the heterologous GFPuv test antigen within the majority of a growing population of live vector bacteria, this series of expression plasmids was not examined further.


CVD 908-htrA carrying expression plasmids with an ori15A origin were then examined. Strains were inoculated into 25 ml cultures of 1×LB+DHB (no antibiotic selection) containing either 50 mM, 150 mM, or 300 mM NaCl. Cultures were incubated for 24 hr at 37° C./250 rpm, diluted 1:1000 into fresh medium of identical osmolarity, and incubated for another 24 hr; samples from all cultures were analyzed for levels of GFPuv synthesis by flow cytometry. Results for the first passage in the absence of selection are listed in Table 6, and the histograms representing these data are shown in FIG. 8.


TABLE 6 shows stability within CVD 908-htrA of ori15A replicons, containing plasmid maintenance systems of increasing complexity, grown without selection and in the presence of increasing osmolarity.1













TABLE 6









50 mM NaCl
150 mM NaCl
300 mM NaCl


















Percent
Mean

Percent
Mean

Percent
Mean




Fluorescing
Fluorescence

Fluorescing
Fluorescence

Fluorescing
Fluorescence


STRAIN2
O.D.600
Bacteria
Intensity
O.D.600
Bacteria
Intensity
O.D.600
Bacteria
Intensity



















CVD908-htrA
0.98
100
0.6
1.11
100
0.6
1.12
100
0.6


pGEN91
1.00
13.2
28.6
1.17
11.4
42.9
1.26
10.9
65.5


pGEN111
1.26
47.4
51.8
1.17
28.9
93.6
1.12
42.4
65.1


pGEN121
1.01
80.5
53.3
1.20
73.8
74.0
1.15
56.7
105.3


pGEN193
1.11
71.4
50.9
1.24
65.2
64.7
1.22
53.7
90.8


pGEN222
1.01
96.8
52.1
1.28
93.3
67.8
1.13
95.3
89.2






1These data are represented as histograms in FIG. 8.




2All strains were streaked from frozen master stocks onto 2× LB agar supplemented with DHB and 50 μg/ml of carbenicillin, and incubated for 36 hr at 30° C. Isolated colonies were pooled into 300 μl of 1× LB broth supplemented with DHB, from which 25 μl were inoculated into25 ml of 1× LB broth containing DHB and either 50 mM, 150 mM, or 300 mM NaCl; cultures were incubated at 37° C., 250 rpm for 24 hr. For the results presented in this table, bacteria were then pelleted, resuspended in 1 ml PBS pH 7.4, and then diluted 1:1000 into PBS for analysis by flow cytometry.







In general, as osmolarity increases and induction of PompC1 rises, the percentage of the live vector population expressing GFPuv drops; nevertheless, the mean level of fluorescence intensity increases as expected. For example, in the presence of 50 mM NaCl, 80.5% of a population of CVD 908-htrA(pGEN121) express GFPuv with a mean fluorescence intensity of 53.3. As the concentration of NaCl increases to 300 mM NaCl, the percentage of the population expressing GFPuv drops to 56.7%; nevertheless, the mean fluorescence intensity rises to 105.3. However, it is notable that for strains carrying pGEN222 with a complete plasmid maintenance system (i.e hok-sok+par+parA), the percentage of the population expressing the heterologous antigen remains at approximately 95%, while the mean fluorescence intensity increases from 52.1 (50 mM NaCl) to 89.2 (300 mM NaCl). It was noted that upon further passage of these strains for an additional 24 hrs in the absence of antibiotic selection, less than 5% of bacteria continued to express functional GFPuv. Streaks of these cultures onto solid medium, prior to flow analysis, indicated that non-fluorescing bacteria remained viable, but were sensitive to antibiotic selection. When non-fluorescing bacteria were sorted and plated, they were confirmed to be sensitive to antibiotic and non-fluorescent when irradiated with ultraviolet light, indicating loss of resident plasmids.


A passage experiment involving CVD 908-htrA carrying expression plasmids with an ori101 origin detected no significant loss of GFPuv expression after passage of strains for 48 hrs without selection, regardless of osmolarity. Therefore, strains were passaged in a separate experiment for 96 hrs (i.e. 4×24 hr) in the presence of either 50, 150, or 300 mM NaCl. Populations were analyzed by flow cytometry after 3 and 4 passages, and results are recorded in Table 7.


TABLE 7 shows stability within CVD 908-htrA of ori101 replicons, containing plasmid maintenance systems of increasing complexity, grown without selection and in the presence of increasing osmolarity.













TABLE 7









50 mM NaCl
150 mM NaCl
300 mM NaCl


















Percent
Mean

Percent
Mean

Percent
Mean


STRAIN (Passage

Fluorescing
Fluorescence

Fluorescing
Fluorescence

Fluorescing
Fluorescence


Number)1
O.D.600
Bacteria
Intensity
O.D.600
Bacteria
Intensity
O.D.600
Bacteria
Intensity



















CVD908-htrA (#3)
ND 2
100
0.6
ND
100
0.5
ND
100
0.5


CVD908-htrA (#4)
1.00
100
0.3
1.18
100
0.3
1.19
100
0.3


pGEN132 (#3)
ND
45.5
29.0
ND
33.2
36.9
ND
81.3
47.3


pGEN132 (#4)
1.03
10.9
27.8
1.20
7.6
36.1
1.32
51.3
47.5


pGEN142 (#3)
1.05
99.5
35.5
1.23
98.9
45.1
1.28
96.5
47.8


pGEN142 (#4)
1.17
94.4
38.0
1.29
91.5
45.0
1.33
93.9
47.7


pGEN206 (#3)
1.08
98.1
36.2
1.25
94.5
42.8
1.29
95.2
47.4


pGEN206 (#4)
1.13
80.2
32.6
1.26
68.6
36.6
1.33
93.5
41.3






1All strains were streaked from frozen master stocks onto 2× LB agar supplemented with DHB and 50 μg/ml of carbenicillin, and incubated for 36 hr at 30° C. Isolated colonies were pooled into 300 μl of 1× LB broth supplemented with DHB, from which 25 μl were inoculated into 25 ml of 1× LB broth containing DHB and either 50 mM, 150 mM, or 300 mM NaCl; cultures were incubated at 37° C., 250 rpm for 24 hr (defined here aspassage #1). For passage #2, 25 μl from passage #1 were inoculated into 25 ml (i.e. 1:1000 dilution) of identical medium and incubated at 37° C., 250 rpm for an additional 24 hr without selection. Passages 3 and 4 were carried out in identical fashion, but after the next passage had been set up the remaining #bacteria were then pelleted, resuspended in 1 ml PBS pH 7.4, and then diluted 1:1000 into PBS for analysis by flow cytometry.




2ND = not done.







Live vectors carrying unstabilized ori101 replicons eventually lost the capacity to synthesize the heterologous antigen after 96 hr. For example, after 96 hr growth in the presence of 50 mM NaCl, only 10.9% of CVD 908-htrA(pGEN132) expressed GFPuv and fluoresced. As the concentration of NaCl in the medium was increased to 150 mM, fluorescence was detected in only 7.6% of the population; curiously, at 300 mM NaCl, the percentage recovered to 51.3% fluorescing bacteria. Remarkably, CVD 908-htrA carrying either pGEN142 (hok-sok) or pGEN206 (hok-sok+parA) retained synthesis of GFPuv in greater than 95% of the population after 3 passages (72 hr), regardless of osmolarity (see Table 7). The percentage of fluorescing CVD 908-htrA (pGEN142) remained near this level after 4 passages (96 hr), while decreasing slightly for CVD 908-htrA (pGEN206).


Taken together, these data show that as copy number is reduced, the apparent stability of resident plasmids and proficiency of a live vector to synthesize a heterologous antigen such as GFPuv increases; as plasmid maintenance systems accumulate within a given plasmid, apparent stability and antigen synthesis are further enhanced. In addition, as the induction of PompC1 and concomitant production of the heterologous antigen increases, the percentage of a growing population remaining capable of synthesizing antigen can be dramatically reduced.


6.7 Bacterial Strains and Culture Conditions


All plasmid constructions were recovered in Escherichia coli strain DH5α or DH5αF′IQ (Gibco BRL). Construction of the hok-sok gene cassette used pR1 template DNA isolated from E. coli strain J53(pR1), a generous gift from James B. Kaper. The live vector S. typhi CVD 908-htrA is an auxotrophic derivative of the wild type strain Ty2 with deletions in aroC, aroD, and htrA (Tacket et al. 1997b). All strains used for examination of plasmid stability were grown in media supplemented with 2,3-dihydroxybenzoic acid (DHB) as previously described (Hone et al. 1991; Galen et al. 1997). When grown on solid medium, plasmid-bearing strains of CVD 908-htrA were streaked from frozen (−70° C.) master stocks onto 2× Luria-Bertani agar containing (per liter) 20 g Bacto tryptone, 10 g Bacto yeast extract, and 3 g NaCl (2×LB agar) plus carbenicillin at a concentration of 50 μg/ml. Plates were incubated at 30° C. for 24-36 hr to obtain isolated colonies ˜2 mm in diameter; strains were incubated at 30° C. to minimize the toxicity of GFPuv expression in CVD 908-htrA.


When grown in liquid medium, cultures were incubated at 37° C., 250 rpm for 16-24 hr. To examine the osmotic induction of the ompC promoter (P.ompC) within either E. coli DH5α or CVD 908-htrA, strains were grown in Bacto nutrient broth (Difco) containing DHB and either NaCl or sucrose; cultures were supplemented either with 50 μg/ml of carbenicillin or increasing concentrations of kanamycin where PompC-aphA-2 cassettes were examined. For quantitation of GFPuv synthesis using flow cytometry, 6-8 isolated colonies from master stocks streaked onto 2×LB agar as above were inoculated into 25 ml of 1×LB broth supplemented with 50 μg/ml carbenicillin where desired and NaCl at increasing concentrations to increase the induction of ompC promoters. Cultures were incubated at 37° C., 250 rpm for 16-24 hr prior to pelleting bacteria for flow cytometry as described below.


6.8 Molecular Genetic Techniques.


Standard techniques were used for the construction of the plasmids represented here (Sambrook et al., 1989). Unless otherwise noted, native Taq DNA polymerase (Gibco BRL) was used in polymerase chain reactions (PCR). S. typhi was prepared for electroporation of recombinant plasmids after harvesting from Miller's LB broth (Gibco BRL) supplemented with DHB; after pelleting bacteria, the cells were washed thrice with one culture volume of sterile distilled water and resuspended in sterile distilled water to a final volume of 1/100 of the original culture volume. Electroporation of strains was performed in a Gene Pulser apparatus (Bio-Rad) set at 2.5 kV, 200Ω, and 25 μF. Following electroporation, bacteria were repaired using SOC medium and incubating at 37° C., 250 rpm for 45 min; bacteria were then plated on 1×LB medium containing DHB plus 50 μg/ml carbenicillin, and incubated at 30° C. for 24 hr. Isolated colonies were then swabbed onto supplemented 2×LB and incubated at 30° C. for 16 hr. Frozen master stocks were prepared by harvesting bacteria into SOC medium without further supplementation and freezing at −70° C.


6.9 Construction of Expression Vectors


The expression vectors listed in the following Table 8 were prepared in the course of the recent work.












TABLE 8






Size




Plasmid
(kb)
Relevant genotype
Reference







pTETnir15
3.7
oriE1 toxC bla
Oxer et al.





(1991)


pJN1
1.9
oriE1 bla
This work


pJN2
3.4
oriE1 toxC bla
This work


pGFPuv
3.3
pUC19ori gfpuv bla
Clontech


pGFPompC
3.5
oriE1 gfpuv bla
This work


pNRB1
3.5
oriE1 gfpuv tetA
This work


pGEN2
4.2
oriE1 gfpuv tetA hok-sok
This work


pGEN3
4.1
ori15A gfpuv tetA hok-sok
This work


pGEN4
5.6
ori101 gfpuv tetA hok-sok
This work


pJN5
3.1
oriE1 gfpuv bla
This work


pJN6
3.7
oriE1 gfpuv bla hok-sok
This work


pJN7
4.1
oriE1 gfpuv bla hok-sok par
This work


pJN8
5.4
oriE1 gfpuv bla hok-sok parA
This work


pGEN51
3.6
oriE1 gfpuv bla
This work


pGEN71
4.2
oriE1 gfpuv bla hok-sok
This work


pGEN84
4.5
oriE1 gfpuv bla hok-sok par
This work


pGEN183
5.9
oriE1 gfpuv bla hok-sok parA
This work


pGEN211
6.2
oriE1 gfpuv bla hok-sok par parA
This work


pGEN91
3.5
ori15A gfpuv bla
This work


pGEN111
4.1
ori15A gfpuv bla hok-sok
This work


pGEN121
4.5
ori15A gfpuv bla hok-sok par
This work


pGEN193
5.8
ori15A gfpuv bla hok-sok parA
This work


pGEN222
6.2
ori15A gfpuv bla hok-sok par parA
This work


pGEN132
4.8
ori101 gfpuv bla par
This work


pGEN142
5.4
ori101 gfpuv bla par hok-sok
This work


pGEN206
7.1
ori101 gfpuv blapar hok-sok par A
This work










6.9.1 Construction of pJN1 and pJN2


The expression plasmids constructed for these studies are composed of 3 basic cassettes encoding 1] expression of a heterologous antigen, 2] a plasmid origin of replication, and 3] selection and maintenance functions. To accomplish this, a basic replicon was constructed in which these cassettes were separated by unique restriction sites. The primers used in construction of the plasmid cassettes are set forth in the following Table 9:















TABLE 9








GenBank





Primer

Cassette
Accession
Region of
Region of


number
Sequence1
created
Number
Homology2
Complementarity3





















1
5′-GCAGGAAAGAACATG

oriE1

J01749
2463-2507





TGAGCCTAGGGCCAGCAA



AAGGCCAGGAAC-3′



(SEQ ID NO: 12)





2
5′-CATGACCAAAATCCCTT



3197-3145



AACTAGTGTTTTAGATCTA



CTGAGCGTCAGACCCCG-3′



(SEQ ID NO: 13)





3
5′-CGGGGTCTGACGCTCAG

bla


3145-3197



TAGATCTAAAACACTAGTT



AAGGGATTTTGGTCATG-3′



(SEQ ID NO: 14)





4
5′-CTGTCAAACATGAGAA



17-1,




TTCTAGAAGACGAAAGGG




4361-4330



CCTCGTGATACGCC-3′



(SEQ ID NO: 15)





5
5′-ACAGCCTGCAGACAG

aphA-2

V00618
1-64



ATCTTGACAGCTGGATCG



CACTCTGGTATAATTGGG



AAGCCCTGCAAAG-3′



(SEQ ID NO: 16)





6
5′-GAAGCCCAACCTTTC



1044-986



ATAGAAGCTAGCGGTGGA



TCCGAAATCTCGTGATGGC



AGGTTG-3′



(SEQ ID NO: 17)





7
5′-AACAAGCGTTATAGGA
PompC
K00541
4-33



ATTCTGTGGTAGCA-3′



(SEQ ID NO: 18)





8
5′-ACTTTCATGTTATTAAA



498-469



GATCTGTTATATG-3′



(SEQ ID NO: 19)





9
5′-AGATCTTAATCATCCAC

gfpuv

U62636
289-317



AGGAGGCTTTCTGATGAG



TAAAGGAGAAGAACTTTT



CACTGG-3′



(SEQ ID NO: 20)





