Polypeptide having cold-stable pyruvate, orthophoshate dikinase activity, DNA encoding the same and recombinant vector and transformed plants containing the DNA

TECHNICAL FIELD
The present invention relates to a novel polypeptide having cold-stable pyruvate, orthophosphate dikinase (hereinafter also referred to as "PPDK") activity, a cloned DNA encoding the same and a recombinant vector containing the DNA, as means for giving cold-stability to plants. The present invention also relates to plants transformed with the DNA according to the present invention.
BACKGROUND ART
C.sub.4 plants have high abilities of photosynthesis under the conditions of strong light, high temperature or low CO.sub.2. However, their photosynthesis abilities are largely reduced under low temperature except for those which are adapted to low temperature conditions. Although PPDK (EC 2.7.9.1, that catalyzes the reaction in which AMP, phosphoenol pyruvate and pyrophosphate are produced from ATP, pyruvate and orthophosphate) is one of the important enzymes in C.sub.4 path, its activity is not sufficient with respect to the photosynthesis rate in leaf tissue, so that it is one of the enzymes which determine the rate of CO.sub.2 fixation in C.sub.4 photosynthesis. Further, it has been pointed out simultaneously with the discovery of this enzyme that this enzyme is cold-sensitive. In case of maize PPDK, the enzyme activity has a point of inflection at 11.7.degree. C. This temperature is coincident with the limit temperature of growth of maize. From these, it is thought that PPDK is one of the causes which reduce the photosynthesis rate of C.sub.4 plants at low temperature. Therefore, by improving the cold-sensitivity of PPDK, the limit temperature of growth of maize may be lowered. Flaveria brownii which is a plant belonging to the family Compositae is classified into C.sub.3 /C.sub.4 intermediate type, and it is known that its PPDK is not substantially inactivated by low temperature treatment at 0.degree. C. (Burnell JN: A comparative study of the cold-sensitivity of pyruvate, Pi dikinase in Flaveria species. Plant Cell Physiol. 31, 295-297 (1990)).
By cloning the gene encoding the cold-stable PPDK of Flaveria brownii, and by transforming a plant with the gene, it is expected that resistance to coldness can be given to the plant.
DISCLOSURE OF THE INVENTION
Accordingly, an object of the present invention is to provide a novel polypeptide having cold-stable PPDK activity, a cloned DNA encoding the same and a recombinant vector containing the DNA, as means for giving cold-stability to plants. Another object of the present invention is to provide a plant transformed with the above-mentioned DNA according to the present invention.
The present inventors intensively studied to succeed in cloning the complete PPDK gene of Flaveria brownii, determining the nucleotide sequence of the gene and the amino acid sequence encoded thereby, and in identifying the region in the PPDK gene, which gives cold-stability, thereby completing the present invention.
That is, the present invention provides a polypeptide having cold-stable PPDK activity, which has an amino acid sequence that is the same as the amino acid sequence of 1/6 region of the entire region from the C-terminal of the following polypeptide (1) or (2), except that at least one amino acid residues of said 1/6 region are substituted with other amino acid residues:
(1) a PPDK having an amino acid sequence shown in SEQ ID NO. 1 to 4 in Sequence Listing; and
(2) a polypeptide having an amino acid sequence which has a homology of not less than 50% with the amino acid sequence mentioned in (1), said polypeptide having cold-stable PPDK activity.
The present invention also provides a cloned DNA encoding the polypeptide having cold-stable PPDK activity according to the present invention. The present invention further provides a recombinant vector containing the DNA according to the present invention, which can express in a host a polypeptide having cold-stable PPDK activity. The present invention still further provides a plant which is transformed with the DNA according to the present invention.
By the present invention, a gene encoding PPDK having cold-stability was cloned and sequenced. Further, the region in the gene, which gives cold-stability was also identified. Therefore, by transforming a plant having cold-sensitive PPDK with the gene according to the present invention, the cold-sensitive PPDK may be changed to cold-stable PPDK. Further, by incorporating the above-mentioned cold-stability-giving region into the corresponding region of a cold-sensitive PPDK, the cold-sensitive PPDK may be changed to cold-stable PPDK. By this, the plant can be cultivated at a cold area in which the plant could not be hitherto cultivated. Therefore, it is expected that the present invention will much contribute to agriculture.

BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 schematically shows a construction method of an expression vector containing an example of the PPDK gene according to the present invention;
FIG. 2 shows the change in enzyme activity with time when PPDKs of Flaveria brownii, Flaveria bidentis and maize, which were expressed in Escherichia coli, were kept at 0.degree. C.; and
FIG. 3 schematically shows a construction method of an expression vector containing an example of the PPDK gene according to the present invention.

BEST MODE FOR CARRYING OUT THE INVENTION
By the present invention, the gene of PPDK having cold-stability of Flaveria brownii was cloned and its nucleotide sequence and the deduced amino acid sequence encoded thereby were determined. The nucleotide sequence and the amino acid sequence are shown in SEQ ID NOS. 9-10 in Sequence Listing. As described in detail in the following examples, this sequence was determined by extracting the total RNAs from leaves of Flaveria brownii; preparing a cDNA library according to a conventional method; carrying out plaque hybridization method using a probe prepared by referring to the region of PPDK gene of Flaveria bidentis and the region of PPDK gene of maize, which regions have high homology; selecting and cloning positive clones; and sequencing the gene by dideoxy method. The sequence has high homology with the PPDK gene of Flaveria bidentis belonging to the same genus, and has a relatively high homology with the maize PPDK gene. Further, the sequences of the N-terminal region, C-terminal region and internal regions of the deduced amino acid sequence are completely the same as the corresponding sequences of the PPDK of Flaveria brownii directly purified from green leaves of this plant. Therefore, it is apparent that the cloned gene is the PPDK gene of Flaveria brownii. The PPDK gene of Flaveria bidentis was sequenced by carrying out plaque hybridization using maize cDNA as the probe; cloning the positive clones; and sequencing the gene by dideoxy method.
The amino acid sequence shown in SEQ ID NOS. 9 and 10 is novel and 40 amino acid residues thereof are different from the amino acid sequence of the PPDK of Flaveria bidentis belonging to the same genus. About 180 amino acid residues thereof are different from the amino acid sequence of the maize PPDK. Thus, in spite of the fact that the amino acid sequence of PPDK of Flaveria brownii shown in SEQ. ID NOS. 9 and 10 has a high homology with the amino acid sequence of the PPDK of Flaveria bidentis belonging to the same genus, the PPDK of Flaveria bidentis is cold-sensitive while that of Flaveria brownii is cold-stable. Thus, the small difference in amino acid residues brings about the important difference of the character. The present invention provides a cloned PPDK gene encoding the amino acid sequence shown in SEQ ID NOS. 9 and 10. As mentioned above, this amino acid sequence is novel and has a prominent effect that it has cold-stability. The gene according to the present invention is not restricted to that having the nucleotide sequence shown in SEQ ID NO. 9, but any nucleotide sequence which encodes this amino acid sequence is within the scope of the gene according to the present invention.
The present inventors tried to identify the region in the PPDK gene of Flaveria brownii shown in SEQ ID NO. 9, which region gives cold-stability. That is, as described in detail in the following examples, the PPDK gene of Flaveria brownii was divided into three regions having about the same size by restriction enzymes; each of the regions was exchanged with the corresponding region of maize PPDK gene to form chimeric PPDK genes; and whether the PPDKs encoded by the obtained chimeric genes have cold-stability or not was determined. As a result, it was confirmed that the region giving cold-stability exists in the last 1/3 region of the PPDK gene of Flaveria brownii. Further, this last 1/3 region was divided by a restriction enzyme into two regions having about the same size, and which region contains the region giving cold-stability was determined by the similar method. As a result, it was confirmed that the function to give cold-stability is encoded in the region downstream of the Xho I site of the PPDK gene of Flaveria brownii shown in SEQ ID NO. 9. That is, it was confirmed that the function to give cold-stability is located within the amino acid sequence between the 832nd amino acid residue, arginine, and the 955th amino acid residue, valine, of the amino acid sequence shown in SEQ ID NOS. 9 and 10 (the amino acid sequence from the 832nd amino acid residue to the 955th amino acid residue may be hereinafter referred to as "cold-stability-giving sequence").
That is, it was proved that the region relating to cold-stability of PPDK is located in the 1/6 region of the entire region from the C-terminal. On the other hand, in SEQ ID NOS. 1 and 2 in Sequence Listing, the nucleotide sequence of the gene encoding PPDK of Flaveria bidentis and deduced amino acid sequence encoded thereby are shown, and in SEQ ID NOS. 3 and 4, the nucleotide sequence of the gene encoding PPDK of maize and deduced amino acid sequence encoded thereby are shown (Journal of Biochemistry 263, 11080-11083 (1988)). In SEQ ID NOS. 5 and 6, the nucleotide sequence of the gene encoding PPDK of Bacteroides symbiosus which is a bacterium, and deduced amino acid sequence encoded thereby are shown (Biochemistry 29, 10757-10765 (1990)). In SEQ ID NOS. 7 and 8, the nucleotide sequence of the gene encoding PPDK of Entamoeba histolytica which is a bacterium, and deduced amino acid sequence encoded thereby are shown (Molecular and Biochemical Parasitology 62, 153-156 (1993)). As described above, it was proved by the present invention that the region relating to cold-stability of PPDK is located in the 1/6 region of the entire region from the C-terminal, it is possible to obtain cold-stable PPDK by substituting at least one amino acid residue in the 1/6 region of the entire region from the C-terminal of the amino acid sequence shown in SEQ ID NOS. 1-2, 3-4, 5-6 or 7-8. Here, the term "cold-stable" means that activity of the enzyme after leaving the enzyme to stand at 0.degree. C. for 20 minutes is not less than 60% of the original activity.
