The present invention relates to polarised three-dimensional cellular aggregates generated in vitro from one or more pluripotent stem cells, methods for obtaining polarised three-dimensional cellular aggregates and cells obtained from the polarised three-dimensional cellular aggregates.
The emergence of asymmetries within a mass of otherwise equivalent cells is the starting event in the development and patterning of all embryos, and results in the establishment of a coordinate system that cells use as a reference to generate the main axes of an organism. In chordate embryos the axial organisation acts as a reference for the process of gastrulation, a choreographed sequence of cell movements that transforms an epithelium into a three-layered structure endowed with a blueprint for the organism: a head at the anterior pole and, in vertebrates, the ectoderm, that will give rise to the nervous system on the dorsal side and the endoderm and the mesoderm on the ventral side. The process of gastrulation is driven by coordinated movements of groups of cells that interpret the global coordinate system of the embryo and give rise to the endoderm and the mesoderm.
Mouse embryonic stem cells (mESCs) are derived from the early mouse embryo and retain their ability to contribute to all embryonic tissues on reintroduction to a host embryo. Whereas mESCs have long been used as an in vitro model of embryogenesis when grown in the form of 3D embryoid bodies (EBs), these structures are typically formed from many hundreds to thousands of cells, and while they form many different cell types, their overall organisation is typically disordered with no reports of axial structures emerging (although polarisation in gene expression has been reported (Berge et al., 2008).
3D culturing protocols for aggregating mouse embryonic stem cells that display key features of early postimplantation mouse development have been reported (Baillie-Johnson et a., 2015, van den Brink et al., 2014, Turner et al., 2014 and Turner et al., 2017). These structures, known as gastruloids, exhibit an embryo-like spatiotemporal organization suggested to correspond to early post-implantation events in the embryo (Turner et al., 2014, Turner et al., 20171, Turner et al., 20172, and van den Brink et al., 2014). However, the lifespan of these gastruloids is limited with decreasing survival after 120 hours post-aggregation. In addition, the gastruloids described to date have not undergone organogenesis. These factors have hindered further development of gastruloids into developmentally and translationally relevant models of organ formation.
The invention provides polarised three-dimensional cellular aggregates (or gastruloids) generated in vitro from one or more pluripotent stem cells, methods for obtaining polarised three-dimensional cellular aggregates and cells (e.g. progenitor cells and derivatives thereof) obtained from the polarised three-dimensional cellular aggregates.
The methods of the invention enable the in vitro generation of polarised three-dimensional cellular aggregates (or gastruloids) that mimic the early post-implantation development of the embryo. When cultured according to the methods of the invention, gastruloids break radial symmetry, polarise their gene expression, and specify the major body axes. They further undergo a gastrulation-like process and axial elongation, and follow a temporal programme of gene expression that corresponds to post-occipital embryonic development, exemplified by the collinear expression of Hox genes along the developing anteroposterior axis. A key strength of this system is the ability to reproducibly and robustly generate large numbers of gastruloids under defined conditions that will enable demanding experimental approaches that would be very difficult or impossible to accomplish in the embryo alone.
Unlike existing methods of cell culture in which cells are kept as disorganised cellular aggregates (embryoid bodies) or artificial 2D cell layers, the polarised three-dimensional cellular aggregates of the invention promote cell-cell interactions in scaffold-free cell culture leading to the emergence of rare and mature cell types (e.g. primordial germ cells (PGCs), haematopoietic stem cells (HSCs) or haematopoietic progenitor cells, cardiac progenitor cells and neuromesodermal progenitors (NMps)) that form integrated tissue and organ structures.
Polarised three-dimensional cellular aggregates (or gastruloids) have a wide range of applications including: Antibody validation (the spatial localisation of a signal allows tests for specificity and background:noise validation for high-throughput early antibody screening); disease modelling and knockout (e.g. gene-editing) modelling (patient-specific or disease-relevant cell lines may be used to generate polarised three-dimensional cellular aggregates to model disease situations); providing a powerful in vitro research tool to gain insights into mechanistic events during post-implantation development including events that co-ordinate organ development with the potential to reduce, refine or replace embryonic material in research (the 3Rs); generation of cell types for in vitro toxicology studies; generation of cell types and tissue primordia for drug screening; induced pluripotent stem cell validation (since polarised three-dimensional cellular aggregates generate 3 germ layers with embryo-like organization, the aggregates may be used as a ‘read out’ assay of iPSC developmental potential, effectively bypassing the need for expensive and ethically-difficult mouse teratoma assays); generation of functional cell types, organs and tissues for regenerative medicine; generation of functional cell types as disease models for use in personalized medicine studies and drug discovery; and non-genetic prenatal diagnostics/testing (with the ability to start from one/few cells, polarised three-dimensional cellular aggregates may be used as a functional assay of developmental potential from blastomere cells of early IVF-embryos)
The polarised three-dimensional cellular aggregates are, like embryos, dynamic entities. These entities have emergent, embryo-like characteristics, in that over time they exhibit temporal sequences of the different combination of markers, gene expression patterns and morphological changes described herein.
The invention provides a polarised three-dimensional cellular aggregate generated in vitro from one or more pluripotent stem cells, wherein:
The invention provides a polarised three-dimensional cellular aggregate generated in vitro from one or more pluripotent stem cells, wherein:
The polarised three-dimensional cellular aggregate may be polarised along the dorsal-ventral axis, wherein the dorsal-ventral axis is defined by at least a dorsal region of cells and a ventral region of cells, wherein the cells of the dorsal region express a higher or lower level of one or more genes than the cells of the ventral region.
The polarised three-dimensional cellular aggregate may be polarised along the medio-lateral, wherein the medio-lateral axis is defined by at least a medial region of cells and two lateral regions of cells, wherein the cells of the medial region express a higher or lower level of one or more genes than the cells of the lateral regions.
The invention provides a polarised three-dimensional cellular aggregate generated in vitro from one or more pluripotent stem cells, wherein:
The invention provides a polarised three-dimensional cellular aggregate generated in vitro from one or more pluripotent stem cells, wherein:
The one or more markers may be gDNA, RNA, polypeptide or other molecules. Preferably, the one or more markers are genes the expression of which is characteristic of the specified cell type.
The one or more markers characteristic of primordial germ cells may be one or more genes the expression of which is characteristic of primordial germ cells. The one or more markers characteristic of primordial germ cells may be one or more genes the expression of which is characteristic of primordial germ cells, optionally wherein the one or more genes are selected from Prdm1, Prdm14, Dazl, Tfap2c, Nanos3. The one or more markers characteristic of primordial germ cells may be one or more markers characteristic of primordial germ cell derivatives.
The cells of the anterior region may express a lower level of one or more genes than the cells of the posterior region, and wherein the one or more genes are selected from Bra, Cdx1, Cdx2, Cdx4, Wnt3a, Cyp26a1, Fgf8, Wnt5a Tbx6, Msgn, Hes3, Chrd, Greb1, Rspo, Notum, Sall3, Sp5, Sp8 and Fgf4.
The cells of the anterior region may express a higher level of one or more genes than the cells of the posterior region, and wherein the one or more genes are selected from Gata6, Raldh2, Otx2, Pax3, Tbx1, Uncx4.1, Pax1, Six1, Meis1, Crabp1, Foxc2, Eya1, Flk1 and Lmo4. Flk1 may be expressed asymmetrically in the anterior region.
The cells of the anterior region may express a lower level of Bra than the cells of the posterior region, and wherein the cells of the anterior region express a higher level of Gata6 than the cells of the posterior region.
The cells of the anterior region may express a lower level of Bra, Cdx2, Wnt3a, Wnt5a Tbx6, Msgn, Hes3, Chrd, Greb1, Rspo, Notum, Sall3, Sp5, Sp8 and/or Fgf4 than the cells of the posterior region, and wherein the cells of the anterior region express a higher level of Gata6 and or Otx2 than the cells of the posterior region.
The cells of the anterior region may express a lower level of Bra, Cdx2, Wnt3a, Wnt5a Tbx6, Msgn, Hes3, Chrd, Greb1, Rspo, Notum, Sall3, Sp5, Sp8 and/or Fgf4 than the cells of the posterior region, and wherein the cells of the anterior region express a higher level of Tbx1 than the cells of the posterior region.
The cells of the anterior region express a lower level of Bra, Cdx2, Wnt3a, Wnt5a Tbx6, Msgn, Hes3, Chrd, Greb1, Rspo, Notum, Sall3, Sp5, Sp8 and/or Fgf4 than the cells of the posterior region, and wherein the cells of the anterior region express a higher level of Six1 than the cells of the posterior region.
The cells of the anterior region may express a lower level of Bra than the cells of the posterior region, and wherein the cells of the anterior region express a higher level of Gata6, Raldh2, Pax3, Tbx1, Uncx4.1, Pax1, Six1, Meis1, Crabp1, Foxc2, Eya1 and/or Lmo4 than the cells of the posterior region.
The cells of the anterior region may express a lower level of Wnt3a than the cells of the posterior region, and wherein the cells of the anterior region express a higher level of Gata6, Raldh2, Pax3, Tbx1, Uncx4.1, Pax1, Six1, Meis1, Crabp1, Foxc2, Eya1 and/or Lmo4 than the cells of the posterior region.
The cells of the anterior region may express a lower level of Tbx6 than the cells of the posterior region, and wherein the cells of the anterior region express a higher level of Gata6, Raldh2, Pax3, Tbx1, Uncx4.1, Pax1, Six1, Meis1, Crabp1, Foxc2, Eya1 and/or Lmo4 than the cells of the posterior region.
The anterior-posterior axis may be further defined by a central region of cells between the anterior region of cells and the posterior region of cells, wherein the cells of the central region express a higher or lower level of one or more genes than the cells of the anterior or posterior regions. The cells of the central region may express a higher level of one or more genes than the cells of the anterior or posterior regions, and wherein the one or more genes are selected from Cer1, Sox1, Sox2, Lnfg, Jag2, Lefty1, Utf1, Tbx3, Ripply2, Mesp1, and Mesp2.
The polarised three-dimensional cellular aggregate may exhibit spatial collinearity of Hox gene expression along the anterior-posterior axis. The polarised three-dimensional cellular aggregate may exhibit spatial and temporal collinearity of Hox gene expression along the anterior-posterior axis. The spatial collinearity of Hox gene expression along the anterior-posterior axis may comprise the sequential and ordered expression along this axis of Hox 1-13 from each of the a, b, c and d clusters. The spatial collinearity of Hox gene expression along the anterior-posterior axis may comprise the temporally sequential and ordered expression along this axis of Hox 1-13 from each of the a, b, c and d clusters.
The anterior region may consist of at least 2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45% or 50% of the polarised three-dimensional cellular aggregate. Preferably, the anterior region consists of at least 5% of the polarised three-dimensional cellular aggregate
The posterior region may consist of at least 2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45% or 50% of the polarised three-dimensional cellular aggregate. Preferably, the posterior region consists of at least 5% of the polarised three-dimensional cellular aggregate.
The central region may consist of at least 2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45% or 50% of the polarised three-dimensional cellular aggregate. Preferably, the central region consists of at least 5% of the polarised three-dimensional cellular aggregate.
The polarised three-dimensional cellular aggregate may comprise two or more of:
The cells of the dorsal region may express a lower level of one or more genes than the cells of the ventral region, and wherein the one or more genes are selected from Shh, Krt18, Pgg, Nedd9, Nodal, Lefty1, 2, Tbx6, Msgn FoxA2, and Kdr. The cells of the dorsal region may express a higher level of one or more genes than the cells of the ventral region, and wherein the one or more genes are selected from Sox2, Lnfg, Irx3, Sox1, and Pax7. The cells of the dorsal region may express a lower level of Shh than the cells of the ventral region, and wherein the cells of the dorsal region express a higher level of Sox2 than the cells of the ventral region.
The dorsal region may consist of at least 2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45% or 50% of the polarised three-dimensional cellular aggregate. Preferably, the dorsal region consists of at least 5% of the polarised three-dimensional cellular aggregate
The ventral region may consist of at least 2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45% or 50% of the polarised three-dimensional cellular aggregate. Preferably, the ventral region consists of at least 5% of the polarised three-dimensional cellular aggregate.
The cells of the medial region may express a lower level of one or more genes than the cells of the lateral regions, and wherein the one or more genes are selected from Osr1, Pecam, Meox1, Kdr, Meox1, Bmp4, Tbx6, Pax2, Lefty1, and Pitx2.