10
5′-GCTAGCTCATTATTTGT



1008-983



AGAGCTCATCCATGC-3′



(SEQ ID NO: 21)





11
5′-AGATCTGAATTCTAGAT

tetA

J01749
4-41



CATGTTTGACAGCTTATCAT



CGATAAGCTTTAATGCG-3′



(SEQ ID NO: 22)





12
5′-AGATCTTATCAGGTCGAG



1275-1234



GTGGCCCGGCTCCATGCACC



GCGACGCAACGCG-3′



(SEQ ID NO: 23)





13
5′-CGCGAATTCTCGAGACAA

hok-sok-tetA

X05813
2-48



ACTCCGGGAGGCAGCGTGAT



GCGGCAACAATCACACGGAT



TTC-3′



(SEQ ID NO: 24)





14
5′-ATGAGCGCATTGTTAGA

J01749,

108-86,



TTTCATTTTTTTTTCCTCCTT

X05813

580-559



ATTTTCTAGACAACATCAGC



AAGGAGAAAGG-3′



(SEQ ID NO: 25)





15
5′-CCTTTCTCCTTGCTGAT

X05813,
559-580,



GTTGTCTAGAAAATAAGG

J01749
86-108



AGGAAAAAAAAAATGAAAT



CTAACAATGCGCTCAT-3′



(SEQ ID NO: 26)





16
5′-GCTACATTTGAAGAGAT

ori15A

X06403

1461-1397



AAATTGCACTGGATCCTAG



AAATATTTTATCTGATTTAA



TAAGATGATC-3′



(SEQ ID NO: 27)





17
5′-CGGAGATTTCCTGGAA


780-829



GATGCCTAGGAGATACTT



AACAGGGAAGTGAGAG-3′



(SEQ ID NO: 28)





18
5′-GTCTGCCGGATTGCTTA

ori101

X01654
4490-4550



TCCTGGCGGATCCGGTTGA



CAGTAAGACGGGTAAGCCT



GTTGAT-3′



(SEQ ID NO: 29)





19
5′-CCTAGGTTTCACCTGTT



6464-6408



CTATTAGGTGTTACATGCTG



TTCATCTGTTACATTGTCGAT



CTG-3′



(SEQ ID NO: 30)





20
5′-AGGCTTAAGTAGCACCC

par

X01654

4918-4858



TCGCAAGATCTGGCAAATC



GCTGAATATTCCTTTTGTC



TCCGAC-3′



(SEQ ID NO: 31)





21
5′-GAGGGCGCCCCAGCTGG

aphA2-parA

V00618,
38-16,



CAATTCTAGACTCGAGCAC

X04268
1-37



TTTTGTTACCCGCCAAACA



AAACCCAAAAACAAC-3′



(SEQ ID NO: 32)





22
5′-AGAAGAAAAATCGAATT

X04268

1704-1644



CCAGCATGAAGAGTTTCAG



AAAATGACAGAGCGTGAGC



AAGTGC-3′



(SEQ ID NO: 33)





23
5′-CGAAGCCCAACCTTTCA

V00618

1044-986 



TAGAAACTAGTGGTGGAA



TCGAAATCTCGTGATGGCA



GGTTTG-3′



(SEQ ID NO: 34)





24
5′-GTTGTTTTTGGGTTTTGT

X04268,
37-1,



TTGGCGGGTAACAAAAGTG

V00618
16-38



CTCGAGTCTAGAATTGCCA



GCTGGGGCGCCCTC-3′



(SEQ ID NO: 35)






1Relevant restriction sites are underlined and referred to in the text; ribosome binding sites and start codons are designated in italics.




2Refers to the sequence within the coding strand of a given gene, to which the primer is homologous.




3Refers to the sequence within the non-coding strand of a given gene, to which the primer is homologous.







pTETnir15 (see Table 8; Oxer et al. 1991) was re-engineered such that the oriE1 origin of replication and bla gene were separated by a unique Spe1 site. Toward this end, an oriE1 cassette was synthesized by PCR using Vent polymerase with primers 1 and 2 and pCVD315 (Galen et al. 1990) as the template. The resulting 735 bp fragment carries engineered Spe1 and BglII sites 5′-proximal to the promoter controlling transcription of RNA II, and an engineered AvrII site 675 bases from these sites. A separate PCR reaction was carried out using primers 3 and 4 to create a 1234 bp bla cassette containing an engineered XbaI site 5′-proximal to the original EcoRI site. The products from these two PCR reactions were gel purified and used in an overlapping PCR with primers 1 and 4 to yield a final 1916 bp oriE1-bla fragment which was self-ligated to create pJN1. The Pnir15-tocC fragment from pTETnir15 was excised as an Eco RI (partial digestion)-Ava1 fragment, in which the Ava1 terminus was polished, and inserted into the multiple cloning region from pSL1180 (Brosius, 1989) cleaved with Eco RI and StuI; this cassette was then re-excised as an Eco RI (partial digestion)—Avril fragment and inserted into pJN1 cleaved with Eco RI-AvrII, creating pJN2 (see Table 8).


6.9.2 Construction of pGFPompC


To facilitate screening of a functional osmotically regulated PompC allele from Escherichia coli, an aphA-2 cassette was constructed, encoding resistance to the aminoglycosides neomycin and kanamycin (Shaw et al. 1993). A polymerase chain reaction (PCR) was carried out using primers 5 and 6 with the template pIB279 (Blomfield et al. 1991) to generate a 1044 bp product, from which a promoterless 903 bp aphA-2 BglII-NheI fragment was cleaved for replacement of a BglII-NheI toxC cassette encoding fragment C of tetanus toxin in pTETnir15. The anaerobically regulated Pnir15 promoter was replaced with a 459 bp EcoRI-BglII PompC allele constructed using primers 7 and 8 with chromosomal template DNA from E. coli DH5α to create pKompC. After confirming osmotic induction of PompC by examining the increase in resistance to kanamycin with increasing osmolarity, the aphA-2 cassette was then replaced with a gfpuv gene encoding a prokaryotic codon-optimized GFPuv allele (Clontech; Crameri et al. 1996). The gfpuv gene was recovered by PCR using primers 9 and 10 with the template pGFPuv to generate a 751 bp BglII-NheI fragment which was inserted into pKompC, to generate pGFPompC. Colonies were screened for functional GFPuv, and the brightest colonies were then examined for induction of fluorescence with increasing concentrations of NaCl. A PompC1-gfpuv cassette was cleaved from pGFPompC1 as an EcoRI-NheI fragment and inserted into a derivative of pJN2 cleaved with EcoRI-NheI to create pJJ4.


6.9.3 Construction of pNRB1, pGEN2, pGEN3, and pGEN4


Since it was intended that copy number not be influenced by transcription originating from promoters outside the origin of replication, it was necessary to ensure that all replication cassettes were flanked at both ends by transcription terminators. Because the origin and antigen cassettes of pJN2 are separated by the trpAterminator, it was only necessary to insert one additional terminator between the origin and bla cassettes.


To facilitate construction of additional plasmids later on, a tetA-T1T2 cassette was created. pYA292 (Galan et al. 1990) was first cleaved with HindIII and BglII, and the T1T2 terminator fragment was polished and inserted into the SmaI site of the pBluescript II KS (Stratagene) mutiple cloning region; when the proper orientation was identified, this cassette was re-excised as a BamHI-PstI fragment and inserted into pIB307 (Blomfield et al. 1991) cleaved with BamHI-PstI, creating pJG14. It was later determined by sequence analysis that the cassette had undergone a deletion of approximately 100 bp, removing half of the T2 terminator.


Using pBR322 as a template, primers 11 and 12 were used to synthesize a 1291 bp tetA BglII fragment. This tetA BglII fragment was then inserted into the BamHI site of pJG14 such that transcription of the tetA gene is terminated at the T1T2 terminator, creating pJG14tetA. Finally, this tetA-T1T2 cassette was cleaved from pJG14tetA as an EcoRI-PstI fragment in which the PstI site had been removed by polishing; the resulting fragment was inserted into pJJ4, cleaved with SpeI, polished, and recleaved with EcoRI to replace the bla cassette and create pNRB1.


The non-catalytic post-segregational killing function to be incorporated into the plasmid maintenance systems of the expression plasmids described here was the hok-sok locus, from the multiple drug resistance R-factor pR1. Initial attempts at recovering the hok-sok locus after PCR were unsuccessful. It was therefore necessary to use overlapping PCR to generate a cassette in which hok-sok was transcriptionally fused to a promoterless tetA gene such that transcription originating from the hok promoter would continue into tetA and result in a transcript encoding both Hok and resistance to tetracycline. pR1 plasmid DNA was purified from E. coli J53(pRI) in which pR1 encodes resistance to both carbenicillin and chloramphenicol. A 640 bp hok-sok fragment was synthesized using primers 13 and 14; a promoterless 1245 bp tetA fragment was recovered in a separate PCR using primers 15 and 12 with pNRB1 as the template. The products from these two PCR reactions were then used in an overlapping PCR with primers 12 and 13 to yield the final 1816 bp hok-sok-tetA fragment. This fragment was inserted as an EcoRI-SphI fragment into pNRB1 cleaved with EcoRI-SphI, regenerating the tetA gene and creating pGEN1.


A set of 3 isogenic plasmids was then constructed, differing only in copy number, from which all further expression plasmids would be derived. The BglII-AvrII origin of replication cassette of pGEN1 was replaced by a BglII-AvrII oriE1 cassette from pJN2 to generate pGEN2. An ori15A replication cassette was synthesized by PCR using primers 16 and 17 with pACYC184 template to generate a 629 bp BamHI-AvrII fragment, which was inserted into pGEN2 cleaved with BglII-AvrII to create pGEN3. Finally, an ori101 replication cassette was synthesized by PCR using primers 18 and 19 with pSC101 template, generating a 1949 bp BamHI-AvrII fragment which was inserted into pGEN2 cleaved with BglII-AvrII to create pGEN4.


6.9.4 Construction of pJN5, pGEN51, pGEN91, and pGEN132


The principle set of isogenic expression plasmids, to which individual elements of a plasmid maintenance system were sequentially added, was composed of pGEN51 (containing oriE1), pGEN91 (containing ori15A), and pGEN132 (containing ori101). The basic replicon from which these 3 plasmids were constructed was pJN5, which was assembled by cleaving the PompC-gfpuv cartridge as an EcoRI-NheI fragment from pGFPompC to replace the Pnir15-toxC cassette of pJN2. Construction of pGEN51 was then accomplished by removal of the replication cassette from pGEN2 as a BamHI fragment, and replacement of the origin of replication within pJN5 digested with BglII and BamHI, thereby regenerating the gfpuv gene. Construction of pGEN91 and pGEN132 were constructed in an identical manner by excision of origin cassettes as BamHI fragments from pGEN3 and pGEN4 respectively (see FIG. 7 for representation of isogenic expression plasmids based on pGEN91).


6.9.5 Construction of pJN6, pGEN71, pGEN111, and pGEN142


The hok-sok locus was then inserted as an XbaI-SalI fragment into pJN5 cleaved with XbaI and SaII, again regenerating the gfpuv gene to create pJN6 (see Table 2). Construction of pGEN71, pGEN111, and pGEN142 was then carried out exactly as for pGEN51, pGEN91, and pGEN132 by insertion into pJN6 of origin cassettes as BamHI fragments from pGEN 2, pGEN3, and pGEN4 respectively.


6.9.6 Construction of pJN7, pGEN84, and pGEN121


Construction of oriE1 and ori15A expression plasmids containing a plasmid maintenance system, composed of both a post-segregational killing system and at least one partition function, was first attempted using the par function from pSC11. A 377 bp BamHI-BglII fragment was synthesized using primers 18 and 20 with pSC101 template DNA; this fragment was inserted into pJN6 cleaved with BglII to create pJN7. As in the constructions above, origin cassettes from pGEN2 and pGEN3 were then excised as BamHI fragments and inserted into pJN7 digested with BglII and BamHI to create pGEN84 and pGEN121.


6.9.7 Construction of pJN8, pGEN183, pGEN193, pGEN206, pGEN211 and pGEN222


The final expression plasmids were constructed by introduction of the parA active partitioning locus from pR1. As with hok-sok, initial attempts at recovering the parA locus after PCR were unsuccessful. It was necessary to use overlapping PCR to generate an aph-parA cassette, in which aph and parA were divergently transcribed and separated by Xba I and XhoI sites, to enable subcloning of the parA locus. A 1737 bp parA fragment was synthesized using primers 21 and 22 with pR1 template; a 1076 bp aphA-2 fragment was recovered in a separate PCR using primers 23 and 24 with pIB279 as the template. The products from these two PCR reactions were then used in an overlapping PCR with primers 22 and 23 to yield the final 2743 bp aphA2-parA fragment. This fragment was inserted as a 2703 EcoRI-SpeI fragment into pJN6. The parA cassette was then re-excised as an XhoI fragment and inserted again into pJN6 cleaved with XhoI, regenerating the gfpuv gene, and creating pJN8.


Plasmids carrying a plasmid maintenance system composed of the post-segregational killing hok-sok function and parA, were constructed by excision of oriE1 and ori15A BamHI-SpeI cassettes from pGEN51 and pGEN91 respectively, and insertion into pJN8 cleaved with BamHI and SpeI to create pGEN183 and pGEN193 respectively. Plasmids containing the full complement of hok-sok, par, and parA maintenance functions were constructed by insertion of par-containing origin cassettes as BamHI-SpeI cassettes from pGEN84, pGEN121, and pGEN132 into pJN8 cleaved with BamHI and SpeI to create pGEN211, pGEN222, and pGEN206 respectively.


6.10 Quantitation of GFPuv and Plasmid Maintenance


Quantitation of GFPuv and plasmid maintenance were analyzed by measuring the fluorescence of plasmid-bearing live vectors using an Epics Elite ESP flow cytometer/cell sorter system (Coulter) with the argon laser exciting bacteria at 488 nm and emissions detected at 525 nm. 25 ml 1×LB cultures grown as described above were pelleted, and bacteria were resuspended into 1 ml of PBS. Cells were then diluted 1:1000 into PBS prior to determination of viable counts and flow analysis. Forward versus side light scatter, measured with logarithmic amplifiers, was used to gate on bacteria. A minimum of 50,000 events were acquired from each sample at a collection rate of approximately 3500 events per second. Mean fluorescence intensity for a given bacterial population was determined using the Epics Elite Software Analysis Package. The levels of autofluorescence, determined using plasmidless S. typhi CVD 908-htrA and E. coli DH5α strains, were used to place markers quantitating the percentages of bacteria in a given population expressing GFPuv.


6.11 Bacterial Live Vaccine Vectors Produced Using Lambda-Red Mediated Mutagenesis


Lambda Red-mediated mutagenesis (described by Datsenko and Wanner, Proc Natl Acad Sci USA. 97:6640-5 (2000)) was used to delete ssb from the chromosome of the Shigella flexneri 2a vaccine strain CVD 1208s, the Salmonella enterica serovar Typhi vaccine strains CVD 908-htrA and CVD 909 and the laboratory E. coli strain DH5 alpha. These strains were complemented in trans by a pBR322-based plasmid encoding ssb with its native (inducible and constitutive) promoters (pBRmSSB). Four days of continuous culture of the modified Shigella vaccine strain in liquid media showed a plasmid retention rate of >90%. This was in comparison to the unmodified vaccine strain which failed to retain pBRmSSB (<1.04×10−5% retention) by this time. Similar retention rates were also demonstrated for the modified S. Typhi strain.