As mentioned above, since the region from the 832nd amino acid residue, arginine, to the 955th amino acid residue, valine, in the amino acid sequence shown in SEQ ID NOS. 9 and 10 defines cold-stability, the cold-sensitive PPDKs having the amino acid sequence shown in SEQ ID NOS. 1-8 can be converted to cold-stable PPDKs by substituting the corresponding regions of the cold-sensitive PPDKs with the amino acid sequence from the 832nd amino acid residue, arginine, to the 955th amino acid residue, valine, of the amino acid sequence shown in SEQ ID NOS. 9 and 10. This finding is very important because by utilizing this, any desired cold-sensitive PPDK can be converted to a cold-stable PPDK. The method of giving cold-stability to a PPDK is not restricted to the method as described in the examples below, in which the cold-stability-giving sequence of PPDK of Flaveria brownii is exchanged with the corresponding region of a cold-sensitive PPDK to prepare a chimeric gene, but the cold-stability may be given by changing the corresponding region of a cold-sensitive PPDK of a plant to the same sequence as the cold-stability-giving sequence of Flaveria brownii by site-directed mutagenesis. Therefore, any DNA which encodes a polypeptide having PPDK activity, which contains the above-described cold-stability-giving sequence is within the scope of the present invention. In particular, the PPDK in which the 869th amino acid residue in the amino acid sequence shown in SEQ ID NOS 1 and 2 is substituted by proline, and the PPDK in which the 885th and 952nd amino acid residues in the amino acid sequence shown in SEQ ID NOS. 1 and 2 are substituted by leucine and valine, respectively, have cold-stability.
The PPDKs to which cold-stability is to be given are not restricted to those shown in SEQ ID NOs. 1-8, but may be those having not less than 50% of homologies to the sequences shown in SEQ ID NOs. 1-8. Preferably, the nucleotide sequence of the gene encoding a PPDK to which cold-stability is to be given has a homology to the PPDK gene of Flaveria brownii in an amount of not less than 48.5%, more preferably, not less than 90%.
It is well-known in the art that there are cases wherein the physiological activity of a physiologically active peptide is retained even if the amino acid sequence of the peptide is modified to a small extent, that is, even if one or more amino acids in the amino acid sequence are substituted or deleted, or even if one or more amino acids are added to the amino acid sequence. Therefore, polypeptides having the same amino acid sequence as shown in SEQ ID NOS. 9 and 10 except that the polypeptides have such modifications, which have cold-stable PPDK activity, are included within the scope of the present invention. That is, the polypeptides having the same amino acid sequence as shown in SEQ ID NOS 9 and 10 except that one or more amino acids are added, deleted or substituted, which have cold-stable PPDK activity, are included within the scope of the present invention. Similarly, DNAs having the same nucleotide sequence as shown in SEQ ID NOS. 9 and 10 except that one or more nucleotides are added, deleted or substituted, which encode polypeptides having cold-stable PPDK activity, are also within the scope of the present invention.
Modification of DNA which brings about addition, deletion or substitution of the amino acid sequence encoded thereby can be attained by the site-specific mutagenesis which is well-known in the art (e.g., Nucleic Acid Research, Vol. 10, No. 20, p6487-6500, 1982). In the present specification, "one or more amino acids" means the number of amino acids which can be added, deleted or substituted by the site-specific mutagenesis.
Site-specific mutagenesis may be carried out by, for example, using a synthetic oligonucleotide primer complementary to a single-stranded phage DNA except that the desired mutation as follows. That is, using the above-mentioned synthetic oligonucleotide as a primer, a complementary chain is produced by a phage, and host bacterial cells are transformed with the obtained double-stranded DNA. The culture of the transformed bacterial cells is plated on agar and plaques are formed from a single cell containing the phage. Theoretically, 50% of the new colonies contain the phage having a single-stranded chain carrying the mutation and remaining 50% of the colonies contain the phage having the original sequence. The obtained plaques are then subjected to hybridization with a kinase-treated synthetic probe at a temperature at which the probe is hybridized with the DNA having exactly the same sequence as the DNA having the desired mutation but not with the original DNA sequence that is not completely complementary with the probe. Then the plaques in which the hybridization was observed are picked up, cultured and the DNA is collected.
In addition to the above-mentioned site-specific mutagenesis, the methods for substituting, deleting or adding one or more amino acids without losing the enzyme activity include a method in which the gene is treated with a mutagen and a method in which the gene is selectively cleaved, a selected nucleotide is removed, added or substituted and then the gene is ligated.
By transforming a plant with PPDK gene of Flaveria brownii or with a DNA encoding a polypeptide containing the cold-stability-giving sequence, which has PPDK activity, a cold-resistant plant can be obtained. Preferred examples of the plants to be transformed include maize, sugar cane, millet, barnyard grass and sorghum, although not restricted thereto.
Methods for transforming plants have already been established and the method utilizing Agrobacterium tumefaciens may preferably be employed. The method for transforming plants utilizing Agrobacterium tumefaciens is well-known in the art. By this method, both dicotyledons (e.g., Japanese Laid-open Patent Application (Kokai) No. 4-330234) and monocotyledons (WO 94/00977) can be transformed. Alternatively, the DNA may be introduced into plant protoplasts by electroporation method or the like well-known in the art. Further, transformation may also be carried out by attaching the DNA to tungsten particles and the like and implanting the particles in embryos of a plant. Concrete methods of these transformation methods are described in the examples hereinbelow described.
EXAMPLES
The present invention will now be described more concretely by way of examples thereof. However, the present invention is not restricted to the examples below.
1. Cloning and Sequencing of PPDK Gene of Flaveria brownii
(1) Preparation of cDNA Library and Cloning of Full-length cDNA
(i) Preparation of cDNA Library
From green leaves (60 g) of F. brownii, total RNAs were isolated by the guanidine hydrochloride/phenol method. By this method, 26.5 mg of RNA after lithium precipitation was obtained. Then 118.9 .mu.g of poly(A) .sup.+ RNA was obtained from 13.2 mg of the RNA according to a conventional method using a column containing Oligo dT cellulose Type 7 (commercially available from PHARMACIA). For the preparation of the cDNA library, TimeSaver cDNA Synthesis kit (commercially available from PHARMACIA), Lambda ZAPII vector (commercially available from STRATAGENE) and the packaging reagent attached to cDNA cloning system .lambda.gt10 (commercially available from AMERSHAM) were used. Using an EcoRI/NotI linker, a cDNA library in which DNA fragments are inserted into the EcoRI site of Lambda ZAPII vectors was prepared. The size of the prepared cDNA library was 415,000 pfu. As the host cells, XL1-Blue cells were used.
(ii) Preparation of Probe
Using a primer having the sequence of 5":GACGGCTAAAAAGAGGGT (SEQ ID NO. 12) (designed based on the regions of PPDK of Flaveria bidentis and of maize PPDK, which have a high homology) and a R primer having the sequence of TATCGAGAAACCTTCTATAC (SEQ ID NO. 13) (a part of the sequence of PPDK of Flaveria bidentis , complementary chain), a DNA fragment originated from RNA of F. brownii was amplified by reverse transcription PCR, and the amplified DNA fragment was inserted in pCRII vector (commercially available from INVITROGEN). Using the obtained vector as a template, and using the same primers as mentioned above, the DNA was amplified and the PCR product was subjected to electrophoresis, followed by recovering the DNA from the gel by using SUPREC-01 (commercially available from TAKARA SHUZO). By this process, a DNA fragment having a size of 428 bp starting from the 24th bp downstream of the N-terminal of the mature protein can be obtained. This fragment was labelled with .sup.32 P using Multiprime DNA labelling system (commercially available from AMERSHAM) to prepare a probe.
(iii) Cloning of Full-length cDNA of Flaveria brownii
The cDNA library was screened by the plaque hybridization method using the above-mentioned DNA fragment as a probe. As the hybridization filter, Hybond N.sup.+ (AMERSHAM) was used, and the hybridization was carried out in 6.times.SSC containing 5.times.Denhalt's solution, 0.1% SDS and 100 .mu.g/ml of denatured salmon testis DNA at 65.degree. C. overnight. Washing was performed with 2.times.SSC containing 0.1% SDS at room temperature for 5 minutes; with 2.times.SSC containing 0.1% SDS at room temperature for 90 minutes; and 1.times.SSC containing 0.1% SDS at 68.degree. C. for 90 minutes. By this, 28 independent positive clones were obtained. From these, 11 plaques which showed strong signals were selected and subjected to second screening. The second screening was carried out in the same manner as in the first screening except that the time of the second washing was 60 minutes. As a result, independent positive plaques originated from a single phage were obtained from 6 clones. To check the sizes of the inserted DNA fragments, PCR was carried out using the above-described R primer, M13PrimerM4 (GTTTTCCCAGTCACGAC, (SEQ ID NO. 13) commercially available from TAKARA SHUZO) and M13PrimerRV (CAGGAAACAGCTATGAC, (SEQ ID NO. 14) TAKARA SHUZO) as primers and using the phage as a template. As a result, 2 clones contained the full-length cDNA. Thereafter, by in vivo excision, the inserted DNA fragments were subcloned into a plasmid vector pBluescriptIISK(-) (commercially available from STRATAGENE). The recombinant plasmids obtained by the subcloning were named p411 and p631.
It was found by the above-described PCR that the library prepared as described above was a library containing sufficiently long inserts, which was suited for cDNA screening. Thus, for the isolation of mRNAs of Flaveria brownii, it is advantageous to employ the above-described method and to obtain a large amount of mRNAs at once by treating a large amount of RNAs as described above.