The cells of the medial region may express a higher level of one or more genes than the cells of the lateral regions, and wherein the one or more genes are selected from Sox2, Lfng, FoxA2, and Noto1.
The cells of the medial region may express a lower level of Meox1 and/or Pax2 than the cells of the lateral regions, and wherein the cells of the medial region express a higher level of Sox2 than the cells of the lateral regions. The cells of the medial region may express a lower level of Meox1 and/or Pax2 than the cells of the lateral regions, and wherein the cells of the medial region express a higher level of Sox1 than the cells of the lateral regions.
The medial region may consist of at least 2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45% or 50% of the polarised three-dimensional cellular aggregate. Preferably, the medial region consists of at least 5% of the polarised three-dimensional cellular aggregate
The lateral regions may consist of at least 2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45% or 50% of the polarised three-dimensional cellular aggregate. Preferably, the lateral regions consist of at least 5% of the polarised three-dimensional cellular aggregate.
The invention provides a polarised three-dimensional cellular aggregate generated in vitro from one or more pluripotent stem cells, wherein:
The one or more markers characteristic of endodermal cells or derivatives thereof may be one or more genes the expression of which is characteristic of endodermal cells or derivatives thereof. The one or more genes the expression of which is characteristic of endodermal cells or derivatives thereof may be selected from Gsc, Cdx2, Nedd9, Pyy, Shh, Sores, Cer1, Sox17 and FoxA1, FoxA2. The one or more genes the expression of which is characteristic of endodermal cells or derivatives thereof may be Sox17, Gsc and Cdx2.
The one or more genes the expression of which is characteristic of endodermal cells or derivatives thereof may be Shh and Sorcs2.
The one or more markers characteristic of derivatives of endodermal cells or derivatives thereof may be one or more genes the expression of which is characteristic of gut cells, optionally wherein the gut cells are foregut cells, midgut and/or hindgut cells. The one or more markers characteristic of derivatives of endodermal cells or derivatives thereof may be one or more genes the expression of which is characteristic of oesophagus, lung, trachea, pancreas, liver, stomach, intestine and/or colon cells.
The three-dimensional cellular aggregate comprises an endoderm-like field of cells. The cells of the endoderm-like field of cells may express one or more of Gsc, Cdx2, Nedd9, Pyy Shh, Sorcs, Cer1, Sox17 and FoxA1. The cells of the endoderm-like field of cells may express Sox17, optionally wherein the cells of the endoderm-like field of cells express one or more of Gsc, Cdx2, Nedd9, Pyy, Shh, Sorcs, Cer1, and FoxA1. The endoderm-like field of cells may be arranged in one or more epithelial sheets or tube-like structures.
The one or more markers characteristic of mesodermal cells may be one or more genes the expression of which is characteristic of mesodermal cells. The one or more markers characteristic of mesodermal cells may be selected from, Bra, Meox1, Msgn, Osr1, Pax2, Raldh2, Ripply1/2, Tbx6, Tcf15, Uncx4.1, Kdr, and Pecam.
The one or more genes the expression of which is characteristic of mesodermal cells may be one or more genes the expression of which is characteristic of axial mesoderm, optionally wherein the one or more genes are selected from Bra, Chrd, FoxA2, Noto1 and Noggin.
The polarised three-dimensional cellular aggregate may comprise an axial mesoderm-like field of cells, optionally wherein the cells of the axial mesoderm-like field of cells express one or more of Bra, Chrd, FoxA2, Noto1 and Noggin.
The one or more genes the expression of which is characteristic of mesodermal cells may be one or more genes the expression of which is characteristic of paraxial mesoderm, optionally wherein the one or more genes are selected from Meox1, Msgn1, Tbx6, Tcf15, and Raldh2.
The polarised three-dimensional cellular aggregate may comprise a paraxial mesoderm-like field of cells, optionally wherein the cells of the paraxial mesoderm-like field of cells express one or more of Meox1, Msgn1, Tbx6, Tcf15, and Raldh2.
The polarised three-dimensional cellular aggregate may comprise neuromesodermal progenitor cells (NMPs), optionally wherein the neuromesodermal progenitor cells co-express Sox2, Bra and Nkx1.2.
The polarised three-dimensional cellular aggregate may comprise a tailbud-like region of cells in the posterior region, optionally wherein the cells of the tailbud-like region of cells express one or more of Bra, Cdx2, Cyp26a1, Fgf8, Fgf4, Wnt3a, and Wnt5a.
The one or more genes the expression of which is characteristic of mesodermal cells may be one or more genes the expression of which is characteristic of somitic mesoderm, optionally wherein the one or more genes are selected from Tcf15, Ripply1/2, Mesp1/2, Meox1, and Uncx4.
The polarised three-dimensional cellular aggregate may comprise a somitic mesoderm-like field of cells, optionally wherein the cells of the somitic mesoderm-like field of cells express one or more of Tcf15, Ripply1/2, Mesp1/2, Meox1, and Uncx4.
The polarised three-dimensional cellular aggregate may comprise one or more blocks of mesoderm, optionally wherein the cells of the mesodermal blocks express one or more of Tcf15, Ripply1/2, Mesp1/2, Meox1, and Uncx4.
The one or more genes the expression of which is characteristic of mesodermal cells may be one or more genes the expression of which is characteristic of intermediate mesoderm, optionally wherein the one or more genes are selected from Osr1 and Pax2.
The polarised three-dimensional cellular aggregate may comprise an intermediate mesoderm-like field of cells, optionally wherein the cells of the intermediate mesoderm-like field of cells express one or more of Osr1 and Pax2.
The one or more genes the expression of which is characteristic of mesodermal cells may be one or more genes the expression of which is characteristic of notochord, optionally wherein the one or more genes are selected from Bra, Noggin, Noto1, and FoxA2.
The three-dimensional cellular aggregate may comprise a cavitated structure, optionally wherein the cells of the cavitated structure express Gata6.
The three-dimensional cellular aggregate may comprise node-like cells, optionally wherein the node-like cells express one or more of Chordin, Gsc, Nodal, Lefty1/2, Noggin, Noto1, and FoxA2.
The polarised three-dimensional cellular aggregate may comprise a cluster of cells and wherein the cells of the cluster of cells express Nodal.
The one or more genes the expression of which is characteristic of mesodermal cells may be one or more genes the expression of which is characteristic of lateral plate mesoderm, optionally wherein the one or more genes are selected from Kdr, Pecam, Lefty 1/2, and Pitx2.
The polarised three-dimensional cellular aggregate may comprise a lateral plate mesoderm-like field of cells, optionally wherein the cells of the lateral plate mesoderm-like field of cells express one or more of Kdr, Pecam, Lefty 1/2, and Pitx2.
The polarised three-dimensional cellular aggregate may comprise a cranial mesoderm-like field of cells, optionally wherein the cells of the cranial mesoderm-like field of cells express one or more of Tbx1,
The polarised three-dimensional cellular aggregate may comprise a cardiac-like region of cells, optionally wherein the cells of the cardiac-like region of cells express one or more of Gata4, Gata6, Mesp1, Flk1, MIc2a IsI1, Pecam, cTnT, and Nkx2.5, optionally wherein the cardiac-like region of cells is located asymmetrically in the anterior region of the three-dimensional cellular aggregate.
The three-dimensional cellular aggregate may comprise a midline structure, optionally wherein the cells of the midline structure express Nodal.
The one or more markers characteristic of ectodermal cells may be one or more genes the expression of which is characteristic of ectodermal cells. The one or more markers characteristic of ectodermal cells may be one or more markers characteristic of neural or pre-neural cells. The one or more markers characteristic of neural or pre-neural cells may be one or more genes the expression of which is characteristic of neural or pre-neural cells, optionally wherein the one or more genes are selected from DII1, Hes5, Lnfg, Olig2, Pax3, Pax7, Sox1, Sox2, Irx3, Mnx1, Phox2a, Evx2, Ascii, Id2, and Lhx9.
The one or more markers characteristic of neural cells may be one or more markers characteristic of neural precursors. The one or more markers characteristic of neural precursors may be one or more genes the expression of which is characteristic of neural precursors, optionally wherein the genes are selected from DII1, Hes5, Olig2, Pax3, Pax7, Sox1 and Sox2
The one or more markers characteristic of neural cells may be one or more markers characteristic of differentiated neural precursor cells and/or may be one or more genes the expression of which is characteristic of differentiated neural precursor cells, optionally wherein the one or more genes are selected from Phox2a, Mnx1, Lhx9, Sox5, Nes.
The one or more markers characteristic of neural cells may be one or more markers characteristic of neural derivatives. The neural derivatives may be neurons and/or glial cells.
The polarised three-dimensional cellular aggregate may comprise neural crest-like cells, optionally wherein the neural crest-like cells express one or more of Sox5, Sox9, and Sox10.
The polarised three-dimensional cellular aggregate may comprise neuroectoderm-like region of cells, optionally wherein the cells of the neuroectoderm-like region express one or more of Sox1, Sox2, Olig2, and Pax7.
The polarised three-dimensional cellular aggregate may comprise neuronal cells, optionally wherein the neuronal cells express one or more of Phox2a and Mnx1.
The polarised three-dimensional cellular aggregate may comprise epithelial tracks or tubes, optionally wherein the cells of the epithelial tracks or tubes express Sox1.
The polarised three-dimensional cellular aggregate may comprise one or more placades For example, one or more sensory placades e.g. otic placodes and/or nasal placodes.
The polarised three-dimensional cellular aggregate may comprise anteriorly located cells at the border of neural and epidermal cells that will become otic and nasal placodes.
The polarised three-dimensional cellular aggregate may comprise anteriorly located cells at the border of neural and epidermal cells that will become otic and nasal placodes, optionally wherein the cells of the neuroectoderm-like region express one or more of Six2, Six3, Six 6, FoxG1, Eya1, Eya2, DIx5, Otx2, Pax1, Foxi2, Foxi3.
The invention provides a polarised three-dimensional cellular aggregate generated in vitro from one or more pluripotent stem cells, wherein:
The invention provides a polarised three-dimensional cellular aggregate generated in vitro from one or more pluripotent stem cells, wherein:
The polarised three-dimensional cellular aggregate may comprise primordial germ cell-like cells (PGCs), optionally wherein the PGCs express Blimp1 and/or AP2g.
The three-dimensional cellular aggregate may comprise clusters of cells expressing Blimp 1 in the anterior region.
The polarised three-dimensional cellular aggregate may comprise cells that are placodal-like optionally wherein these placodal-like cells are sensory placodal-like.
The polarised three-dimensional cellular aggregate may comprise cells that become placodes optionally wherein they express one or more of Six2, Six3, Six 6, FoxG1, Eya1, Eya2, DIx5, Otx2, Pax1, Foxi2 and Foxi3.
The polarised three-dimensional cellular aggregate may comprise one or more of axial mesodermal derivatives, paraxial mesodermal derivatives, intermediate mesodermal derivatives and lateral plate mesodermal derivatives. The paraxial mesodermal derivatives may comprise somite cells. The intermediate mesodermal derivatives may comprise kidney cells and/or gonadal cells. The lateral plate mesodermal derivatives may be selected from one or more of cardiac cells, haematopoietic cells and limb cells.
The polarised three-dimensional cellular aggregate may comprise somite cells, kidney cells, gonadal cells, cardiac cells, haematopoietic cells and limb cells.
The polarised three-dimensional cellular aggregate may comprise at least 50 cells, at least 100 cells, at least 200 cells, at least 300 cells, at least 400 cells, at least 500 cells, at least 600 cells, at least 800 cells, at least 900 cells, at least 1000 cells, at least 1500 cells, at least 2000, at least 2500 cells, at least 5000 cells, at least 10,000 cells, at least 15,000 cells, at least 20,000 cells, at least 30,000 cells, at least 40,000 cells or at least 50,000 cells. Preferably, the polarised three-dimensional cellular aggregate comprises at least 20,000 cells. The polarised three-dimensional cellular aggregate may comprise 50-100,000 cells, 100-75,000 cells, 200-50,000 cells, 300-25,000 cells, 400-10,000 cells, 500-5,000 cells, 750-2,500 cells or 1000-2,000 cells. Preferably, the polarised three-dimensional cellular aggregate comprises 20,000-75,000 cells.
