Escherichia coli XL1-Blue MR (Stratagene), E. coli DH10B (GibcoBRL) and E. coli ET12567 were grown in 2xTY medium as described by Sambrook et al., (1989). Vector pUC18, pUC19 and Litmus 28 were obtained from New England Biolabs. E. coli transformants were selected with 100 μg/mL ainpicillin. Conditions used for growing the Saccharopolyspora erythraea NRRL 2338-red variant strain were as described previously (Gaisser et al., 1997, Gaisser et al., 1998). Expression vectors in S. erythraea were derived from plasmid pSG142 (Gaisser et al., 2000). Plasmid-containing S. erythraea were selected with 25-40 μg/mL thiostrepton or 50 μg/mL apramycin. To investigate the production of antibiotics, S. erythraea strains were grown in sucrose-succinate medium (Caffrey et al., 1992) as described previously (Gaisser et al., 1997) and the cells were harvested by centrifugation. Chromosomal DNA of Streptomyces rochei ATCC21250 was isolated using standard procedures (Kieser et al., 2000). Feedings of 3-O-mycarosyl erythronolide B or tylactone were carried out at concentrations between 25 to 50 mg /L.
DNA manipulations, PCR and electroporation procedures were carried out as described in Sambrook et al., (1989). Protoplast formation and transformation procedures of S. erythraea were as described previously (Gaisser et al., 1997). Southern hybridizations were carried out with probes labelled with digoxigenin using the DIG DNA labelling kit (Boehringer Mannheim). DNA sequencing was performed as described previously (Gaisser et al., 1997), using automated DNA sequencing on double stranded DNA templates with an ABI Prism 3700 DNA Analyzer. Sequence data were analysed using standard programs.
1 mL of each fermentation broth was harvested and the pH was adjusted to pH 9. For extractions an equal volume of ethyl acetate, methanol or acetonitrile was added, mixed for at least 30 min and centrifuged. For extractions with ethyl acetate, the organic layer was evaporated to dryness and then re-dissolved in 0.5 mL methanol. For methanol and acetonitrile extractions, supernatant was collected after centrifugation and used for analysis. High resolution spectra were obtained on a Bruker BioApex II FT-ICR (Bruker, Bremen, FRG).
An aliquot of whole broth (1 mL) was shaken with CH3CN (1 mL) for 30 minutes. The mixture was clarified by centrifugation and the supernatant analysed by LCMS. The HPLC system comprised an Agilent HP1100 equipped with a Luna 5 μm C18 BDS 4.6×250 mm column (Phenomenex, Macclesfield, UK) heated to 40° C. The gradient elution was from 25% mobile phase B to 75% mobile phase B over 19 minutes at a flow rate of 1 mL/min. Mobile phase A was 10% acetonitrile: 90% water, containing 10 mM ammonium acetate and 0.15% formic acid, mobile phase B was 90% acetonitrile: 10% water, containing 10 mM ammonium acetate and 0.15% formic acid. The HPLC system described was coupled to a Bruker Daltonics Esquire3000 electrospray mass spectrometer operating in positive ion mode.
For NMR analysis of 5-O-dedesosaminyl-5-O-mycaminosyl erythromycin A the fermentation broth was clarified by centrifugation to provide supernatant and cells. The supernatant was applied to a column (16×15 cm) of Diaione HP20 resin (Supelco), washed with 10% Me2CO/H20 (2×2 L) and then eluted with Me2CO (3.5 L). The cells were mixed to homogeneity with an equal volume of Me2CO/MeOH (1:1). After at least 30 minutes the slurry was clarified by centrifugation and the supernatant decanted. The pelleted cells were similarly extracted once more with Me2CO/MeOH (1:1). The cell extracts were combined with the Me2CO from the HP20 column and the solvent was removed in vacuo to give an aqueous concentrate. The aqueous was extracted with EtOAc (3×) and the solvent removed in vacuo to give a crude extract. The residue was dissolved in CH3CN/MeOH and purified by repeated rounds of reverse phase (C18) high performance liquid chromatography using a Gilson HPLC, eluting a Phenomenex 21.2×250 mm Luna 5 μm C18 BDS column at 21 mL/min. Elution with a linear gradient of 32.5% B to 63% B was used to concentrate the macrolides followed by isocratic elution with 30% B to resolve the individual erythromycins. Mobile phase A was 20 mM ammonium acetate and mobile phase B was acetonitrile. High resolution mass spectra were acquired on a Bruker BioApex II FTICR (Bruker, Bremen, Germany).
For NMR analysis of 5-O-angolosaminyl tylactone bioconversion experiments were performed as previously described with four 2 L flasks containing each 400 mL of SSDM medium inoculated with 5% of pre-cultures. Feedings with tylactone were carried out at 50 mg/L. The culture was centrifuged and the pH of the supernatant was adjusted to about pH 9 followed by extractions with three equal volumes of ethyl acetate. The cell pellet was extracted twice with equal volumes of a mixture of acetone-methanol (50:50, vol/vol). The extracts were combined and concentrated in vacuo. The resulting aqueous fraction was extracted three times with ethyl acetate and the extracts were combined and evaporated until dryness.
This semi purified extract was dissolved in methanol and purified by preparative HPLC on a Gilson 315 system using a 21 mm×250 mm Prodigy ODS3 column (Phenomenex, Macclesfield, UK). The mobile phase was pumped at a flow rate of 21 mL/min as a binary system consisting of 30% CH3CN, 70% H20 increasing linearly to 70% CH3CN over 20 min.
Plasmid pSG142 (Gaisser et al., 2000) was digested with XbaI and a fill-in reaction was performed using standard protocols. The DNA was re-ligated and used to transform E. coli DH10B. Construct pSG143 was isolated and the removal of the XbaI site was confirmed by sequence analysis.
The gene eryBV was amplified by PCR using the primers casOleG21 (WO01/79520) and 7966 5′-GGGGAATTCAGATCTGGTCTAGAGGTCAGCCGGCGTGGCGGCGCGTGAGTTCCTCCAGTCGC GGGACGATCT -3′ (SEQ ID NO: 16) and pSG142 (Gaisser et al., 2000) as template. The PCR fragment was cloned using standard procedures and plasmid pUC18eryBVcas was isolated with an NdeI site overlapping the start codon of eryBV and XbaI and BglII sites (underlined) following the stop codon. The construct was verified by sequence analysis.
The isolation of this vector is described in PCT/GB03/003230.
Plasmid pSGCIII (WO01/79520) was digested with NdeI/BglII and the insert fragment was isolated and ligated with the NdeIBglII treated vector fragment of pSGLit1. The ligation was used to transform E. coli ET12567 and plasmid pSGLit1 eryCIII was isolated using standard procedures. The construct was confirmed using restriction digests and sequence analysis. This cloning strategy allows the introduction of a his-tag C-terminal of EryCIII.
Plasmid pSGTYLM2 (WO01/7952) was digested with NdeI/BglII and the insert fragment was isolated and ligated with the NdeI/BglII treated vector fragment of pSGLit1. The ligation was used to transform E. coli ET12567 and plasmid pSGLit1tylMII was isolated using standard procedures. The construct was confirmed using restriction digests and sequence analysis. This cloning strategy allows the introduction of a his-tag C-terminal of TylMII.
Plasmid pSGLit1 was isolated and digested with NdeI/BglII and an approximately 1.3 kb insert was isolated. Plasmid pSG143 was digested with NdeI/BglII, the vector band was isolated and ligated with the approximately 1.3 kb band from pSGLit1 followed by transformation of E. coli DH10B. Plasmid pSG144 (
EryCIII was amplified by PCR reaction using standard protocols, with primers casOleG21 (WO 01/79520) and caseryCIII2 (WO 01/79520) and plasmid pSGCIII (Gaisser et al., 2000) as template. The approximately 1.3 kb PCR product was isolated and cloned into pUC18 using standard techniques. Plasmid pUCCIIIcass was isolated and the sequence was verified. The insert fragment of plasmid pUCCIIIcass was isolated after NdeI/XbaI digestion and ligated with the NdeI/XbaI digested vector fragment of pSG144. After the transformation of E. coli DH10B plasmid pSG144eryCIII was isolated using standard techniques.
Primers BIOSG34 5′-GGGCATATGAACGACCGTCCCCGCCGCGCCATGAAGGG-3′ (SEQ ID NO: 17) and 5′-CCCCTCTAGAGGTCACTGTGCCCGGCTGTCGGCGGCGGCCCCGCGCATGG-3′ (SEQ ID NO: 18) were used with genomic DNA of Streptomyces fradiae as template to amplify tylAI. The amplified product was cloned using standard protocols and plasmid pUC19tylAI was isolated. The insert was verified by DNA sequence analysis. Differences to the published sequence are shown in
Plasmid Litmus 28 was digested with SpeI/XbaI and the vector fragment was isolated. Plasmid pSGLit1 (dam−) was digested with XbaI and the insert band was isolated and ligated with the SpeI/XbaI digested vector fragment of Litmus 28 followed by the transformation of E. coli DH10B using standard techniques. Plasmid pSGLit2 was isolated and the construct was verified by restriction digest and sequence analysis. This plasmid can be used to add a 5′ region containing an xbaI site sensitive to Dam methylation and a Shine Dalgarno region thus converting genes which were originally cloned with an NdeI site overlapping the start codon and an bal site 3′ of the stop codon for the assembly of gene cassettes. This conversion includes the transformation of the ligations into E. coli ET12567 followed by the isolation of darn DNA and xbaI digests. Examples for this strategy are outlined below.