Methods:


Bacterial strains and Culturing conditions. E. coli strain DH5 alpha was used for all plasmid constructions. The live vector CVD 1208s (unpublished) is isogenic to CVD 1208 (Levine, J. Pediatr. Gastroenterol. Nutr. 31:336-355 (2000)), with the exception of being constructed using animal-free soy media. Both vaccine strains were derived from wild type S. flexneri 2a strain 2457t, and are guanine auxotrophs due to deletions in guaB and guaA. Additional attenuation is conferred by deletions in set and sen encoding Shigella enterotoxins (ShETs) 1 and 2, respectively. S. Typhi vaccine strain CVD 908-htrA harbors deletion mutations in aroC and aroD, interrupting the aromatic compound biosynthesis pathway and htrA, which encodes a stress response protein (Tacket et al. Infect Immun. 65:452-6 (1997), and Levine et al. J. Biotechnol. 44:193-196 (1996)). CVD 909 is a variant of CVD 908-htrA that constitutively expresses Vi capsular polysaccharide (Wang et al. Infect. Immun. 68: 4647-4652 (2000)).



E. coli DH5 alpha was grown using Luria Bertani liquid medium or agar (Difco, Detroit, Mich.) supplemented with antibiotics carbenecillin (50 μg/ml), tetracyline (10 μg/ml) or chloramphenicol (25 μg/ml) where necessary. For strain constructions, the vaccine strains were grown with 2× soy medium (20 g Hy-soy peptone, 10 g Hy-soy yeast extract, and 3 g NaCl, ±20 g of granulated agar (Difco) per liter) containing guanine (0.001% v/v; Sigma, St Louis, Mo.) for CVD 1208s or with 0.0001% dihydrobenzoic acid (Sigma) for the S. Typhi strains and antibiotics where necessary. Liquid cultures were incubated at 30° C. or 37° C. at 250 rpm for 16-24 hrs unless stated otherwise. For in vitro plasmid retention experiments, vaccine strains were grown in standard rich Luria-Bertani (LB) medium to allow for rapid growth.


Plasmids and Molecular Genetic Techniques. Standard techniques were used for the construction of the plasmids represented here (Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd ed. CSHL Press, Cold Spring Harbor. 2001). Plasmid extraction and gel purification of DNA fragments was performed using QIAprep Spin Miniprep and QIAquick Gel Extraction kits, respectively, as directed by the manufacturer (Qiagen Inc., Valencia, Calif.). Plasmid pBR322 (Fermetas Inc., Hanover, Md.) was the progenitor of pBRmSSB (below). Plasmid pCR-Blunt II-TOPO (Invitrogen, Carlsbad, Calif.) was used as an intermediate for cloning blunt ended polymerase chain reaction (PCR) products generated with Vent™ DNA Polymerase (New England Biolabs, Ipswich, Mass.). Taq-Pro™ DNA Polymerase (Denville Sci., Metuchen, N.J.) was used for lambda Red-mediated mutagenesis and diagnostic PCR on single bacterial colonies diluted in 20 μl of sterile water. All restriction enzymes were from New England Biolabs. T4 DNA polymerase (NEB) was used to create blunt ended DNA fragments. Electroporation of strains was performed in a Gene Pulser apparatus (Bio-Rad) set at 2.5 kV, 200Ω, and 25 μF. Following electroporation, bacteria were repaired using either Luria Bertani or 2× soy medium.


Construction of pBRmSSB. All PCR amplifications described in this section involved Vent™ DNA Polymerase. Primers were designed based on the published sequence of S. flexneri 2a strain 2457t, genbank accession number AE014073. Primers CVOL108 and CVOL109 (Table 9) were used to amplify a 734 bp fragment encoding ssb from the chromosome of CVD 1208s (SEQ ID NO:41). The resulting product was ligated into pCR-Blunt II-TOPO (creating pCR-Blunt II-TOPO-ssb), and excised as a 750 bp EcoRI fragment. This fragment was then cloned into the EcoRI site of pBR322 (GenBank #J01749). The gene encoding β-lactamase was removed from this construct via SspI-PstI digestion, T4 polymerase treatment and religation. This final construct was termed pBRmSSB and was used to complement all ssb deletants. This construct contained both the inducible and constitutive promoters for ssb, as well as the complete polynucleotide sequence encoding SSB and is shown in FIG. 18. The 4550 bp sequence of pBRmSSB is set forth in SEQ ID NO:64. The region from 3810 to 4550 encodes ssb and native promoters.














TABLE 9









SEQ



Name
Sequencea
Target
Regionb
ID NO:







CVOL

CATATGAATATCCTCCTTAGTTCCTATTCC

pKD3
1044-1015
42



 75





CVOL

GCTAGCGTGTAGGCTGGAGCTGCTTCGAAGTTCCTA

pKD3
31-57
43


 99





CVOL
GCAACTACAGTTCACTTACACCGCCTCTCA
2457t
3457200-3457171
44


101





CVOL

CATATGTTATATTGTTTTAAGGTGGATGATTAAAG

2457t
3456522-3456550
45


104

K12
4272704-4272733





CVOL

CTCGAGACTAGTCACCAGAAAATCATTGATATGGCC

2457t
3457131-3457160
46


105
ATGAAT





CVOL

CATATGATTGACCTGAATGAATATACAGTATTGGAA

2457t
3455801-3455831
47


108





CVOL

GCTAGCTATTGTTTTAATGACAAATCAGAACGGAA

2457t
3456559-3456532
48


109





CVOL
GGAAAGATCGCAGACTTCGCCATCAATACG
2457t
3455161-3455190
49


110





CVOL

CATATGTTATTATTATTAGCTAGCTACTGTATATTCA

2457t
3455830-3455794
50


111
TTCAGGTCAATTTGTGT





CVOL
GAAGCGATCAACCACCACTTCAATGGTATG
2457t
3455101-3455130
51


112

K12
4271274-4271303





CVOL

CTCGAGACTAGTTCTGTACAGCAATAAAAGTCACGG

K12
4273260-4273231
52


138
GGTAAT





CVOL
CTAGAGGAATGCAGAGGCGGCGGGAAGATA
K12
4273320-4273291
53


139





CVOL
TTCGGCGGATCGGAGAGATCGCAGACTTCG
Ty2
3455150-3455179
54


140





CVOL
AGACATCAATTATTGCACTAACTATATCTT
Ty2
4307282-4307251
55


141





CVOL
CTTGCCAGATTTTCCAGCGTTTTGGTGTGT
Ty2
4305301-4305330
56


142





CVOL

CATATGTTATTATTATTAGCTAGCTACTGTATATTCA

Ty2
4305912-4305883
57


143
AACAGGTTAAATTGTGT





CVOL

CATATGCATTTTCGCTATAGTTCTCGTCTGCTGAA

Ty2
4306619-4306650
58


144





CVOL

CTCGAGACTAGTTAGCTAATCATTGAAACTCTAAAT

Ty2
4307282-4307251
59


145
CATTTT





virG1
TAGGGGGGGTAGGGGTGGTGAGCATA
VP
1035-1060
60





virG2
TCAGGCGATAGTCATAACTACCAGCA
VP
2734-2709
61






aPrimers are listed in 5′ > 3′ direction with restriction enzyme cleavage sites underlined.




bIndicates region of homology to plasmid pKD3 (genbank accession number AY048742), the chromosome of parent S. flexneri 2a strain 2457t (genbank accession number AE014073) or its virulence plasmid (VP; genebank accession number M22802, S. Typhi parent strain Ty2 (genbank accession number AE014613) or E. coli K12 genome (genbank accession number U00096).







Lambda Red Mediated Mutagenesis. Deletion of the chromosomal ssb locus of the bacterial live vectors Shigella flexneri 2a vaccine strain CVD 1208s, Salmonella enterica serovar Typhi vaccine strains CVD 908-htrA and CVD 909, and E. coli strain DH5 alpha, was performed by lambda red-mediated mutagenesis.


The creation of the template for lambda red-mediated deletion of the chromosomal ssb locus was performed in 3 stages. Stage 1 involved the PCR amplification of a DNA fragment upstream of ssb. Primers CVOL 110 and CVOL 111 (Table 9) were used to amplify SSBm1 (˜670 bp) with CVD 1208s genomic DNA as template to delete ssb from both CVD 1208s and DH5 alpha. This is because the region upstream of ssb is >99% homologous in both strains. Primers CVOL 142 and CVOL 143 (Table 9) were used to amplify TYSSBm1 (˜611 bp) with CVD 908-htrA as a template. It should be noted that SSBm1 and TYSSBm1 were designed to encode the uvrA promoter and the LexA binding region but not the two ssb promoters (FIG. 9A). The PCR products were cloned into pCR-Blunt II-TOPO, and fragment orientation identified via NdeI (in CVOL 111 and CVOL 143) digestion of plasmid clones with either SpeI or XhoI found in the pCR-Blunt II-TOPO multiple cloning site.


Stage 2 involved amplification of a DNA fragment downstream of ssb. Primers used were CVOL 104 and CVOL 105 (Table 9) with CVD 1208s as a template (producing SSBm2, ˜640 bp), CVOL 104 and CVOL 138 (Table 9) with DH5 alpha as a template (producing K12SSBm2, ˜560 bp), and CVOL 144 and CVOL 145 (Table 9) with CVD 908-htrA as a template (producing Ty2SSBm2). The resulting fragment was ligated into pCR-Blunt II-TOPO and excised by either NdeI-XhoI or NdeI-SpeI digestion. SSBm2, K12SSBm2 and TY2SSBm2 were then ligated into the corresponding pCR-Blunt II-TOPO containing SSBm1, K12SSBm1 or TY2SSBm1 previously digested with either NdeI-XhoI (for PCR products derived from CV1208s and DH5 alpha) or NdeI-SpeI (for PCR products derived from CVD 908-htrA) (FIG. 9B).


The final stage of template construction involved PCR amplification of a chloramphenicol (cml) resistance cassette from template pKD3 (Datsenko and Wanner, genbank accession number AY048742) using primers CVOL 75 and CVOL 99 (Table 9). The ˜1020 bp product was ligated into pCR-Blunt II-TOPO, excised by a NheI-NdeI digestion and inserted into the NheI-NdeI digested plasmids containing SSBm1-SSBm2, SSBm1-K12SSBm2 or TY2SSBm1-TY2SSBm2. The final constructs contained a cml resistance cartridge flanked by regions homologous to those surrounding ssb on the chromosomes of CVD 1208s, DH5 alpha, CVD 908-htrA. The ssb gene in CVD 909 was deleted using the same construct as used to mutate CVD 908-htrA.


Mutagenesis was performed as described by Datsenko and Wanner (PNAS USA 97:6640-6645 (2000)), with minor modifications. Strains CVD 1208s, CVD 908-htrA, CVD 909 and DH5 alpha transformed via electroporation with pKD46 and pBRmSSB, using the technique described in section 6.8. pKD46 encodes a temperature sensitive origin of replication, and the λ Red recombinase under the control of an arabinose inducible promoter. 10 colonies of CVD 1208s, CVD 908-htrA, CVD 909 or DH5 alpha carrying KD46 and pBRmSSB were added to 20 ml of 2× soy media with carbenecillin and L-arabinose (0.2%) and grown at 30° C., 250 rpm for 3 hrs (OD600 nm of ˜0.6). Competent cells were electroporated with 100 ηg-1 μg of gel-purified PCR product previously amplified using template SSBm1-cml-SSBm2 (for CVD 1208s) with primers CVOL 105 and 110, SSBm1-cml-K12SSBm2 (for DH5 alpha) with primers CVOL 110 and CVOL 138, and TY2SSBm1-TY2SSBm2 (for CVD 908-htrA and CVD 909) with primers CVOL 142 and CVOL 145. Cells were incubated in 2× soy media at 37° C. for 3 hrs prior to plating on 2× soy agar containing guanine and chloramphenicol overnight.


Antibiotic resistant colonies were screened via PCR for the alterations in the chromosomal ssb gene using primers that are homologous to regions outside those used to construct the ssb deletion templates. These primers were CVOL 101 and CVOL 112 (Table 9) for colonies derived from CVD 1208s, CVOL 112 and CVOL 139 (Table 9) for colonies derived from DH5 alpha, and CVOL 140 and 141 (Table 9) for colonies derived from CVD 908-htrA or CVD 909. Additionally, primers virG1 and virG2 (Table 9) were used in a separate reaction to confirm the presence of the virG in colonies derived from CVD 1208s, an indirect indicator of the presence of the Shigella virulence plasmid.


Colonies found to contain cml resistance were re-streaked at 37° C. on 2× soy agar lacking carbenecillin to ensure loss of pKD46. Removal of the cml resistance cassette was performed as described by Datsenko and Wanner. The resulting Δssb mutant bacteria containing a functional copy of ssb on the pBRmSSB plasmid (CVD 1208sΔssb3.1, DH5 alphaΔssb1.1, CVD 908-htrAΔssb1.1 and CVD 909Δssb1.1) were screened via PCR as described above for the absence of chromosomal ssb (and virG for CVD 1208s-based strains). Colonies exhibiting the correct genotype were re-streaked on 2× soy media to ensure loss of all antibiotic resistance. CVD 1208s-based strains were also replica-streaked onto trypticase soy agar (Becton Dickinson, Cockeysville, Md.)-Congo red plates supplemented with guanine (0.001%) to ensure that they appeared uniformly red in color. Those selected for storage were re-screened via PCR prior to freezing at −70° C. in 2× soy media containing 20% (v/v) glycerol.


Results:


Lambda Red-mediated mutagenesis of CVD 1208s harboring pKD46 and pBRmSSB gave rise to 2 cml resistant clones (3 and 11), which were subsequently treated to remove the presence of the cml resistance cassette. The resulting clones were termed CVD 1208sΔssb3.1, CVD 1208sΔssb3.2, CVD 1208sΔssb1.1 and CVD 1208sΔssb11.2. PCR fragments generated with primers specific for the regions surrounding ssb showed a band of ˜1.5 kb in these clones indicative of a successful deletion event (FIG. 10, panel A, lanes 1-4). This was not the case using the progenitor CVD 1208s that exhibited an unmodified locus of ˜2 kb (lane 5). Nevertheless, PCR with primers specific for ssb showed that the deletants retained an unmodified copy of ssb as encoded by pBRmSSB (FIG. 10, panel B, lanes 1-4) that was equivalent to that found in the chromosome of CVD 1208s (FIG. 10, panel B, lane 5). Lastly, all the deletants were virG (FIG. 10, panel C, lanes 1-4) and Congo Red positive (data not shown), indicating retention of the Shigella virulence plasmid.


In vitro growth analysis of modified CVD1208s strains. Overnight 5 ml starter cultures of CVD 1208s and the ssb deletion derivatives CVD 1208sΔssb3.1 and CVD 1208sΔssb11.1, all harboring pBRmSSB, were subcultured 1:200 in 20 ml of 2× soy containing tetracycline. Growth was monitored hourly for 8 hrs and was found to be equivalent between all three strains (FIG. 11).


In vitro plasmid retention analysis for CVD1208s strains. The same three strains were tested for their ability to retain pBRmSSB in the absence of antibiotic selection. Overnight 5 ml starter cultures of the three strains grown in the presence of tetracycline were passaged for four days by diluting bacteria 1:1000 in 20 ml of 2× soy every 24 hrs. The percentage stability was estimated by calculating bacterial colony counts on 2× soy containing tetracycline divided by the total number of cells at each passage as determined by viable count on 2× soy lacking antibiotic, multiplied by 100. As shown in FIG. 12, CVD 1208s failed to retain pBRmSSB as <1.04×10−5% of the bacteria exhibited resistance to tetracycline by day 4. This was in stark contrast to CVD 1208sΔssb3.1 and CVD 1208sΔssb11.1, which were both able to retain pBRmSSB at levels >90% at the same time point.