Further, since the above-described cDNA library contains a number of inserts which are sufficiently long, screening of the full-length cDNA was able to be performed easily by preparing a probe prepared by using a primer which hybridizes with a region in the vicinity of the processing region of the desired protein.
(2) Determination of Total Nucleotide Sequence of cDNA and Comparison of Deduced Amino Acid Sequence
To determine the total nucleotide sequence of the inserted cDNA fragment of p631, deletion mutants were prepared. The deletion mutants were prepared by using Deletion Kit for Kilo-Sequence (commercially available from TAKARA SHUZO). However, the reaction by exonuclease III was stopped by transferring the reaction mixture to Mung Bean Nuclease buffer kept at 65.degree. C. Determination of the nucleotide sequence was carried out using a plasmid purified by using Qiagen Plasmid Mini Kit (commercially available from Diagen), Taq DyeDeoxy Terminator Cycle Sequencing Kit (commercially available from ABI) and Applied Biosystems 373A DNA Sequencer (ABI). Both chains were sequenced except for some parts thereof. Based on the determined nucleotide sequence, amino acid sequence was determined. The determined nucleotide sequence and the amino acid sequence are shown in SEQ ID NO. 5 in the Sequence Listing.
It should be noted that in the preparation of the deletion clones for sequencing the isolated cDNA, it was important to preliminarily heat the Mung Bean Nuclease Buffer at 65.degree. C. because the reaction could not be stopped by merely transferring the reaction mixture to the Mung Bean Nuclease Buffer. Further, since the sequence at the region up to about 600-900 bp from the boarder between the vector and the insert could not be determined by deleting the insert from the upstream end alone, it was necessary to carry out the deletion from both ends.
On the other hand, PPDK was purified directly from Flaveria brownii and the amino acid sequences of its N-terminal region, C-terminal region and internal regions were determined. The PPDK was purified as follows. That is, green leaves were ground in triple volume of extraction buffer. After centrifugation, ammonium sulfate was added to the supernatant to 30% saturation and precipitated proteins were removed. Ammonium sulfate was further added to 70% saturation and precipitated proteins were recovered. The recovered proteins were applied to Sephadex G25 (commercially available from PHARMACIA) to remove salts. The resultant was applied to DEAE-Sepharose column (PHARMACIA) and the proteins adsorbed to the column were eluted by KCl having a gradient of 50-400 mM. Fractions having PPDK activity were combined and concentrated by ammonium sulfate of 70% saturation, followed by desalination by Sephadex G25. The resultant was then applied to a hydroxyapatite column. The adsorbed proteins were eluted by phosphate buffer having a gradient of phosphate from 10 mM to 40 mM. Fractions having PPDK activity were combined and concentrated by ammonium sulfate of 70% saturation, followed by desalination by Sephadex G25. The resultant was subjected to SDS-PAGE and the band of PPDK was cut out. Protein was recovered from the gel by electroelution. By this process, purified PPDK sample was obtained in an amount of about 5-10 nmol. The purified PPDK thus obtained showed a single band in SDS-PAGE.
Then the amino acid sequences of N-terminal region, C-terminal region and internal regions of the thus obtained purified PPDK were determined. That is, the amino acid sequence of the N-terminal region was determined by transferring the protein on a PVDF membrane and then determining the sequence using a gas phase amino acid sequencer. The amino acid sequence of the C-terminal region was determined by digesting the purified PPDK with carboxypeptidase Y and estimating the amino acid sequence based on the relationship between the composition of the liberated amino acids and the digestion time. The amino acid sequences of the internal regions were determined by determining the amino acid sequence from the N-terminal of peptides generated by digesting the protein with a protease. The details of this method are as follows. Firstly, as in the case of determining the amino acid sequence of the N-terminal region, PPDK from green leaves of Flaveria brownii was partially purified and subjected to an ordinary SDS-PAGE. The gel was stained with Coomasssie Brilliant Blue R250 and the band of PPDK was cut out. The cut out gel was equilibrated in an equilibrating buffer (Tris-HCl pH6.8, 125 mM, EDTA 1 mM, 0.1% SDS) and inserted in a well, followed by second SDS-PAGE. Here, an overlaying solution (Tris-HCl pH6.8, 125 mM, EDTA 1 mM, 0.1% SDS, 0.01% BPB, 20% glycerol) and an enzyme solution (Tris-HCl pH6.8, 125 mM, EDTA 1 mM, 0.1% SDS, 0.01% BPB, 10% glycerol, lysyl endopeptidase 1-15 .mu.g or V8 protease 0.01-0.1 .mu.g) were added together with the equilibrated gel. After carrying out electrophoresis for a while, digestion of the protein was carried out in the concentrated gel (the electric power was turned off and the gel was left to stand for 45 minutes). Then electrophoresis was restarted and the resultant was transferred to a PVDF membrane in the same manner as in the determination of the N-terminal sequence, and the amino acid sequences of the fragments obtained by the digestion were determined from the N-terminals thereof using the gas phase amino acid sequencer.
The determined sequences of N-terminal region, C-terminal region and internal regions are as follows:
N-terminal Sequence: Asn Pro Val Ser Pro Pro Val (72-78)
C-terminal Sequence: Leu - Ala Ala * - Val Val (948-955)
Internal Sequence (1): Lys Leu Tyr Glu Phe Leu Val Asn Ala Gln Gly - Aspp Val Val Ala, (349-365)
Internal Sequence (2): Gln Leu Leu Ala Pro Pro Ala Met Ser, Asn Ala Leu - Thr (592-605)
Internal Sequence (3): Leu Thr Ala Asp Thr Gly Met Ser Lys, Asp Glu Ile Tyr Ser Arg Ile Glu (721-738)
Internal Sequence (4): Ala - - - Ser Phe Gly Thr
Asn Asp Leu Cys Gln Met Val Phe Gly - Ser (844-862)
In the above-described amino acid sequences, "*" means glutamine but could not be analyzed by the analyzer used, and "-" means that the result of the analysis was unclear. The numbers in the parentheses indicate the amino acid number of the corresponding region in the amino acid sequence shown in SEQ ID NOS 9 and 10. Although parts of the Internal Sequences (2) and (4) are different from the amino acid sequence shown in SEQ ID NOS. 9 and 10, it is thought that this is due to errors of the amino acid sequencer. As is well-known, errors are caused by amino acid sequencers at considerable frequency while errors are not substantially caused by DNA sequencers.
Since the amino acid sequence shown in SEQ ID NOS. 9 and 10 well corresponds with the partial amino acid sequences directly determined in the above-described purified PPDK, it was confirmed that the amino acid sequence shown in SEQ ID NOS. 9 and 10 is the amino acid sequence of PPDK. The amino acid sequence shown in SEQ ID NOS. 9 and 10 was compared with the amino acid sequences of known PPDKs of Flaveria bidentis and maize. As a result, 40 amino acid residues (Flaveria bidentis) and about 180 amino acid residues (maize) were different, respectively, in the mature protein region. Further, from the above-described results, it is thought that in the amino acid sequence shown in SEQ ID NOS. 9 and 10, the amino acid sequence from 1st to 71st amino acid residue does not exist in the mature protein but a transit peptide necessary for passing through membranes, which is processed after passing through membranes. Differences between the amino acid sequences of mature proteins of Flaveria brownii and Flaveria bidentis are shown in Table 1 below.
TABLE 1______________________________________Amino Acid Numbers and AminoAcids Which are Differentbrownii bidentis______________________________________5 Phe 6 Ser10 Pro 11 Leu15 Asn 16 Arg28 Thr 29 Asn40 Pro 41 Ser41 Ala 42 Ser48 Arg 47 Leu49 Arg 48 Thr50 Lys 49 Pro52 Ser 50 Ala57 Ile 55 Pro61 Thr 59 Ser62 Gly 60 Ser66 Leu 64 Pro81 Thr 79 Ala92 Asn 90 Arg97 Lys 95 Arg114 Ala 112 Ser146 Lys 138 Ser150 Leu 148 Ser154 Gln 152 Asp170 Ala 168 Pro201 Asp 199 Ala205 Ala 203 Gly263 Ala 261 Val265 Gln 263 Lys323 Cys 321 Ser356 Val 354 Ile374 Val 372 Gly382 Glu 380 Asp385 Arg 383 Lys392 Val 390 Glu396 Arg 394 Gly465 Asn 463 Asp490 Val 488 Cys564 Val 562 Ile583 Ser 581 Thr605 Thr 603 Ile672 Ala 670 Val723 Thr 721 Ala724 Ala 722 Val730 Lys 728 Ala736 Arg 734 Lys739 Lys 737 Asn777 Asn 775 Thr803 Gly 801 Ser818 Leu 816 Val838 Asp 836 Glu841 Ala 839 Gly845 Glu 843 Asp871 Pro 869 Gln875 Ser 873 Ala887 Leu 885 Ile954 Val 952 Ile______________________________________
2. Production of PPDK of Flaveria brownii in E. coli and Measurement of Cold-stability
To confirm that a cold-stable enzyme is actually produced from the cDNA of PPDK of Flaveria brownii isolated as described above, expression in E. coli was carried out as follows:
To remove the transit peptide and to ligate the DNA to an expression vector so that the reading frames are coincident, restriction sites were introduced as follows: That is, p631 was digested with SacI and recyclized to obtain p631Sac (a plasmid same as p631 except that downstream region of SacI site is deleted). PCR was performed using p631Sac as a template and using primer 4: GATATCAATCCGGTGTCTCCTCC (SEQ ID NO. 15) containing EcoRV site, prepared based on the sequence in the vicinity of the processing region and primer M13 RV (commercially available from TAKARA SHUZO) complementary to the sequence of the vector, and the amplified fragment was subcloned into pCR II. A fragment containing the N-terminal region was cut out using restriction enzymes EcoRV and SacI. Three DNA fragments, that is, the thus cut out DNA fragment, the SacI-HindIII fragment from p631 (containing the remaining region of cDNA of PPDK) and a fragment obtained by digesting pKK233-2 with NcoI, blunting the ends with Klenow fragment and then digesting the resultant with HindIII, were ligated (FIG. 1). E. coli MV1184 was transformed with the obtained plasmid and used for expression experiments. One ml of a precultured medium was diluted with 9 ml of fresh LB medium (containing 50 mg/l of ampicillin) and the resultant was cultured with shaking for 3 hours at 37.degree. C. Then IPTG was added to a concentration of 5 mM and culture was continued for another 3 hours, followed by collection of cells by centrifugation. The cells were suspended in 0.5 ml of an extraction buffer (50 mM Hepes-KOH pH7.5, 10 mM MgSO.sub.4, 1 mM EDTA, 5 mM DTT) and lysozyme was added to a final concentration of about 0.5 mg/ml. The suspension was left to stand in ice for 5 minutes and then treated by an ultrasonic disrupter (Model UCD-130T commercially available from COSMOBIO) for a period of 30 seconds each, totally 5 minutes, thereby extracting the enzyme. The resultant was centrifuged by a microcentrifuge for 10 minutes and the supernatant was applied to Sephadex G25 column equilibrated with a column buffer (50 mM Hepes-KOH pH 7.0, 10 mM MgCl.sub.2, 2 mM EDTA, 10 mM DTT) to remove low molecular substances. The resultant was left to stand at 25.degree. C. for not less than 30 minutes thereby carrying out association to tetramer, which was then used for the measurement of activity.