The polarised three-dimensional cellular aggregate may have a length of at least 0.05 mm, at least 0.1 mm, at least 0.2 mm, 0.3 mm, at least 0.4 mm, at least 0.5 mm, at least 0.6 mm, at least 0.7 mm, at least 0.8 mm, at least 0.9 mm, at least 1 mm or at least 1.5 mm. Preferably the polarised three-dimensional cellular aggregate has a length of at least 0.2 mm. The polarised three-dimensional cellular aggregate may have a length of 0.05-2 mm, 0.1-2 mm, 0.2-2 mm, 0.3-1.9 mm, 0.5-1.8 mm, 0.6-1.7 mm, 0.7-1.6 mm, 0.8-1.5 mm, 0.9-1.4 mm, 1.0-1.3 mm or 1.1-1.2 mm. Preferably, the polarised three-dimensional cellular aggregate has a length of 0.2-2 mm.
The polarised three-dimensional cellular aggregate may be elongate along the anterior-posterior axis. The anterior-posterior axis may be at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45% or at least 50% longer than the dorso-ventral axis. Preferably, the anterior-posterior axis is at least at least 10% longer than the dorso-ventral axis.
The polarised three-dimensional cellular aggregate may be elongated from anterior to posterior. The diameter of the polarised three-dimensional cellular aggregate at the anterior end may be greater than the diameter of the polarised three-dimensional cellular aggregate at the posterior end.
The polarised three-dimensional cellular aggregate may be elongated along the anterior-posterior axis, optionally wherein the cells of the posterior region express a higher level of Bra than the cells of the posterior region.
The polarised three-dimensional cellular aggregate may have undergone one or more morphological elongation, optionally wherein the morphological elongations are convergent-extension and proliferation.
The polarised three-dimensional aggregate may comprise, within a Bra expressing region, an oval, polarized structure with differential adhesion between its cells that acts as a source of axial mesoderm.
The polarised three-dimensional cellular aggregate may comprise one or more of cavities, tubular structures, cysts pores, lumens, folds, plates, tracts, and segments.
The polarised three-dimensional cellular aggregate may have undergone one or more morphological shape changes, optionally wherein the morphological shape changes are one or more of elongation, cavitation, cyst formation and epithelialisation or segmentation.
The polarised three-dimensional cellular aggregate may have undergone one or multiple segmentations along the anteroposterior axis. The segments may be somite-like. The polarised three-dimensional cellular aggregate may have undergone bilaterally symmetrical budding at defined positions along the anteroposterior axis. The budding may be limb buds.
The polarised three-dimensional cellular aggregate may comprise one or more stem or progenitor cells or derivatives thereof. As used herein the term “progenitors” or “progenitor cells” refer to both stem cells and progenitor cells.
The polarised three-dimensional cellular aggregate may comprise haematopoietic progenitors or derivatives thereof. The haematopoietic progenitors or derivatives thereof may express one or more of Flk1, Scl, Runx1, Gata2, Cxcr4, cKit and CD41.
The polarised three-dimensional cellular aggregate may comprise one or more progenitors of the vascular system or derivatives thereof. The progenitors of the vascular system or derivatives thereof may express one or more of Flk1, Scl, Runx1, Gata2, Cxcr4, cKit and CD41.
The polarised three-dimensional cellular aggregate may comprise haematopoietic progenitors or derivatives thereof, optionally wherein these haematopoietic cells are haematopoietic stem cells or derivatives thereof.
The polarised three-dimensional cellular aggregate may comprise a vascular system.
The polarised three-dimensional cellular aggregate may comprise a vascular system, optionally wherein this is part of an aortic cluster.
The polarised three-dimensional cellular aggregate may comprise endothelial cells, optionally wherein the endothelial cells express one or more of VE-Cadherin, Flk1, Pecam and Scl.
The polarised three-dimensional cellular aggregate may comprise cysts comprising clusters of endothelial cells expressing one or more of VE-Cadherin, CD41, CD43 and CD45.
The haematopoietic progenitors may express one or more haemogloblin genes, optionally wherein the haemoglobin is fetal haemoglobin (HbF) or adult haemoglobin (HbA and HbB). The one or more haemogloblin genes may be Hbb (e.g. Hbb-bh1 and Hbb-y) or Hba (e.g. Hba-x).
The haematopoietic progenitors may express one or more markers of haematopoietic genes, optionally wherein the haematopoietic genes are selected from Flk1, CD41, cKit, CD45, CD31, Vecadh, Runx1, Spfi1, Gata2, Gata1, Scl1 and Tal1.
The haematopoietic progenitors derived from the polarised three-dimensional cellular aggregate may be capable of generating differentiated blood cells in vitro (e.g. as determined by a colony forming cell (CFC) assay), optionally wherein the differentiated blood cells are myeloid cells and/or lymphoid cells.
The myeloid cells may be selected from one or more of monocytes, macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes and platelets.
The lymphoid cells may be selected from one or more of T cells, B cells, and natural killer cells.
The polarised three-dimensional cellular aggregate may comprise one or more cardiac progenitor cells or derivatives thereof. The cardiac progenitor cells express one or more cardiac specific genes.
The polarised three-dimensional cellular aggregate may comprise a cardiac structure. The cardiac structure may be located in the anterior region of the polarised three-dimensional cellular aggregate, optionally wherein the cardiac structure is asymmetrically located in the anterior region of the three-dimensional cellular aggregate. The cardiac structure may comprise components of a vascular system, optionally wherein the cardiac structure comprises one or more blood vessels. The cardiac structure may comprise one or more cavities. The cardiac structure may comprise one or more tubular structures. The cardiac structure may beat or contract spontaneously. The cardiac structure may beat or contract at 10-250 beats per minute, 20-200 beats per minute, 30-175 beats per minute, 40-120 beats per minute, 50-100 beats per minute. The cardiac structure may start beating 6 or 7 days after the formation of the three-dimensional cellular aggregate.
The cardiac progenitor cells, or derivatives thereof, or cells of the cardiac structure may express at any point in their development one or more cardiac specific genes. The cardiac progenitor cells, or derivatives thereof, or the cells of the cardiac structure may express one or more cardiac specific genes. The one or more cardiac specific genes may be selected from Flk1, cTnT, MIc2a CD31, Mesp1, Nkx2-5, Tbx5, Tbx1, IsI1 and Pitx2. The cardiac structure may comprise a domain of cells expressing Flk1. The cardiac structure may comprise cells co-expressing cTnT, MIc2a CD31, and Nkx2-5. The cells of the cardiac structure may express Gata4 and/or Gata6.
The polarised three-dimensional cellular aggregate may be generated in vitro from one or more embryonic stem cells (ESCs). The embryonic stem cells may be naiive type embryonic stem cells, optionally wherein the naiive type embryonic stem cells are prepared by the 2i culture method. The embryonic stem cells may be non-naiive type embryonic stem cells, optionally wherein the non naiive type embryonic stem cells are prepared in ESLIF or medium comprising BMP and LIF.
The polarised three-dimensional cellular aggregate may be generated in vitro from one or more induced pluripotent stem cells (iPSCs).
The polarised three-dimensional cellular aggregate may be generated in vitro from one or more epiblast stem cells (EpiSCs).
The polarised three-dimensional cellular aggregate may be generated in vitro from one or more epiblast-like stem cells (Epi-like SCs). The polarised three-dimensional cellular aggregate may be generated in vitro from a single pluripotent stem cell.
The polarised three-dimensional cellular aggregate may be generated in vitro from a single colony derived from a single pluripotent stem cell.
The polarised three-dimensional cellular aggregate may be generated in vitro from one or more blastomeres derived from a pre-implantation epiblast.
The pluripotent stem cells may be mammalian pluripotent stem cells e.g. mouse pluripotent stem cells. The pluripotent stem cells may not be human pluripotent stem cells.
The invention provides a method for obtaining a polarised three-dimensional cellular aggregate, the method comprising:
The invention provides a method for obtaining a polarised three-dimensional cellular aggregate, the method comprising:
The invention provides a method for obtaining a polarised three-dimensional cellular aggregate, the method comprising:
The invention provides a method for obtaining a polarised three-dimensional cellular aggregate, the method comprising:
The invention provides a method for obtaining a polarised three-dimensional cellular aggregate, the method comprising:
A “cell suspension” as used herein refers to a suspension comprising single disassociated pluripotent stem cells i.e. a single cell suspension, and/or to a suspension comprising disassociated colonies comprising pluripotent stem cells i.e. a colony suspension (wherein a colony is derived from a single pluripotent stem cell).
Step (e) may comprise isolating one or more stem or progenitor cells or derivatives thereof, either as individual disassociated cells or as collections of cells. These collections of cells may comprise combinations of differentiated cell types, primordia, tissues or organs.
Step (b) may comprise culturing the cell suspension until one or more three-dimensional cellular aggregates is/are formed. Step (b) may comprise culturing the cell suspension for 5 minutes-48 hours, 10 minutes-24 hours, 30 minutes-12 hours, 1-6 hours or 2-4 hours. Preferably, step (b) comprise culturing the cell suspension for 1-24 hours.
Step (b) may comprise sorting the cell suspension (e.g. by flow cytometry) until the three-dimensional cellular aggregate is formed.
Step (c) may comprise culturing the three-dimensional cellular aggregate until one or more polarised three-dimensional cellular aggregates is/are formed. Step (c) may comprise culturing the three-dimensional cellular aggregate for 1-96 hours, 6-90 hours, 12-85 hours, 24-80 hours or 48-72 hours. Preferably, step (c) comprises culturing the three-dimensional cellular aggregate for 24-72 hours.
Step (d) may comprise culturing the polarised three-dimensional cellular aggregate until one or more progenitor cells or derivatives thereof is/are formed. Step (d) may comprise culturing the polarised three-dimensional cellular aggregate for 24-360 hours, 48-336 hours, 72-288 hours, 96-264 hours, 120-240 hours, 144-216 hours or 168-192 hours. Preferably, step (d) comprises culturing the polarised three-dimensional cellular aggregate for 48-96 hours.
Step (b) may comprise embedding the cell suspension in a gel and/or a matrix and culturing the cell suspension under conditions that promote the transformation of at least one of the disassociated pluripotent stem cells into a three-dimensional cellular aggregate.
Step (c) may comprise embedding the three-dimensional cellular aggregate in a gel and/or a matrix and culturing the three-dimensional cellular aggregate under conditions that promote the transformation of the three-dimensional cellular aggregate into a polarised three-dimensional cellular aggregate.
Step (d) may comprise embedding the polarised three-dimensional cellular aggregate in a gel and/or a matrix and culturing the polarised three-dimensional cellular aggregate under conditions that promote the differentiation of one or more cells of the polarised three-dimensional cellular aggregate.
Preferably the step of embedding promotes the formation of somite-like structures or segments.
In the methods, the gel or matrix may comprise at least one extracellular matrix protein or analogue thereof. The extracellular matrix protein may be one or more of collagen (e.g.
collagen IV), laminin, fibronectin, vitronectin and/or gelatin. Preferably, the extracellular matrix protein is collagen (e.g. collagen IV) and/or laminin. The matrix may activate signalling through β-integrin receptors. The gel may be a hydrogel. The gel may comprise or consist substantially of basement membrane matrix. The basement membrane matrix may comprise one or more of laminin, collagen (e.g. collagen IV), heparan sulphate proteoglycan and entactin. The gel may be formed from basement membrane extract, which may be isolated from a suitable basement membrane-secreting cell type, such as Engelbreth-Holm-Swarm (EHS) mouse sarcoma cells. Basement membrane extracts produced from EHS cells are commercially available under the trade names Matrigel (BD Biosciences, Franklin Lakes, N.J., USA), Cultrex (Trevigen Inc., Gaithersburg, Md., USA) and Geltrex (Invitrogen). Their major component is laminin, followed by collagen IV, heparan sulphate proteoglycan and entactin. Alternatively, the gel may be a polyacrylamide gel, e.g. a gel comprising across-linked polymer matrix formed by polymerisation of acrylamide and bis-acrylamide (e.g. N,N′-methylenebisacrylamide). Other suitable gel types may include alginate gels, polyethylene glycol (PEG)based gels and agarose gels.
In the methods, the polarised three-dimensional cellular aggregate may be cultured in the absence of extra-embryonic cells or tissue including primitive endoderm, amnion and/or trophoblast.