Construction of ssb deletions in DH5 alpha. ssb deletions were introduced into DH5 alpha to facilitate the construction of various antibiotic resistance cartridge-free prokaryotic expression plasmids prior to their transformation into live-attenuated bacterial vectors. Lambda Red mutagenesis of DH5 alpha harboring pKD46 and pBRmSSB gave rise to numerous cml resistant mutants, six of which were screened by PCR for evidence of recombination (see FIG. 13A). All six colonies were positive for a mutated ssb region as shown by a larger PCR product (lanes 1-6, ˜2.0 kb) compared to that derived from unmodified DH5 alpha (lane 7, ˜1.5 kb). Clones in lanes 1 and 2 were further treated to remove the cml resistance cartridge as shown in FIG. 13B. The top of the panel shows that a smaller PCR product was obtained in 6 cml sensitive mutants (lanes 1-6, ˜1.2 kb) compared to unmodified DH5 alpha (lane 7). As shown in the bottom of panel B, these six mutants also contained a normal ssb gene (lanes 1-6) as found in pBRmSSB and the chromosome of unmodified DH5 alpha (lane 7). Colonies that gave rise to products in lanes 1 and 4 (termed DH5 alphaΔssb1.1 and DH5 alphaΔssb2.1, respectively) were selected for storage.


Construction of ssb deletions in CVD 908-htrA and CVD 909. In order to increase the repertoire of live-attenuated vectors that can carry ssb-stabilized plasmids, ssb deletions were introduced into CVD 908-htrA and CVD 909. Lambda Red mutagenesis of CVD 908-htrA harboring pKD46 and pBRmSSB gave rise to numerous cml resistant mutants, four of which were screened by PCR for evidence of recombination (FIG. 14A). All four colonies were positive for a mutated ssb region as shown by a larger PCR product (lanes 1-4, ˜2.5 kb) compared to that derived from unmodified CVD 908-htrA (lane 5, ˜2.0 kb). Clones in lanes 1 and 2 were further treated to remove the cml resistance cartridge as shown in FIG. 14B. The top of the panel shows that a smaller PCR product was obtained in six cml sensitive mutants (lanes 1-6, ˜1.5 kb) compared to unmodified CVD 908-htrA (lane 7). As shown in the bottom of panel B, these six mutants (lanes 1-6) also contained ssb as found in pBRmSSB (PCR with plasmid DNA template, lane 7). Colonies that gave rise to products in lanes 1 and 4 in panel B (termed CVD 908-htrAΔssb1.1 and CVD 908-htrAΔssb2.1, respectively) were selected for storage.


The same approach taken with creating ssb mutations in CVD 908-htrA was used for CVD 909. Lambda Red mutagenesis of CVD 909 harboring pKD46 and pBRmSSB gave rise to numerous cml resistant mutants, five of which were screened by PCR for evidence of recombination (FIG. 15A). All five colonies were positive for a mutated ssb region as shown by a larger PCR product (lanes 1-5, ˜2.5 kb) compared to that derived from unmodified CVD 909 and CVD 908-htrA (lanes 6 and 7, respectively, ˜2.0 kb). Clones in lanes 1 and 2 were further treated to remove the cml resistance cartridge as shown in FIG. 15B. The top of the panel shows that a smaller PCR product was obtained in six cml sensitive mutants (lanes 1-6, ˜1.5 kb) compared to unmodified CVD 908-htrA (lane 7). As shown in the bottom of panel B, these six mutants (lanes 1-6) also contained ssb as found in pBRmSSB. Lane 7 shows that the primers used in the reaction were not specific for ssb found on the chromosome of unmodified CVD 909. Colonies that gave rise to products in lanes 1 and 4 in panel B (termed CVD 909Δssb1.1 and CVD 909Δssb2.1, respectively) were selected for storage.


In vitro plasmid retention analysis for CVD 908-htrAΔssb1.2. It was extremely difficult to select for ligated plasmid constructs after introduction by electroporation into attenuated S. Typhi vaccine strains. The initial engineering and recovery of an SSB-encoding test plasmid (FIG. 18) was therefore carried out in E. coli prior to introduction into S. Typhi deleted of ssb. As mentioned above, during the construction of these chromosomal ssb deletions, all strains were complemented for SSB in trans by pBRmSSB. After chromosomal deletions were accomplished, pBRmSSB was replaced in both DH5 alphaΔssb1.1 and CVD 908-htrAΔssb1.2 with pJG9-SSB (FIG. 17), a temperature-sensitive replicon derived from pSC101 carrying ssb, gfpuv, the cat chloramphenicol resistance allele, and the counterselectable marker sacB.


The 8763 bp sequence set forth in SEQ ID NO:65 represents the composite sequence of pJG9-SSB, containing an ssb-gfpuv cassette inserted into pJG9, as represented in FIG. 17. pJG9 has been previously described in Wainwright et al. Mol. Microbiol. 27(6): 1247-60 (1998). A ssb-gpfuv-tetA cassette was created by inserting a gfpuv-tetA Spe I cassette into the Nhe I-digested pCR-Blunt II-TOPO-ssb clone described above (“Construction of pBRmSSB”). The resulting ssb-gpfuv-tetA cassette was removed as a Eco RI digested cassette and inserted into pJG9 partially digested with Eco RI. The resulting pJG9-SGT construct was recovered in DH5α using selection with tetracycline at 10 μg/ml. The final pJG9-SSB plasmid was recovered after digestion of pJG9-SGT with Nhe I to remove the tetA marker, and re-ligation. pJG9-SSB was recovered in DH5α using selection with chloramphenicol at 20 μg/ml. Deletion of tetA was performed to enable replacement of pBRmSSB (carries tetA) in all ssb strains with pJG9-SSB; proper exchange of these two plasmids was facilitated by selection with chloramphenicol at 20 μg/ml (to recover pJG9-SSB), and screening for sensitivity to tetracycline (to confirm loss of pBRmSSB). Loss of pBRmSSB was confirmed using PCR and primers specific for the tetA allele and oriE1 in separate reactions.


Prior to final electroporation into S. Typhi live vectors, the SSB-stabilized test plasmid was first recovered in DH5alphaΔssb1.1 (pJG9-SSB) by selecting on solid Luria-Bertani (LB) medium, supplemented only with 16% sucrose (to select for loss of sacB) and incubated at 42° C. (to inactivate the pJG9-SSB ori101). The desired SSB-stabilized supercoiled test plasmid was then purified and recovered in CVD 908-htrAΔssb1.2(pJG9-SSB) using the same procedure.


Construction of the critical DH5alphaΔssb 1.1 (pJG9-SSB) strain, in which pBRmSSB was replaced with the temperature-sensitive pJG9-SSB replicon, was unexpectedly difficult. Exchange of these two plasmids required the use of coumermycin at a concentration of 5 μg/ml to inhibit the oriE1 origin of replication in pBRmSSB, in addition to selection with 20 μg/ml chloramphenicol for incoming pJG9-SSB. Loss of pBRmSSB was confirmed by PCR analysis using primers specific for tetA and oriE1 in separate reactions. DH5alphaΔssb1.1(pJG9-SSB) is intended only as a strain for recovery of SSB-plasmids destined for electroporation into S. Typhi vaccine strains. Therefore, any un-intended mutagenic effects of coumermycin upon either the E. coli chromosome or pJG9-SSB are irrelevant, since the desired SSB-stabilized expression plasmids will be screened for antigen expression and then purified prior to electroporation into CVD 908-htrA.


Construction of CVD 908-htrAΔssb1.2(pJG9-SSB) was one-step procedure. pJG9-SSB was electroporated into CVD 908-htrAΔssb1.2(pBRmSSB), and CVD 908-htrAΔssb1.2(pJG9-SSB) was recovered on LB medium containing 20 μg/ml chloramphenicol and 2,3-dihydroxybenzoate (DHB). Loss of pBRmSSB was again confirmed by PCR analysis using primers specific for tetA and oriE1 in separate reactions.


The replacement of pJG9-SSB in CVD 908-htrAΔssb1.2(pJG9-SSB) with an incoming test plasmid was confirmed by constructing the medium copy test plasmid pGEN222AKS (15 copies per cell, FIG. 16, SEQ ID NO:66), encoding resistance to ampicillin (bla) and kanamycin (aph), as well as carrying a complete plasmid maintenance system (hok-sok+parM+parR=hok-sok/parA) and also encoding SSB and UV-fluorescent GFPuv. Electroporation of supercoiled pGEN222AKS into CVD 908-htrAΔssb1.2(pJG9-SSB), followed by selection at 42° C. on LB agar containing 16% sucrose+DHB, resulted in efficient selection of CVD 908-htrAΔssb1.2(pGEN222AKS). Loss of pJG9-SSB was confirmed by PCR analysis using primers specific for sacB, cat, and ori101 in separate reactions.


The stability of pGEN222AKS, both within CVD 908-htrA (i.e. wildtype for ssb) and within CVD 908-htrΔssb1.2, was examined where both strains were passaged in rich LB media without antibiotic selection. aph was included within pGEN222AKS as some growth inhibition of CVD 908-htrA was previously observed when grown using kanamycin selection versus selection with other antibiotics including carbenicillin and tetracycline; gfpuv was also included for its growth inhibitory effects on CVD 908-htrA, as well as to provide a convenient fluorescence screen for plasmid retention. Given the expected metabolic burden associated with pGEN222AKS, it was hypothesized that this plasmid might prove somewhat unstable in CVD 908-htrA, but would be efficiently maintained in CVD 908-htrAΔssb1.2.


Both strains were grown for 5 hours in LB broth containing DHB plus carbenicillin (50 μg/ml) to ensure a healthy and uniform starting population of live vectors carrying the test expression plasmid. Cultures were then diluted 1:1000 into LB medium containing only DHB and grown for 24 hours at 37° C. After 24 hrs, the frequency of recovery for plasmid-bearing CVD 908-htrA(pGEN222AKS) was only 1%, as determined by comparison of viable counts on LB agar with and without 50 μg/ml carbenicillin. The same frequency of 1% was observed when colonies grown without selection were examined directly for GFPuv fluorescence. However, the frequency of recovery for CVD 908-htrAΔssb1.2(pGEN222AKS) was 100% by the same measures, even after passing without selection for 5 days.


Given the presence of a hok-sok/parA plasmid maintenance system, it was surprising that pGEN222AKS proved to be so unstable in wildtype CVD 908-htrA. It was previously hypothesized that such instability could arise in the presence of severe metabolic burden after the occurrence of point mutations which inactivate the hok-sok post-segregational killing system. However, the identical plasmid was quite stable when maintained within CVD 908-htrAΔssb1.2. These results clearly showed the utility of ssb as an alternative to the use of antibiotics to select for and maintain expression plasmids within S. Typhi live vectors.


6.12 Conclusions


The broad objective of the research presented in Sections 6.6-6.10 was to investigate the feasibility of developing a plasmid maintenance system for the stabilization of multicopy expression plasmids encoding foreign antigens in an S. typhi live vector vaccine strain, without additional modification of the chromosome. The maintenance of expression plasmids was enhanced at two independent levels. First, dependence upon balanced-lethal maintenance systems that involve catalytic enzymes expressed from multicopy plasmids was removed; this was accomplished through incorporation into expression plasmids of a post-segregational killing system based on the non-catalytic hok-sok plasmid addiction system from the antibiotic-resistance factor pR1. At least one naturally occurring plasmid partition function was also introduced into these expression plasmids, to potentially eliminate random segregation of such plasmids, thereby enhancing their inheritance and stability.


Although these expression plasmids are ultimately intended to express immunogenic and protective antigens for delivery to the human immune system, GFPuv was selected as a test reporter antigen because quantitation of mean fluorescence in a population of growing live vectors could be used as a measure of the stability of resident plasmids within the live vector. All expression plasmids carried an identical antigen expression cassette, with a PompC1 allele controlling transcription, and translation optimized by incorporation of a consensus ribosome binding site. Because no catalytic activity is associated with the fluorescence of GFPuv, the level of fluorescence intensity measured by flow cytometry within individual bacteria could be correlated directly with gene dosage and copy number. In addition, use of an osmotically regulated ompC promoter allowed an assessment of plasmid stability and live vector viability as increasing osmolarity induced higher levels of GFPuv synthesis and presumably higher levels of metabolic stress on the live vector. As seen in Table 2, it was confirmed that the PompC1 allele engineered for these studies was responsive to increased osmolarity; when driving expression of an aph-2 resistance gene, resistance to less than 50 μg/ml kanamycin was observed in the absence of osmotic pressure but resistance increased to greater than 800 μg/ml in the presence of 300 mM NaCl. It was surprising that although the PompC1 allele was engineered from the chromosomal locus of E. coli, it appeared to function more efficiently in S. typhi. The uninduced level of expression of GFPuv was the same for both DH5α and CVD 908-htrA (mean fluorescence intensity of 4.45 vs 5.37 respectively, Table 3). However, GFPuv synthesis increased 70% in DH5α after induction, but rose over 300% in CVD 908-htrA (mean fluorescence intensity of 7.69 vs 23.4 respectively). This effect was not limited to the PompC1 allele but was equally remarkable when using PompC3 (Table 3). These data do not agree with recent observations of Martinez-Flores et al (1999) who reported that E. coli ompC-lacZ genetic fusions expressed constitutively within S. typhi, and that this constitutive level of expression was comparable to induced levels within E. coli. Although a defined locus of point mutations at the 3′-terminus of the E. coli PompC1 allele was identified which could explain its osmotically controlled behavior within S. typhi CVD 908-htrA, such mutations were not identified within PompC3, which also responds to osmolarity within CVD 908-htrA. It should be noted, however, that the genetic fusions studied by Martinez-Flores et al involved 1,150 bp of the E. coli 5′ ompC upstream control region, while the PompC alleles constructed here involve only 459 bp of the 5′-proximal control region of ompC. Regardless of this discrepancy, it is encouraging that the highest levels of regulated heterologous gene expression are observed within the attenuated S. typhi live vector vaccine strain.


The contributions of several plasmid maintenance systems to the stability of plasmids within CVD 908-htrA, growing in the absence of antibiotic selection, were then examined. No combination of maintenance functions could stabilize plasmids containing oriE1 origins of replication; in fact, these constructs were difficult to propagate even in the presence of antibiotic. These observations cast doubt upon the rationale for using higher copy number plasmids to optimize expression of heterologous antigens within the cytoplasm of S. typhi-based live vectors, a strategy that, heretofore, has been followed by other groups investigating Salmonella as live vectors (Covone et al. 1998).


Incorporation of plasmid maintenance systems into plasmids carrying an ori15A origin of replication was more encouraging. When live vectors carrying such plasmids were passage without selection for 24 hr at 37° C., the effects of various combinations of maintenance functions became apparent. In the absence of maintenance functions, the ori15A replicon pGEN91 was lost from greater than 90% of the population, regardless of the level of induction of PompC1 (see Table 6 and FIG. 8). With incorporation of the hok-sok post-segregational killing locus in pGEN111, the percentage of bacteria expressing GFPuv tripled under all induction conditions, confirming the observations of others that the hok-sok locus enhances the stability of ori15A replicons (Gerdes et al. 1985; Gerdes, 1988; Gerdes et al. 1997b). However, it was still noted that regardless of induction conditions, greater than 50% of the bacterial population no longer fluoresced. Since it was confirmed that at least a portion of this non-fluorescing population was still viable and lacked drug resistance, these data confirm previous reports (Gerdes et al. 1986; Wu and Wood, 1994; Pecota et al. 1997) that the presence of a hok-sok post-segregational killing system is insufficient by itself to ensure that plasmidless viable bacteria will not arise in a growing population.