The PPDKs produced in E. coli cells from PPDK cDNAs of Flaveria brownii, Flaveria bidentis and maize (Harvest Queen) exhibited substantially the same mobility as the enzymes originated from the plants in SDS-PAGE. Although the molecular weights of the mature enzymes, which are expected from the respective cDNAs are about the same, the apparent molecular weights on SDS-PAGE substantially differ. It was proved that this is due to the differences in amino acid compositions and not due to deletion processing of the proteins or modifications after translation, such as attaching of sugar chains. The cold-stability of each PPDK produced in E. coli was identical to the corresponding enzyme originated from each plant. Thus, the cold-stability of the PPDK of Flaveria brownii is attained without an auxiliary factor specific to the plant or processing after translation, so that it is expected that cold-stable PPDK is produced by introducing the cDNA into maize and expressing it. FIG. 2 shows the relationship between the time which lapsed after placing the enzyme at 0.degree. C. and relative activity of PPDK.
In the above-described process for producing active PPDK in E. coli, the cDNA from which the region encoding the transit peptide was removed was inserted in the expression vector. For this, it was important to precisely match the site to be cut with the site corresponding to the N-terminal of the enzyme originated from the plant.
______________________________________ Amount of Enzyme Produced in E. coli Primer Used______________________________________(F. brownii)MITAKKRVFTF . . . - 2MIPVSPPVTTTKKRVFTF . . . + 3MINPVSPPVTTTKKRVFTF . . . ++ 4NPVSPPVTTTKKRVFTF . . . (enzyme originated from leaves)(F. bidentis)MITAKKRVFTF . . . ++MIPVSPPVTTAKKRVFTF . . . -TAKKRVFTF . . . (enzyme originated from leaves)(maize)MATKKRVFTF . . . ++TTKKRVFTF . . . (enzyme originated from leaves)______________________________________
More particularly, at the time point of carrying out the expression experiment of cDNA of Flaveria brownii, expression of PPDKs of maize and Flaveria bidentis had been succeeded, referring to the cutting site in maize in both cases. Thus, in expression of cDNA of Flaveria brownii too, firstly, the DNA was cut at the same site using primer 2 and it was tried to express the cDNA after constructing an expression vector containing the cDNA. However, PPDK was not produced at all. Then, based on the sequence of the N-terminal region of the enzyme originated from leaves, an expression vector in which the inserted cDNA contains an additional sequence encoding the enzyme extended to the direction of N-terminal by 7 residues was constructed using the primer 3 and expression was carried out using the expression vector. As a result, production of PPDK was confirmed. However, even with this expression vector, the amount of the produced enzyme was small, so that the enzyme was not obtained in an amount sufficient for measuring its activity. Thus, an expression vector in which the inserted cDNA contains a still additional sequence encoding the enzyme extended to the direction of N-terminal by 1 residue was constructed using the primer 4 and expression was carried out using the expression vector. As a result, a large amount of PPDK was produced and its cold-stability was confirmed. The nucleotide sequences of the primer 2 and the primer 3 were as follows:
primer 2: CGGTGTCTCCTCCGGATATCACGGCTAAAAAGAG (SEQ ID NO. 16)
primer 3: TTGATATCCCGGTTGTCTCCTCCGGTA (SEQ ID NO. 17)
3. Identification of Region Giving Cold-stability in PPDK Gene of Flaveria brownii
(1) Chimera of Flaveria brownii and Flaveria bidentis
The expression vectors were recombined according to a conventional method using restriction enzymes. That is, the EcoRI-HindIII fragment of pKK-brownii was exchanged with the corresponding fragment of pKK-bidentis (a plasmid obtained by inserting the cDNA of Flaveria bidentis into pKK 223-2 as in the construction of pKK-brownii) to obtain a plasmid pKK-011. On the other hand, the EcoRI-HindIII fragment of pKK-bidentis was exchanged with the corresponding fragment of pKK-brownii to obtain a plasmid pKK-100. Similarly, the NdeI-HindIII fragments were exchanged to obtain pKK-001 and pKK-110. Further, the Xho-HindIII fragment of pKK-110 was exchanged with the corresponding fragment of pKK-bidentis to obtain pKK-1101, and the XhoI-HindIII fragment of pKK-bidentis was exchanged with the corresponding fragment of pKK-brownii to obtain pKK-1110. To further finely recombine the XhoI-HindIII fragments, the fragments were linked by PCR (linking PCR method). That is, primers complementary to the nucleotide sequence in the XhoI-HindIII fragment, which sequence is common in bidentis and brownii, that is, a primer link-F: GCAGAGATGATGTTGGCAAG (SEQ ID NO. 18) and a primer link-R: CTTGCCAACATCATCTCTGC (SEQ ID NO. 19) were prepared. Using the XhoI-HindIII fragment of brownii or bidentis subcloned into pBluescript SK(-) as a template, and using combination of primers of link-F/RV or M4/link-R, the first PCR was carried out. The obtained fragments (totally 4 types) were purified by cutting out from the gel. Using the mixture of the fragment encoding the former half of brownii and the fragment encoding the latter half of bidentis, or the mixture of the fragment encoding the former half of bidentis and the fragment encoding the latter half of brownii as a template, and using primers M4/RV, the second PCR was performed. The amplified linked fragments were digested with XhoI and HindIII and the resultants were exchanged with the corresponding region of pKK-bidentis to obtain pKK-link01 and pKK-link10. Another pair of chimeric genes were prepared utilizing the PstI site between the recombination site in the linking PCR and the HindIII site. That is, the XhoI-PstI fragment of pKK-link10 and the PstI-HindIII fragment of pKK-bidentis were inserted into the XhoI-HindIII site of pKK-bidentis (three fragments-linking reaction) to obtain pKK-link101. Similarly, the XhoI-PstI fragment of pKK-bidentis and the PstI-HindIII fragment of pKK-brownii were inserted into the XhoI-HindIII site of pKK-bidentis to obtain pKK-link110.
The 40 sites at which the amino acid residues are different between the mature PPDK proteins of Flaveria brownii and of Flaveria bidentis are mainly exist in the N-terminal and C-terminal regions, and do not exist so many in the center region, that is, in the active site. Thus, the cDNAs were divided into three regions, that is, the front, middle and rear regions by utilizing EcoRI sites and NdeI sites which commonly exist in both of the genes, and these fragments were interchangeably exchanged to prepare chimeric genes. By checking these chimeric genes, it was determined which region is related to the cold-stability. As a result, cold-stability is acquired when the protein contains the rear 1/3 region of the cDNA of Flaveria brownii. In contrast, when the protein contains the rear 1/3 region of the cDNA of Flaveria bidentis, the protein was cold-sensitive. Then the rear 1/3 region was divided into two regions by restriction enzyme XhoI, and the fragments were respectively introduced into the corresponding regions of pKK-bidentis and the cold-stability was checked. As a result, the region downstream of the XhoI site (i.e., the 1/6 region from the C-terminal) was necessary and sufficient for attaining cold-stability. Then a chimeric gene containing the rear 1/6 region (XhoI-HindIII fragment, containing 7 substitutions of amino acid residues) was prepared by the linking PCR method and the amplified gene was introduced into pKK-bidentis, followed by measuring the cold-stability thereof. As a result, a chimeric enzyme pKK-link10 having the rear most region containing 4 substitutions was cold-stable while a chimeric enzyme pKK-link01 having the former half of the rear region, which contains 3 substitutions was cold-sensitive. Then the rear region was recombined using a restriction enzyme PstI to prepare chimeric genes having two amino acid substitutions per gene, and the cold-stability of the obtained genes was checked. As a result, all of the chimeric genes exhibited cold-stability. Thus, it is assumed that there are two or more regions related to cold-stability.