The methods may comprise a further step, prior to step (a), of culturing the cell suspension in 2i.
In the methods, the steps (c) and/or (d) may be performed on ultra-low adherence plates.
The one or more progenitor cells or derivatives thereof may be:
m. node cells and/or derivatives thereof; and/or
The methods may comprise any of the following conditions:
The step of culturing the polarised three-dimensional cellular aggregate may comprise culturing the polarised three-dimensional cellular aggregate in a medium comprising FGF2 and VEGF. The progenitor cells or derivatives thereof may be haematopoietic progenitor cells or derivatives thereof, or cardiac progenitor cells or derivatives thereof.
The invention provides a method for obtaining a polarised three-dimensional cellular aggregate, the method comprising:
The haematopoietic progenitor cells or derivatives thereof may be asymmetrically-distributed in the polarised three-dimensional cellular aggregate.
The method may further comprise a pre-treatment step (performed before step (a)). The pre-treatment step may comprise culturing pluripotent stem cells in a medium comprising an activator of Wnt signalling and Leukaemia Inhibitory Factor (LIF). Optionally wherein the medium further comprises PDO3.
The method may further comprise a pre-treatment step (performed before step (a)). The pre-treatment step may comprise culturing pluripotent stem cells in a medium comprising an activator of Wnt signalling and an inhibitor of FGF signalling (e.g. PD03). Optionally wherein the medium further comprises Leukaemia Inhibitory Factor (LIF).
Step (b) may comprise culturing the cell suspension until one or more three-dimensional cellular aggregates is/are formed. Step (b) may comprise culturing the cell suspension for 5 minutes-48 hours, 10 minutes-24 hours, 30 minutes-12 hours, 1-6 hours or 2-4 hours. Preferably, step (b) comprise culturing the cell suspension for 1-24 hours.
Step (c) may comprise culturing the three-dimensional cellular aggregate until one or more polarised three-dimensional cellular aggregates is/are formed. Step (c) may comprise culturing the three-dimensional cellular aggregate for 1-96 hours, 6-90 hours, 12-85 hours, 24-80 hours or 48-72 hours. Preferably, step (c) comprises culturing the three-dimensional cellular aggregate for 24-72 hours.
The step of culturing the three-dimensional cellular aggregate (step (c)) may comprise culturing the three-dimensional cellular aggregate in a medium comprising an activator of Wnt signalling. The step of culturing the three-dimensional cellular aggregate (step (c)) may comprise culturing the three-dimensional cellular aggregate in a medium comprising an activator of Wnt signalling and an activator of SMAD signalling. The step of culturing the three-dimensional cellular aggregate (step (c)) may comprise culturing the three-dimensional cellular aggregate in a medium comprising an activator of Wnt signalling and an activator of Nodal/Activin signalling (e.g. Activin A). Preferably this step is performed on day 2 after formation of the three-dimensional cellular aggregate.
The step of culturing the polarised three-dimensional cellular aggregate (step (d)) is performed after step (c). Step (d) may comprise culturing the polarised three-dimensional cellular aggregate in a medium comprising FGF (e.g. FGF2) and VEGF. Step (d) may comprise culturing the polarised three-dimensional cellular aggregate in a medium comprising FGF (e.g. FGF2), VEGF and a further agent, wherein the further agent is a Shh signalling agonist (e.g. Shh, SAG (Smoothened Agonist)) and/or a BMP signalling antagonist (e.g. Noggin).
Step (d) may comprise culturing the polarised three-dimensional cellular aggregate until one or more haematopoietic progenitor cells or derivatives thereof is/are formed.
Step (d) may comprise:
Step (d)(i) may comprise culturing the polarised three-dimensional cellular aggregate for 15 mins-72 hours, 30 minutes-66 hours, 1-60 hours, 6-54 hours, 12-48 hours, 18-42 hours or 24-36 hours. Preferably, (d)(i) comprises culturing the polarised three-dimensional cellular aggregate for 24-168 hours. Step (d)(ii) may comprise culturing the polarised three-dimensional cellular aggregate for 15 mins-72 hours, 30 minutes-66 hours, 1-60 hours, 6-54 hours, 12-48 hours, 18-42 hours or 24-36 hours. Preferably, (d)(ii) comprises culturing the polarised three-dimensional cellular aggregate for 24-144 hours.
In the method that promote the differentiation of one or more cells of the polarised three-dimensional cellular aggregate into haematopoietic progenitor cells or derivatives thereof, the steps of culturing typically comprise changing the media every 24 hours. The steps of culturing the three-dimensional cellular aggregate (step (c)) and/or the step of culturing the polarised three-dimensional cellular aggregate (step (d) may comprise performing a modified change of 25-75%, 30-70%, 35-65%, 40-60%, 45-55% or 50% of the media. Preferably, step (c) and/or step (d) comprise performing a change of 45-55% of the media.
The change in media may performed be once every 12-36 hours, once every 18-30 hours, once every 20-28 hours, once every 22-26 hours or once every 24 hours. Preferably, the change in media is performed once every 22-26 hours. The modified change of the media may start 24 hours, 36 hours, 48 hours, 60 hours, 72 hours, 84 hours, or 96 hours, 108 hours, or 120 hours after he formation of the three-dimensional cellular aggregate.
Preferably, the modified change of the media is started 72 hours (i.e. day 3) after the formation of the three-dimensional cellular aggregate.
The invention provides a method for obtaining a polarised three-dimensional cellular aggregate, the method comprising:
The step of culturing the three-dimensional cellular aggregate (step (c)) may comprise culturing the three-dimensional cellular aggregate in a medium comprising an activator of Wnt signalling.
Step (b) may comprise culturing the cell suspension until one or more three-dimensional cellular aggregates is/are formed. Step (b) may comprise culturing the cell suspension for 5 minutes-48 hours, 10 minutes-24 hours, 30 minutes-12 hours, 1-6 hours or 2-4 hours. Preferably, step (b) comprise culturing the cell suspension for 1-24 hours.
Step (c) may comprise culturing the three-dimensional cellular aggregate until one or more polarised three-dimensional cellular aggregates is/are formed. Step (c) may comprise culturing the three-dimensional cellular aggregate for 1-96 hours, 6-90 hours, 12-85 hours, 24-80 hours or 48- 72 hours. Preferably, step (c) comprises culturing the three-dimensional cellular aggregate for 24-72 hours.
The step of culturing the polarised three-dimensional cellular aggregate (step (d)) is performed after step (c). Step (d) may comprise culturing the polarised three-dimensional cellular aggregate in a medium comprising FGF (e.g. FGF2), VEGF and Ascorbic Acid. The polarised three-dimensional cellular aggregate may be cultured in a medium comprising FGF (e.g. FGF2), VEGF and Ascorbic Acid from day 4 after formation of the three-dimensional cellular aggregate (i.e. day 4 after aggregation). This step may be performed for at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours or at least 120 hours.
Step (d) may comprise culturing the polarised three-dimensional cellular aggregate until one or more cardiac progenitor cells or derivatives thereof is/are formed. Step (d) may comprise culturing the polarised three-dimensional cellular aggregate for 1-72, 6-66 hours, 12-48 hours, 24-36 hours, 12-144 hours, 24-144 hours or 24-168 hours. Preferably, step (d) comprise culturing the three-dimensional cellular aggregate for 24-168 h.
The invention provides a method for obtaining one or more progenitor cells or derivatives thereof, the method comprising:
The invention provides a method for obtaining one or more progenitor cells or derivatives thereof, the method comprising:
The progenitor cells or derivatives thereof may be any of the progenitor cells or derivatives thereof described herein.
In any of the methods described herein, the polarised three-dimensional cellular aggregate may be a polarised three-dimensional cellular aggregate as defined herein.
The step of culturing the three-dimensional cellular aggregate may comprise culturing the three-dimensional cellular aggregate in a medium comprising an activator of Wnt signalling. The activator of Wnt signalling may be any agent or molecule that activates the Wnt signalling pathway including the downstream signalling network The activator of Wnt signalling may be an activator of Wnt/β-catenin signalling. The activator of Wnt signalling may be a soluble protein. The activator of Wnt signalling may be a GSK inhibitor. The GSK inhibitor may be a GSK3 inhibitor, optionally wherein the GSK3 inhibitor is CHI99021 (Chi or Chiron). The activator of Wnt signalling may be selected from one or more of Wnt3, Wnt3a, Wnt5, Wnt8 and Wnt11.
The step of culturing the three-dimensional cellular aggregate (step (c)) may comprise shaking the three-dimensional cellular aggregate. Additionally or alternatively the step of culturing the polarised three-dimensional cellular aggregate (step (d)) may comprise shaking the polarised three-dimensional cellular aggregate. The shaking may be started after the formation of the three-dimensional cellular aggregate. The shaking may be started 12 hours, 24 hours, 36 hours, 48 hours, 60 hours, 72 hours, 84 hours, or 96 hours after the formation of the three-dimensional cellular aggregate. Preferably, the shaking is started 96 hours (i.e. day 4) after the formation of the three-dimensional cellular aggregate.
The steps of culturing typically comprise changing the media every 24 hours. The steps of culturing the three-dimensional cellular aggregate (step (c)) and/or the step of culturing the polarised three-dimensional cellular aggregate (step (d) may comprise performing a modified change of 25-75%, 30-70%, 35-65%, 40-60%, 45-55% or 50% of the media. Preferably, step (c) and/or step (d) comprise performing a change of 45-55% of the media. The change in media may performed be once every 12-36 hours, once every 18-30 hours, once every 20-28 hours, once every 22-26 hours or once every 24 hours. Preferably, the change in media is performed once every 22-26 hours. The modified change of the media may start 24 hours, 36 hours, 48 hours, 60 hours, 72 hours, 84 hours, or 96 hours, 108 hours, or 120 hours after he formation of the three-dimensional cellular aggregate.
Preferably, the modified change of the media is started 120 hours (i.e. day 5) after the formation of the three-dimensional cellular aggregate.
The one or more disassociated pluripotent stem cells may be one or more embryonic stem cells (ESCs).
The one or more disassociated pluripotent stem cells may be one or more induced pluripotent stem cells (iPSCs).
The one or more disassociated pluripotent stem cells may be a single pluripotent stem cell.
The one or more disassociated pluripotent stem cells may be a colony from a single pluripotent stem cell.
The one or more disassociated pluripotent stem cells may be one or more blastomeres from a pre-implantation epiblast.
The pluripotent stem cells may be mouse pluripotent stem cells. The pluripotent stem cells may not be human pluripotent stem cells.
One or more of steps (a)-(e) may be performed with the pluripotent stem cells in suspension, three-dimensional cellular aggregates in suspension and/or polarised three-dimensional cellular aggregates in suspension.
Step (a) may comprise growing one or more pluripotent stem cells on a solid substrate and then disassociating the pluripotent stem cells to obtain the cell suspension. The solid substrate may be a gelatin-coated, fibronectin-coated tissue substrate or may be comprised of a feeder-layer of cells, optionally mouse embryonic fibroblasts. The cells may be grown to 20-80% confluency, 30-70% confluency, or 40-60% confluency. Preferably, the cells are grown to 40-60% confluency.
Prior to the step of disassociating the pluripotent stem cells, the method may further comprise the step of culturing the pluripotent stem cells in a medium comprising one or more of an inhibitor of ERK signalling, an inhibitor of FGF signalling, an inhibitor of MEK signalling (e.g. PD03), an activator of BMP signalling, an activator of Wnt signalling and/or Leukaemia Inhibitory Factor.
The cell suspension may comprise 1×103-1×105 cells/ml, 5×103-5×104 cells/ml or 7.5×103-2.5×104 cells/ml.
Step (b) may comprise centrifugation of the one or more disassociated pluripotent stem cells, optionally wherein centrifugation of the one or more disassociated pluripotent stem cells initiates the formation of the three-dimensional cellular aggregate.
One or more of steps of the method (e.g. one or more of steps (b)-(d)) may be performed in a low or ultra-low adherence plate e.g. a low adherence 96 well plate.
Step (b) may comprise culturing the cell suspension for 24-72 hours, 30-66 hours, 36-60 hours, 42-54 hours, 44-52 hours, 46-50 hours, 47-49 hours or 48 hours.
Step (c) may comprise culturing the three-dimensional cellular aggregate for 1-48 hours, 6-42 hours, 12-36 hours, 18-30 hours, 20-28 hours, 22-26 hours, 23-25 hours or 24 hours.