Plasmid pSGLit2 and pUC19tylAI were digested with NdeI/XbaI and the insert band of pUC19tylAI and the vector band of pSGLit2 were isolated, ligated and used to transform E. coli ET12567. Plasmid pSGLit2tylAI (darn) was isolated.
Primers 5′-CCCCTCTAGAGGTCTAGCGCGCTCCAGTTCCCTGCCGCCCGGGGACCGC TTG-3′ (SEQ ID NO: 19) and 5′-GGGTCTAGATCGATTAATTAAGGAGGACATTCATGCGCGT CCTGGTGACCGGAGGTGCGGGCTTCATCGGCTCGCACTTCA-3′ (SEQ ID NO: 20) and genomic DNA of Streptomyces fradiae as template were used for a PCR reaction applying standard protocols to ampIlify tylAII. The approximately 1 kb sized DNA fragment was isolated and cloned into SmaI-cut pUC19 using standard techniques. The DNA sequencing of this construct revealed that 12 nucleotides at the 5′ end had been removed possibly by an exonuclease activity present in the PCR reaction. The comparison of the amino acid sequence of the cloned fragment compared to the published sequence is shown in
To add the missing 5′-nucleotides, pSGLit2 was digested with PacI/XbaI and the vector fragment was isolated and ligated with the PacI/AbaI digested insert fragment of pUC19tyl4II. The ligated DNA was used to transform E. coli ET12567 and plasmid pSGLit2tylAII (dam−) was isolated.
The eryCVI gene was amplified by PCR using primer BIOSG28 5′-GGGCATATGTACGAGGG CGGGTTCGCCGAGCTTTACGACC-3′(SEQ ID NO: 21) and BIOSG29 5′-GGGGTCTAGAGGTCAT CCGCGCACACCGACGAACAACCCG-3′ (SEQ ID NO: 22) and plasmid pNCO62 (Gaisser et al., 1997) as a template. The PCR product was cloned into Smal digested pUC19 using standard techniques and plasmid pUC19eryCVI was isolated and verified by sequence analysis.
Plasmid pUC19eryCVI was digested with NdellXbaI and ligated with the NdeIlXbaI digested vector fragment of pSGLit2 followed by transformation of E. coli ET12567. Plasmid pSGLit2eryCVI (dam−) was isolated.
Plasmid pSG144 and pUC19tylAI were digested with NdeI/XbaI and the insert band of pUC I 9tylAI and the vector band of pSG144 were isolated, ligated and used to transform E. coli DHI10B. Plasmid pSG144tylAI was isolated using standard protocols.
Plasmid pSGLit2tylAII (dam−) was digested with XbaI and ligated with XbaI digested plasmid pSG144tylAI. The ligation was used to transform E. coli DH10B and plasmid pSG144tylAItylAII was isolated and verified using standard protocols.
Plasmid pUC18tylM3 (Isolation described in WO01/79520) was digested with NdeI/XbaI and the insert band and the vector band of NdeIIAbaI digested pSGLit2 were isolated, ligated and used to transform E. coli ET12567. Plasmid pSGLit2tylMIII (dam−) was isolated using standard protocols. The construct was verified using restriction digests and sequence analysis.
Plasmid pSGLit2tylMIII (dam−) was digested with XbaI and the insert band was ligated with XbaI digested plasmid pSG144tylAltylAII. The ligation was used to transform E. coli DH10B and plasmid pSG144tylAItylAItylMIII no36 was isolated using standard protocols. The construct was verified using restriction digests and sequence analysis.
Plasmid pUC18tylB (Isolation described in WO01/79520) was digested with PacI/XbaI and the insert band and the vector band of PacI/XbaI digested pSGLit2 were isolated, ligated and used to transform E. coli ET12567. Plasmid pSGLit2tylB nol (dam−) was isolated using standard protocols.
Plasmid pSGLit2tylB (dam−) was digested with XbaI and the insert band was ligated with XbaI digested plasmid pSG144tylAItylAItylMIII. The ligation was used to transform E. coli DH10B and plasmid pSG144tylAItylAIItylMIIItylB no5 was isolated using standard protocols and verified by restriction digests and sequence analysis.
Primers BIOSG 88 5′-GGGCATATGGCGGCGAGCACTACGACGGAGGGGAATGT-3′ (SEQ ID NO: 23) and BIOSG 89 5′-GGGTCTAGAGGTCACGGGTGGCTCCTGCCGGCCCTCAG-3′ (SEQ ID NO: 24) were used to amplify tylIa using a plasmid carrying the tyl region (accession number u08223.em_pro2) comprising ORF1 (cytochrome P450) to the end of ORF2 (TyIB) as a template. Plasmid pUCtyIa nol was isolated using standard procedures and the construct was verified using sequence analysis.
Plasmid pUCtylIa nol was digested with NdeI/XbaI and the insert band and the vector band of NdelIXbaI digested pSGLit2 were isolated, ligated and used to transform E. coli ET12567. Plasmid pSGLit2tylIa no 54 (dam−) was isolated using standard protocols. The construct was verified using sequence analysis.
Plasmid pSGLit2tylIa (dam−) was digested with XbaI and the insert band was ligated with XbaI digested plasmid pSG144tylAItylAIItylMIIItylB. The ligation was used to transform E coli DH10B and plasmid pSG144tylAItylAIItylMIIItylBtylIa no3 was isolated using standard protocols and verified by restriction digests and sequence analysis.
Plasmid pUCtylMI (Isolation described in WO01/79520) was PacI digested and the insert was ligated with the PacI digested vector fragment of pSGLitl eryCIII using standard procedures. Plasmid
pSGL it1tylMIeryCIII no20 was isolated and the orientation was confirmed by restriction digests and sequence analysis.
Plasmid pSGLit1tylMIeryCIII no20 was digested with XbaI/BglII and the insert band was isolated and ligated with the XbaI/BglII digested vector fragment of plasmid pSG144tylAltylAIItylMIIItylBtylIa no3. Plasmid pSG144tylAItylAIItylMIIItylBtyl1atylMIeryCIII was isolated using standard procedures and the construct was confirmed using restriction digests and sequence analysis. Plasmid preparations were used to transform S. eryth7raea mutant strains with standard procedures.
To prevent the conversion of the substrate 3-O-mycarosyl erythronolide B to 3,5-di-O-mycarosyl erythronolide B a further chromosomal mutation was introduced into S. erythraea SGQ2 (Isolation described in WO 01/79520) to prevent the biosynthesis of L-mycarose in the strain background. Plasmid pSGKCI was isolated by cloning the approximately 0.7 kb DNA fragment of the eryBVIgene by using PCR amplification with cosmid2 or plasmid pGG1 (WO01/79520) as a template and with the primers 646 5′-CATCGTCAAGGAGTTCGACGGT-3′ (SEQ ID NO: 25) and 874 5′-GCCAGCTCGGCGACGTCC ATC-3′ (SEQ ID NO: 26) using standard protocols. Cosmid 2 containing the right hand site of the ery-cluster was isolated from an existing cosmid library (Gaisser et al., 1997) by screening with eryBVas a probe using standard techniques. The amplified DNA fragment was isolated and cloned into EcoRV digested pKC1132 (Bierman et al., 1992) using standard methods. The ligated DNA was used to transform E. coli DH10B and plasmid pSGKCl was isolated using standard molecular biological techniques. The construct was verified by DNA sequence analysis.
Isolation of S. erythraea Q42/1 (Biot-2166) Plasmid pSGKC1 was used to transform S. erythraea SGQ2 using standard techniques followed by selection with apramycin. Thiostrepton/apramycin resistant transformant S. erythraea Q42/1 was isolated.
Bioconversion assays using 3-O-mycarosyl erythronolide B are carried out as described in General Methods. Improved levels of mycaminosyl erythromycin A are detected in bioconversion assays using S. erythraea Q42/1 pSG144tylAItylAIItylMIIItylBtyl1atylMIeryCIII compared to bioconversion levels previously observed (WO01/79520).
Plasmid pUCtylMI (Isolation described in WO1/79520) was PacI digested and the insert was ligated with the PacI digested vector fragment of pSGLit1 tylMII using standard procedures. Plasmid pSGLit1tylMItylMII no16 was isolated and the construct was confirmed by restriction digests and sequence analysis.