One possible mechanism that allows for escape from the influence of hok-sok involves spontaneous point mutations arising within the lethal Hok open reading frame, which could conformationally inactivate Hok and thereby allow plasmid loss to occur without lethality. This point emphasizes the requirement of multiple mechanisms for enhancing the stability of resident plasmids within growing bacteria; should one maintenance function become inactivated, the probability of other independent functions simultaneously becoming inactivated becomes vanishingly small. Indeed, such redundancy in maintenance functions is widespread within naturally occurring low copy number plasmids (Nordstrom and Austin, 1989). For example, the Escherichia coli sex factor F contains one active partitioning function (sop) and two killing systems (ccd and flm) (Loh et al. 1988; Golub and Panzer, 1988; Van Melderen et al. 1994; Niki and Hiraga, 1997). Similarly, the drug resistance plasmid pR1 contains the active partitioning function parA, as well as the post-segregational killing system hok-sok; in addition, it carries yet another recently defined kis-kid killing system (Bravo et al. 1987; Bravo et al. 1988; Ruiz-Echevarria et al. 1995). Insertion into multicopy ori15A replicons of a more complete maintenance system, composed of both a post-segregational system and two partition functions, was demonstrated to dramatically improves the stability of these expression plasmids in the absence of selection, regardless of induction conditions for heterologous antigen expression. However, after passage without selection for 48 hrs, plasmids were eventually lost from the bacterial population, due to escape from the lethality of Hok. This problem has recently been addressed by Pecota et al (1997) who reported that incorporation of dual killing systems significantly improved plasmid stability when compared to the use of hok-sok alone; no partition functions were present in these plasmids. Perhaps inclusion of the kis-kid killing system, to more fully represent the complement of pR1 stability functions, may be required for optimal stability of higher copy expression plasmids within S. typhi live vectors; since phd-doc PSK cassettes have recently been constructed, the compatibility of this PSK function in the expression plasmids pGEN211, pGEN222 and pGEN206 of the instant invention are also being examined.


A comparison of strains carrying pGEN121 (an ori15A replicon carrying hok-sok+par, ˜15 copies per chromosomal equivalent) with the much lower copy number plasmid pGEN142 (an ori101 replicon carrying hok-sok+par, ˜5 copies per chromosomal equivalent) shows that under conditions of maximum induction of PompC1 with 300 mM NaCl, 57% of a population of CVD 908-htrA(pGEN121), passaged for only 24 hr without selection, fluoresce with a mean fluorescence intensity of 105.3; for a population of CVD 908-htrA(pGEN142), passaged for 96 hr without selection under identical induction conditions, 94% of the bacteria analyzed by flow cytometry still maintain a mean fluorescence intensity of 47.7. Based on such results with GFPuv as a test antigen, it is tempting to speculate that an optimum level of heterologous antigen presented by an attenuated S. typhi-based live vector vaccine to the human immune system can be achieved by decreasing the copy number of resident expression plasmids to perhaps 5 copies per chromosomal equivalent.


The efficiency of eliciting an immune response directed against a heterologous antigen will depend in part upon the ability of the live vector to present such antigens to the immune system. The ability of a live vector to present antigens will in turn depend upon the stability of multicopy expression plasmids that encode the heterologous antigens. The results demonstrate that inclusion of a plasmid maintenance system within multicopy expression plasmids, without further genetic manipulation of the live vector, enhances the stability of such expression plasmids. However, the presence of multicopy plasmids may also influence the metabolic fitness of the live vector. This is relevant because some foreign antigens of interest exert a deleterious effect on the live vector.


While not intended to be bound to this theory, it was concluded that a significant metabolic burden is placed upon CVD 908-htrA carrying a multicopy expression plasmid; as copy number and/or level of gene expression increases, metabolic burden increases. Studies with E. coli have clearly established that plasmid-bearing bacteria grow slower than plasmidless bacteria (Boe et al. 1987; McDermott et al. 1993; Wu and Wood, 1994; Pecota et al. 1997; Summers, 1998). It has also been demonstrated that as copy number increases, the growth rate of such strains decreases; similarly, as induction of heterologous genes increases, growth rate decreases further (Wu and Wood, 1994; Pecota et al. 1997). Clearly, spontaneous plasmid loss would remove any metabolic burden and allow plasmidless bacteria to quickly outgrow the population of plasmid-bearing bacteria. In elegant studies, Wu and Wood (Wu and Wood, 1994) showed that plasmid-bearing E. coli strains maintained plasmids under conditions where cloned gene expression was low for 100 hr when passaged in the absence of selection; in contrast, under maximum induction conditions, complete plasmid loss occurred within 10 hr. Interestingly, when the hok-sok locus was inserted into these expression plasmids, the plasmids were maintained for 300 hr. under uninduced conditions and 30 hr. under inducing conditions. Such a shift in antigen expression within a population of live vector bacteria would be expected to reduce the efficiency of stimulating any immune response specific to the foreign antigen. The analysis leads to the conclusion that the goal for an effective multivalent S. typhi-based live vector vaccine is to optimize viability using stabilized lower copy number expression vectors, capable of expressing high levels of heterologous antigen in response to an environmental signal likely to be encountered in vivo after the vaccine organisms have reached an appropriate ecological niche. This strategy is being tested using the murine intranasal model to examine the immunogenicity of fragment C of tetanus toxin expressed within CVD 908-htrA from expression vectors pGEN211 (oriE1), pGEN222 (ori15A), and pGEN206 (ori101), all of which carry identical plasmid maintenance systems and differ only in copy number. The work presented herein enables the development of single dose, oral S. typhi-based live vector vaccines capable of inducing protective immune responses against multiple unrelated human pathogens.


7. REFERENCES

The disclosures of the following references are incorporated herein in their entirety, as are all of the publications, patents and references set forth throughout this document.