Step (d) may comprise culturing the polarised three-dimensional cellular aggregate for 24-120 hours, 30-96 hours, 36-72 hours, 42-54 hours, 44-52 hours, 46-50 hours, 47-49 hours or 48 hours.
Step (b) may comprise culturing the cell suspension for 44-52 hours, step (c) may comprise culturing the three-dimensional cellular aggregate for 20-28 hours, and step (d) may comprise culturing the polarised three-dimensional cellular aggregate for 44-52 hours.
Step (b) may comprise culturing the cell suspension for 46-50 hours, step (c) may comprise culturing the three-dimensional cellular aggregate for 22-26 hours, and step (d) may comprise culturing the polarised three-dimensional cellular aggregate for 46-50 hours.
Step (b) may comprise culturing the cell suspension for 47-49 hours, step (c) may comprise culturing the three-dimensional cellular aggregate for 23-25 hours, and step (d) may comprise culturing the polarised three-dimensional cellular aggregate for 47-49 hours.
The cell suspension, three-dimensional cellular aggregate and polarised three-dimensional cellular aggregate may be cultured for a total of at least 120 hours, at least 130 hours, at least 140 hours, at least 150 hours, at least 160 hours, at least 170 hours, at least 180 hours, at least 190 hours, at least 200 hours, at least 210 hours, at least 220 hours, at least 230 hours, at least 240 hours or at least 250 hours.
One or more of steps of the method (e.g. one or more of steps (b)-(d)) may further comprise shaking the three-dimensional cellular aggregate or polarised three-dimensional cellular aggregate.
Step (b) may further comprise transferring one or more of the disassociated pluripotent stem cells into a well of a plate. The number of disassociated pluripotent stem cells transferred into a well of the plate may be 50-1000 disassociated pluripotent stem cells, 200-800 disassociated pluripotent stem cells, 300-800 disassociated pluripotent stem cells, or 400-600 disassociated pluripotent stem cells.
Step (d) may further comprise transferring the polarised three-dimensional aggregate into a well of a plate. Optionally, this could be a 6-well plate, 12-well plate, 24-well plate or 48-well plate.
The invention provides a method for obtaining a polarised three-dimensional cellular aggregate, the method comprising:
Step (a)(i) may comprise culturing the epiblast pluripotent stem cells in a medium comprising FGF and Activin, wherein the medium does not comprise an activator of Wnt signalling.
Step (a) (ii) may comprise culturing the epiblast pluripotent stem cells in a medium comprising FGF, wherein the medium does not comprise Activin and/or an activator of Wnt signalling.
Step (a)(iii) may comprise culturing the epiblast pluripotent stem cells in a medium comprising FGF and an activator of Wnt signalling, wherein the medium does not comprise Activin.
Step (c) may comprise culturing the cell suspension in a medium comprising an activator of Wnt signalling.
Step (c) may comprise culturing the cell suspension in a medium comprising an activator of Wnt signalling and FGF.
The activator of Wnt signalling may be any agent or molecule that activates the Wnt signalling pathway including the downstream signalling network. The activator of Wnt signalling may be an activator of Wnt/β-catenin signalling. The activator of Wnt signalling may be a soluble protein. The activator of Wnt signalling may be a GSK inhibitor. The GSK inhibitor may be a GSK3 inhibitor, optionally wherein the GSK3 inhibitor is CHI99021 (Chi or Chiron). The activator of Wnt signalling may be selected from one or more of Wnt3, Wnt3a, Wnt5, Wnt8 and Wnt11.
FGF may be FGF2 (or bFGF) FGF4 or FGF8 and/or FGF10. Activin may be Activin A or Nodal.
Step (a)(i) may comprise culturing the epiblast pluripotent stem cells for 6-42 hours, 12-36 hours, 18-30 hours, 20-28 hours, 22-26 hours, 23-25 hours or 24 hours.
Step (a)(ii) may comprise culturing the epiblast pluripotent stem cells for 6-42 hours, 12-36 hours, 18-30 hours, 20-28 hours, 22-26 hours, 23-25 hours or 24 hours.
Step (a)(iii) may comprise culturing the epiblast pluripotent stem cells for 6-42 hours, 12-36 hours, 18-30 hours, 20-28 hours, 22-26 hours, 23-25 hours or 24 hours.
Steps (a)(i)(iii) may each comprise culturing the epiblast pluripotent stem cells for 6-42 hours, 12-36 hours, 18-30 hours, 20-28 hours, 22-26 hours, 23-25 hours or 24 hours.
Step (c) may comprise culturing the cell suspension one or more epiblast pluripotent stem cells for 24-240 hours, 36-228 hours, 48-216 hours, 60-204 hours, 72-192 hours, 84-180 hours, 96-168 hours, 108-156 hours or 120-144 hours.
The one or more epiblast pluripotent stem cells may be a single epiblast pluripotent stem cell. The one or more epiblast pluripotent stem cells may be a single colony derived from a single pluripotent stem cell.
The epiblast pluripotent stem cells may be mouse epiblast pluripotent stem cells or epiblast-like pluripotent stem cells. The epiblast pluripotent stem cells may not be human epiblast pluripotent stem cells.
The invention provides a polarised three-dimensional cellular aggregate obtainable by any one of the methods described herein.
The invention provides a progenitor cell or derivative thereof obtainable by any one of the methods described herein. The invention further provides an organ and/or tissue comprising one or more progenitor cell or derivative thereof. The progenitor cell or derivative thereof may be any one of more of the progenitor cells or derivatives thereof described herein. The organ or tissue may be blood, vascular tissue, kidney, heart, lungs, somites, dermatome, myotome, sclerotome, neural crest, neural tube, neurons, sensory placode, gonad, notochord, neural-mesodermal progenitors, primordial germ cells, node, oesophagus, stomach, intestine, lungs, pancreas, liver, trachea, thymus and/or thyroid.
The polarised three-dimensional cellular aggregate may not comprise extra-embryonic cells or tissue including primitive endoderm, amnion and/or trophoblast. The polarised three-dimensional cellular aggregate may not be associated with extra-embryonic cells or tissue including primitive endoderm, amnion and/or trophoblast. The polarised three-dimensional cellular aggregate may not be associated with extra-embryonic cells or tissue including primitive endoderm, amnion and/or trophoblast. The polarised three-dimensional cellular aggregate may be unable to form yolk sac or placenta. The polarised three-dimensional cellular aggregate may not comprise yolk sac or placenta. The polarised three-dimensional cellular aggregate may lack any anterior neural derivatives. The polarised three-dimensional cellular aggregate may be unable to form brain tissue. The polarised three-dimensional cellular aggregate may not comprise brain tissue. The polarised three-dimensional cellular aggregate does not have the inherent capacity of developing into a human being.
The present disclosure will now be described, by way of example only, with reference to the accompanying drawings in which:
Instead, genes involved in notch signaling in neural progenitors (Hes5, Dll1) and in the terminal differentiation of neural precursor (Phox2a, Mnx1) displayed a salt and pepper expression pattern, consistent with the lack of an organized neural tube structure (
(A-D) Immunofluorescence for cTnT (magenta) on non-beating (A, B) and beating Gastruloids (C, D) at 144 (A-C) and 168 (D) hours. Note that Gastruloids initially show a crescent-like domain of cTnT expression (A, B), reminiscent of the E7.5 cardiac crescent stage of mouse embryos. The expression of cTnT then progressively increases (C) and becomes more restricted to the beating portion (D). The bottom panel shows a representative picture (E) and its 3D reconstruction through the IMARIS software (F). Dapi was used to stain nuclei (blue). Scale bar 100 μm.
The emergence of multiple axes is an essential element in the establishment of the mammalian body plan. This process takes place shortly after implantation of the embryo within the uterus and relies on the activity of Gene Regulatory Networks (GRNs) that coordinate transcription in space and time. While genetic approaches have revealed important aspects of these processes, a mechanistic understanding is hampered by the poor experimental accessibility of early post-implantation stages. Here we show that small aggregates of murine Embryonic Stem cells (ESC) stimulated to undergo gastrulation-like events and elongation in vitro, are capable of organising a post-occipital pattern of neural, mesodermal and endodermal derivatives that mimic the embryonic spatial and temporal gene expression. The establishment of the three major body axes in such ‘gastruloids’ suggests that the mechanisms involved are interdependent. Specifically, gastruloids display the hallmarks of axial gene regulatory systems as exemplified by the implementation of Hox collinear transcriptional patterns along an extending anterior-posterior axis. These results reveal an unanticipated self-organising capacity for aggregated ESC and suggest that gastruloids may be used as a complementary system to study early developmental events in the mammalian embryo.
Materials and Methods
ES/iPS cells and gastruloid cultures: The culture conditions and a detailed protocol for ES/iPS cells culturing and gastruloid production are provided below.
Animal experimentation: wild-type CD1 mouse embryos were used for RNAseq experiments. All experiments were performed in agreement with the Swiss law on animal protection (LPA) under license number GE 81/14 (to D. Duboule).
Libraries and qPCR analysis: Purified RNA from iPS cell derived gastruloids was retrotranscribed using the Promega GoScript retrotranscription kit. Quantitative PCR analysis of mRNA levels for different Hoxd genes, Bra and the housekeeping gene Hmbs was performed using the Syber select master mix for CFX (Thermofisher) kit according to manufacturer instruction and specific primers. The Biorad CFX96 thermocycler was used. At least two technical (PCR) replicates and two biological replicates were analyzed per time-point after aggregation.
Data availability statement. All RNAseq datasets produced in this study are publicly available in the Gene Expression Omnibus (GEO) database under #GSE10622.
Reagents & Equipment
Routine Culture Medium:
ESLIF Medium (1)
or
ESLIF Medium (2) (e.g. for culture of Sox1eGFP; Bramcherry double reporter (SBR) mESC line, Oct4:GFP miPSC line)
Differentiation medium:
or
N2B27
Reagents:
Plastics:
Equipment:
Procedure
Culture Conditions Prior to Aggregation:
0 hours: Preparation of Gastruloids from mESCs and miPSCs (one 96-well plate)
Note 1: The following protocol describes generation of gastruloids from mESCs and miPSCs. Gastruloids can be reproducibly generated with mESC and miPSC lines from genetic backgrounds that include the 129 strain. The culture requirements may differ for mESCs and miPSCs (e.g. the use of ES+LIF Medium1 or 2, respectively). Such differences can also be observed between different mESC lines from different genetic backgrounds.
Note 2: Gastruloids derived from miPSCs generally require higher starting cell numbers (e.g. 600-800 cells/well) compared to mESC-derived gastruloids (e.g. 300 cells/well). The optimum starting cell number should be defined empirically.
Note 3: Gastruloids can be formed successfully from cells cultured in 2i conditions (N2B27+3 μM Chi+1 μM PD0325901+LIF), although the process of elongation is slightly delayed with respect to cells from ESL medium.
Troubleshooting
Aggregation Failure.
Aggregation failure might originate from the U-bottomed 96-well plate of choice. Make sure to use the aforementioned plates for efficient aggregation. The culture is also sensitive to the starting state of the cells. Failure to aggregate has been observed in stocks that have been maintained at high confluence (>90%) or under stress (e.g. from missing daily medium changes or pH<6.5), resulting in the formation of large embryoid bodies but not gastruloids.
The cells aggregate, but the gastruloids disintegrate during the culture.
This is often observed as a progressive decompaction of the cells, starting at the edge of the tissue and proceeding inwards. A possible cause is batch-to-batch variability in the N2B27 medium, which needs to be prepared carefully and checked for the presence of any precipitates before use. When using commercially available N2B27, follow the manufacturer's protocol for storage and thawing to prevent precipitation. Other causes could be environmental; start by confirming that the CO2 concentration and temperature are stable within the incubator.
Gastruloids fail to form, or disintegrate during culture.
The droplet volumes are initially small (40 μL) and so the plates are sensitive to evaporation during the first 48 hours. Check that the incubator is adequately humidified and, where possible, avoid areas of rapid air circulation (e.g. close to the fan, if present). This problem becomes evident as a reduction in droplet volume and changes in pH in the peripheral wells.