Plasmid pSGLit1tylMItylMII no16 was digested with XbaI/BglII and the insert band was isolated and ligated with the XbaI/BglII digested vector fragment of plasmid pSG144tylAItylAItylMIItylBtylIa no3. Plasmid pSG144tylAItylAIItylMIIItylBtyl1atylMItylMII was isolated using standard procedures and the construct was confirmed using restriction digests and sequence analysis. The plasmid was isolated and used for transformation of S. erythraea mutant strains using standard protocols.
The conversion of fed tylactone to mycaminosyl tylactone was assessed in bioconversion assays using S. erythraea Q42/1pSG144tylAItylAIItylMIIItylBtyl1atylMItylMII. Bioconversion assays were carried out using standard protocols. The analysis of the culture showed the major ion to be 568.8 [M+H]+ consistent with the presence of mycaminosyl tylactone. Fragmentation of this ion gave a daughter ion of m/z 174, as expected for protonated mycaminose. No tylactone was detected during the analysis of the culture extracts, indicating that the bioconversion of the fed tylactone was complete.
Recently, a homologue of TyIIa was identified in the biosynthetic pathway of dTDP-3-acetamido-3,6-dideoxy-alpha-D-galactose in Aneurinibacillus therm oaerophilus L420-91T* (Pfoestl et al., 2003) and the function was postulated as a novel type of isomerase capable of synthesizing dTDP-6-deoxy-D-xylohex-3-ulose from dTDP-6-deoxy-D-xylohex-4-ulose.
(pSG144angAIangAIIorf14angMIIIangBangMIeryCIII).
The gene angMIII was amplified by PCR using the primers BIOSG61 5′-GGGCATATGAGCCCCGCACCCGCCACCGAGGACCC-3′ (SEQ ID NO: 27) and BIOSG62 5′-GGTCTAGAGGTCAGTTCCGCGGTGCGGTGGCGGGCAGGTCAC -3′ (SEQ ID NO: 28). Cosmid5B2 containing a fragment of the angolamycin biosynthetic pathway was used as template. The 1.4 kb PCR fragment (PCR no1) was cloned using standard procedures and EcoRV digested plasmid Litmus28. Plasmid Lit1/4 was isolated with an NdeI site overlapping the start codon of angMIII and an XbaI site following the stop codon. The construct was verified by sequence analysis.
Plasmid Lit1/4 was digested with NdeI/XbaI and the about 1.4 kb fragment was isolated and ligated to NdeI/XbaI digested DNA of pSGLit2. The ligation was used to transform E. coli ET12567 and plasmid pSGLt21/4 no 7 (dam−) was isolated. This construct was digested with XbaI and used for othe construction of gene cassettes.
The gene angMII was amplified by PCR using the primers BIOSG63 5′-GGGCATATGCGTATC CTGCTGACGTCGTTCGCGCACAACAC-3′(SEQ ID NO: 29) and BIOSG64 5′-GGTCTAGAGGTCA GGCGCGGCGGTGCGCGGCGGTGAGGCGTTCG-3′ (SEQ ID NO: 30) and cosmid5B2 containing a fragment of the angolamycin biosynthetic pathway was used as template. The 1.3 kb PCR fragment (PCR no2) was cloned using standard procedures and EcoRV digested plasmid Litmus28. Plasmid Lit2/8 was isolated with an NdeI site overlapping the start cocon of angMII and an XbaI site following the stop codon. The construct was verified by sequence analysis.
The gene angMII was amplified by PCR using primers BIOSG63 5′-GGGCATATGCGTATCCT GCTGACGTCGTTCGCGCACAACAC-3′ (SEQ ID NO: 29) and BIOSG80 5′-GGAGATCTGGCGCG GCGGTGCGCGGCGGTGAGGCGTTCG-3′ (SEQ ID NO: 31) and cosmid5B2 containing a fragment of the angolamycin biosynthetic pathway as template. The 1.3 kb PCR fragment was cloned using standard procedures and EcoRV digested plasmid Litmus28. Plasmid LitangMII(BGlII)no8 was isolated with an NdeI site overlapping the start codon of angMII and a BglII site instead of a stop codon thus allowing the addition of a his-tag. The construct was verified by sequence analysis.
Plasmid LitangMII(BgIII) was digested with NdeI/BglII and ligated with the NdeI/BglII digested vector fragment of pSGLit1. The ligation was used to transform E. coli ET12567 and plasmid psGLit1angMII (dam−) was isolated using standard procedures.
The gene angMI was amplified by PCR using the primers BIOSG65 5′-GGGCATATGAAC CTCGAATACAGCGGCGACATCGCCCGGTTG -3′ (SEQ ID NO: 32) and BIOSG66 5′-GGTCTAGAGGTCAGGCCTGGACGCCGACGAAGAGTCCGCGGTCG-3′ (SEQ ID NO: 33) and cosmid5B2 containing a fragment of the angolamycin biosynthetic pathway was used as template. The 0.75 kb PCR fragment (PCR no3) was cloned using standard procedures and EcoRV digested plasmid Litmus28. Plasmid Lit3/6 was isolated with an NdeI site overlapping the start codon of angMI and an XbaI site following the stop codon. The construct was verified by sequence analysis.
Plasmid Lit3/6 was digested with NdeI/XbaI and the about 0.8 kb fragment was isolated and ligated to NdeI/XbaI digested DNA of pSGLit2. The ligation was used to transform E. coli ET12567 and plasmid pSGLit23/6 no8 (dam−) was isolated. This construct was digested with XbaI and the isolated about 1 kb fragment was used for the assembly of gene cassettes.
The gene angB was amplified by PCR using the primers BIOSG67 5′-GGGCATATGACTACCT ACGTCTGGGACTACCTGGCGG -3′ (SEQ ID NO: 34) and BIOSG68 5′-GGTCTAGAGGTCAGAGC GTGGCCAGTACCTCGTGCAGGGC-3′ (SEQ ID NO: 35) and cosmid4H2 containing a fragment of the angolamycin biosynthetic pathway was used as template. The 1.2 kb PCR fragment (PCR no4) was cloned using standard procedures and EcoRV digested plasmid Litmus28. Plasmid Lit4/19 was isolated with an NdeI site overlapping the start codon of angB and an XbaI site following the stop codon. The construct was verified by sequence analysis.
Plasmid Lit4/19 was digested with NdeI/XbaI and the 1.2 kb fragment was isolated and ligated into NdeI/XbaI digested DNA of pSGLit2. The ligation was used to transform E. coli ET12567 and plasmid pSGLit24/19 no24 (dam−) was isolated. This construct was digested with XbaI and the isolated 1.2 kb fragment was used for the assembly of gene cassettes.
The gene orf14 was amplified by PCR using the primers BIOSG69 5′-GGGCATATGGTGAA CGATCCGATGCCGCGCGGCAGTGGCAG-3′ (SEQ ID NO: 36) and BIOSG70 5′-GGTCTAGAGGT CAACCTCCAGAGTGTTTCGATGGGGTGGTGGG-3′ (SEQ ID NO: 37) and cosmid4H2 containing a fragment of the angolamycin biosynthetic pathway was used as template. The 1.0 kb PCR fragment (PCR no5) was cloned using standard procedures and EcoRV digested plasmid Litmus28. Plasmid Lit5/2 was isolated with an NdeI site overlapping the start codon of ORF14 and an XbaI site following the stop codon. The construct was verified by sequence analysis.
Plasmid Lit5/2 was digested with NdeI/XbaI and the approximately 1 kb fragment was isolated and ligated to NdeI/Xbal digested DNA of pSGLit2. The ligation was used to transform E. coli ET12567 and plasmid pSGLit25/2 no24 (dam−) was isolated. This construct was digested with XbaI, the about 1 kb fragment isolated and used for the assembly of gene cassettes.
Plasmid Lit7/9 was digested with NdeI/XbaI and the approximately 1 kb fragment was isolated and ligated to NdeI/XbaI digested DNA of pSGLit2. The ligation was used to transform E. coli ET12567 and plasmid pSGLit27/9 no15 (dam−) was isolated. This construct was digested with XbaI and the isolated 1 kb fragment was used for the assembly of gene cassettes.
The gene angAI was amplified by PCR using the primers BIOSG73 5′-GGGCATATGAAGGGC ATCATCCTGGCGGGCGGCAGCGGC-3′ (SEQ ID NO: 38) and BIOSG74 5′-GGTCTAGAGGTCAT GCGGCCGGTCCGGACATGAGGGTCTCCGCCAC-3′ (SEQ ID NO: 39) and cosmid4H2 containing a fragment of the angolamycin biosynthetic pathway was used as template. The around 1.0 kb PCR fragment (PCR no8) was cloned using standard procedures and EcoRV digested plasmid Litmus28. Plasmid Lit8/2 was isolated with an NdeI site overlapping the start codon of angAI and an XbaI site following the stop codon. The construct was verified by sequence analysis.