  • Acheson, D. W. K. 1998. Nomenclature of enterotoxins. Lancet 351:1003.
  • Acheson, D. W. K., M. M. Levine, J. B. Kaper, and G. T. Keusch. 1996. Protective immunity to Shiga-like toxin I following oral immunization with Shiga-like toxin I B-subunit-producing Vibrio cholerae CVD 103-HgR. Infection and Immunity 64:355.
  • Austin, S. J. 1988. Plasmid partition. Plasmid 20:1.
  • Austin, S., S. Friedman, and D. Ludtke. 1986. Partition functions of unit-copy plasmids can stabilize the maintenance of plasmid pBR322 at low copy number. J Bacteriol 168: 1010-1013.
  • Barry, E. M., O. G. Gomez-Duarte, S. Chatfield, R. Rappuoli, M. Pizza, G. Losonsky, J. E. Galen, and M. M. Levine. 1996. Expression and immunogenicity of pertussis toxin S1 subunit-tetanus toxin fragment C fusions in Salmonella typhi vaccine strain CVD 908. Infection and Immunity 64:4172-4181
  • Barth, P. T., H. Richards, and N. Datta. 1978. Copy numbers of coexisting plasmids in Escherichia coli K-1 2. J Bacteriol 135: 760-765.
  • Bast, D. J., J. L. Brunt n, M. A. Karmali, and S. E. Richardson. 1997. Toxicity and immunogenicity of a verotoxin 1 mutant with reduced globotriaosylceramide receptor binding in rabbits. Infection and Immunity 65:2019.
  • Baumler, A. J., J. G. Kusters, I. Stojiljkovic, and F. Heffron. 1994. Salmonella typhimurium loci involved in survival within macrophages. Infection and Immunity 62:1623.
  • Beaucage, S. L., C. A. Miller, and S. N. Cohen. 1991. Gyrase-dependent stabilization of pSC101 plasmid inheritance by transcriptionally active promoters. EMBO J 10: 2583-2588.
  • Blattner, F. R., G. Plunkett III, C. A. Bloch, N. T. Perna, V. Burland, M. Riley, J. Collado-Vides, J. D. Glasner, C. K. Rode, G. F. Mayhew, J. Gregor, N. W. Davis, H. A. Kirkpatrick, M. A. Goeden, D. J. Rose, B. Mau, and Y. Shao. 1997. The complete genome sequence of Escherichia coli K-12. Science 277:1453.
  • Blomfield, I. C., V. Vaughn, R. F. Rest, and B. I. Eisenstein. 1991. Allelic exchange in Escherichia coli using the Bacillus subtilis sacB gene and a temperature-sensitive pSC101 replicon. Molecular Microbiology 5:1447-1457.
  • Boe, L. and K. V. Rasmussen. 1996. Suggestions as to quantitative measurements of plasmid loss. Plasmid 36:153.
  • Boe, L., K. Gerdes, and S. Molin. 1987. Effects of genes exerting growth inhibition and plasmid stability on plasmid maintenance. Journal of Bacteriology 169:4646-4650.
  • Bokman, S. H. and W. W. Ward. 1981. Renaturation of Aequorea green-fluorescent protein. Biochemical and Biophysical Research Communications 101:1372.
  • Bosworth, B. T., J. E. Samuel, H. W. Moon, A. D. O'Brien, V. M. Gordon, and S. C. Whipp. 1996. Vaccination with genetically modified Shiga-like toxin IIe prevents edema disease in swine. Infection and Immunity 64:55.
  • Bouvier, J., C. Richaud, W. Higgins, O. Bogler, and P. Stragier. 1992. Cloning, characterization, and expression of the dapE gene of Escherichia coli. Journal of Bacteriology 174:5265.
  • Boyd, B. and C. A. Lingwood. 1989. Verotoxin receptor glycolipid in human renal tissue. Nephron 51:207.
  • Bravo, A., G. de Torrontegui, and R. Diaz. 1987. Identification of components of a new stability system of plasmid R1, ParD, that is close to the origin of replication of this plasmid. Mol Gen Genet 210: 101-110.
  • Brayo, A., S. Ortega, G. de Torrontegui, and R. Diaz. 1988. Killing of Escherichia coli cells modulated by components of the stability system parD of plasmid R1. Mol Gen Genet 215: 146-151.
  • Brosius, J. 1989. Superpolylinkers in cloning and expression vectors. DNA 8: 759-777.
  • Butterton, J. R., E. T. Ryan, D. W. Acheson, and S. B. Calderwood. 1997. Coexpression of the B subunit of Shiga toxin 1 and EaeA from enterohemorrhagic Escherichia coli in Vibrio cholerae vaccine strains. Infection and Immunity 65:2127-2135
  • Cabello, F., K. Timmis, and S. N. Cohen. 1976. Replication control in a composite plasmid constructed by in vitro linkage of two distinct replicons. Nature 259: 285-290.
  • Calderwood, S. B., D. W. K. Acheson, G. T. Keusch, T. J. Barrett, P. M. Griffin, N. A. Strockbine, B. Swaminathan, J. B. Kaper, M. M. Levine, B. S. Kaplan, H. Karch, A. D. O'Brien, T. G. Obrig, Y. Takeda, P. I. Tarr, and I. K. Wachsmuth. 1996. Proposed new nomenclature for SLT (VT) family. ASM News 62:118.
  • Calderwood, S. B., F. Auclair, A. Donohue-Rolfe, G. T. Keusch, and J. J. Mekalanos. 1987. Nucleotide sequence of the Shiga-like toxin genes of Escherichia coli. Proceedings of the National Academy of Sciences USA 84:4364.
  • Carlini, L. E., R. D. P rter, U. Curth, and C. Urbanke. 1993. Viability and preliminary in vivo characterization of site-specific mutants of Escherichia coli single-stranded DNA-binding protein. Molecular Microbiology 10:1067.
  • Carter, P. B. and F. M. Collins. 1974. Growth of typhoid and paratyphoid bacilli in intravenously infected mice. Infection and Immunity 10:816.
  • Cerin, H. and J. Hackett. 1989. Molecular cloning and analysis of the incompatibility and partition functions of the virulence plasmid of Salmonella typhimurium. Microbial Pathogenesis 7:85.
  • Cerin, H. and J. Hackett. 1993. The parVP region of the Salmonella typhimurium virulence plasmid pSLT contains four loci required for incompatibility and partition. Plasmid 30:30.
  • Chalfie, M., Y. Tu, G. Euskirchen, W. W. Ward, and D. C. Prasher. 1994. Green fluorescent protein as a marker for gene expression. Science 263:802.
  • Chambers, S. P., S. E. Prior, D. A. Barstow, and N. P. Minton. 1988. The pMTLnic cloning vectors. I. Improved pUC polylinker regions to facilitate the use of sonicated DNA for nucleotide sequencing. Gene 68:139.
  • Chang, A. C. Y., and S. N. Cohen. 1978. Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J Bacteriol 134: 1141-1156.
  • Chase, J. W. and K. R. Williams. 1986. Single-stranded DNA binding proteins required for DNA replication. Annual Reviews in Biochemistry 55:103.
  • Chase, J. W., J. B. Murphy, R. F. Whittier, E. Lorensen, and J. J. Sninsky. 1983. Amplification of ssb-1 mutant single-stranded DNA-binding protein in Escherichia coli. Journal of Molecular Biology 164:193.
  • Chatfield, S., K. Strahan, D. Pickard, I. G. Charles, C. E. Hormaeche, and G. Dougan. 1992. Evaluation of Salmonella typhimurium strains harbouring defined mutations in htrA and aroA in the murine salmonellosis model. Microbial Pathogenesis 12:145.
  • Clark, C., D. Bast, A. M. Sharp, P. M. St. Hilaire, R. Agha, P. E. Stein, E. J. Toone, R. J. Read, and J. L. Brunton. 1996. Phenylalanine 30 plays an important role in receptor binding of verotoxin-1. Molecular Microbiology 19:891.
  • Conradi, H. 1903. Ueber losliche, durch aseptische autolyse erhaltene giftstoffe von ruhrund Typhusbazillen. Dtsch. Med. Wochenschr. 29:26.
  • Covarrubias, L., L. Cervantes, A. Covarrubias, X. Soberon, I. Vichido, A. Blanco, Y. M. Kupersztoch-Portnoy, and F. Bolivar. 1981. Construction and characterization of new cloning vehicles. V. Mobilization and coding properties of pBR322 and several deletion derivatives including pBR327 and pBR328. Gene 13: 25-35.
  • Covone, M. G., M. Brocchi, E. Palla, W. D. da Silveira, R. Rappuoli, and C. L. Galeotti. 1998. Levels of expression and immunogenicity of attenuated Salmonella enterica serovar typhimurium strains expressing Escherichia coli mutant heat-labile enterotoxin. Infection and Immunity 66:224-231
  • Crameri, A., E. A. Whitehorn, E. Tate, and W. P. Stemmer. 1996. Improved green fluorescent protein by molecular evolution using DNA shuffling. Nat Biotechnol 14: 315-319.
  • Dam, M. and K. Gerdes. 1994. Partitioning of plasmid R1: ten direct repeats flanking the parA promoter constitute a centromere-like partition site parC, that expresses incompatibility. Journal of Molecular Biology 236:1289-1298.
  • Dopf, J. and T. M. Horiagon. 1996. Deletion mapping of the Aequorea victoria green fluorescent protein. Gene 173:39.
  • Downes, F. P., T. J. Barrett, J. H. Green, C. H. Aloisio, J. S. Spika, N. A. Strockbine, and I. K. Wachsmuth. 1988. Affinity purification and characterization of Shiga-like toxin II and production of toxin-specific monoclonal antibodies. Infection and Immunity 56:1926.
  • Egger, L. A., H. Park, and M. Inouye. 1997. Signal transduction via the histidyl-aspartyl phosphorelay. Genes to Cells 2:167.
  • Endo, Y., K. Tsurugi, T. Yutsudo, Y. Takeda, T. Ogasawara, and K. Igarashi. 1988. Site of action of a Vero toxin (VT2) from Escherichia coli O157:H7 and of Shiga toxin on eukaryotic ribosomes: RNA N-glycosidase activity of the toxins. European Journal of Biochemistry 171:45.
  • Forrest, B. D., J. T. Labrooy, S. R. Attridge, G. Boehm, L. Beyer, R. Morona, D. J. C. Shearman, and D. Rowley. 1989. Immunogenicity of a candidate live oral typhoid/cholera hybrid vaccine in humans. J. Infect. Dis. 159: 145.
  • Fraser, M. E., M. M. Chernaia, Y. V. Kozlov, and M. N. G. James. 1994. Crystal structure of the holotoxin from Shigella dysenteriae at 2.5 A resolution. Nature Structural Biology 1:59.
  • Galan, J. E., K. Nakayama, and R. Curtiss III. 1990. Cloning and characterization of the asd gene of Salmonella typhimurium: use in stable maintenance of recombinant plasmids in Salmonella vaccine strains. Gene 94:29-35.
  • Galen, J. E. and M. M. Levine. 1995. Improved suicide vectors for chromosomal mutagenesis in Salmonella typhi. Abstracts of the Annual Meeting of the American Society of Microbiology H192:(Abstract)
  • Galen, J. E. and M. M. Levine. 1996. Further refinements of suicide vector-mediated chromosomal mutagenesis in Salmonella typhi. Abstracts of the Annual Meeting of the American Society of Microbiology H260:(Abstract)
  • Galen, J. E., O. G. Gomez-Duarte, G. Losonsky, J. L. Halpern, C. S. Lauderbaugh, S. Kaintuck, M. K. Reymann, and M. M. Levine. 1997. A murine model of intranasal immunization to assess the immunogenicity of attenuated Salmonella typhi live vector vaccines in stimulating serum antibody responses to expressed foreign antigens. Vaccine 15:700-708.
  • Galen, J. E., E. R. Vimr, L. Lawrisuk, and J. B. Kaper. 1990. Cloning, sequencing, and expression of the gene, nanH, for Vibrio cholerae neuraminidase. In Advances in research on cholera and related diarrheas (Edited by Sack R. B. and Zinnake Y. Tokyo: KTK Scientific Publishers. pp. 143-153.
  • Gay, P., D. Le Coq, M. Steinmetz, E. Ferrari, and J. A. Hoch. 1983. Cloning structural gene sacB, which codes for exoenzyme levansucrase of Bacillus subtilis: expression of the gene in Escherichia coli. Journal of Bacteriology 153:1424.
  • Gerdes, K. 1988. The parB (hok-sok) locus of plasmid R1: a general purpose plasmid stabilization system. Bio/Technology 6: 1402-1405.
  • Gerdes, K. and S. Molin. 1986. Partitioning of plasmid R1: structural and functional analysis of the parA locus. Journal of Molecular Biology 190:269.
  • Gerdes, K., A. P. Gultyaev, T. Franch, K. Pedersen, and N. D. Mikkelsen. 1997. Antisense RNA-regulated programmed cell death. Annual Reviews in Genetics 31:1-31.
  • Gerdes, K., J. S. Jacobsen, and T. Franch. 1997b. Plasmid stabilization by post-segregational killing. Genet Eng (NY) 19: 49-61.
  • Gerdes, K., J. E. Larsen, and S. Molin. 1985. Stable inheritance of plasmid R1 requires two different loci. J Bacteriol 161: 292-298.
  • Gerdes, K., P. B. Rasmussen, and S. Molin. 1986. Unique type of plasmid maintenance function: postsegregational killing of plasmid-free cells. Proc Natl Acad Sci USA 83: 3116-3120.
  • Gerichter, C. B. 1960. The dissemination of Salmonella typhi, S. paratyphi A, and S. paratyphi B through the organs of the white mouse by oral infection. Journal of Hygiene, Cambridge 58:307.
  • Gerichter, C. B. and D. L. Boros. 1962. Dynamics of infection of the blood stream and internal organs of white mice with Salmonella typhi by intraperitoneal injection. Journal of Hygiene, Cambridge 60:311.
  • Golub, E. I., and H. A. Panzer. 1988. The F factor of Escherichia coli carries a locus of stable plasmid inheritance stm, similar to the parB locus of plasmid R1. Mol Gen Genet 214: 353-357.
  • Gomez-Duarte, O. G., J. E. Galen, S. N. Chatfield, R. Rappuoli, L. Eidels, and M. M. Levine. 1995. Expression of fragment C of tetanus toxin fused to a carboxyl-terminal fragment of diphtheria toxin in Salmonella typhi CVD 908 vaccine strain. Vaccine 13:1596.
  • Gonzalez, C., D. M. Hone, F. Noriega, C. 0. Tacket, J. R. Davis, G. Losonsky, J. P. Nataro, S. Hoffman, A. Malik, E. Nardin, M. Sztein, D. G. Heppner, T. R. Fouts, A. Isibasi, and M. M. Levine. 1994. Salmonella typhi vaccine strain CVD 908 expressing the circumsporozoite protein of Plasmodium falciparum: strain construction and safety and immunogenicity in humans. Journal of Infectious Diseases 169:927-931.
  • Gordon, V. M., S. C. Whipp, H. W. Moon, A. D. O'Brien, and J. E. Samuel. 1992. An enzymatic mutant of Shiga-like toxin II variant is a vaccine candidate for edema disease of swine. Infection and Immunity 60:485.
  • Gottesman, S., W. P. Clark, V. de Crecy-Lagard, and M. R. Maurizi. 1993. ClpX, an alternative subunit for the ATP-dependent Clp protease of Escherichia coli. Journal of Biological Chemistry 268:22618.
  • Green, J. M., B. P. Nichols, and R. G. Matthews. 1996. Folate biosynthesis, reduction, and polyglutamylation. In Escherichia coli and Salmonella: Cellular and molecular biology. 2nd ed. F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter and H. E. Umbarger, eds. ASM Press, Washington, D.C. p. 665.
  • Griffin, P. M. 1995. Escherichia coli O157:H7 and other enterohemorrhagic Escherichia coli. In Infections of the gastrointestinal tract. M. J. Blaser, P. D. Smith, J. I. Ravdin, H. B. Greenberg and R. L. Guerrant, eds. Raven Press, Ltd, New York, p. 739.
  • Gyles, C. L. 1992. Escherichia coli cytotoxins and enterotoxins. Canadian Journal of Microbiology 38:734.
  • Heim, R., D. C. Prasher, and R. Y. Tsien. 1994. Wavelength mutations and posttranscriptional autoxidation of green fluorescent protein. Proceedings of the National Academy of Sciences USA 91:12501.
  • Hiszczynska-Sawicka, E., and J. Kur. 1997. Effect of Escherichia coli IHF mutations on plasmid p15A copy number. Plasmid 38: 174-179.
  • Hoiseth, S. K. and B. A. Stocker. 1981. Aromatic-dependent Salmonella typhimurium are non-virulent and effective as live vaccines. Nature 291:238.
  • Hone, D. M., A. M. Harris, S. Chatfield, G. Dougan, and M. M. Levine. 1991. Construction of genetically defined double aro mutants of Salmonella typhi. Vaccine 9: 810-816.
  • Hovde, C. J., S. B. Calderwood, J. J. Mekalanos, and R. J. Collier. 1988. Evidence that glutamic acid 167 is an active-site residue of Shiga-like toxin I. Proceedings of the National Academy of Sciences USA 85:2568.
  • Jackson, M. P., E. A. Wadolkowski, D. L. Weinstein, R. K. Holmes, and A. D. O'Brien. 1990. Functional analysis of the Shiga toxin and Shiga-like toxin type II variant binding subunits by using site-directed mutagenesis. Journal of Bacteriology 172:653.
  • Jackson, M. P., R. J. Neill, A. D. O'Brien, R. K. Holmes, and J. W. Newland. 1987. Nucleotide sequence analysis and comparison of the structural genes for Shiga-like toxin I and Shiga-like toxin II encoded by bacteriophages from Escherichia coli. FEMS Microbiology Letters 44:109.
  • Jackson, M. P., R. L. Deresiewicz, and S. B. Calderwood. 1990. Mutational analysis of the Shiga toxin and Shiga-like toxin II enzymatic subunits. Journal of Bacteriology 172:3346.
  • Jarvis, K. G. and J. B. Kaper. 1996. Secretion of extracellular proteins by enterohemorrhagic Escherichia coli via a putative type III secretion system. Infection and Immunity 64:4826.
  • Jarvis, K. G., J. A. Giron, A. E. Jerse, T. K. McDaniel, M. S. Donnenberg, and J. B. Kaper. 1995. Enteropathogenic Escherichia coli contains a putative type III secretion system necessary for the export of proteins involved in attaching and effacing lesion formation. Proceedings of the National Academy of Sciences USA 92:7996.
  • Jensen, R. B. and K. Gerdes. 1995. Programmed cell death in bacteria: proteic plasmid stabilization systems. Molecular Microbiology 17:205.
  • Jensen, R. B. and K. Gerdes. 1997. Partitioning of plasmid R1. The ParM protein exhibits ATPase activity and interacts with the centromere-like ParR-parC complex. Journal of Molecular Biology 269:505-513.
  • Karem, K. L., S. Chatfield, N. Kuklin, and B. T. Rouse. 1995. Differential induction of carrier antigen-specific immunity by Salmonella typhimurium live-vaccine strains after single mucosal or intravenous immunization of BALB/c mice. Infection and Immunity 63:4557-4563.
  • Karmali, M. A. 1989. Infection by verocytotoxin-producing Escherichia coli. Clinical Microbiological Reviews 2:15.
  • Karmali, M. A., M. Petric, C. Lim, P. C. Fleming, and B. T. Steele. 1983. Escherichia coli cytotoxin, haemolytic-uraemic syndrome, and haemorrhagic colitis. Lancet ii:1299.
  • Karmali, M. A., M. Petric, C. Lim, P. C. Fleming, G. S. Arbus, and H. Lior. 1985. The association between idiopathic hemolytic uremic syndrome and infection by verotoxin-producing Escherichia coli. Journal of Infectious Diseases 151:775.
  • Karpman, D., H. Connell, M. Svensson, F. Scheutz, P. Alm, and C. Svanborg. 1997. The role of lipopolysaccharide and Shiga-like toxin in a mouse model of Escherichia coli O157:H7 infection. Journal of Infectious Diseases 175:611.
  • Keusch, G. T., G. F. Grady, L. J. Mata, and J. McIver. 1972. Pathogenesis of shigella diarrhea. 1. Enterotoxin production by Shigella dysenteriae 1. Journal of Clinical Investigation 51:1212.
  • Killeen, K. P., V. Escuyer, J. J. Mekalanos, and R. J. Collier. 1992. Reversion of recombinant toxoids: mutations in diphtheria toxin that partially compensate for active-site deletions. Proceeding of the National Academy of Sciences USA 89:6207.
  • Kim, J. Y., H. A. Kang, and D. D. Ryu. 1993. Effects of the par locus on the growth rate and structural stability of recombinant cells. Biotechnology Progress 9:548.
  • Konowalchuk, J., J. I. Speirs, and S. Stavric. 1977. Vero response to a cytotoxin of Escherichia coli. Infection and Immunity 18:775.
  • Langermann, S., S. Palaszynski, A. Sadziene, C. K. Stover, and S. Koenig. 1994. Systemic and mucosal immunity induced by BCG vector expressing outer-surface protein A of Borrelia burgdorferi. Nature 372: 552-555.
  • Lee, S. F., R. J. March, S. A. Halpern, G. Faulkner, and L. Gao. 1999. Surface expression of a protective recombinant pertussis toxin S1 subunit fragment in Streptococcus gordonii. Infect Immun 67: 1511-1516.
  • Lehnherr, H. and M. B. Yarmolinsky. 1995. Addiction protein Phd of plasmid prophage P1 is a substrate of the CIpXP serine protease of Escherichia coli. Proceedings of the National Academy of Sciences USA 92:3274.
  • Lehnherr, H., E. Maguin, S. Jafri, and M. B. Yarmolinsky. 1993. Plasmid addiction genes of bacteriophage P1: doc, which causes cell death on curing of prophage, and phd, which prevents host death when prophage is retained. Journal of Molecular Biology 233:414.
  • Levine, M. M., J. E. Galen, E. M. Barry, F. Noriega, S. Chatfield, M. Sztein, G. Dougan, and C. O. Tacket. 1996. Attenuated Salmonella as live oral vaccines against typhoid fever and as live vectors. Journal of Biotechnology 44:193.
  • Lindgren, S. W., J. E. Samuel, C. K. Schmitt, and A. D. O'Brien. 1994. The specific activities of Shiga-like toxin type II (SLT-II) and SLT-II-related toxins of enterohemorrhagic Escherichia coli differ when measured by Vero cell cytotoxicity but not by mouse lethality. Infection and Immunity 62:623.
  • Lloyd, R. G. and K. B. Low. 1996. Homologous recombination. In Escherichia coli and Salmonella: Cellular and molecular biology. 2nd ed. F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter and H. E. Umbarger, eds. ASM Press, Washington, D.C. p. 2236.
  • Loh, S. M., D. S. Cram, and R. A. Skurray. 1988. Nucleotide sequence and transcriptional analysis of a third function (Flm) involved in F plasmid maintenance. Gene 66: 259-268.
  • Lohman, T. M. and M. E. Ferrari. 1994. Escherichia coli single-stranded DNA-binding protein: multiple DNA-binding modes and cooperativities. Annual Reviews in Biochemistry 63:527.
  • Louise, C. B. and T. G. Obrig. 1995. Specific interaction of Escherichia coli O157:H7-derived Shiga-like toxin II with human renal endothelial cells. Journal of Infectious Diseases 172:1397.
  • Love, C. A., P. E. Lilley, and N. E. Dixon. 1996. Stable high-copy-number bacteriophage lambda promoter vectors for overproduction of proteins in Escherichia coli. Gene 176:49.
  • Lynch, A. S. and E. C. C. Lin. 1996. Responses to molecular oxygen. In Escherichia coli and Salmonella: Cellular and molecular biology. 2nd ed. F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter and H. E. Umbarger, eds. ASM Press, Washington, D.C. p. 1526.
  • Magnuson, R., H. Lehnherr, G. Mukhopadhyay, and M. B. Yarmolinsky. 1996. Autoregulation of the plasmid addiction operon of bacteriophage P1. Journal of Biological Chemistry 271:18705.
  • Makoff, A. J., and A. E. Smallwood. 1988. Heterologous expression in Escherichia coli: effects of alterations in the sequence 5′ to the initiation codon. Biochem Soc Trans 16: 48-49.
  • Mangeney, M., C. A. Lingwood, S. Taga, B. Caillou, T. Tursz, and J. Wiels. 1993. Apoptosis induced in Burkitt's lymphoma cells via Gb.sub.3/CD77, a glycolipid antigen. Cancer Research 53:5314.
  • Marshall, J., R. Molloy, G. W. J. Moss, J. R. Howe, and T. E. Hughes. 1995. The jellyfish green fluorescent protein: a new tool for studying ion channel expression and function. Neuron 14:211.
  • Martinez-Flores, I., R. Cano, V. H. Bustamante, E. Calva, and J. L. Puente. 1999. The ompB operon partially determines differential expression of OmpC in Salmonella typhi and Escherichia coli. J Bacteriol 181: 556-562.
  • Matthews, R. G. 1996. One-carbon metabolism. In Escherichia coli and Salmonella: Cellular and molecular biology. 2nd ed. F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter and H. E. Umbarger, eds. ASM Press, Washington, D.C. p. 600.
  • Maurizi, M. R., W. P. Clark, Y. Katayama, S. Rudikoff, J. Pumphrey, B. Bowers, and S. Gottesman. 1990. Sequence and structure of CIp P, the proteolytic component of the ATP-dependent CIp protease of Escherichia coli. Journal of Biological Chemistry 265:12536.
  • McClelland, M. and. R. Wilson. 1998. Sample sequencing of the Salmonella typhi genome: comparison to the E. coli K-12 genome. Infection and Immunity
  • McDaniel, T. K., K. G. Jarvis, M. S. Donnenberg, and J. B. Kaper. 1995. A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens. Proceedings of the National Academy of Sciences USA 92:1664.
  • McDermott, P. J., P. Gowland, and P. C. Gowland. 1993. Adaptation of Escherichia coli growth rates to the presence of pBR322. Lett Appl Microbiol 17: 139-143.
  • Meacock, P. A., and S. N. Cohen. 1980. Partitioning of bacterial plasmids during cell division: a cis-acting locus that accomplishes stable plasmid inheritance. Cell 20: 529-542.
  • Medaglini, D., G. Pozzi, T. P. King, and V. A. Fischetti. 1995. Mucosal and systemic immune responses to a recombinant protein expressed on the surface of the oral commensal bacterium Streptococcus gordonii after oral colonization. Proc Natl Acad Sci USA 92: 6868-4872.
  • Melton-Celsa, A. R. and A. D. O'Brien. 1998. The structure, biology, and relative toxicity for cells and animals of Shiga toxin family members. In Escherichia coli O157:H7 and other Shiga toxin-producing E. coli strains. J. B. Kaper and A. D. O'Brien, eds. ASM Press, Washington, D.C. In press.
  • Mikkelsen, N. D. and K. Gerdes. 1997. Sok antisense RNA from plasmid R1 is functionally inactivated by RNaseE and polyadenylated by poly(A) polymerase I. Molecular Microbiology 26:311.
  • Miller, C. A., S. L. Beaucage, and S. N. Cohen. 1990. Role of DNA superhelicity in partitioning of the pSC101 plasmid. Cell 62: 127-133.
  • Moxley, R. A. and D. H. Francis. 1998. Overview of Animal Models. In Eschenchia coli O157: H7 and other Shiga toxin-producing E. coli strains. J. B. Kaper and A. D. O'Brien, eds. ASM Press, Washington, D.C. In press.
  • Muhldorfer, I., J. Hacker, G. T. Keusch, D. W. Acheson, H. Tschape, A. V. Kane, A. Ritter, T. Olschlager, and A. Donohue-Rolfe. 1996. Regulation of the Shiga-like toxin II operon in Escherichia coli. Infection and Immunity 64:495.
  • Nakayama, K., S. M. Kelley, and R. Curtiss III. 1988. Construction of an Asd.sup.+expression-cloning vector: stable maintenance and high level expression of cloned genes in a Salmonella vaccine strain. Bio/Technology 6: 693-697.
  • Nakayama, K., S. M. Kelley, and R. Curtiss III. 1988. Construction of an Asd.sup.+expression-cloning vector: stable maintenance and high level expression of cloned genes in a Salmonella vaccine strain. Bio/Technology 6:693.
  • Nelson, S., S. E. Richardson, C. A. Lingwood, M. Petric, and M. A. Karmali. 1994. Biological activity of verocytotoxin (VT)2c and VT1/VT2c chimeras in the rabbit model. In Recent advances in verocytotoxin-producing Escherichia Coli infections. M. A. Karmali and A. G. Goglio, eds. Elsevier Science, New York, p. 245.
  • Niki, H., and S. Hiraga. 1997. Subcellular distribution of actively partitioning F plasmid during the cell division cycle of E. coli. Cell 90: 951-957.
  • Nordstrom, K. and S. J. Austin. 1989. Mechanisms that contribute to the stable segregation of plasmids. Annual Reviews in Genetics 23:37.
  • Noriega, F. R., G. Losonsky, J. Y. Wang, S. B. Formal, and M. M. Levine. 1996. Further characterization of .DELTA.aroA .DELTA.virG Shigella flexneri 2a strain CVD 1203 as a mucosal Shigella vaccine and as a live-vector vaccine for delivering antigens of enterotoxigenic Escherichia coli. Infect Immun 64: 23-27.
  • Norioka, S., G. Ramakrishnan, K. Ikenaka, and M. Inouye. 1986. Interaction of a transcriptional activator, OmpR, with reciprocally osmoregulated genes, ompF and ompC, of Escherichia coli. Journal of Biological Chemistry 261:17113-17119
  • Nyholm, P., G. Magnusson, Z. Zheng, R. Norel, B. Binnington-Boyd, and C. A. Lingwood. 1996. Two distinct binding sites for globotriaosyl ceramide on verotoxins: identification by molecular modelling and confirmation using deoxy analogues and a new glycolipid receptor for all verotoxins. Chemistry and Biology 3:263.
  • Nyholm, P., J. L. Brunton, and C. A. Lingwood. 1995. Modelling of the interaction of verotoxin-1 (VT1) with its glycolipid receptor, globotriaosylceramide (Gb.sub.3). International Journal of Biological Macromolecules 17:199.
  • O'Brien, A. D. 1982. Innate resistance of mice to Salmonella typhi infection. Infection and Immunity 38:948.
  • O'Brien, A. D., V. L. Tesh, A. Donohue-Rolfe, M. P. Jackson, S. Olsnes, K. Sandvig, A. A. Lindberg, and G. T. Keusch. 1992. Shiga toxin: biochemistry, genetics, mode of action, and role in pathogenesis. Current Topics in Microbiology and Immunology 180:65.
  • Olitsky, P. K. and I. J. Kligler. 1920. Toxins and antitoxins of Bacillus dysenteriae Shiga. Journal of Experimental Medicine 31:19.
  • Orosz, A., I. Boros, and P. Venetianer. 1991. Analysis of the complex transcription termination region of the Escherichia coli rrnB gene. European Journal of Biochemistry 201:653.
  • Oxer, M. D., C. M. Bentley, J. G. Doyle, T. C. Peakman, I. G. Charles, and A. J. Makoff. 1991. High level heterologous expression in E. coli using the anaerobically-activated nirB promoter. Nucleic Acids Research 19:2889-2892.
  • Pallen, M. J. and B. W. Wren. 1997. The HtrA family of serine proteases. Molecular Microbiology 26:209.
  • Pecota, D. C., C. S. Kim, K. Wu, K. Gerdes, and T. K. Wood. 1997. Combining the hoklsok, parDE, and pnd postsegregational killer loci to enhance plasmid stability. Applied and Environmental Microbiology 63:1917-1924.
  • Perera, L. P., J. E. Samuel, R. K. Holmes, and A. D. O'Brien. 1991. Mapping the minimal contiguous gene segment that encodes fuictionally active Shiga-like toxin II. Infection and Immunity 59:829.
  • Perera, L. P., J. E. Samuel, R. K. Holmes, and A. D. O'Brien. 1991. Identification of three amino acid residues in the B subunit of Shiga toxin and Shiga-like toxin type II that are essential for holotoxin activity. Journal of Bacteriology 173:1151.
  • Pittard, A. J. 1996. Biosynthesis of the aromatic amino acids. In Escherichia coli and Salmonella: Cellular and molecular biology. 2nd ed. F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter and H. E. Umbarger, eds. ASM Press, Washington, D.C. p. 458.
  • Polisky, B. 1986. Replication control of the CoIE1-type plasmids. In Maximizing gene expression. W. S. Reznikoff and L. Gold, eds. Butterworths, Boston, p. 143.
  • Porter, R. D., S. Black, S. Pannuri, and A. Carlson. 1990. Use of the Escherichia coli ssb gene to prevent bioreactor takeover by plasmidless cells. Bio/Technology 8:47.
  • Pouwels, P. H., R. J. Leer, M. Shaw, M. J. Heijne den Bak-Glashouwer, F. D. Tielen, E., Smit, B. Martinez, J. Jore, and P. L. Conway. 1998. Lactic acid bacteria as antigen delivery vehicles for oral immunization purposes. Int J Food Microbiol 41: 155-167.
  • Pratt, L. A., W. Hsing, K. E. Gibson, and T. J. Silhavy. 1996. From acids to osmZ: mutiple factors influence synthesis of the OmpF and ompC porins in Escherichia coli. Molecular Microbiology 20:911.
  • Puente, J. L., V. Alvarez-Scherer, G. Gosset, and E. Calva. 1989. Comparative analysis of the Salmonella typhi and Escherichia coli ompC genes. Gene 83:197.
  • Richardson, S. E., T. A. Rotman, V. Jay, C. R. Smith, L. E. Becker, M. Petric, N. F. Olivieri, and M. A. Karmali. 1992. Experimental verocytotoxemia in rabbits. Infection and Immunity 60:4154.
  • Ringquist, S., S. Shinedling, D. Barrick, L. Green, J. Binkley, G. D. Stormo, and L. Gold. 1992. Translation initiation in Escherichia coli: sequences within the ribosome-binding site. Molecular Microbiology 6:1219.
  • Roberts, M., S. Chatfield, and G. Dougan. 1994. Salmonella as carriers of heterologous antigens. In Novel delivery systems for oral vaccines. D. T. O'Hagan, ed. CRC Press, Ann Arbor, p. 27-58.
  • Ruiz-Echevarria, M. J., G. Gimenez-Gallego, R. Sabariegos-Jareno, and R. Diaz-Orejas. 1995. Kid, a small protein of the parD stability system of plasmid R1, is an inhibitor of DNA replication acting at the initiation of DNA synthesis. J Mol Biol 247: 568-577.
  • Rupp, W. D. 1996. DNA repair mechanisms. In Escherichia coli and Salmonella: Cellular and molecular biology. 2nd ed. F. C. Neidhardt, R. Curtiss 111, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter and H. E. Umbarger, eds. ASM Press, Washington, D.C. p. 2277.
  • Ryan, E. T., J. R. Butterton, R. N. Smith, P. A. Carroll, T. I. Crean, and S. B. Calderwood. 1997a. Protective immunity against Clostridium difficile toxin A induced by oral immunization with a live, attenuated Vibrio cholerae vector strain. Infect Immun 65: 2941-2949.
  • Ryan, E. T., J. R. Butterton, T. Zhang, M. A. Baker, S. L. J. Stanley, and S. B. Calderwood. 1997b. Oral immunization with attenuated vaccine strains of Vibrio cholerae expressing a dodecapeptide repeat of the serine-rich Entamoeba histolytica protein fused to the cholera toxin B subunit induces systemic and mucosal antiarnebic and anti-V. cholerae antibody responses in mice. Infect Immun 65: 3118-3125.
  • Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: A Laboratory Manual, 2nd edition. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press.
  • Selzer, G., T. Som, T. Itoh, and J. Tomizawa. 1983. The origin of replication of plasmid p15A and comparative studies on the nucleotide sequences around the origin of related plasmids. Cell 32:119.
  • Shaw, K. J., P. N. Rather, R. S. Hare, and G. H. Miller. 1993. Molecular genetics of amino-glycoside resistance genes and familial relationships of the aminoglycoside-modifying enzymes. Microbiol Rev 57: 138-163.
  • Siegler, R. L. 1995. The hemolytic uremic syndrome. Pediatric Nephrology 42:1505.
  • Siegler, R. L., A. T. Pavia, R. D. Christofferson, and M. K. Milligan. 1994. A 20-year population-based study of postdiarrheal hemolytic uremic syndrome in Utah. Pediatrics 94:35.
  • Sixma, T. K., P. E. Stein, W. G. Hol, and R. J. Read. 1993. Comparison of the B-pentamers of heat-labile enterotoxin and verotoxin-1: two structures with remarkable similarity and dissimilarity. Biochemistry 32:191.
  • Srinivasan, J., S. A. Tinge, R. Wright, J. C. Herr, and R. Curtiss III. 1995. Oral immunization with attenuated Salmonella expressing human sperm antigen induces antibodies in serum and the reproductive tract. Biology of Reproduction 53:462.
  • Stein, P. E., A. Boodhoo, G. J. Tyrrell, J. L. Brunton, and R. J. Read. 1992. Crystal structure of the cell-binding B oligomer of verotoxin-1 from E. coli. Nature 355:748.
  • Stoker, N. G., N. F. Fairweather, and B. G. Spratt. 1982. Versatile low-copy-number plasmid vectors for cloning in Escherichia coli. Gene 18: 335-341.
  • Streaffield, S. J., M. Sandkvist, T. K. Sixma, M. Bagdasarian, W. G. Hol, and T. R. Hirst. 1992. Intermolecular interactions between the A and B subunits of heat-labile enterotoxin from Escherichia coli promote holotoxin assembly and stability in vivo. Proceedings of the National Academy of Sciences USA 89:12140.
  • Strockbine, N. A., L. R. M. Marques, J. W. Newland, H. W. Smith, R. K. Holmes, and A. D. O'Brien. 1986. Two toxin-converting phages from Escherichia coli O157:H7 strain 933 encode antigenically distinct toxins with similar biologic activities. Infection and Immunity 53:135.
  • Strockbine, N. A., M. P. Jackson, L. M. Sung, R. K. Holmes, and A. D. O'Brien. 1988. Cloning and sequencing of the genes for Shiga toxin from Shigella dysenteriae Type 1. Journal of Bacteriology 170:1116.
  • Strugnell, R. A., D. Maskell, N. F. Fairweather, D. Pickard, A. Cockayne, C. Penn, and G. Dougan. 1990. Stable expression of foreign antigens from the chromosome of Salmonella typhimurium vaccine strains. Gene 88: 57-63.
  • Summers, D. K. The Biology of Plasmids, 65-91, 1996.
  • Summers, D. K. 1998. Timing, self-control and sense of direction are the secrets of multicopy plasmid stability. Mol Microbiol 29: 1137-1145.
  • Summers, D. K. and D. J. Sherratt. 1984. Multimerization of high copy number plasmids causes instability: CoIE1 encodes a determinant essential for plasmid monomerization and stability. Cell 36:1097.
  • Tacket, C. O., D. M. Hone, R. Curtiss III, S. M. Kelly, G. L s nsky, L. Gu rs, A. M. Harris, R. Edelman, and M. M. Levine. 1992. Comparison of the safety and immunogenicity of .DELTA.aroC.DELTA.aroD and .DELTA.cya.DELTA.crp Salmonella typhi strains in adult volunteers. Infection and Immunity 60:536.
  • Tacket, C. O., M. Sztein, G. Losonsky, S. S. Wasserman, J. P. Nataro, R. Edelman, D. Pickard, G. Dougan, S. Chatfield, and M. M. Levine. 1997. Safety of live oral Salmonella typhi vaccine strains with deletions in htrA and aroC aroD and immune responses in humans. Infection and Immunity 65:452-456.
  • Tacket, C. O., S. M. Kelley, F. Schodel, G. Losonsky, J. P. Nataro, R. Edelman, M. M. Levine, and R. Curtiss III. 1997. Safety and immunogenicity in humans of an attenuated Salmonella typhi vaccine vector strain expressing plasmid-encoded hepatitis B antigens stabilized by the Asd-balanced lethal vector system. Infection and Immunity 65:3381-3385.
  • Takeda, Y. 1995. Shiga and Siga-like (Vero) toxins. In Bacterial toxins and virulence factors in disease. J. Moss, B. Iglewski, M. Vaughan and A. Tu, eds. Marcel Dekker, Inc. New York, p. 313.
  • Tauxe, R. V. 1998. Public health perspective on immunoprophylactic strategies for Escherichia coli O157:H7: who or what would we immunize? In Escherichia coli O157:H7 and other Shiga toxin-producing E. coli strains. J. B. Kaper and A. D. O'Brien, eds. ASM Press, Washington, D.C. In press.
  • Tesh, V. L., J. A. Burris, J. W. Owens, V. M. Gordon, E. A. Wadolkowski, A. D. O'Brien, and J. E. Samuel. 1993. Comparison of the relative toxicities of Shiga-like toxins type I and type II for mice. Infection and Immunity 61:3392.
  • Thisted, T., A. K. Nielsen, and K. Gerdes. 1994. Mechanism of post-segregational killing: translation of Hok, SmB and Pnd mRNAs of plasmids R1, F and R483 is activated by 3′-end processing. EMBO Journal 13:1950.
  • Thisted, T., N. S. Sorensen, and K. Gerdes. 1995. Mechanism of post-segregational killing: secondary structure analysis of the entire Hok mRNA from plasmid R1 suggests a fold-back structure that prevents translation and antisense RNA binding. Journal of Molecular Biology 247:859.
  • Thisted, T., N. S. Sorensen, E. G. Wagner, and K. Gerdes. 1994. Mechanism of post-segregational killing: Sok antisense RNA interacts with Hok mRNA via its 5′-end single-stranded leader and competes with the 3′-end of Hok mRNA for binding to the mok translational initiation region. EMBO Journal 13:1960.
  • Tinge, S. A. and R. Curtiss III. 1990. Conservation of Salmonella typhimurium virulence plasmid maintenance regions among Salmonella serovars as a basis for plasmid curing. Infection and Immunity 58:3084.
  • Tinge, S. A. and R. Curtiss III. 1990. Isolation of the replication and partitioning regions of the Salmonella typhimurium virulence plasmid and stabilization of heterologous replicons. Journal of Bacteriology 35 172:5266.
  • Twigg, A. J., and D. Sherratt. 1980. Trans-complementable copy-number mutants of plasmid CoIE1. Nature 283: 216-218.
  • Umbarger, H. E. 1978. Amino acid biosynthesis and its regulation. Annual Reviews in Biochemistry 47:533.
  • Valdivia, R. H. and S. Falkow. 1997. Fluorescence-based isolation of bacterial genes expressed within host cells. Science 277:2007.
  • Valdivia, R. H., A. E. Hromockyj, D. Monack, L. Ramakrishnan, and S. Falkow. 1996. Applications for green fluorescent protein (GFP) in the study of host-pathogen interactions. Gene 173:47.
  • Van Melderen, L., P. Bernard, and M. Couturier. 1994. Lon-dependent proteolysis of CcdA is the key control for activation of CcdB in plasmid-free segregant bacteria. Mol Microbiol 11: 1151-1157.
  • Vicari, G., A. J. Olitzki, and Z. Olitzki. 1960. The action of the thermolabile toxin of Shigella dysenteriae on cells cultivated in vitro. British Journal of Experimental Pathology 41:179.
  • Wada, K., Y. Wada, F. Ishibashi, T. Gojobori, and T. Ikemura. 1992. Codon usage tabulated from the GenBank genetic sequence data. Nucleic Acids Research 20:2111.
  • Wadolkowski, E. A., L. M. Sung, J. A. Burris, J. E. Samuel, and A. D. O'Brien. 1990. Acute renal tubular necrosis and death of mice orally infected with Escherichia coli strains that produce Shiga-like toxin type II. Infection and Immunity 58:3959.
  • Wahle, E., and A. Kornberg. 1988. The partition locus of plasmid pSC101 is a specific binding site for DNA gyrase. EMBO J 7: 1889-1895.
  • Wang, S. and T. Hazelrigg. 1994. Implications for bcd mRNA localization from spatial distribution of exu protein in Drosophila oogenesis. Nature 369:400.
  • Wang, Y., Z. Zhang, S. Yang, and R. Wu. 1992. Cloning of par region and the effect of par region on the stability of pUC9. Chinese Journal of Biotechnology 8:107.
  • Williams, K. R., J. B. Murphy, and J. W. Chase. 1984. Characterization of the structural and functional defect in the Escherichia coli single-stranded DNA binding protein encoded by the ssb-1 mutant gene. Journal of Biological Chemistry 259:11804.
  • Wu, K., and T. K. Wood. 1994. Evaluation of the hok/sok killer locus for enhanced plasmid stability. Biotechnol Bioeng 44: 912-921.
  • Yamasaki, S., M. Furutani, K. Ito, K. lgarashi, M. Nishibuchi, and Y. Takeda. 1991. Importance of arginine at postion 170 of the A subunit of Vero toxin 1 produced by enterohemorrhagic Escherichia coli for toxin activity. Microbial Pathogenesis 11:1.
  • Yanofsky, C., T. Platt, I. P. Crawford, B. P. Nichols, G. E. Christie, H. Horowitz, M. Van Cleemput, and A. M. Wu. 1981. The complete nucleotide sequence of the tryptophan operon of Escherichia coli. Nucleic Acids Res 9: 6647-6668.
  • Yu, J. and J. B. Kaper. 1992. Cloning and characterization of the eae gene of enterohaemorrhagic Escherichia coli. Molecular Microbiology 6:411.
  • Zalkin, H. and P. Nygaard. 1996. Biosynthesis of purine nucleotides. In Escherichia coli and Salmonella: Cellular and molecularbiology. 2nd ed. F. C. Neidhardt, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter and H. E. Umbarger, eds. ASM Press, Washington, D.C. p. 561.
  • Zhang, X., Y. Lou, M. Koopman, T. Doggett, K. S. K. Tung, and R. Curtiss III. 1997. Antibody responses and infertility in mice following oral immunization with attenuated Salmonella typhimurium expressing recombinant murine ZP3. Biology of Reproduction 56:33.
  • Zoja, C., D. Coma, C. Farina, G. Sacchi, C. A. Lingwood, M. P. Doyle, V. V. Padhye, M. Abbate, and G. Remuzzi. 1992. Verotoxin glycolipid receptors determine the localization of microangiopathic process in rabbits given verotoxin-1. Journal of Laboratory and Clinical Medicine 120:229.
  • Zurita, M., F. Bolivar, and X. Soberon. 1984. Construction and characterization of new cloning vehicles. VII. Construction of plasmid pBR327par, a completely sequenced, stable derivative of pBR327 containing thepar locus of pSC101. Gene 28:119.