Many small satellite aggregates form, or the gastruloids are very small. These observations indicate problems in cell counting. In the former case, underestimation of the true cell density results in too many cells being plated in each well. This can produce many small satellite aggregates that can fuse with the main gastruloid, producing spurious elongated morphologies. Ensure that the suspension is fully dissociated to single cells before counting and that the plating suspension is well-mixed prior to use. Satellite aggregates may also form in sub-optimal U-bottomed 96-well plates. Make sure to use mentioned plates for efficient aggregation.
The gastruloids adhere to the plastic and lose their shape.
This becomes a common problem if the gastruloids are maintained beyond 120 hours in the non-tissue culture treated U-bottomed 96-well plates. It can be alleviated by adding the culture media with some force to move the gastruloids within the wells, or by using low-attachment 96-well plates. The extended culture protocol described above is recommended as a means of maintaining the gastruloids to 168 hours.
Time Taken
The total duration is 5-7 days, depending on whether the culture is extended. The hands-on time breaks down as follows:
0 hours: Approx. 30-45 minutes per cell line.
48 hours: Approx. 10 minutes per cell line.
72, 96 and 120 hours: Approx. 15 minutes per cell line.
120+ hours: Approx. 30 minutes per cell line to transfer the gastruloids to 24-well plates.
Anticipated Results
A brief overview of gastruloid development is detailed below:
Within the first 24 hours, the cell suspension sediments to the bottom of the wells, forming a single cellular aggregate in each well. Individual cells within the aggregates should be indistinct, indicating that they are fully adherent to their neighbours.
At the 48 hour time point, the aggregates should be smooth spheroids that have increased slightly in size over the preceding 24 hours.
At the 72 hour time point, the aggregates should have grown further, with some of the population remaining as spheroids and others showing regions of local narrowing, giving an ovoid appearance. The surface should no longer be smooth, with loose extruded cells forming a rough, but thin, coating on the tissue.
At the 96 hour time point, many of the aggregates will have proceeded from a spheroid or ovoid shape to become elongated along a clear long axis. One end of this axis should have a smooth border and appear bright under phase contrast microscopy, which corresponds to the elongating posterior end. The other end of the axis should be round and dark and be covered in a loose layer of extruded cells; corresponding to the more anterior tissue.
The optimal time to observe the elongations appears to be around 114-120 hours, by which point they should appear as long extensions from the darker, round-shaped anterior tissues. At later time points, some of the aggregates may start to adhere to the bottom surface of the wells and the tissue organisation will be disrupted, unless the extended culture technique is used.
Extended Cultures
In these cases, shaking the gastruloids in a larger volume extends the length of the elongations, allowing them to form very long and thin tissues. It is also be possible to observe internal epithelial tissues by phase contrast microscopy.
Results
When ca. 250 ESCs are aggregated, given a pulse of the Wnt agonist CHIR99021 (Chi) between 48 and 72 h of culture, and returned to N2B27 medium (
To characterize the transcriptional programmes of these gastruloids, we carried out RNAseq on duplicated pools and compared their profiles with those of developing mouse embryos from E6.5 to E9.5. Since gastruloids display hallmarks of post-occipital embryos (
The analysis of different endodermal markers revealed temporal dynamics also reminiscent of the embryonic situation10 (
This unanticipated level of organization and capacity to self-organize an integrated axial system reminiscent of the embryo was further explored by assessing the expression of genes associated with the developing embryonic axes (
Nodal expression was found confined to a small and compact region on the ventral most posterior aspect at 120 h AA (
The formation and patterning of post-occipital embryonic territories is tightly linked to the sequential activation of the 39 Hox gene, which are clustered at four distinct genomic loci in mammals. As Hox genes appeared differentially regulated in the RNAseq time-course (
Similar dynamics were observed for Hoxd genes (
Comparable profiles were also scored when single organoids were examined (
When compared to single tissue organoids, gastruloids exhibit an integrated structure, which seems to specify all major embryonic axes in a coordinated manner. The remarkable autonomy in the patterns of gene expression reported here highlights the potential of gastruloids in the study of complex regulatory circuits, particularly during early post-implantation development and the emergence of body axes.
Materials and Reagents
25 cm2 cell culture flask (Grenier Bio-One 690-175).
Activin A (10 mM, use at 100 ng/mL; Peprotech 120-14B). CHIR99021 (Chiron, 10 mM, Wellcome Trust-Medical Research Council Cambridge Stem Cell Institute).
ESLIF medium: 500 mL Glasgow's Minimal Essential Medium (GMEM, Gibco 11710-035); 5 mL sodium pyruvate (Invitrogen 11360-039); 5 mL non-essential amino acids (Gibco 11140-035); 5 mL GlutaMAX (Gibco 35050-038); 1 mL R-mercaptoethanol (Gibco 31350-010); 50 mL Foetal Bovine Serum (FBS, Biosera FB-1090/500) and 550 μL Leukaemia Inhibitory Factor (1000 units, Merck Millipore ESG1107).
Gelatin (Sigma-Aldrich G1890-100G), dissolved in distilled water to a 1% (w/v) solution, autoclaved and diluted to 0.1% in PBS (see below).
NDiff227 (N2B27, Takara Y40002).
Phosphate Buffered Saline (PBS with calcium and magnesium, Sigma-Aldrich D8662). SB431542 (100 mM SB43, use at 10 μM; Tocris Bioscience 1614).
Sterile reservoir (55 mL, STARLAB E2310-1010).
Trypsin-EDTA (0.05%, Gibco 25300-054).
U-bottomed non-tissue cultured treated 96-well plate (Grenier 650185).
XAV939 (10 mM TIN, use at 1 μM; Tocris Bioscience 3748).
Basic Method
Day 0: Culture Conditions Prior to Aggregation
Day 1: Generation of Aggregates (0-24 h)
Day 2: Observation (24-48 h)
Day 3: Applying Stimuli (48-72 h)
Day 4: Changing Medium (72-96 h)
Day 5: Changing Medium (96-120 h)
Day 6: Observation (120 h)
Cardiac Organogenesis Method and Results
The “Cardiac Method” was based on the “Basic Method” provided above with the following modifications.
Gastruloids were transferred from 96-well plates to low-adherence 24-well plates at day 4. This brings a more than 4-fold higher volume of medium, resulting in an improved availability of nutrients and growth factors. Second, we modified the medium exchange procedure, introducing a half-medium change instead of a full change every day from day 5 onwards. This step is useful in maintaining a “conditioned” environment that promotes in vitro organogenesis. Third, we introduced shaking of cultures to extend gastruloid lifespan. When gastruloids are transferred to a shaking platform located in a classic cell culture incubator from day 4 from aggregation, they look healthier and can be grown for extended periods of time.
Gastruloids are by definition composed of cells from the three germ layers from which all organs of the body will develop. To elicit and/or enhance the first steps of organogenesis in culture, we applied organ-specifying factors to our cultures. As a proof of principle, we concentrated on the heart and blood, which are the first developing organs in the embryo.
We formulated a medium enriched in VEGF, Ascorbic Acid (AA) and basic FGF (bFGF), in which gastruloids are grown from day 4. We find that the combination of increased medium volume, shaking, modified medium exchange and addition of VEGF, AA and bFGF to our cell culture results in a very robust development of beating portions at the gastruloid anterior side 7 days after aggregation (
Perhaps most importantly, we also observe the reproducible development of a network of Flk1/VEGFR2 positive cells in the anterior portion, resembling the formation of a vascular network (
Haematopoietic Organogenesis Method and Results
We have developed protocols to promote blood specification and capture both primitive and definitive haematopoiesis, with the potential to produce haematopoietic stem cells (HSC) in the absence of genetic manipulation.
The “Haematopoietic Method” was based on the “Basic Method” provided above with the following modifications, as illustrated in (
The resulting gastruloid cultures exhibit polarised expression of a Flk1-GFP reporter from 96 h, with subsequent nucleation of the Flk1-GFP expression and the formation of luminal-like structures, that are evident as a more complex network from 144 h onwards, and could correspond to vasculature (
Differentiating gastruloid cultures maintained in FGF2 and VEGF significantly up-regulate expression of haematopoietic, as well as endothelial markers (
Flow cytometry analysis of dissociated Flk1-GFP-expressing gastruloids revealed the presence of CD41+ C-Kit+ cells and CD45+, cKIT+ and CD31+ cells, compatible with the development of early haematopoietic percursors from haemogenic endothelium. These cells were apparent from day 5 of gastruloid culture amongst Flk1-GFP+ cells, in particular at higher levels of GFP detection (
During embryogenesis, the formation of the heart is mediated by waves of different progenitors, which are typically defined as first and second heart field (FHF and SHF, respectively). FHF and SHF progenitors differ in their kinetic of proliferation and differentiation, in the expression of typical markers and, most importantly, in their prospective contribution to the different heart portions (Miquerol and Kelly , w2013). Since progenitors from the two different heart fields will give rise to different portions of the heart and outflow tract, it is an important point that features of both FHF and SHF are recapitulated in Gastruloids. As shown in
A second remarkable feature of Gastruloids is that the formation of a beating portion can pass through spatially organized domains which are similar to those observed in embryos. Specifically, in mouse embryos at E7.5, cardiac progenitors are located in a crescent-like domain, namely the cardiac crescent (Miquerol and Kelly). From this crescent, progenitors will fuse at the midline to give rise to the heart tube, the first beating structure which develops during cardiogenesis (around E8-E8.5 in the mouse). As shown in
Detection of Gastruloid Derived Aortic Clusters
Engraftment Experiment
FLK1-GFP cells were originally generated in a C57131/6 background, and express the CD45.2 isoform of the pan-haematopoietic marker CD45.
Dissociated cells from 192 h gastruloids cultured under FGF2/VEGF, with or without a 24 h pulse of SHH between 144 and 168 h, were washed and resuspended in PBS/BSA and injected intra-tail vein into irradiated CD45.1 recipient mice. Animals were irradiated with a total of 8Gy 1-2 h prior to injection and gastruloid-derived cells were injected in a mixture with accessory bone marrow CD45.1 cells to support the early haematopoietic recovery post-irradiation. In some cases, 192 h-gastruloids from both culture conditions were pre-sorted by flow cytometry on CD45 expression with the aim of injecting a pure population of cells in the haematopoietic lineage. Animals injected with whole gastruloid culture received the same equivalent amount of CD45+ cells.
Engraftment was monitored in the peripheral blood at 8 weeks by staining of a cell suspension pre-treated with red blood cell lysis buffer, with antibodies against CD45.1 and CD45.2 so as to distinguish host (CD45.1) from graft (CD45.2) cells. Some animals were sacrificed at 10 weeks and bone marrow and spleen collected and stained as described for peripheral blood.
All experiments were performed against a control CD45.1 animal that did not receive gastruloid cells.
Results
Week 9 Mouse GT7 (unsorted VEGF), GT9 (unsorted Shh), GT11 (sorted VEGF) and GT14 (no injection) have been terminated and FACS analysis was performed on CD45.1-PE and CD45.2-APC-Cy7.
Bone marrow cells were harvested for FACS. The results of which are shown in
Epiblast Stem Cells (EpiSCs) are epithelial and have several properties that make them different from naïve ESCs. These cells are in a state of what is known as ‘primed pluripotency’ and part of the interest in these cells is derived from their similarity to hESCs. EpiSCs are unable to form Gastruloids under standard conditions. However, the invenotors have developed a protocol that allows EpiSCs to form a different kind of Gastruloid structure, that we call EpiGastruloid. This protocol required an adaptation to the conditions of the EpiSCs and involves a pretreatment that lasts three days in adherent culture and aggregation in a combination of the Wnt agonist CHI and FGF2. Under these conditions, EpiSCs form a polarized structure that grows over time. We find that ESCs do not produce EpiGastruloids. This differential behaviour allows the two types of Gastruloids to discern between different states of pluripotency and we have shown this.
EpiGastruloids can be used, in parallel with standard Gastruloids, to test the state of different stem cell populations and as a source of more posterior fates.
Method
Pretreatment: Start with EpiSC (ES cells after 3 passages in bFgf/Activin) (bFGF: 12 ng/mL and Activin 25 ng/mL).
Day 0: Plate 5.105 EpiSC in a well of 6WP coated with Fibronectin in bFgf/Activin medium. (bFGF: 12 ng/mL and Activin 25 ng/mL)
Day 1: Change medium with N2B27+bFGF (bFGF:20 ng/mL concentration).
Day 2: Change medium with N2B27+bFGF+CHI (bFGF:20 ng/mL and CHI:3 uM).