The gene angaII was amplified by PCR using the primers BIOSG71 5′-GGGCATATGCGGCTG CTGGTCACCGGAGGTGCGGGC-3′ (SEQ ID NO: 40) and BIOSG72 5′-GGTCTAGAGGTCAGTCG GTGCGCCGGGCCTCCTGCG-3′ (SEQ ID NO: 41) and cosmid4H2 containing a fragment of the angolamycin biosynthetic pathway was used as template. The 1.0 kb PCR fragment was cloned using standard procedures and EcoRV digested plasmid Litmus28. Plasmid Lit7/9 was isolated with an NdeI site overlapping the start codon of angAII and an XbaI site following the stop codon. The construct was verified by sequence analysis.
Plasmid Lit8/2 was digested with NdellXbaI and the 1 kb fragment was isolated and ligated to NdeI/XbaI digested DNA of pSGLit2. The ligation was used to transform E. coli ET12567 and plasmid pSGLit28/2 no18 (dam−) was isolated.
Plasmid Lit8/2 was digested with NdeI/XbaI and the approximately 1 kb fragment was isolated and ligated with NdeI/XbaI digested DNA of pSG144. The ligation was used to transform E. coli DH10B and plasmid pSG1448/2 (dam−) (pSG144angAI) was isolated using standard procedures. This construct was verified with restriction digests and sequence analysis.
Plasmid pSGLit27/9 (isolated from E. coli ET12567) was digested with XaI and the 1 kb fragment was isolated and ligated with the XbaI digested vector fragment of pSG1448/2 (pSG144angAI).
The ligation was used to transform E. coli DH10B and plasmid pSG1448/27/9 (pSG144angAIangAII) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.
Plasmid pSGLit21/4 (isolated from E. coli ET12567) was digested with XbaI and the 1.4 kb fragment was isolated and ligated with the XbaI digested vector fragment of pSG1448/27/9 (pSG144angAIangAII). The ligation was used to transform E. coli DH10B and plasmid pSG1448/27/91/4 (pSG144angAIanggAIangMIII) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.
Plasmid pSGLit24/19 (isolated from E. coli ET12567) was digested with XbaI and the about 1.2 kb fragment was isolated and ligated with the XbaI digested vector fragment of pSG1448/27/91/4 (pSG144angAIangAIIangMIII). The ligation was used to transform E. coli DH10B and plasmid pSG144/27/91/44/19 (pSG144angAIangAIIangMIIIangB) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.
Plasmid pSGLit23/6 (isolated from E. coli ET12567) was digested with XbaI and the about 0.8 kb fragment was isolated and ligated with the XbaI digested vector fragment of pSG1448/27/91/44/19 (pSG144angAIang4AIIangMIIIangB). The ligation was used to transform E. coli DH10B and plasmid pSG1448/27/91/44/193/6 (pSG144angAIangAIIangMIIIangBangMI) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.
Plasmid pSGLit1eryCIII (isolated from E. coli ET12567) was digested with XbaI/BglII and the about 1.2 kb fragment was isolated and ligated with the XbaI digested and partially BglII digested vector fragment of pSG1448/27/91/44/193/6 (pSG144angAIangAIIangMIIIangBangMI). The BglII partial digest Was necessary due to the presence of a BglII site in angB. The ligation was used to transform E. coli DH10B and plasmid pSG1448/27/91/44/193/6eryCIII no9 (pSG144angAIangAIIangMIIIangBangMIeryCIII) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis. EryCIII carries a his-tag fusion at the end.
(pSG144angAIangAIIangMIIIangBangMIeryCIII)
The S. erythraea strain Q42/1pSG1448/27/91/44/193/6eryCIII was grown and bioconversions with fed 3-O-mycarosyl erthronolide B were performed as described in the General Methods. The cultures were analysed and a small amount of a compound with m/z 750 was detected consistent with the presence of 5-O-dedesosaminyl-5-O-mycaminosyl erythromycin A.
Plasmid pSGLit25/2 (isolated from E. coli ET12567) was digested with XbaI and the about 1 kb fragment was isolated and ligated with the XbaI digested vector fragment of pSG1448/27/9 (pSG144angAIangAII). The ligation was used to transform E. coli DH10B and plasmid pSG1448/27/95/2 (pSG144angAIangAIIorf14) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.
Plasmid pSGLit21/4 (isolated from E. coli ET12567) was digested with XbaI and the 1.4 kb fragment was isolated and ligated with the XbaI digested vector fragment of pSG1448/27/95/2 (pSG144angAIangAIIorf14). The ligation was used to transform E. coli DH10B and plasmid pSG1448/27/95/21/4 (pSG144angAlIangAIIorf14angMIII) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.
Plasmid pSGLit24/19 (isolated from E. coli ET12567) was digested with XbaI and the 1.2 kb fragment was isolated and ligated with the XbaI digested vector fragment of pSGI448/27/95/21/4 (pSG 144angAIangAIIorf4angMIII). The ligation was used to transform E. coli DH10B and plasmid pSG 1448/27/95/21/44/19 (pSG 144angaIangAIIorf1 4angMIIIangB) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.
(pSG144angAIang/AIIorf14angMIIIangBangMIeryCIII)
Plasmid pSG1448/27/91/44/193/6eryCIII no9 was digested with BglII and the about 2 kb fragment was isolated and ligated with the BglI digested vector fragment of pSG1448/27/95/21/44/19 (pSG144angaIangAIIorf14angMIIIIangB). The ligation was used to transform E. coli DH10B and plasmid pSG 1448/27/95/21/44/193/6eryCIII (pSG144angAIangAIIorf14angMIIIangBangMIeryCIII) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis. EryCIII carries a his-tag fusion at the end. The construct was used to transform S. erythraea SGQ2 using standard procedures.
The S. erythraea strain SGQ2pSG1448/27/95/21/44/193/6eryCIII was grown and bioconversions with fed 3-O-mycarosyl erythronolide B were performed as described in the General Methods. The cultures were analysed and improved amounts of a compound with m/z 750 was detected consistent with the presence of 5-O-dedesosaminyl-5-O-mycaminosyl erythromycin A. Similar results were obtained with the S. erythraea strain Q42/1 containing the gene cassette pSG1448/27/95/21/44/193/6eryCIII. 16 mg of the compound with m/z 750 was purified and the structure of 5-O-dedesosaminyl-5-O- inycaminosyl erythromycin A was confirmed by NMR analysis (See Table I and
1H and 13C NMR data for 5-O-dedesosaminyl-5-O-mycaminosyl
aThis carbon was assigned from the HMQC spectrum
(pSG144angAIangAIIorf14angMIIIangB3/6tylMII)
Plasmid pSG1448/27/91/44/193/6tylMII no9 was digested with BglII and the about 2 kb fragment was isolated and ligated with the BglII digested vector fragment of pSG1448/27/95/21/44/19 (pSG144angAIangAIIorf14angMIIIangB). The ligation was used to transform E. coli DHIOB and plasmid pSG1448/27/95/21/44/193/6tylMII (pSG144angAIangAIIorf14angMIIIangBangMItylMII) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis. TylMII carries a his-tag fusion at the end.
The S. erythraea strain Q42/1pSG1448/27/95/21/44/193/6tylMII is grown and bioconversions with fed tylactone is performed as described in the General Methods. The cultures are analysed and a compound with In/z 568 is detected consistent with the presence of mycaminosyl tylactone.
For the multiple use of promoter sequences in act-controlled gene cassettes a 240 bp fragment was amplified by PCR using the primers BIOSG78 5′-GGGCATATGTGTCCTCCTTAATTAATCGAT GCGTTCGTCC-3′ (SEQ ID NO: 42) and BIOSG79 5′-GGAGATCTGGTCTAGATCGTGTTCCCCTCC CTGCCTCGTGGTCCCTCACGC -3′ (SEQ ID NO: 43) and plasmid pSG142 (Gaisser et al., 2000) as template. The 0.2 kb PCR fragment (PCR no5) was cloned using standard procedures and EcoRV digested plasmid Litmus28. Plasmid conv nol was isolated. The construct was verified by sequence analysis.
Plasmid conv nol was digested with NdeJ/BglII and the about 0.2 kb fragment was isolated and ligated with the BamHI/NdeI digested vector fragment of pSGLit2. The ligation was used to transform E. coli DH10B and plasmid pSGLit3relig1 was isolated using standard procedures. This construct was verified using restriction digests and sequence analysis.
Plasmid Lit4/19 was digested with NdeI/XbaI and the 1.2 kb fragment was isolated and ligated to NdeI/XbaI digested DNA of pSGLit3. The ligation was used to transform E. coli ET12567 and plasmid pSGLit34/19 no23 was isolated. This construct was digested with xbaI and the isolated 1.4 kb fragment was used for the assembly of gene cassettes.
The gene orf4 was amplified by PCR using the primers BIOSG75 5′-GGGCATATGAGCACCC CTTCCGCACCACCCGTTCCG-3′ (SEQ ID NO: 44) and BIC)SG76 5′-GGTCTAGAGGTCAGTACAG CGTGTGGGCACACGCCACCAG-3′ (SEQ ID NO: 45) and cosmid4H2 containing a fragment of the angolainycin biosynthetic pathway was used as template. The 2.5 kb PCR fragment (PCR no6) was cloned using standard procedures and EcoRV digested plasmid Litmus28. Plasmid Lit6/4 was isolated with an Ndel site overlapping the start codon of orf4 and an XbaI site following the stop codon. The construct was verified by sequence analysis.