(2) Chimera of Maize and Flaveria brownii
Using a primer PPDK-F: CTCACTGTTCGAAGAGAAGC (SEQ ID NO. 36) and a primer mNdeI: CATATGCTCTGTCCGGCATAATC (SEQ ID NO. 37) (complementary chain side) containing NdeI site as primers, and cDNA of maize PPDK as a template, PCR was performed and the amplified fragment was subcloned into pCR II. This fragment was cut out from pCR II by SacI and NdeI. This fragment, the SacI-SmaI fragment (vector fragment) of pKK-PPDK and a fragment obtained by digesting cDNA of PPDK of F. brownii, blunting the resultant with Klenow fragment and then digesting the resultant with NdeI, were linked by three fragments-linking reaction (FIG. 3) to obtain pKK-mz/bro (Nde). PCR was performed using primer PPDK-F and a primer mXhoI: CTCGAGGGATCTCAATCATTG (SEQ ID NO. 21) (complementary chain), and maize PPDK as a template. The obtained fragment was subcloned into pCR II and the insert was cut out by SacI and XhoI from pCR II. The cut out fragment was ligated with the SacI-XhoI fragment (vector fragment) of pKK-mz/bro(Nde) to obtain pKK-mz/bro(Xho).
Both of the chimeric enzyme containing the C-terminal 1/3 region (NdeI-HindIII fragment) of brownii PPDK in maize PPDK and the chimeric enzyme containing the C-terminal 1/6 region (XhoI-HindIII fragment) of brownii PPDK in maize PPDK exhibited cold-stability as strong as that of brownii. Thus, since cold-stability could be given to maize PPDK whose amino acid sequence is considerably different from that of F. brownii, it is thought that cold-stability can be given to PPDKs of various plants by introducing the rear 1/3 region or the C-terminal 1/6 region. Since the thus prepared maize/F. brownii chimeric PPDK contains the transit peptide of maize PPDK as it is, if a transformed plant has a problem in transportation of the cold-stable PPDK to chloroplasts, in which the transit peptide is also originated from Flaveria brownii, this problem is thought to be overcome by introducing this chimeric gene in place of the gene originated from F. brownii.
(3) Point-mutated Clones
Amino acid residues of XhoI-HindIII fragment of pKK-brownii were changed one by one from brownii type to bidentis type. Similarly, amino acid residues of XhoI-HindIII fragment of pKK-bidentis were changed one by one from bidentis type to brownii type. Introduction of the mutation was carried out by subcloning the XhoI-HindIII fragments of PPDK cDNAs of F. brownii and of F. bidentis into pBluescript IISK(-), and then substituting nucleotides by Kunkel method using Megalabel kit (commercially available from TAKARA SHUZO) and Mutan-K kit (commercially available from TAKARA SHUZO). The sequence of the primers used for introducing mutations were as shown in Table 2. After confirming the mutated nucleotide sequence by a DNA sequencer, these fragments were inserted into the XhoI-HindIII site of pKK-bidentis.
TABLE 2______________________________________Primers Used for Preparation of Point-mutated Clones______________________________________Introduction of Mutation from F. brownii type toF. bidentis type836DE 5'GCAATCTCTTCAGCAATC (SEQ ID NO. 22)839AG 5'GCTTCTTTTCCAATCTCATC (SEQ ID NO. 23)843ED 5'CGAAAAGAAATCGGCTTC (SEQ ID NO. 24)869PQ 5'GAAAGATAAATCTGCAAAAACTTG (SEQ ID NO. 25)873SA 5'GCCTTGAGCAAGATAAATC (SEQ ID NO. 26)885LI 5'TTCTGGTCAATAACCTCAATG (SEQ ID NO. 27)952VI 5'GCTTAAACAATGACTTGTGC (SEQ ID NO. 28)Introduction of Mutation from F. bidentis type toF. brownii type836ED 5'CCAATCTCATCAGCTATTAAAG (SEQ ID NO. 29)839GA 5'GCTTCTTTTGCAATCTCTTC (SEQ ID NO. 30)843DE 5'CGAAAAGAACTCAGCTTC (SEQ ID NO. 31)869QP 5'CAAGATAAATCGGCAAAAACTTG (SEQ ID NO. 32)873AS 5'GAATGCCTTGAGAAAGATAAATC (SEQ ID NO. 33)885IL 5'CTTTCTGGTCAAGAACCTCAAATG (SEQ ID NO. 34)952IV 5'GCTTAAACAACGACTTGTGC (SEQ ID NO. 35)______________________________________
All of the enzymes in which one amino acid residue in the XhoI-HindIII region of pKK-1110, which amino acid residue is different between F. brownii and F. bidentis, was substituted to the corresponding amino acid residue of the bidentis type exhibited cold-stability. Thus, it is thought that there are a plurality of mutations which give cold-stability (because the cold-stability is not lost by changing only one amino acid residue). Then enzymes in which one amino acid residue in the XhoI-HindIII region of pKK-bidentis, which amino acid residue is different between F. brownii and F. bidentis , was substituted to the corresponding amino acid residue of the brownii type were prepared, and it was checked whether the enzymes acquired cold-stability. That is, the enzyme activity after treatment at 0.degree. C. for 20 minutes was measured. As a result, by the mutation of 869Gln.fwdarw. Pro, the enzyme acquired cold-stability (the activity after the cold treatment is 60-70% of the original activity). With the mutation of 885Ile.fwdarw.Leu or 952Ile.fwdarw. Val, the loss of activity at low temperature was prevented a little. Taking these results and the results of chimeric enzyme pKK-link110 described in (1) into consideration, it is assumed that the enzyme acquires cold-stability when these mutations coexist. From these results, it was concluded that the three amino acid residues, that is, 869Pro, 885Leu and 952Val are related to cold-stability. However, among these residues relating to cold-stability of brownii, as for 869Pro and 885Leu, these residues are of brownii type in maize PPDK too. Therefore, cold-stability is not necessarily attained only by the fact that these residues are of brownii type, but it is thought that these residues give complete cold-stability in the amino acid sequence of PPDK of brownii or bidentis . Therefore, in cases where cold-stability is to be given to a PPDK originated from a different species, whose amino acid sequence is considerably different from those of brownii and bidentis, it is preferred not to introduce point mutations, but to prepare a chimeric gene in which a region giving cold-stability is introduced as carried out for maize PPDK.
4. Transformation of Maize with PPDK Gene of Flaveria brownii
In accordance with the method of Gordon-Kamm W. J. et al (The Plant Cell 2:603-618, 1990) or Koziel M. G. et al.(Bio/Technology 11:194-200, 1993), gold or tungsten fine particles are coated with pKK-brownii , and the coated particles are implanted into maize immature embryos or suspended cultured cells. From the treated cells, transformants are selected, and obtained calli of transformants are cultured according to a conventional method, followed by regenerating plants from the calli. The method of transformation is not restricted to the particle gun method, but the methods of transformation which may be employed include electroporation method (Rhodes C. A. et al., Science 240:204-207, 1988), PEG method (Armstrong C. L. et al., Plant Cell Reports 9:335-339, 1990), tissue-electroporation method (D'Halluin K. et al., The Plant Cell 4:1495-1505, 1992), Agrobacterium method (Hiei Y. and Komari T. WO 9400977) and the like. From the obtained plants, seeds are recovered and germinated to regenerate plants. PPDK is isolated from leaves of the obtained plants and its cold-stability is checked. For transformed plants and non-transformed plants, effect of temperature with respect to photosynthesis rate is checked. Stability of the transformation is assured by proliferating maize plants which exhibit high photosynthesis rates at low temperature for many generations, and measuring the photosynthesis rates at different temperatures and measuring the cold-stability of PPDKs isolated from the plants.
5. Transformation of Flaveria bidentis with PPDK gene of Flaveria brownii
An intermediate vector containing the full-length cDNA shown in SEQ ID NOS. 9 and 10) and a reporter gene is introduced into a disarmed Ti plasmid of Agrobacterium tumefaciens. This can be accomplished by the method described in Draper J et al. eds., Plant Genetic Transformation and Gene Expression--a laboratory manual, Blackwell Scientific Publications (ISBN 0-632-02172-1).
On the other hand, leaf tissue or callus of Flaveria bidentis is infected with the above-mentioned Agrobacterium tumefaciens. This can be accomplished by culturing the tissue or callus together with Agrobacterium tumefaciens. Infected cells are selected based on the drug resistance. From the selected calli, whole plants are generated by a conventional methods. From the obtained plants, seeds are recovered and germinated to regenerate plants. PPDK is isolated from leaves of the obtained plants and its cold-stability is checked. For transformed plants and non-transformed plants, effect of temperature with respect to photosynthesis rate is checked. Stability of the transformation is assured by proliferating maize plants which exhibit high photosynthesis rates at low temperature for many generations, and measuring the photosynthesis rates at different temperatures and measuring the cold-stability of PPDKs isolated from the plants.