Aggregation: Low adherent 96w plates (Greiner) were used.
Confluent cells were washed with PBS and Accutase was used to detach the cells. The cells were spun, counted and 350 cells were plated per 96w plate in 40 ul of Fgf and CHI medium (bFGF: 20 ng/mL and CHI: 3 uM). 150 ul FGF+CHI medium was added after 48 hours of plating cells and after that, 150 ul of medium was changed every day. The cells were imaged every 24 hours, from 24 hours-120 hours.
Materials and Methods—See Example 1, Materials and Methods, varied as described below.
Results
Materials and Methods—See Example 1, Materials and Methods, varied as described below.
Results
Materials and Methods—See Example 1, Materials and Methods, varied as described below.
Results
Summary
Organoids are powerful in vitro models for the study of tissue development, physiology and disease. However, existing organoids are derived using methodologies that disrupt inductive 3D tissue-tissue interactions that play an indispensable role during native organogenesis (Tom et al., 1997; and Harvey et al., 2002). It has thus not yet been possible to recreate organogenesis approximating the spatial and temporal fidelity found in the embryo (Rossi et al., 2018). Here we show that when stimulated with key cardiogenic factors, embryonic organoids (van den Brink et al., 2014; and Beccari et al., 2018) can be coaxed to robustly undergo fundamental steps of early heart organogenesis (Miquerol and Kelly 2013) in a spatiotemporally accurate manner. In particular, these organoids support the formation of Mesp1+ cardiac progenitor cells that persist anteriorly, the generation of Flk1+ bipotent cardiovascular progenitors, and the formation of first and second heart field compartments. Cardiac progenitors self-organize into an anterior domain reminiscent of a crescent, which further condenses to form a beating cardiac tissue. Similar to what happens in vivo, in embryonic organoids the heart primordium forms anteriorly, in close proximity to an epithelial tissue akin to the primitive gut tube, from which it is separated by an endocardial-like layer. These findings highlight the surprising potential of aggregated, free-floating embryonic stem cells to progress beyond the previously characterized early developmental stages preceding organogenesis. This platform provides new perspectives to study heart development in vitro with unprecedented detail and throughput.
Methods
Cell Culture
mESCs were cultured at 37° C., 5%CO2 in DMEM supplemented with 10% Embryonic Stem Cell qualified FBS (Gibco), NEAA, Sodium Pyruvate, β-mercaptoethanol, 3 μM CHI99201 (Chi), 1 μM PD025901 and 0.1 μg ml−1 LIF. Gata6-Venus (Freyer et al., 2015), Flk1-GFP (Brutsaert 2003), and Mesp1-GFP (Bondue et al., 2011) cells were cultured on gelatinised tissue-culture flasks; Soxl-GFP::Brachyury-mCherry (Deluz et al., 2016) cells on tissue-culture flasks without coating. If not differently specified, Sox1-GFP::Brachyury-mCherry (Deluz et al., 2016) cells were used for our experiments. HUVECs were cultured in EGM-2 medium (Lonza). All cells were routinely tested for Mycoplasma with Mycoalert mycoplasma detection kit (Lonza) or by PCR.
Gastruloid Culture
Gastruloids were generated as previously described (Baillie-Johnson et al., 2015). Briefly, 300-700 mESCs were plated in 40 μl N2B27 in 96-well Clear Round Bottom Ultra-Low Attachment Microplates (7007, Corning). After 48 h, 150 μl of N2B27 containing 3 μM Chi were added to each well. After 72 h, medium was changed with N2B27. Starting from 96 h, the protocol was optimized as described in
Live Imaging and Cell Tracking
Bright-field live imaging of beating gastruloids was performed with a Nikon Ti inverted microscope equipped with an incubation chamber at 37° C., 5% CO2. Light sheet live imaging of Flk1-GFP and Mesp1 gastruloids was performed with a prototype of LS1 live inverted light sheet microscope (Viventis Microscopy Sari, Switzerland), at 37° C., 5%CO2. A volume of 150-200 μm was acquired with a Z spacing of 2-3 μm between slices and pictures were captured every 20 min for Flk1 gastruloids and every 10min for tracking of Mesp1 cells. Flk1 light sheet video montages were obtained with the Arivis Vision4D software. To track Mesp1+ cells in Gastruloids from 96 to 120 h, LS1 live light sheet images were processed with the Fiji Mastodon plugin, using a semi-automatic tracking. Subsequently, Mastodon files were exported for Mamut, and the Fiji Mamut plugin was used to display cell tracks as shown in
Immunofluorescence, Confocal and Light Sheet Imaging on Fixed Samples
Immunofluorescence on whole mount gastruloids was performed as previously described (Baillie-Johnson et al., 2015). Briefly, gastruloids were washed in PBS and fixed in 4% PFA for 2 hours at 4° C. while shaking. Samples were washed 3 times in PBS and 3 times (10 minutes each) in blocking buffer (PBS, 10%FBS, 0.2%Triton X-100), then blocked for 1 h at 4° C. in blocking buffer. Gastruloids were then incubated O/N with primary antibodies in blocking buffer, at 4° C. while shaking. The day after, gastruloids were washed 4 times (20 minutes each) with blocking buffer, at 4° C. while shaking, and incubated O/N with secondary antibodies and DAPI (2 μg ml−1, Sigma-Aldrich) in blocking buffer, at 4° C. while shaking. The day after, gastruloids were washed for 1 h with blocking buffer, at 4° C. while shaking, then rinsed in PBS, 0.2%FBS, 0.2% Triton X-100 and mounted on Superfrost plus glass slides (ThermoFisher) with Floromount-G for confocal imaging (Southern Biotech). The following primary antibodies were used: mouse anti-Gata4 (1:500, Santa Cruz Biotechnology, G-4); chicken anti-GFP (1:750, Ayes Labs); goat anti-Brachyury (1:300, Santa Cruz Biotechnology, C-19); rat anti-CD31 (1:100, BD, MEC 13.3), mouse anti-cardiac troponin T (1:100, ThermoFisher, 13-11), rabbit anti-E-Cadherin (1:500, Cell Signaling, 24E10). The following secondary antibodies were used: donkey anti-chicken 488 AlexaFluor (1:500, Jackson ImmunoResearch); donkey anti-goat AlexaFluor 568 (1:500, ThermoFisher); goat anti-rat AlexaFluor 568 (1:500, ThermoFisher); goat anti-mouse AlexaFluor 647 (1:500, ThermoFisher); donkey anti-rabbit 568 (1:500, ThermoFisher). Confocal pictures were acquired with a Zeiss LSM 700 inverted confocal microscope equipped with a Axiocam MRm black and white camera in the EPFL bioimaging and optics facility. For light sheet imaging (
RNA Extraction and qRT-PCR
RNA was extracted from gastruloids with the RNeasy Micro kit (Qiagen), according to manufacturer's instructions and quantified with a spectrophotometer (ND-1000, Nanodrop). 1 μg of RNA was reverse-transcribed with the iScript cDNA Supermix kit (Biorad). cDNA was diluted 1:10 and 1.5p1 of cDNA per reaction were used, in a total volume of 10 μl. 384 plates were prepared using a robotized liquid handling platform (Hamilton Microlab Star). qPCR was run with a 7900HT Fast PCR machine (Applied Biosystems), using Power SYBR Green PCR Master Mix (Applied Biosystems), with an annealing temperature of 60° C. Gene expression was normalized on β-actin expression. Relative fold expression was calculated with the 2-AACT method. 500 nM of the following primers were used: Mesp1 FOR GTCTGCAGCGGGGTGTCGTG; Mesp1 REV CGGCGGCGTCCAGGTTTCTA; Nkx2.5 FOR CACATTTTACCCGGGAGCCT; Nkx2.5 REV ACCAGATCTTGACCTGCGTG; HCN4 FOR GTGGGGGCCACCTGCTAT; HCN4 REV GTCGGGTGTCAGGCGGGA; a-actinin FOR GGGCTATGAGGAGTGGCTATT; α-actinin REV AGTCCTTCTGCAGCAAGATCT; RyR2 FOR TGCATGAGAGCATCAAACGC; RyR2 REV CGCGGAGAGAGGCATTACAT; Tbx5 FOR GGCATGGAAGGAATCAAGGTG; Tbx5 REV TTTGGGATTAAGGCCAGTCAC; Tbx1 FOR CTGTGGGACGAGTTCAATCAG; Tbx1 REV TTGTCATCTACGGGCACAAAG; IsI1 FOR ATGATGGTGGTTTACAGGCTAAC; IsI1 REV TCGATGCTACTTCACTGCCAG; FGF10 FOR TCAGCGGGACCAAGAATGAAG; FGF10 REV CGGCAACAACTCCGATTTCC; β-actin FOR CTGTCGAGTCGCGTCCACC; β-actin REV CGCAGCGATATCGTCATCCA.
RNAscope
For RNAscope, gastruloids were washed in PBS and fixed 0/N in 4% PFA, at 4° C. while shaking. The day after, samples were washed 3 times in PBS and included in HistoGel (ThermoFisher) blocks. HistoGel blocks were then processed with a Tissue-Tek VIP 6 Al Vacuum Infiltration Processor (Sakura) and included in paraffin. Paraffin blocks were cut at 4□m with a Hyrax M25 microtome (Zeiss). RNA-scope was performed with the ACDBio Manual assay kit using RNAscope Probe-Mm-Tbx1 (481911), RNAscope Probe-Mm-IsI1-C3 (451931-C3) and RNAscope Probe-Mm-Tbx5-C2 (519581-C2) probes, according to manufacurer's instructions. Polr2a-C1, Ppib-C2 and Ubiquitin-C3 probes were used as positive and negative controls. Pictures were acquired with an upright Leica DM5500 microscope equipped with a CCD DFC 3000 black and white camera.
FACS Analysis and Cell Sorting5
In order to perform FACs analysis and cell sorting, gastruloids were collected, washed in PBS, and digested in 4 mg ml−1 dispase I (Roche), 3 mg ml−1 collagenase IV (Gibco) and 100 μg ml−1 DNase I (Roche) in PBS (2 digestion cycles at 37° C., 5 min each; gentle pipetting was applied between the two cycles to mechanically dissociate the gastruloids). Digestion was blocked with DMEM containing 10% FBS, then samples were centrifuged and the cell pellet was resuspended in sorting buffer (PBS, 5%FBS, 1 mM EDTA, 1%P/S) for antibody staining. Samples were incubated for 1 h on ice with antibodies, and 30 min on ice with Aqua live/dead fixable dead cell stain kit (405/525 nm, Invitrogen) or 10 min on ice with DAPI. Unstained, FMO and single color samples were used as controls. The following antibodies were used: anti CD31-PE 1:1200 (BD, MEC 13.3), anti VEGFR2/Flk1-APC 1:200 (Biolegend, Avas12); anti CXCR4-APC 1:100 (BD, 2611). Samples were analysed with a BD LSR II flow cytometer. Cell sorting was performed using a BD FACSAria Fusion cell sorter.
Angiogenesis Assay
For the angiogenesis assay, Flk1-GFP gastruloids at 168 h were collected and digested as described for FACs analysis. Flk1+ and Flk1− cells were isolated through cell sorting with a BD FACSAria Fusion cell sorter. 5 104 cells per condition were plated in IBIDI μ-angiogenesis slides pre-coated with 10 μl reduced growth factor Matrigel (Corning) in the lower chamber. Undifferentiated mESCs and HUVEC were used as negative and positive controls, respectively. Live imaging of tube formation was performed with a Nikon Ti inverted microscope equipped with an incubation chamber at 37° C., 5% CO2, with acquisitions every 15 minutes.
Calcium Imaging
To image calcium fluxes, gastruloids were incubated for 1 h with 8 μM Cal-520 (AAT Bioquest) at 37° C., 5% CO2. Gastruloids were then transferred to fresh medium before imaging. Imaging was performed with a Light sheet Z1 microscope (Zeiss) equipped with an environmental chamber to maintain gastruloids at 37° C. and 5% CO2. For imaging, gastruloids were embedded in 1% low melt agarose and the chamber was filled with culture medium. Nifidepine (Sigma Aldrich, 10 μM) and Isoproterenol (Isoprenaline hydrochloride, Sigma 15627, 1 μM) were added with a syringe directly to the imaging chamber during acquisition. The analysis of calcium spikes was performed with the Fiji Stacks-plot Z-Axis profile plugin. The baseline intensity was normalized to the minimum value over 10 sec. The ratio of fluorescence intensity to baseline intensity was calculated and results are shown as the percentage of increase over the baseline, which shows the relative changes in intracellular Ca2+.