Plasmid Lit6/4 was digested with NdeI/XbaI and the DNA was isolated and ligated to NdeI/AbaI digested DNA of pSGLit2. The ligation was used to transform E. coli ET12567 and plasmid pSGLit26/4 no9 was isolated. This construct was confirmed by restriction digests and sequence analysis.
The gene spnO from the spinosyn biosynthetic gene cluster of Saccharopolyspoia spinosa was amplified by PCR using the primers BIOSG41 5′-GGGCATATGAGCAGTTCTGTCGAAGCTGAGGC AAGTG-3′ (SEQ ID NO: 46) and BIOSG42 5′-GGTCTAGAGGTCATCGCCCCAACGCCCACAAGCT ATGCA GG-3′ (SEQ ID NO: 47) and genomic DNA of S. spinosa as template. The about 1.5 kb PCR fragment was cloned using standard procedures and SmaI digested plasmid pUC19. Plasmid pUC19spnO no2 was isolated with an NdeI site overlapping the start codon of spnO and an XbaI site following the stop codon. The construct was verified by sequence analysis.
Plasmid pUC19spnO was digested with NdeI/XbaI and the 1.5 kb fragment was isolated and ligated to NdeI/XbaI digested DNA of pSGLit2. The ligation was used to transform E. coli ET12567 and plasmid pSGLit2spnO no 4 was isolated using standard procedures. This construct was digested with XbaI and the isolated 1.5 kb fragment was used for the assembly of gene cassettes.
Plasmid pSGLit2spnO no4 (isolated from E. coli ET12567) was digested with XbaI and the 1.5 kb fragment was isolated and ligated with the XbaI digested vector fragment of pSG1448/27/91/4 (pSG144angAIangAIIangMIII). The ligation was used to transform E. coli DH10B and plasmid pSG1448/27/91/4spnO (pSG144angAIangAIIangMIIIspnO) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.
Plasmid pSGLit25/2 no24 (isolated from E. coli ET 12567) was digested with XbaI and the 1 kb fragment was isolated and ligated with the XbaI digested vector fragment of pSG1448/27/91/4spnO (pSG144angaIangAIIangMIIIspnO). The ligation was used to transform E. coli DH10B and plasmid pSG1448/27/91/4spnO5/2 (pSG144angaIangAIIangMIIspnOangorfl4) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.
Plasmid pSGLit34/19 no23 (isolated from E. coli ET12567) was digested with XbaI and the about 1.4 kb fragment was isolated and ligated with the XbaI digested vector fragment of pSG1448/27/91/4spnO5/2 (pSG144angAIangAIIangMIIIspnOangorf14). The ligation was used to transform E. coli DH10B and plasmid pSG1448/27/91/4spnO5/2p19 (pSG 144angaIangAIIangMIIIspnOangorf14pangB) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis. ‘p’ indicates the presence of the promoter region in front of angB to emphasize the presence of multiple promoter sites in the construct.
Plasmid pSG1448/27/91/44/193/6eryCIII no9 was digested with BglII and the about 2 kb fragment was isolated and ligated with the BglII digested vector fragment of pSG1448/27/91/4spnO5/2p4/19 (pSG144angAIangAIIangMIIIspnOorf14pangB). The ligation was used to transform E. coli DH10B and plasmid pSG1448/27/91/4spnO5/2p4/193/6eryCIII (pSG144angAIangAIIangMIlIspnOorf14pangBangMIeryCIII) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis. EryCIII carries a his-tag fusion at the end. ‘p’ indicates the presence of the promoter region in front of angB to emphasize the presence of multiple promoter sites in the construct. The plasmid construct was used to transform mutant strains of S. erythraea using standard procedures.
Strain S. erythiaea Q42/1 pSG1448/27/91/4spnO5/2p4/193/6eryCIII was grown and bioconversions with fed 3-O-mycarosyl erythronolide B were performed as described in the General Methods. The cultures were analysed and peaks with m/z 704, m/z 718 and m/z 734 consistent with the presence of angolosaminyl erythromycin D, B and A, respectively, were observed.
(pSG144angAIangAIIangMIIIspnOorf14pangBangMItylMII)
Plasmid pSG1448/27/91/44/193/6tylMII no9 was digested with BglII and the about 2 kb fragment was isolated and ligated with the BglII digested vector fragment of pSG1448/27/91/4spnO5/2p4/19 (pSG144angaIangAIIangMIIIspnOorf14pangB). The ligation was used to transform E. coli DH10B and plasmid pSG 1448/27/91/4spnO5/2p193/6tylMII (pSG144angAIangAIIangMIIIspnOorf14pangBangMItylMIi) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis. TylMII carries a his-tag fusion at the end. The plasmid was used to transform mutant strains of S. erythraea applying standard protocols. ‘p’ indicates the presence of the promoter region in front of angB to emphasize the presence of multiple promoter sites in the construct.
To introduce a deletion comprising the PKS and majority of post PKS genes in S. erythraea a region of the left hand side of the ery- cluster (LHS) containing a portion of eryCl, the complete ermE gene and a fragment of the eryBI gene were cloned together with a region of the right hand side of the ery- cluster (RHS) containing a portion of the eryBVII gene, the complete eryK gene and a fragment of DNA adjacent to eryK. This construct should enable homologous recombination into the genome in both LHS and RHS regions resulting in the isolation of a strain containing a deletion between these two regions of DNA. The LHS fragment (2201 bp) was PCR amplified using S. erythraea chromosomal DNA as template and primers BldelNde (5′-CCCATATGACCGGAGTTCGAGGTACGCGGCTTG-3′, SEQ ID NO: 48) and BIdelSpe (5′-GATACTAGTCCGCCGACCGCACGTCGCTGAGCC-3′, SEQ ID NO: 49). Primer BIdeINde contains an NdeI restriction site (underlined) and primer BIdelSpe contains a SpeI restriction site used for subsequent cloning steps. The PCR product was cloned into the Smal restriction site of pUC19, and plasmid pLSB177 was isolated using standard procedures. The construct was confirmed by sequence analysis. Similarly, RHS (2158 bp) was amplified by PCR using S. erythraea chromosomal DNA as template and primers BVIIdelSpe (5′-TGCACTAGTGGCCGGGCGCTCGACGT CATCGTCGACAT-3′, SEQ ID NO: 50) and BVIIdelEco (5′-TCGATATCGTGTCCTGCGGTTTCACC TGCAACGCTG-3′, SEQ ID NO: 51). Primer BVIIdelSpe contains a SpeI restriction site and primer BVIIdelEco contains an EcoRV restriction site. The PCR product was cloned into the SinaI restriction site of pUC19 in the orientation with SpeI positioned adjacent to KpnI and EcoRV positioned adjacent to xbaI. The plasinid pLSB 178 was isolated and confirmed using sequence analysis. Plasmid pLSB177 was digested with NdeI and SpeI, the ˜2.2 kb fragment was isolated and similarly plasmid pLSB178 was digested with NdeI and SpeI and the 4.6 kb fragment was isolated using standard methods. Both fragments were ligated and plasmid pLSB188 containing LHS and RHS combined together at a SpeI site in pUC19 was isolated using standard protocols. An NdeI/XbaI fragment (˜4.4 kbp) from pLSB188 was isolated and ligated with SpeI and NdeI treated pCJR24. The ligation was used to transform E. coli DH10B and plasmid pLSB189 was isolated using standard methods. Plasmid pLSB189 was used to transform S. erythraea P2338 and transformants were selected using thiostrepton. S. erythraea Del18 was isolated and inoculated into 6 ml TSB medium and grown for 2 days. A 5% inoculum was used to subculture this strain 3 times. 100 μof the final culture were used to plate onto R2T20 agar followed by incubation at 30° C. to allow sporulation. Spores were harvested, filtered, diluted and plated onto R2T20 agar using standard procedures. Colonies were replica plated onto R2T20 plates with and without addition of thiostrepton. Colonies that could no longer grow on thiostrepton were selected and further grown in TSB medium. S. erythraea 18A1 was isolated and confirmed using PCR and Southern blot analysis. The strain was designated LB-1 /BIOT-2634. For further analysis, the production of erythromycin was assessed as described in General Methods and the lack of erythromycin production was confirmed. In bioconversion assays this strain did not further process fed erythronolide B and erythromycin D was hydroxylated at C12 to give erythromycin C as expected, indicating that EryK was still functional.
Strain S. erythraea SGQ2pSG1448/27/91/4spnO5/2p4/193/6tylM-III was grown and bioconversions with fed tylactone were performed as described in the General Methods. The cultures were extracted and analysed. A compound consistent with the presence of angolosaminyl tylactone was detected. 20 mg of this compound were purified and the structure was confirmed by NMR analysis. A compound consistent with the presence of angolosaminyl tylactone was also obtained when the gene cassette pSG1448/27/91/4spnO5/2p4/193/6tylMII was expressed in the S. erythraea strain Q42/1 or S. erythraea 18A1.