__________________________________________________________________________# SEQUENCE LISTING- (1) GENERAL INFORMATION:- (iii) NUMBER OF SEQUENCES: 37- (2) INFORMATION FOR SEQ ID NO:1:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 2915 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 50..2908- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:- CGATCTCCTT CTGCTATTGC TGATATCTCA ATTTCACAGG TGAAGAAGG ATG - # ATG 55#Met Met# 1- AGT TCG TTG TCT GTT GAA GGT ATG CTT CTC AA - #G TCA GCC CGT GAG TCG 103Ser Ser Leu Ser Val Glu Gly Met Leu Leu Ly - #s Ser Ala Arg Glu Ser# 15- TGC TTA CCG GCG AGA GTG AAG CAA CGG CGA AA - #C GGT GAT CTC CGG CGA 151Cys Leu Pro Ala Arg Val Lys Gln Arg Arg As - #n Gly Asp Leu Arg Arg# 30- TTG AAC CAC CAC CGT CAA TCG TCG TTT GTC CG - #G TGT TTA ACT CCG GCG 199Leu Asn His His Arg Gln Ser Ser Phe Val Ar - #g Cys Leu Thr Pro Ala# 50- AGA GTT AGC AGA CCA GAG TTG CGC AGC AGT GG - #C TTA ACT CCG CCG CGA 247Arg Val Ser Arg Pro Glu Leu Arg Ser Ser Gl - #y Leu Thr Pro Pro Arg# 65- GCA GTT CTT AAT CCG GTG TCT CCT CCG GTG AC - #G ACG GCT AAA AAG AGG 295Ala Val Leu Asn Pro Val Ser Pro Pro Val Th - #r Thr Ala Lys Lys Arg# 80- GTT TTC ACT TTT GGT AAA GGA AGA AGT GAA GG - #C AAC AGG GAC ATG AAA 343Val Phe Thr Phe Gly Lys Gly Arg Ser Glu Gl - #y Asn Arg Asp Met Lys# 95- TCC TTG TTG GGA GGA AAA GGA GCA AAT CTT GC - #T GAG ATG TCA AGC ATT 391Ser Leu Leu Gly Gly Lys Gly Ala Asn Leu Al - #a Glu Met Ser Ser Ile# 110- GGT CTA TCA GTT CCT CCT GGG CTC ACT ATT TC - #A ACT GAA GCA TGT GAG 439Gly Leu Ser Val Pro Pro Gly Leu Thr Ile Se - #r Thr Glu Ala Cys Glu115 1 - #20 1 - #25 1 -#30- GAA TAT CAA CAA AAT GGA AAG AGC CTA CCT CC - #A GGT TTG TGG GAT GAG 487Glu Tyr Gln Gln Asn Gly Lys Ser Leu Pro Pr - #o Gly Leu Trp Asp Glu# 145- ATT TCA GAA GGC TTA GAT TAT GTC CAG AAA GA - #G ATG TCT GCA TCT CTC 535Ile Ser Glu Gly Leu Asp Tyr Val Gln Lys Gl - #u Met Ser Ala Ser Leu# 160- GGT GAC CCG TCT AAA CCT CTC CTC CTT TCC GT - #C CGT TCG GGT GCT GCC 583Gly Asp Pro Ser Lys Pro Leu Leu Leu Ser Va - #l Arg Ser Gly Ala Ala# 175- ATA TCT ATG CCT GGT ATG ATG GAC ACT GTA TT - #G AAT CTC GGG CTT AAT 631Ile Ser Met Pro Gly Met Met Asp Thr Val Le - #u Asn Leu Gly Leu Asn# 190- GAT GAG GTC GTA GCT GGT CTA GCT GGC AAA AG - #T GGA GCA CGG TTT GCC 679Asp Glu Val Val Ala Gly Leu Ala Gly Lys Se - #r Gly Ala Arg Phe Ala195 2 - #00 2 - #05 2 -#10- TAT GAC TCG TAT AGA AGG TTT CTC GAT ATG TT - #T GGC AAC GTT GTA ATG 727Tyr Asp Ser Tyr Arg Arg Phe Leu Asp Met Ph - #e Gly Asn Val Val Met# 225- GGT ATC CCG CAT TCA TTA TTT GAC GAA AAG TT - #A GAG CAG ATG AAA GCT 775Gly Ile Pro His Ser Leu Phe Asp Glu Lys Le - #u Glu Gln Met Lys Ala# 240- GAA AAA GGG ATT CAT CTC GAC ACC GAT CTC AC - #T GCT GCT GAT CTT AAA 823Glu Lys Gly Ile His Leu Asp Thr Asp Leu Th - #r Ala Ala Asp Leu Lys# 255- GAT CTT GTT GAG AAA TAC AAG AAC GTG TAT GT - #G GAA GCA AAG GGC GAA 871Asp Leu Val Glu Lys Tyr Lys Asn Val Tyr Va - #l Glu Ala Lys Gly Glu# 270- AAG TTT CCC ACA GAT CCA AAG AAA CAG CTA GA - #G TTA GCA GTG AAT GCT 919Lys Phe Pro Thr Asp Pro Lys Lys Gln Leu Gl - #u Leu Ala Val Asn Ala275 2 - #80 2 - #85 2 -#90- GTT TTT GAT TCT TGG GAC AGC CCA AGG GCC AA - #T AAG TAC AGA AGT ATT 967Val Phe Asp Ser Trp Asp Ser Pro Arg Ala As - #n Lys Tyr Arg Ser Ile# 305- AAC CAG ATA ACT GGA TTA AAG GGG ACT GCA GT - #T AAC ATT CAA AGC ATG1015Asn Gln Ile Thr Gly Leu Lys Gly Thr Ala Va - #l Asn Ile Gln Ser Met# 320- GTG TTT GGC AAC ATG GGA AAC ACT TCA GGA AC - #T GGT GTT CTT TTC ACT1063Val Phe Gly Asn Met Gly Asn Thr Ser Gly Th - #r Gly Val Leu Phe Thr# 335- AGG AAC CCA AGC ACC GGT GAG AAG AAG CTA TA - #C GGG GAG TTT TTA ATC1111Arg Asn Pro Ser Thr Gly Glu Lys Lys Leu Ty - #r Gly Glu Phe Leu Ile# 350- AAT GCT CAG GGA GAG GAT GTT GTT GCT GGG AT - #C AGA ACA CCA GAA GAT1159Asn Ala Gln Gly Glu Asp Val Val Ala Gly Il - #e Arg Thr Pro Glu Asp355 3 - #60 3 - #65 3 -#70- TTG GGG ACC ATG GAG ACT TGC ATG CCT GAT GC - #A TAC AAA GAG CTT GTG1207Leu Gly Thr Met Glu Thr Cys Met Pro Asp Al - #a Tyr Lys Glu Leu Val# 385- GAG AAC TGC GAG ATC TTA GAG GGA CAC TAC AA - #A GAT ATG ATG GAT ATT1255Glu Asn Cys Glu Ile Leu Glu Gly His Tyr Ly - #s Asp Met Met Asp Ile# 400- GAA TTC ACA GTT CAA GAA AAC AGG CTT TGG AT - #G TTG CAA TGC CGA ACA1303Glu Phe Thr Val Gln Glu Asn Arg Leu Trp Me - #t Leu Gln Cys Arg Thr# 415- GGG AAA CGT ACT GGT AAA GGT GCA GTG AGA AT - #T GCA GTA GAT ATG GTG1351Gly Lys Arg Thr Gly Lys Gly Ala Val Arg Il - #e Ala Val Asp Met Val# 430- AAC GAA GGG CTA ATT GAT ACT AGA ACA GCA AT - #T AAG AGG GTT GAG ACT1399Asn Glu Gly Leu Ile Asp Thr Arg Thr Ala Il - #e Lys Arg Val Glu Thr435 4 - #40 4 - #45 4 -#50- CAA CAT CTA GAT CAG CTT CTT CAT CCA CAG TT - #T GAG GAT CCG TCT GCT1447Gln His Leu Asp Gln Leu Leu His Pro Gln Ph - #e Glu Asp Pro Ser Ala# 465- TAC AAA AGC CAT GTG GTA GCA ACC GGT TTG CC - #A GCA TCC CCC GGG GCA1495Tyr Lys Ser His Val Val Ala Thr Gly Leu Pr - #o Ala Ser Pro Gly Ala# 480- GCT GTG GGA CAG GTT TGT TTT AGT GCA GAG GA - #T GCA GAA ACA TGG CAT1543Ala Val Gly Gln Val Cys Phe Ser Ala Glu As - #p Ala Glu Thr Trp His# 495- GCA CAA GGA AAG AGT GCT ATC TTG GTA AGG AC - #C GAA ACA AGC CCA GAA1591Ala Gln Gly Lys Ser Ala Ile Leu Val Arg Th - #r Glu Thr Ser Pro Glu# 510- GAT GTT GGT GGT ATG CAT GCA GCA GCT GGA AT - #C TTA ACC GCT AGA GGA1639Asp Val Gly Gly Met His Ala Ala Ala Gly Il - #e Leu Thr Ala Arg Gly515 5 - #20 5 - #25 5 -#30- GGC ATG ACA TCA CAT GCA GCG GTG GTG GCT CG - #C GGA TGG GGC AAA TGT1687Gly Met Thr Ser His Ala Ala Val Val Ala Ar - #g Gly Trp Gly Lys Cys# 545- TGT GTT TCC GGT TGT GCT GAT ATT CGT GTG AA - #C GAT GAT ATG AAG ATT1735Cys Val Ser Gly Cys Ala Asp Ile Arg Val As - #n Asp Asp Met Lys Ile# 560- TTT ACG ATT GGC GAC CGT GTG ATT AAA GAA GG - #C GAC TGG CTT TCT CTT1783Phe Thr Ile