Claims
  • 1. An expression vector comprising a nucleotide sequence encoding: (a) a restricted-copy-number origin of replication cassette comprising (i) a nucleotide sequence encoding an origin of replication that limits the expression vector to an average plasmid copy number of about 2 to 75 copies per cell,(ii) a first unique restriction enzyme cleavage site located 5′ of the nucleotide sequence encoding the origin of replication, and(iii) a second unique restriction enzyme cleavage site located 3′ of the nucleotide sequence encoding the origin of replication;(b) at least one post-segregational killing cassette comprising (i) a nucleotide sequence encoding a ssb post-segregational killing locus, wherein the nucleotide sequence encoding the ssb post-segregational killing locus is the nucleotide sequence of SEQ ID NO:41 or a nucleotide sequence having at least 95% sequence identity over its entire length to the nucleotide sequence of SEQ ID NO:41, wherein the nucleotide sequence of SEQ ID NO:41 comprises the ssb inducible promoter, the ssb constitutive promoter and the ssb coding region of Shigella flexneri 2a strain 2457t, and wherein both the inducible and constitutive promoters of said nucleotide sequence having at least 95% sequence identity have promoter activity, and wherein the SSB polypeptide encoded by said nucleotide sequence having at least 95% sequence identity has DNA binding and DNA replication activity,(ii) a third unique restriction enzyme cleavage site located 5′ of the nucleotide sequence encoding the ssb post-segregational killing locus, and(iii) a fourth unique restriction enzyme cleavage site located 3′ of the nucleotide sequence encoding the ssb post-segregational killing locus; and(c) at least one partitioning cassette comprising (i) a nucleotide sequence encoding at least one partitioning function,(ii) a fifth unique restriction enzyme cleavage site located 5′ of the nucleotide sequence encoding the at least one partitioning function, and(iii) a sixth unique restriction enzyme cleavage site located 3′ of the nucleotide sequence encoding the at least one partitioning function.
  • 2. The expression vector of claim 1, wherein the nucleotide sequence encoding said ssb post-segregational killing locus is the nucleotide sequence of SEQ ID NO:41.
  • 3. The expression vector of claim 1, wherein the nucleotide sequence encoding said ssb post-segregational killing locus is the nucleotide sequence having at least 95% sequence identity over its entire length to the nucleotide sequence of SEQ ID NO:41.
  • 4. The expression vector of claim 1, wherein the restricted-copy-number origin of replication is selected from the group consisting of oriEl comprising nucleotides 1250 to 1936 of SEQ ID NO: 1, ori101 comprising nucleotides 50 to 2004 of SEQ ID NO: 3, and ori15A comprising nucleotides 50 to 684 of SEQ ID NO: 2.
  • 5. The expression vector of claim 1, wherein the average plasmid copy-number is about 5 to about 60 copies per cell.
  • 6. The expression vector of claim 1, wherein the partitioning function is an active partitioning function.
  • 7. The expression vector of claim 1, wherein the nucleotide sequence encoding at least one partitioning function comprises the Escherichia coli parA set forth in SEQ ID NO:63.
  • 8. The expression vector of claim 1, wherein the nucleotide sequence encoding at least one partitioning function is the par locus of Escherichia coli pSC101 set forth in SEQ ID NO:62.
  • 9. The expression vector of claim 1, further comprising (d) an expression cassette comprising: (i) a promoter,(ii) a seventh unique restriction enzyme cleavage site located 5′ of the promoter, and(iii) an eighth unique restriction enzyme cleavage site located 3′ of the promoter.
  • 10. The expression vector of claim 9, wherein the promoter of (d)(i) is an inducible promoter.
  • 11. The expression vector of claim 10, wherein the inducible promoter is an ompC promoter.
  • 12. The expression vector of claim 11, wherein the ompC promoter comprises the nucleotide sequence set forth in SEQ ID NO:67.
  • 13. The expression vector of claim 9, wherein said expression cassette (d) further comprises a nucleotide sequence encoding an antigen positioned at the 3′ end of the nucleotide sequence encoding promoter (d)(i), wherein expression of said antigen is under control of said promoter (d)(i).
  • 14. The expression vector of claim 13, wherein the antigen is selected from the group consisting of a viral antigen, a bacterial antigen, a cancer antigen, and an auto-immune antigen.
  • 15. The expression vector of claim 13, wherein the antigen is selected from the group consisting of a domain of the anthrax toxin Protective Antigen PA83 moiety, full-length PA83 or the 63 kDa biologically active form of PA83.
  • 16. The expression vector of claim 13, wherein the antigen is one or more fragments of a Clostridium botulinum neurotoxin eukaryotic cell-binding heavy chain, wherein said heavy chain is a heavy chain of a Clostridium botulinum serotype selected from the group consisting of Clostridium botulinum serotypes A, B, C, D, E, F and G.
  • 17. The expression vector of claim 15, wherein the domain of the anthrax toxin Protective Antigen PA83 moiety is domain 4.
  • 18. An isolated cell comprising the expression vector of claim 1.
  • 19. The isolated cell of claim 18, wherein the isolated cell is a bacterial cell.
  • 20. The isolated cell of claim 19, wherein the isolated cell is an attenuated Salmonella typhi cell.
  • 21. The isolated cell of claim 19, wherein the isolated cell is a cell of a bacterial strain selected from the group consisting of Shigella flexneri 2a strain CVD 1208s, Salmonella enterica serovar Typhi strain CVD 908-htrA, Salmonella enterica serovar Typhi strain CVD 909, and E. coli strain DH5 alpha.
  • 22. The isolated cell of claim 19, wherein the endogenous ssb gene of said bacterial cell is inactivated or deleted.
  • 23. The isolated cell of claim 21, wherein the endogenous ssb gene of said bacterial cell is inactivated or deleted.
CROSS-REFERENCE TO RELATED APPLICATIONS