Plasmid pSGLit35/2 (isolated from E. coli ET12567) was digested with XbaI and the insert fragment was isolated and ligated with the XbaI digested vector fragment of pSG1448/27/91/4spnO (pSG144angAIangAIIangMIIspnO). The ligation was used to transform E. coli DH10B and plasmid pSG1448/27/91/4spnOp5/2 (pSG144angAIangAIangMIIIspnOpangorf14) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.
Plasmid pSGLit24/19 (isolated from E. coli ET12567) was digested withXbaI and the insert fragment was isolated and ligated with the XbaI digested vector fragment of pSG1448/27/91/4spnCp5/2 (pSG144angAIangAIIangMIIspnOpangorf14). The ligation was used to transform E. coli DH10B and plasmid pSG1448/27/91/4spnOp5/24/19 (pSG144angaIangAIIangMIIIspnOpangorf194angB) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.
(pSG144angAIangAIIangMIIIspnOpangorf14angBangMI)
Plasmid pSGLit23/6 (isolated from E. coli ET12567) was digested with XbaI and the insert fragment was isolated and ligated with the xbaI digested vector fragment of pSG1448/27/91/4spnOp5/24/19 (pSG144angAIangAIIangMII-spnOpangorf14angB). The ligation was used to transform E. coil DH10B and plasmid pSG1448/27/91/4spnOp5/24/193/6 (pSG144angAIangAIfangMIIIspnOpangorf14angBangMI) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.
(pSG144angAIangAIIangMIIIspnOpangorf14angBangMIangMII)
Plasmid pSGLit1angMII (isolated from E. coli ET12567) was digested with XbaI/BglII and the insert fragment was isolated and ligated with the XbaI and partial BglII digested vector fragment of pSG1448/27/91/4spnOp5/24/193/6 (pSG144angAIangAIIangMIIIspnOpangorf14angBangMI). The ligation was used to transform E. coli DH10B and plasmid pSG1448/27/91/4spnOp5/24/193/6angMII (pSG144angAIangAIIangMIIIspnOpangorf14angBangMIangMII) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis. The plasmid was used to transform mutant strains of S. erytlraea with standard procedures.
(pSG144angAIangAIIangMIIIspnOpangorf14angBangMIangMII)
Biotransformation experiments feeding tylactone are carried out as described in General Methods and the cultures are analysed. Angolosaminyl tylactone is detected.
Plasmid pSG1448/27/9 (pSG144angAIangA14) was digested with XbaI and treated with alkaline phosphatase using standard protocols. The vector fragment was used for ligations with XbaI treated plasmid pSGLit26/4 no9 followed by transformations of E. coli DH10B using standard protocols. Plasmid pSGI448/27/96/4 (pSG144angalangAIIangorf4) was isolated using standard procedures and the construct was confirmed by restriction digests and sequence analysis.
Plasmid pSGLit35/2 (isolated from E. coli ET12567) was digested with XbaI and the insert fragment was isolated and ligated with the XbaI digested vector fragment of pSGI448/27/96/4 (pSG144angAIangAIIangorf4). The ligation was used to transform E. coli DH10B and plasmid pSG1448/27/96/4p5/2 (pSG144angAIangAIIangorf4pangorf14) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.
Plasmid pSGLit21/4 (isolated from E. coli ET12567) was digested with XbaI and the 1.4 kb fragment was isolated and ligated with the XbaI digested vector fragment of pSG1448/27/96/4p5/2 (pSG144angaIangAIIangorf4pangorf14). The ligation was used to transform E. coli DH10B and plasmid pSG1448/27/96/4p5/21/4 (pSG144angAIangAIIangorf4pangorf14angMIII) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.
Plasmid pSGLit24/19 (isolated from E. coli ET12567) was digested with XbaI and the 1.4 kb fragment was isolated and ligated with the XbaI digested vector fragment of pSG1448/27/96/4p5/21/4 (pSG144angAIangAIIangorf4pangorf14angMIII). The ligation was used to transform E. coli DH10B and plasmid pSG1448/27/96/4p5/21/44/19 (pSG144angAIangAIIangorf4pangorf14angMIIIangB) was isolated using standard protocols. The construct was verified with restriction digests and sequence analysis.
(pSG144a ngAIangAIIangorf4pangorf14angMIIIangBangMIangMII)
Plasmid pSG1448/27/91/4spnOp5/24/193/6angMI was digested with BglII and the about 2.2 kb fragment was isolated and used to ligate with the BglII treated vector fragment of SG1448/27/96/4p5/21/44/19. The ligation was used to transform E. coli DH10B using standard procedures and plasmid pSG1448/27/96/4p5/21/44/193/6angMII (pSG144angAIangAIIangorf4pangorf14angMIIIangBangMIangMII) was isolated. The construct was verified using restriction digests and sequence analysis. The plasmid was used to transform mutant strains of S. erythraea with standard protocols.
(pSG144angAIangAIIangorf4pangorf14angMIIIangBangMIangMII)
Biotransformation experiments feeding tylactone are carried out as described in General Methods and the cultures are analysed. Angolosaminyl tylactone is detected.
To amplify eryK primers eryK1 5′-GGTCTAGACTACGCCGACTGCCTCGGCGAGGAGCCC-3′ (SEQ ID NO: 52) and eryK2: 5′-GGCATATGTTCGCCGACGTGGAAACGACCTGCTGCG-3′ (SEQ ID NO: 53) were used and the PCR product was cloned as described for pUC19eryCVI. Plasmid pUC19eryK was isolated.
Plasmid pUC19eryK was digested with NdeI/XbaI and the insert band was ligated with NdeI/XbaI digested pCJR24. Plasmid pLSB111 (pCJR24eryK) was isolated and the construct was verified with restriction digests.
Plasmid pLSB111 (pCJR24eryK) was digested with NdeI/XbaI and the insert fragment was isolated and ligated with the NdeI/XbaI digested vector fragment of plasmid pSGLit2 and plasmid pLSB115 was isolated using standard protocols. The plasmid was verified using restriction digestion and DNA sequence analysis.
Plasmid pLSB115 from E. coli ET12567 was digested with XbaI and the insert fragment was isolated and ligated with the XbaI treated vector fragment of pSG1448/27/95/21/4 (pSG144angAIangAIIangorf14angMIII). The ligation was used to transform E. coli DH10B with standard procedures and plasmid pSG1448/27/95/21/4eryK (pSG144angAIangAIangorf14angMIIIeryK) is isolated. The construct is confirmed with restriction digests.
Plasmid pSGLit24/19 from E. coli ET12567 is digested with XbaI and the insert fragment is isolated and ligated with the xbaI treated vector fragment of plasmid pSG1448/27/95/21/4eryK. The ligation is used to transform E. coli DH10B with standard procedures and plasmid pSG1448/27/95/21/4eryK4/19 (pSG144angAIangtlIIangorf14angMIIIeryKangB) is isolated. The construct is confirmed with restriction digests.
Plasmid pSG1448/27/95/21/44/193/6eryCIII is digested with BglII and the about 2.1 kb fragment is isolated and ligated with the BglII treated vector fragment of pSG1448/27/95/21/4eryK4/19. Plasmid pSG1448/27/95/21/4eryK4/193/6eryCIII is isolated using standard procedures and the construct is confirined using restriction digests. The plasmid is used to transform mutant strains of S. erythraea with standard methods.
The S. erythraea strain Q4211pSG1448/27/95/21/4eryK4/193/6eryCIII is grown and bioconversions with fed 3-O-mycarosyl erythronolide B are performed as described in the General Methods. The cultures are analysed and a compound with m/z 750 is detected consistent with the presence of 5-O-dedesosaminyl-5-O-mycaminosyl erythromycin A.
Plasmid pLS025, (WO 03/033699) a pCJR24-based plasmid containing the DEBS1, DEBS2 and DEBS3 genes, in which the loading module of DEBS1 has been replaced by the loading module of the avermectin biosynthetic cluster, was used to transform S. erythraea JC2ΔeryCIII (isolated using techniques and plasmids described previously (Rowe et al., 1998; Gaisser et al., 2000)) using standard techniques. The transformant JC2ΔeryCIIIpLS025 was isolated and cultures were grown using standard protocols. Cultures of S. erythraea JC2ΔeryCIIIpLS025 are extracted using methods described in the General Methods section and the presence of 3-O-mycarosyl erythronolide B, 13-desethyl-13-methyl-3-O-mycarosyl erythronolide B, 13-desethyl-13-isopropyl-3-O-mycarosyl erythronolide B and 13-desethyl-13-secbutyl-3-O-mycarosyl erythronolide B in the crude extract is verified by LCMS analysis.