Gly Asp Arg Val Ile Lys Glu Gl - #y Asp Trp Leu Ser Leu# 575- AAT GGT ACA ACT GGT GAA GTC ATA TTG GGT AA - #A CAG CTA CTG GCT CCA1831Asn Gly Thr Thr Gly Glu Val Ile Leu Gly Ly - #s Gln Leu Leu Ala Pro# 590- CCT GCA ATG AGC AAT GAC TTA GAA ATA TTC AT - #G TCA TGG GCT GAT CAA1879Pro Ala Met Ser Asn Asp Leu Glu Ile Phe Me - #t Ser Trp Ala Asp Gln595 6 - #00 6 - #05 6 -#10- GCA AGG CGT CTC AAG GTT ATG GCA AAT GCA GA - #C ACA CCT AAT GAT GCA1927Ala Arg Arg Leu Lys Val Met Ala Asn Ala As - #p Thr Pro Asn Asp Ala# 625- TTA ACA GCC AGA AAC AAT GGT GCA CAA GGG AT - #C GGG CTC TGT AGA ACT1975Leu Thr Ala Arg Asn Asn Gly Ala Gln Gly Il - #e Gly Leu Cys Arg Thr# 640- GAA CAT ATG TTT TTC GCT TCT GAT GAG AGG AT - #C AAA GCT GTA AGA AAG2023Glu His Met Phe Phe Ala Ser Asp Glu Arg Il - #e Lys Ala Val Arg Lys# 655- ATG ATC ATG GCG GTC ACT CCA GAA CAA AGA AA - #A GTG GCT CTA GAT CTC2071Met Ile Met Ala Val Thr Pro Glu Gln Arg Ly - #s Val Ala Leu Asp Leu# 670- TTA CTC CCA TAC CAA AGA TCC GAT TTT GAG GG - #C ATT TTC CGA GCA ATG2119Leu Leu Pro Tyr Gln Arg Ser Asp Phe Glu Gl - #y Ile Phe Arg Ala Met675 6 - #80 6 - #85 6 -#90- GAT GGA CTT CCT GTA ACT ATC CGC CTT CTA GA - #C CCT CCA CTT CAT GAG2167Asp Gly Leu Pro Val Thr Ile Arg Leu Leu As - #p Pro Pro Leu His Glu# 705- TTT TTA CCC GAA GGT GAT CTA GAA CAC ATA GT - #G AAC GAA CTT GCA GTC2215Phe Leu Pro Glu Gly Asp Leu Glu His Ile Va - #l Asn Glu Leu Ala Val# 720- GAC ACA GGC ATG AGT GCA GAT GAA ATC TAT TC - #A AAA ATC GAA AAT CTA2263Asp Thr Gly Met Ser Ala Asp Glu Ile Tyr Se - #r Lys Ile Glu Asn Leu# 735- TCT GAA GTG AAC CCT ATG CTT GGT TTC CGT GG - #T TGC AGA TTA GGG ATT2311Ser Glu Val Asn Pro Met Leu Gly Phe Arg Gl - #y Cys Arg Leu Gly Ile# 750- TCA TAC CCC GAG CTA ACA GAA ATG CAA GTT CG - #T GCG ATC TTT CAA GCT2359Ser Tyr Pro Glu Leu Thr Glu Met Gln Val Ar - #g Ala Ile Phe Gln Ala755 7 - #60 7 - #65 7 -#70- GCA GTG TCT ATG ACC AAT CAG GGG GTG ACT GT - #A ATA CCA GAG ATC ATG2407Ala Val Ser Met Thr Asn Gln Gly Val Thr Va - #l Ile Pro Glu Ile Met# 785- GTT CCG TTA GTG GGG ACA CCT CAG GAA TTA CG - #T CAT CAA ATC AGT GTA2455Val Pro Leu Val Gly Thr Pro Gln Glu Leu Ar - #g His Gln Ile Ser Val# 800- ATT CGT GGA GTA GCT GCA AAT GTG TTT GCT GA - #A ATG GGG GTG ACA TTG2503Ile Arg Gly Val Ala Ala Asn Val Phe Ala Gl - #u Met Gly Val Thr Leu# 815- GAA TAT AAA GTG GGA ACG ATG ATT GAG ATT CC - #T CGA GCT GCT TTA ATA2551Glu Tyr Lys Val Gly Thr Met Ile Glu Ile Pr - #o Arg Ala Ala Leu Ile# 830- GCT GAA GAG ATT GGA AAA GAA GCT GAT TTC TT - #T TCG TTT GGA ACC AAT2599Ala Glu Glu Ile Gly Lys Glu Ala Asp Phe Ph - #e Ser Phe Gly Thr Asn835 8 - #40 8 - #45 8 -#50- GAT CTG ACC CAG ATG ACA TTT GGG TAC AGC AG - #A GAT GAT GTT GGC AAG2647Asp Leu Thr Gln Met Thr Phe Gly Tyr Ser Ar - #g Asp Asp Val Gly Lys# 865- TTT TTG CAG ATT TAT CTT GCT CAA GGC ATT CT - #G CAG CAT GAT CCA TTT2695Phe Leu Gln Ile Tyr Leu Ala Gln Gly Ile Le - #u Gln His Asp Pro Phe# 880- GAG GTT ATT GAC CAG AAA GGG GTG GGT CAG TT - #G ATT AAG ATG GCT ACG2743Glu Val Ile Asp Gln Lys Gly Val Gly Gln Le - #u Ile Lys Met Ala Thr# 895- GAG AAA GGT CGT GCA GCA AAT CCT AAC TTA AA - #G GTT GGG ATA TGT GGG2791Glu Lys Gly Arg Ala Ala Asn Pro Asn Leu Ly - #s Val Gly Ile Cys Gly# 910- GAG CAT GGT GGG GAG CCT TCT TCT GTT GCA TT - #T TTT GAT GGA GTT GGA2839Glu His Gly Gly Glu Pro Ser Ser Val Ala Ph - #e Phe Asp Gly Val Gly915 9 - #20 9 - #25 9 -#30- CTA GAT TAT GTG TCG TGC TCT CCA TTT AGG GT - #T CCT ATC GCA AGG TTG2887Leu Asp Tyr Val Ser Cys Ser Pro Phe Arg Va - #l Pro Ile Ala Arg Leu# 945# 2915 TC ATT GTT TAAGCTTAla Ala Ala Gln Val Ile Val 950- (2) INFORMATION FOR SEQ ID NO:2:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 953 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:- Met Met Ser Ser Leu Ser Val Glu Gly Met Le - #u Leu Lys Ser Ala Arg# 15- Glu Ser Cys Leu Pro Ala Arg Val Lys Gln Ar - #g Arg Asn Gly Asp Leu# 30- Arg Arg Leu Asn His His Arg Gln Ser Ser Ph - #e Val Arg Cys Leu Thr# 45- Pro Ala Arg Val Ser Arg Pro Glu Leu Arg Se - #r Ser Gly Leu Thr Pro# 60- Pro Arg Ala Val Leu Asn Pro Val Ser Pro Pr - #o Val Thr Thr Ala Lys# 80- Lys Arg Val Phe Thr Phe Gly Lys Gly Arg Se - #r Glu Gly Asn Arg Asp# 95- Met Lys Ser Leu Leu Gly Gly Lys Gly Ala As - #n Leu Ala Glu Met Ser# 110- Ser Ile Gly Leu Ser Val Pro Pro Gly Leu Th - #r Ile Ser Thr Glu Ala# 125- Cys Glu Glu Tyr Gln Gln Asn Gly Lys Ser Le - #u Pro Pro Gly Leu Trp# 140- Asp Glu Ile Ser Glu Gly Leu Asp Tyr Val Gl - #n Lys Glu Met Ser Ala145 1 - #50 1 - #55 1 -#60- Ser Leu Gly Asp Pro Ser Lys Pro Leu Leu Le - #u Ser Val Arg Ser Gly# 175- Ala Ala Ile Ser Met Pro Gly Met Met Asp Th - #r Val Leu Asn Leu Gly# 190- Leu Asn Asp Glu Val Val Ala Gly Leu Ala Gl - #y Lys Ser Gly Ala Arg# 205- Phe Ala Tyr Asp Ser Tyr Arg Arg Phe Leu As - #p Met Phe Gly Asn Val# 220- Val Met Gly Ile Pro His Ser Leu Phe Asp Gl - #u Lys Leu Glu Gln Met225 2 - #30 2 - #35 2 -#40- Lys Ala Glu Lys Gly Ile His Leu Asp Thr As - #p Leu Thr Ala Ala Asp# 255- Leu Lys Asp Leu Val Glu Lys Tyr Lys Asn Va - #l Tyr Val Glu Ala Lys# 270- Gly Glu Lys Phe Pro Thr Asp Pro Lys Lys Gl - #n Leu Glu Leu Ala Val# 285- Asn Ala Val Phe Asp Ser Trp Asp Ser Pro Ar - #g Ala Asn Lys Tyr Arg# 300- Ser Ile Asn Gln Ile Thr Gly Leu Lys Gly Th - #r Ala Val Asn Ile Gln305 3 - #10 3 - #15 3 -#20- Ser Met Val Phe Gly Asn Met Gly Asn Thr Se - #r Gly Thr Gly Val Leu# 335- Phe Thr Arg Asn Pro Ser Thr Gly Glu Lys Ly - #s Leu Tyr Gly Glu Phe# 350- Leu Ile Asn Ala Gln Gly Glu Asp Val Val Al - #a Gly Ile Arg Thr Pro# 365- Glu Asp Leu Gly Thr Met Glu Thr Cys Met Pr - #o Asp Ala Tyr Lys Glu# 380- Leu Val Glu Asn Cys Glu Ile Leu Glu Gly Hi - #s Tyr Lys Asp Met Met385 3 - #90 3 - #95 4 -#00- Asp Ile Glu Phe Thr Val Gln Glu Asn Arg Le - #u Trp Met Leu Gln Cys# 415- Arg Thr Gly Lys