This Application is a Continuation-in-Part Application of U.S. application Ser. No. 11/229,069, filed Sep. 19, 2005, now U.S. Pat. No. 7,141,408 which is a Continuation Application of U.S. application Ser. No. 10/750,976 (now U.S. Pat. No. 6,977,176), filed Jan. 5, 2004, which is a Divisional of U.S. application Ser. No. 09/453,313 (now U.S. Pat. No. 6,703,233), filed Dec. 2, 1999, which is a Continuation-in-Part Application of U.S. application Ser. No. 09/204,117, filed Dec. 2, 1998 (now U.S. Pat. No. 6,413,768), and also claims benefit of U.S. Provisional Application No. 60/158,738, filed Oct. 12, 1999. Each of these prior applications is hereby incorporated by reference.

STATEMENT OF GOVERNMENT INTEREST

This invention was made with government support under Grant No. RO1AI29471 awarded by the National Institutes of Health. The government has certain rights in the invention.

US Referenced Citations (19)
Number Name Date Kind
4735801 Stocker Apr 1988 A
4760022 Molin et al. Jul 1988 A
4764370 Fields et al. Aug 1988 A
5459072 McKay et al. Oct 1995 A
5527529 Dougan et al. Jun 1996 A
5545541 Molin et al. Aug 1996 A
5643771 Stocker Jul 1997 A
5672345 Curtiss, III Sep 1997 A
5674703 Woo et al. Oct 1997 A
5695983 Miller et al. Dec 1997 A
5763270 Eastman et al. Jun 1998 A
5770214 Dougan et al. Jun 1998 A
5804194 Dougan et al. Sep 1998 A
5824538 Branstrom et al. Oct 1998 A
5851519 Dougan et al. Dec 1998 A
5853718 Molin et al. Dec 1998 A
5922583 Morsey Jul 1999 A
6251406 Haefliger et al. Jun 2001 B1
6703233 Galen Mar 2004 B1
Related Publications (1)
Number Date Country
20070281348 A1 Dec 2007 US
Provisional Applications (1)
Number Date Country
60158738 Oct 1999 US
Divisions (1)
Number Date Country
Parent 09453313 Dec 1999 US
Child 10750976 US
Continuations (1)
Number Date Country
Parent 10750976 Jan 2004 US
Child 11229069 US
Continuation in Parts (2)
Number Date Country
Parent 11229069 Sep 2005 US
Child 11542264 US
Parent 09204117 Dec 1998 US
Child 09453313 US