Crescent Analysis
Analysis of crescent geometrical properties was performed using a custom-made Matlab script for Imaris files with a Imaris XT feature and EasyXT. Initially, we generated artificial shapes to be used as reference for defined geometrical metrics. Using a custom script (crescent generator.m), 3D objects were generated to mimic crescent structures with different characteristics. To do so, the script creates two spot objects, makes channels from these spots and finally subtracts one channel to the other. To analyse surfaces, 3D images from non-beating organoids at 144 h and beating organoids at 168 h were acquired with a Light sheet Z1 microscope (Zeiss) after clearing, as described above. For each individual stack, a surface was created using a dedicated user interface (GUI DetectAndAnalyze.m), defining the object that should be created for each channel (settings .m). Due to variability in background and signal intensity, the threshold (absolute intensity) was adjusted manually for each surface. Using a custom script (makeCroissantMeasure_final.m) geometrical measurements were computed and the results exported in csv table. In the graph, we plot the measure of Spareness, which is described as the ratio between the volume of the object and the volume of the best fitted ellipsoid. All scripts and settings used for analysis are available at Zenodo.org.
Statistics
All data shown in column graphs are expressed as mean±SD, apart from the graph showing Calcium spikes frequency, which is expressed as mean±whiskers from min to max. All other graphs show single data points. Statistical analysis between two columns was performed using two-tailed unpaired Student's t test, whereas data containing more than two experimental groups were analyzed with one-way analysis of variance followed by Bonferroni's test. To calculate the significance of the percentage of increase over baseline frequency after Isoproterenol administration, we applied a one sample t test. Statistical significance was calculated using the Graphpad Prism software, that was also used to generate all graphs. *P<0.05; **P<0.01; ***P<0.001; confidence intervals 95%; alpha level 0.05.
Results
Stem cell-derived organoids self-organize into complex structures mimicking aspects of the architecture, cellular composition and functionality of tissues found in real organs (Rossi et al., 2018; Sasai 2013; Clevers 2016; and Lancaster and Knoblich 2014). While most organoids are focused on the recapitulation of specific features of adult organs, embryonic organoids can capture key processes happening during early embryonic development, from the pre-implantation blastocyst (Rivron et al., 2018) to early post-implantation development (Harrison et al., 2017; Shao1 et al., 2017; Shao2 et al., 2017; and Sozen et al., 2018) and gastrulation (as shown in this disclosure).
When cultured for 144 h or longer in N2B27 medium, gastruloids occasionally form a beating domain that is exclusively located within their anterior region (38.5±29.3% at 168 h) (
In cardiomyocytes, physical contraction is coupled to electrical excitation through intracellular changes of Ca2+ (Tyser et al., 2016). To evaluate the functionality of the gastruloid cardiac domain, we thus assessed calcium transients by live gastruloid imaging via light sheet microscopy (at 168 h). Image analysis revealed rhythmic calcium spiking in beating areas, with a frequency that is comparable to beating rates observed in embryos from the crescent stage to the linear heart tube (Tyser et al., 2016) (
To understand if the cardiac portion forms through the recapitulation of developmentally relevant processes, we first analyzed the temporal expression of key genes involved in cardiovascular specification (
During embryonic development, endothelial cells are a prerequisite for cardiomyocyte maturation, function and survival, through their continuous cross-talk in the developing heart (Brutsaert et al., 2003). For this reason we tested whether such tissue-tissue interaction could potentially take place in developing gastruloids, focusing on cardiovascular progenitors expressing the well-known marker Flk1 (also known as Kdr or Vegfr2) (Kattman et al., 2006). In 96 h gastruloids derived from a Flk1-GFP reporter ESC line (Jakobsson et al., 2010), Flk1 was expressed at the anterior pole opposite to Brachyury (
A key feature of cardiogenesis is a requirement for a coordinated interaction between two distinct mesodermal progenitor populations: the first heart field (FHF), that contributes to the left ventricle and part of the atria, and the second heart field (SHF) that gives rise to the outflow tract, right ventricle and part of the atria (Harvey et al., 2002; and Miquerol and Kelly 2013). After migration from the posterior primitive streak, FHF progenitors form the cardiac crescent and early heart tube anteriorly. SHF progenitors, originating from cardiopharyngeal mesoderm (Cortes et al., 2018), are characterized by delayed differentiation and are located medially to the crescent to then be involved in heart tube elongation. Each of these populations is characterized by a specific pattern of gene expression that we see recapitulated in our embryonic organoids, where we observed expression of markers of the FHF (Tbx5) and SHF (Tbx1) (
In the mouse embryo, after their specification, cardiac progenitors migrate antero-laterally and progressively fuse at the midline to define the first morphologically identifiable heart structure, the cardiac crescent around E7.5 (Miquerol and Kelly 2013). Then, morphogenetic movements associated with foregut closure result in formation of a linear heart tube by E8.5 (Miquerol and Kelly 2013). We explored whether gastruloids stimulated with cardiogenic factors can capture these morphological hallmarks of cardiogenesis. Remarkably, in gastruloids cultured for 144 h to 168 h, we observed a recapitulation of these events. Around 144 h, cTnT positive cardiomyocytes were organized in crescent-like domains (
The presence of a crescent-like structure and its evolution to a coherent beating group of cells, led us to test whether this was accompanied with an association between the crescent and anterior endoderm, as is the case in the embryo (Ivanovitch et al., 2017; and Lough and Sugi 2000). In gastruloids, primitive gut tube-like expression patterns (marked by Sox17, Shh, Sox2, CDX2 and E-cadherin) have already been described (Beccari et al., 2018). Strikingly, the cTnT positive cardiac domain in 168 h gastruloids was exclusively located in proximity to the anterior side of the gut tube (n=14/14), with a CD31 positive endocardial-like layer in between (
These results show that embryonic organoids can be stimulated to recapitulate key steps of early cardiac development in vitro that in vivo require polarized interactions between different primordia. These interactions are critical for achieving architectural and compositional complexity that are absent in conventional organoids, but appear to be provided by the multi-axial properties and spatial organization of different embryonic tissues characteristic of gastruloids. In our case, we have steered these interactions to generate a cardiac primordium that serves as a basis for the development of an embryonic heart.
Andersen, P. et al. Precardiac organoids form two heart fields via Bmp/Wnt signaling. Nat. Commun. 9, 3140 (2018).
Baillie-Johnson, P., et al., Generation of aggregates of mouse ES cells that show symmetry breaking, polarisation and emergent collective behaviour. JOVE, 2015. doi: 10.3791/53252(105).
Beccari, L. et al. Multi-axial self-organization properties of mouse embryonic stem cells into gastruloids. Nature 562, 272-276 (2018).
Berge, ten, D. et al. Wnt Signaling Mediates Self-Organization and Axis Formation in Embryoid Bodies. Cell Stem Cell 3, 508-518 (2008).
Bondue, A. et al. Defining the earliest step of cardiovascular progenitor specification during embryonic stem cell differentiation. J. Cell Biol. 192, 751-765 (2011).
Brutsaert, D. L. Cardiac endothelial-myocardial signaling: its role in cardiac growth, contractile performance, and rhythmicity. Physiol. Rev. 83, 59-115 (2003).
Clevers, H. Modeling Development and Disease with Organoids. Cell 165, 1586-1597 (2016).
Cortes Claudio, Francou Alexandre, De Bono Christopher & Kelly Robert G. Epithelial Properties of the Second Heart Field. Circ. Res. 122, 142-154 (2018).
Deluz, C. et al. A role for mitotic bookmarking of SOX2 in pluripotency and differentiation. Genes Dev. 30, 2538-2550 (2016).
Freyer, L. et al. A loss-of-function and H2B-Venus transcriptional reporter allele for Gata6 in mice. BMC Dev. Biol. 15, 38 (2015).
Harrison, S. E., Sozen, B., Christodoulou, N., Kyprianou, C. & Zernicka-Goetz, M. Assembly of embryonic and extraembryonic stem cells to mimic embryogenesis in vitro. Science 356, (2017).
Harvey, R. P. Patterning the vertebrate heart. Nat. Rev. Genet. 3, 544-556 (2002).
Ivanovitch, K., Temiño, S., and Torres, M. (2017). Live imaging of heart tube development in mouse reveals alternating phases of cardiac differentiation and morphogenesis.
Jakobsson, L. et al. Endothelial cells dynamically compete for the tip cell position during angiogenic sprouting. Nat. Cell Biol. 12, 943-953 (2010).
Kattman, S. J., Huber, T. L. & Keller, G. M. Multipotent flk-1+ cardiovascular progenitor cells give rise to the cardiomyocyte, endothelial, and vascular smooth muscle lineages. Dev. Cell 11, 723-732 (2006).
Lancaster, M. A. & Knoblich, J. A. Organogenesis in a dish: Modeling development and disease using organoid technologies. Science 345, 1247125 (2014).
Le Garrec, J.-F. et al. A predictive model of asymmetric morphogenesis from 3D reconstructions of mouse heart looping dynamics. eLife 6,
Lee, E. et al. ACT-PRESTO: Rapid and consistent tissue clearing and labeling method for 3-dimensional (3D) imaging. Sci. Rep. 6, 18631 (2016).
Lescroart, F. et al. Early lineage restriction in temporally distinct populations of Mesp1 progenitors during mammalian heart development. Nat. Cell Biol. 16, 829-840 (2014).
Lough, J. & Sugi, Y. Endoderm and heart development. Dev. Dyn. 217, 327-342 (2000). Miquerol, L., and Kelly, R. G. (2013) Organogenesis of the vertebrate heart. Wiley Interdiscip. Rev. Dev. Biol. 2, 17-29.
Rajala, K., Pekkanen-Mattila, M. & Aalto-Setala, K. Cardiac Differentiation of Pluripotent Stem Cells. Stem Cells Int. 2011, (2011).
Rivron, N. C. et al. Blastocyst-like structures generated solely from stem cells. Nature 557, 106-111 (2018).
Rossi, G., Manfrin, A. & Lutolf, M. P. Progress and potential in organoid research. Nat. Rev. Genet. 19, 671 (2018).
Saga, Y. et al. MesP1: a novel basic helix-loop-helix protein expressed in the nascent mesodermal cells during mouse gastrulation. Dev. Camb. Engl. 122, 2769-2778 (1996).
Sasai, Y. Cytosystems dynamics in self-organization of tissue architecture. Nature 493, 318-326 (2013).
Shao1, Y. et al. Self-organized amniogenesis by human pluripotent stem cells in a biomimetic implantation-like niche. Nat. Mater. 16, 419-425 (2017).
Shao2, Y. et al. A pluripotent stem cell-based model for post-implantation human amniotic sac development. Nat. Commun. 8, 208 (2017).
Sozen, B. et al. Self-assembly of embryonic and two extra-embryonic stem cell types into gastrulating embryo-like structures. Nat. Cell Biol. 20, 979 (2018).
Tam, P. P. L. & Behringer, R. R. Mouse gastrulation: the formation of a mammalian body plan. Mech. Dev. 68, 3-25 (1997).
Turner, D. A., et al., Wnt/beta-catenin and FGF signalling direct the specification and maintenance of a neuromesodermal axial progenitor in ensembles of mouse embryonic stem cells. Development, 2014. 141(22): p. 4243-53.
Turner, D., et al., Gastruloids develop the three body axes in the absence of extraembryonic tissues and spatially localised signalling. bioRxiv, 20171. doi.org/10.1101/104539.
Turner, D., et al., Anteroposterior polarity and elongation in the absence of extra-embryonic tissues and of spatially localised signalling in gastruloids: mammalian embryonic organoids. Development, 20172. 144(21): p. 3894-3906.
Tyser, R. C. et al. Calcium handling precedes cardiac differentiation to initiate the first heartbeat. eLife 5, (2016).
van den Brink, S. C. et al. Symmetry breaking, germ layer specification and axial organisation in aggregates of mouse embryonic stem cells. Development 141, 4231-4242 (2014).
| Number | Date | Country | Kind |
|---|---|---|---|
| 1815438.5 | Sep 2018 | GB | national |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/GB2019/052668 | 9/23/2019 | WO | 00 |