Production of 13-desetdyl-13-methyl-5-O-dedesosminyl-5-O-rnycaminosyl erythromycin A and B, 13- desetlyl-13-isopropyl-5-O-dedesosaininyl-5-O-mycaininosyl erythromnycin A and B, 13-desethyl-13- secbutyl-5-O-dedesosminyl-5-O-mycaminosyl erythromycin A and B
Cultures of S. erythraea JC2ΔeryCIIIpLS025 are extracted using methods described in the General Methods section and the crude extracts are dissolved in 5 ml of methanol and subsequently fed to culture supernatants of the S. erythraea strain SGQ2pSG1448/27/95/21/44/193/6eryCIII using standard techniques. The bioconversion of 13-desethyl-13-methyl-3-O-mycarosyl erythronolide B, 13-desethyl-13- isopropyl-3-O-mycarosyl erythronolide B and13-desethyl-13-secbutyl-3-O-mycarosyl erythronolide B to 13-desethyl-13-metlyl-5-O-dedesosaminyl-5-O-mycaminosyl erythromycin A and 13-desethyl-13-mnethyl-5-O-dedesosaminyl-5-O-mycaminosyl erythromycin B; 13-desethyl-13-isopropyl-5-O-dedesosaminyl-5-O-mycaminosyl erythromycin A and 13-desethyl-13-isopropyl-5-O-dedesosaminyl-5-O-mycaminosyl erythromycin B; 13-desethyl-13-secbutyl-5-O-dedesosaminyl-5-O-mycaminosyl erythrornycini A and 13-desethyl-13-secbutyl-5-O-dedesosaminyl-5-O-mycaminosyl erythromycin B is verified by LCMS analysis.
Plasmid pIB023 (Patent application no 0125043.0), a pCJR2-based plasmid containing the DEBS1, DEBS2 and DEBS3, was used to transform S. erythraea JC2ΔeryCIII using standard techniques. The transformant JC2ΔeryCIIIpIB023 was isolated and cultures were grown using standard protocols, extracted and the crude extract was assayed using methods described in the General Methods section. The production of 3-O-mycarosyl erythronolide B, and 13-desethyl-13-methyl-3-O-mycarosyl erythronolide B is verified by LCMS analysis.
Cultures of S. erythraea JC2ΔeryCIIIpIB023 are extracted using methods described in the General Methods section and the crude extracts are dissolved in 5 ml of methanol and subsequently fed to culture supernatants of S. erythraea SGQ2pSG1448/27/95/21/44/193/6eryCIII using standard techniques. The bioconversion of 13-desethyl-13-methyl-3-O-mycarosyl erythronolide B to 13-desethyl-13-methyl-5-O-dedesosaminyl-5-O-mycaminosyl erythromycin A and 13-desethyl-13-methyl-5-O-dedesosaminyl-5- O-mycaminosyl erythromycin B are verified by LCMS analysis.
Azithromycin aglycones were prepared using methods described in EP1024145A2 (Pfizer Products Inc. Groton, Connecticut). The S. erythraea strain SGT2pSG142 was isolated using techniques and plasmid constructs described earlier (Gaisser et al., 2000). Feeding experiments are carried out using methods described previously (Gaisser et al., 2000) with the S. erythraea mutant SGT2pSG142 thus converting azithromyciin aglycone to 3-O-mycarosyl azithronolide. Biotransformation experiments are carried out using S. erythraea SGQ2pSG1448/27/95/21/44/193/6eryCIII and crude extracts containing 3-O-mycarosyl azithronolide are added using standard microbiological techniques. The bioconversion of 3-O-mycarosyl azithronolide to 5-O-dedesosaminyl-5-O-mycaminosyl azithromycin is verified by LCMS analysis.
To create a chromosomal deletion in eryG, construct pSGAG3 was isolated as follows:
Fragment 1 was amplified using primers BIOSG53 5′-GGAATTCGGCCAGGACGCGTGGCTGGTCACCGGCT-3′ (SEQ ID NO: 54) and BIOSG54 5′-GGTCTAGAAAGAGCGTGAGCAGGCTCTTCTACAGCCAGGTCA-3′ (SEQ ID NO: 55) and genomic DNA of S. erythraea was used as template. Fragment 2 was amplified using primers
and genomic DNA of S. erythaea was used as template. Both DNA fragments were cloned into SinaI cut pUC19 using standard techniques, plasmids pUCPCR1 and pUCPCR2 were isolated and the sequence of the amplified fragments was verified. Plasmid pUCPCR1 was digested using EcoRI/XbaI and the insert band DNA was isolated and cloned into EcoRI/XbaI digested pUC19. Plasmid pSGAG1 is isolated using standard methods and digested with SphI/XbaI followed by a ligation with the SphI/XbaI digested insert fragment of pUCPCR2. Plasmid pSGAG2 is isolated using standard procedures, digested with SphI/HindIII and ligated with the SphI/HindIII fragment of pCJR24 (Rowe et al., 1998) containing the gene encoding for tlhiostrepton resistance. Plasmid pSGAG3 is isolated and used to delete eryG in the genome of S. erythraea strain SGQ2 using methods described previously (Gaisser et al., 1997; Gaisser et al., 1998) and the S. erythraea mutant SGP1 (SGQ2ΔeryG) is created.
Production of 5-O-dedesosaminyl-5-O-mycamninosyl erythromycin C
The S. erythraea strain SGP1 (S. eiythraea SGQ2ΔeryG) is isolated using standard techniques and consequently used to transform the cassette construct pSG1448/27/95/21/44/193/6eryCIII as formerly described. The S. erythraea strain SGPlpSG1448/27/95/21/44/193/6eryCIII is isolated and used for biotransformation as described in Example 2 and assays are carried out as described above to verify the conversion of 3-O-mycarosyl-erythronolide B to 5-O-dedesosaminyl-5-O-mycaminosyl erythromycin C by LCMS analysis.
(pSG144angAIangAIIangMIIIspnOpangorf14andBangMIangMII)
Biotransformation experiments feeding erythronolide B were carried out as described in General Methods and the cultures were analysed. Angolosaminylated erythronolide B was detected. About 30 mg of 3-O-angolosaminyl-erythronolide B were isolated and the structure was confirmed by NMR analysis.
1H and 13C NMR for the 3-angolosaminyl-erythronolide B in CDCl3
(pSG144angAIangAIIangorf4pangorf14angMIIIangBangMIangMII)
Biotransformation experiments feeding erythronolide B were carried out as described in General Methods and the cultures are analysed. Peaks characteristic for angolosaminylated erythronolide B were detected.
Ali, N., Herron, P. R., Evans, M. C. and Dyson, P. J. (2002) Osmotic regulation of the Streptomyces lividans thiostrepton-inducible promoter, ptipA. Microbiology 148: 381-390.
Bertram, G., Innes, S., Minella, O., Richardson, J. P. and Stanfield, I. (2001) Endless possibilities: translation termination and stop codon recognition. Microbiology 147: 255-269.
Bussiere, D. E. and Bastia, D. (1999) Termination of DNA replication of bacterial and plasmid chromosomes. Mol Microbiol 31: 1611-1618.
Bierman, M., Logan, R., O'Brien, K., Seno, E. T., Rao, R. N. and Schoner, B. E. (1992) Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene 116: 43-49.
Caffrey, P., Bevitt, D. J., Staunton, J. and Leadlay, P. F. (1992) Identification of DEBS1, DEBS 2 and DEBS 3, the multienzyme polypeptides of the erythromycin-producing polyketide synthase from Saccharopolyspora erythraea. FEBS 304: 225-228.
Doumith, M., Legrand, R., Lang, C., Salas, J. and Raynal, M. C. (1999) Interspecies complementation in Saccharopolyspora erythraea: Elucidation of the function of oleP1, oleG1 and oleG2 from the oleandomycin biosynthetic gene cluster of Streptomyces antibioticus and generation of new erythromnycin derivatives. Mol Microbiol 34:1039-1048.
Gaisser, S., Böhm, G. A., Cortés, J. and Leadlay, P. F. (1997) Analysis of seven genes from the eryAI-eryK region of the erythromycin biosynthetic gene cluster in Saccharopolyspora erythraea. Mol Gen Genet 256: 239-251.
Gaisser, S., Böhm, G. A., Doumith, M., Raynal, M. C., Dhillon, N., Cortés, J. and Leadlay, P. F. (1998) Analysis of eryBI, eryBIII and eryBVII from the erythromycin biosynthetic gene cluster in Saccharopolyspora erythraea. Mol Gen Genet 258: 78-88.
Gaisser, S., Reather, J., Wirtz, G., Kellenberger, L., Staunton, J. and Leadlay, P. F. (2000) A defined system for hybrid macrolide biosynthesis in Saccharopolyspora erythraea. Mol Microbiol 36: 391-401.
Gaisser, S., Martin, C. J., Wilkinson, B., Sheridan, R. M., Lill, R. E., Weston, A. J., Ready, S. J., Waldron, C., Crouse, G. D., Leadlay, P. F. and Staunton, J. (2002a) Engineered biosynthesis of novel spinosyns bearing altered deoxyhexose substituents. Chemn Commun 618-619.
Gaisser, S., Lill, R., Staunton, J., Mendez, C., Salas, J. and Leadlay, P F. (2002b) Parallel pathways for oxidation of 14-membered polyketide macrolactones in Saccharopolyspora erythraea. Mol Microbiol 44: 771-81.
Gates, P. J., Kearney, G. C., Jones, R., Leadlay, P. F. and Staunton, J. (1999) Structural elucidation studies of erythromycins by electrospray tandem mass spectrometry. Rapid Commun Mass Spectrom 13: 242-246.
Hansen, J. L., Ippolito, J. A., Ban, N., Nissen, P., Moore, P. B. and Steitz, T. A. (2002) The structures of four macrolide antibiotics bound to the large ribosomal subunit. Molecular Cell 10: 117-128.
Hu Y. and Walker S. (2002) Remarkable structural similarities between diverse glycosyltransferases. Chemistry and Biology 9: 1287-1296.
Ichinose, K., Ozawa M., Itou K., Kunieda K., and Ebizuka Y. (2003) Cloning, sequencing and heterologous expression of the medermycin biosynthetic gene cluster of Streptomyces sp AM-7161: towards comparative analysis of the benzoisochromanequinone gene cluster. Microbiology 149: 1633-1645.
Jones, P. H., Iyer, K. S. and Grundy, W. E. (1969) Chemical modifications of erythromycin antibiotics. II. Synthesis of 4′-hydroxyerythromycin A. Antimicrobial Agents Chemother 9: 123-130.
Kaneko, T., McArthur, H. and Sutcliffe, J. (2000) Recent developments in the area of macrolide antibiotics. Exp Opin Ther Patents 10: 1-23.
Kato, Y., Bai, L., Xue, Q., Revill, W. P., Yu, T. W. and Floss, H. G. (2002) Functional expression of genes involved in the biosynthesis of the novel polyketide chain extension unit, methoxymalonyl-acyl carrier protein, and engineered biosynthesis of 2-desmethyl-2-methoxy-6-deoxyerythronolide B. J. Am Chem Soc 124: 5268-5269.
Kieser, T., Bibb, M. J., Buttner, M. J., Chater, K. F., and Hopwood, D. A. (2000) Practical Streptomyces Genetics, John Innes Foundation, Norwich.
Kinumaki, A. and Suzuki, M. (1972) Proposed structure of angolamycin (shincomycin A) by mass spectrometry. J. Antibiotics 25: 480-482.
Lee, M. H., Pascopella, L., Jacobs, W. R. Jr, and Hatfull, G. F. (1991). Site specific integration of mycobacteriopliage L5: integration-proficient vectors for Mycobacterium smegmatis, Mycobacterium tuberculosis and Bacille Calmette-Guerin. Proc. Natl. Acad. Sci. USA, 88: 3111-3115.
Liu, H.-W. and Thorson, J. S. (1994) Pathways and mechanisms in the biogenesis of novel deoxysugars by bacteria. Annu Rev Microbiol 48: 223-56.
Madduri, K., Kennedi, J., Rivola, G., Inventi-Solari, A., Filippini, S., Zanoso, G., et al., (1998) Production of the antitumor drug epirubicin (4′-epidoxorubicin) and its precursor by a genetically engineered strain of Streptomyces peucetius. Nat Biotechnol 16: 69-74.
Matsuura, M., Noguchi, T., Yamaguchi, D., Aida, T., Asayama, M., Takahashi, H. and Shirai, M. (1996). The sre gene (ORF469) encodes a site-specific recombinase responsible for integration of the R4 phage genome. J Bact. 178: 3374-3376.
Méndez, C. and Salas, J. A. (2001) Altering the glycosylation pattern of bioactive compounds. Trends in Biotechnology 19: 449-456.
Pfoestl, A., Hofinger, A., Kosma, P., and Messner P. (2003) Biosynthesis of dTDP-3-acetamido-3,6-dideoxy-alpha-D-galactose in Aneurinibacillus thernioaerophilus L420-91T*. J Bio Chem 278:26410-26417.
Poulsen, S. M., Kofoed, C. and Vester, B. (2000) Inhibition of the ribosomal peptidyl transferease reaction by the mycarose moiety of the antibiotics carbomycin, spiramycin and tylosin. J Mol Biol 304: 471-481.
Rowe, C. J., Cortés, J., Gaisser, S., Staunton, J. and Leadlay, P. F. (1998) Construction of new vectors for high-level expression in actinomycetes. Gene 216: 215-223.
Salah-Bey, K., Blanc, V. and Thompson, C. J. (1995) Stress-activated expression of a Streptomyces pristinaespiralis multidrug resistance gene (ptr) in various Streptomyces spp. and Escherichia coli. Molecular Microbiology 17: 1001-1012.
Salah-Bey, K., Doumith, M., Michel, J. M., Haydock, S., Cortés, J., Leadlay, P. F. and Raynal, M. C. (1998) Targeted gene inactivation for the elucidation of the deoxysugar biosynthesis in the erythromycin producer Saccharopolyspora erythraea. Mol Gen Genet 257: 542-553.
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989) Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, N.Y.
Schliünzen, F., Zarivach, R., Harms, J., Bashan, A., Tocilj, A., Albrecht, R., Yonath, A. and Franceschi, F. (2001) Structural basis for the interaction of antibiotics with the peptidyl transferase centre in eubacteria. Nature 413: 814-821.
Solenberg, P. J., Matsushima, P., Stack, D. R., Wilkie, S. C., Thompson, R. C. and Baltz, R. H. (1997) Production of hybrid glycopeptide antibiotics in vitro and in Streptomnyces toyocaensis. Chem Biol 4: 195-202.
Smovkina, T., Mazodier, P., Boccard, F., Thompson, C. J. and Guerineau, M. (1990) Construction of a series of pSAM2-based integrative vectors for use in actinomycetes. Gene 94: 53-59.
Spagnoli, R., Cappelletti, L. and Toscano, L. (1983) Biological conversion of erythronolide B, an intermediate of erythromycin biogenesis, into “hybrid” macrolide antibiotics. J Antibiot 36: 365-375.
Staunton, J. and B. Wilkinson (1997). Biosynthesis of erythromycin and rapamycin. Chem Rev 97: 2611-2629.
Summers, R. G., Donadio, S., Staver, M. J., Wendt-Pienkowski, E., Hutchinson, C. R. and Katz, L. (1997) Sequencing and mutagenesis of genes from the erythromycin biosynthetic gene cluster of Saccharopolyspora erythraea that are involved in L-mycarose and D-desosamine production. Microbiol 143: 3251-3262.
Tang, L. and McDaniel, R. (2001) Construction of desosamine containing polyketide libraries using a glycosyltransferase with broad substrate specificity. Chemistry and Biology 8: 547-555.
Trefzer, A., Salas, J. A. and Bechthold, A. (1999) Genes and enzymes involved in deoxysugar biosynthesis in bacteria. Nat Prod Rep 16: 283-299.
Van Mellaert, L., Mei, L., Lammertyn, E., Schacht, S., and Anne, J. (1998) Site-specific integration of bacteriophage VWB genome into Streptomyces venezuelae and construction of a VWB-based integrative vector. Microbiology 144: 3351-3358.
Wohlert, S. E., Blanco, G., Lombo, F., Fernandez, E., Brana, A. F., Reich, S., Udvarnoki, G., et al., (1998) Novel hybrid tetracenomycins through combinatorial biosynthesis using a glycosyltransferase encoded by the elm genes in cosmid 16F4 and which shows a broad sugar substrate specificity. J Am Chem Soc 120: 10596-10601.
Wohlert, S.E., Lomovskaya, N., Kulowski, K., Fonstein, L., Occi, J. L., Gewain, K. M., MacNeil, D. J. and Hutchinson, C. R. (2001) Insights about the biosynthesis of the avermectin deoxysugar L-oleandrose through heterologous expression of Streptomyces avermitilis deoxysugar genes in Streptomyces lividans. Chemistry & Biology 8: 681-700.
Zhao, L., Ahlert, J., Xue, Y., Thorson J.S., Sherman, D. H. and Liu, H-W. (1999) Engineering a methymycin/pikroinycin-calicheamicin hybrid: Construction of two new macrolides carrying a designed sugar moiety. J Am Chem Soc 121: 9881-9882.
Zhao, L., Que, N. L. S, Xue, Y., Sherman, D. H. and Liu, H. W. (1998a) Mechanistic studies of desosamine biosynthesis: C-4 deoxygenation precedes C-3 transamination. J Am Chem Soc 120: 12159-10160.
Zhao, L., Sherman, D. H. and Liu, H. W. (1998b) Biosynthesis of desosamine: Construction of a new methymycin/neomethymycin analogue by deletion of a desosamine biosynthetic gene. J Am Chem Soc 120: 10256-10257.
Number | Date | Country | Kind |
---|---|---|---|
0327721.7 | Nov 2003 | GB | national |
Filing Document | Filing Date | Country | Kind | 371c Date |
---|---|---|---|---|
PCT/GB04/05001 | 11/29/2004 | WO | 00 | 6/11/2007 |