Arg Thr Gly Lys Gly Ala Va - #l Arg Ile Ala Val Asp# 430- Met Val Asn Glu Gly Leu Ile Asp Thr Arg Th - #r Ala Ile Lys Arg Val# 445- Glu Thr Gln His Leu Asp Gln Leu Leu His Pr - #o Gln Phe Glu Asp Pro# 460- Ser Ala Tyr Lys Ser His Val Val Ala Thr Gl - #y Leu Pro Ala Ser Pro465 4 - #70 4 - #75 4 -#80- Gly Ala Ala Val Gly Gln Val Cys Phe Ser Al - #a Glu Asp Ala Glu Thr# 495- Trp His Ala Gln Gly Lys Ser Ala Ile Leu Va - #l Arg Thr Glu Thr Ser# 510- Pro Glu Asp Val Gly Gly Met His Ala Ala Al - #a Gly Ile Leu Thr Ala# 525- Arg Gly Gly Met Thr Ser His Ala Ala Val Va - #l Ala Arg Gly Trp Gly# 540- Lys Cys Cys Val Ser Gly Cys Ala Asp Ile Ar - #g Val Asn Asp Asp Met545 5 - #50 5 - #55 5 -#60- Lys Ile Phe Thr Ile Gly Asp Arg Val Ile Ly - #s Glu Gly Asp Trp Leu# 575- Ser Leu Asn Gly Thr Thr Gly Glu Val Ile Le - #u Gly Lys Gln Leu Leu# 590- Ala Pro Pro Ala Met Ser Asn Asp Leu Glu Il - #e Phe Met Ser Trp Ala# 605- Asp Gln Ala Arg Arg Leu Lys Val Met Ala As - #n Ala Asp Thr Pro Asn# 620- Asp Ala Leu Thr Ala Arg Asn Asn Gly Ala Gl - #n Gly Ile Gly Leu Cys625 6 - #30 6 - #35 6 -#40- Arg Thr Glu His Met Phe Phe Ala Ser Asp Gl - #u Arg Ile Lys Ala Val# 655- Arg Lys Met Ile Met Ala Val Thr Pro Glu Gl - #n Arg Lys Val Ala Leu# 670- Asp Leu Leu Leu Pro Tyr Gln Arg Ser Asp Ph - #e Glu Gly Ile Phe Arg# 685- Ala Met Asp Gly Leu Pro Val Thr Ile Arg Le - #u Leu Asp Pro Pro Leu# 700- His Glu Phe Leu Pro Glu Gly Asp Leu Glu Hi - #s Ile Val Asn Glu Leu705 7 - #10 7 - #15 7 -#20- Ala Val Asp Thr Gly Met Ser Ala Asp Glu Il - #e Tyr Ser Lys Ile Glu# 735- Asn Leu Ser Glu Val Asn Pro Met Leu Gly Ph - #e Arg Gly Cys Arg Leu# 750- Gly Ile Ser Tyr Pro Glu Leu Thr Glu Met Gl - #n Val Arg Ala Ile Phe# 765- Gln Ala Ala Val Ser Met Thr Asn Gln Gly Va - #l Thr Val Ile Pro Glu# 780- Ile Met Val Pro Leu Val Gly Thr Pro Gln Gl - #u Leu Arg His Gln Ile785 7 - #90 7 - #95 8 -#00- Ser Val Ile Arg Gly Val Ala Ala Asn Val Ph - #e Ala Glu Met Gly Val# 815- Thr Leu Glu Tyr Lys Val Gly Thr Met Ile Gl - #u Ile Pro Arg Ala Ala# 830- Leu Ile Ala Glu Glu Ile Gly Lys Glu Ala As - #p Phe Phe Ser Phe Gly# 845- Thr Asn Asp Leu Thr Gln Met Thr Phe Gly Ty - #r Ser Arg Asp Asp Val# 860- Gly Lys Phe Leu Gln Ile Tyr Leu Ala Gln Gl - #y Ile Leu Gln His Asp865 8 - #70 8 - #75 8 -#80- Pro Phe Glu Val Ile Asp Gln Lys Gly Val Gl - #y Gln Leu Ile Lys Met# 895- Ala Thr Glu Lys Gly Arg Ala Ala Asn Pro As - #n Leu Lys Val Gly Ile# 910- Cys Gly Glu His Gly Gly Glu Pro Ser Ser Va - #l Ala Phe Phe Asp Gly# 925- Val Gly Leu Asp Tyr Val Ser Cys Ser Pro Ph - #e Arg Val Pro Ile Ala# 940- Arg Leu Ala Ala Ala Gln Val Ile Val945 9 - #50- (2) INFORMATION FOR SEQ ID NO:3:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 2880 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 24..2864- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:- CGGCGCAGTA GGGGATCGGA AGG ATG GCG GCA TCG GTT TC - #C AGG GCC ATC 50#Arg Ala Ile Ala Ala Ser Val Ser# 5 1- TGC GTA CAG AAG CCG GGC TCA AAA TGC ACC AG - #G GAC AGG GAA GCG ACC 98Cys Val Gln Lys Pro Gly Ser Lys Cys Thr Ar - #g Asp Arg Glu Ala Thr#25- TCC TTC GCC CGC CGA TCG GTC GCA GCG CCG AG - #G CCC CCG CAC GCC AAA 146Ser Phe Ala Arg Arg Ser Val Ala Ala Pro Ar - #g Pro Pro His Ala Lys# 40- GCC CGC CGG CGT CAT CCG CTC CGA CTC CGG CG - #C GGG ACG GGG CCA CAT 194Ala Arg Arg Arg His Pro Leu Arg Leu Arg Ar - #g Gly Thr Gly Pro His# 55- TGC TCG CCG CTG AGG GCC GTC GTT GAC GCC GC - #G CCG ATA CAG ACG ACC 242Cys Ser Pro Leu Arg Ala Val Val Asp Ala Al - #a Pro Ile Gln Thr Thr# 70- AAA AAG AGG GTG TTC CAC TTC GGC AAG GGC AA - #G AGC GAG GGC AAC AAG 290Lys Lys Arg Val Phe His Phe Gly Lys Gly Ly - #s Ser Glu Gly Asn Lys# 85- ACC ATG AAG GAA CTG CTG GGC GGC AAG GGC GC - #G AAC CTG GCG GAG ATG 338Thr Met Lys Glu Leu Leu Gly Gly Lys Gly Al - #a Asn Leu Ala Glu Met#105- GCG AGC ATC GGG CTG TCG GTG CCG CCA GGG TT - #C ACG GTG TCG ACG GAG 386Ala Ser Ile Gly Leu Ser Val Pro Pro Gly Ph - #e Thr Val Ser Thr Glu# 120- GCG TGC CAG CAG TAC CAG GAC GCC GGG TGC GC - #C CTC CCC GCG GGG CTC 434Ala Cys Gln Gln Tyr Gln Asp Ala Gly Cys Al - #a Leu Pro Ala Gly Leu# 135- TGG GCC GAG ATC GTC GAC GGC CTG CAG TGG GT - #G GAG GAG TAC ATG GGC 482Trp Ala Glu Ile Val Asp Gly Leu Gln Trp Va - #l Glu Glu Tyr Met Gly# 150- GCC ACC CTG GGC GAT CCG CAG CGC CCG CTC CT - #G CTC TCC GTC CGC TCC 530Ala Thr Leu Gly Asp Pro Gln Arg Pro Leu Le - #u Leu Ser Val Arg Ser# 165- GGC GCC GCC GTG TCC ATG CCC GGC ATG ATG GA - #C ACG GTG CTC AAC CTG 578Gly Ala Ala Val Ser Met Pro Gly Met Met As - #p Thr Val Leu Asn Leu170 1 - #75 1 - #80 1 -#85- GGG CTC AAC GAC GAA GTG GCC GCC GGG CTG GC - #G GCC AAG AGC GGG GAG 626Gly Leu Asn Asp Glu Val Ala Ala Gly Leu Al - #a Ala Lys Ser Gly Glu# 200- CGC TTC GCC TAC GAC TCC TTC CGC CGC TTC CT - #C GAC ATG TTC GGC AAC 674Arg Phe Ala Tyr Asp Ser Phe Arg Arg Phe Le - #u Asp Met Phe Gly Asn# 215- GTC GTC ATG GAC ATC CCC CGC TCA CTG TTC GA - #A GAG AAG CTT GAG CAC 722Val Val Met Asp Ile Pro Arg Ser Leu Phe Gl - #u Glu Lys Leu Glu His# 230- ATG AAG GAA TCC AAG GGG CTG AAG AAC GAC AC - #C GAC CTC ACG GCC TCT 770Met Lys Glu Ser Lys Gly Leu Lys Asn Asp Th - #r Asp Leu Thr Ala Ser# 245- GAC CTC AAA GAG CTC GTG GGT CAG TAC AAG GA - #G GTC TAC CTC TCA GCC 818Asp Leu Lys Glu Leu Val Gly Gln Tyr Lys Gl - #u Val Tyr Leu Ser Ala250 2 - #55 2 - #60 2 -#65- AAG GGA GAG CCA TTC CCC TCA GAC CCC AAG AA - #G CAG CTG GAG CTA GCA 866Lys Gly Glu Pro Phe Pro Ser Asp Pro Lys Ly - #s Gln Leu Glu Leu Ala# 280- GTG CTG GCT GTG TTC AAC TCG TGG GAG AGC CC - #C AGG GCC AAG AAG TAC 914Val Leu Ala Val Phe Asn Ser Trp Glu Ser Pr - #o Arg Ala Lys Lys Tyr# 295- AGG AGC ATC AAC CAG ATC ACT GGC CTC AGG GG - #C ACC GCC GTG AAC GTG 962Arg Ser Ile Asn Gln Ile Thr Gly Leu Arg Gl - #y Thr Ala Val Asn Val# 310- CAG TGC ATG GTG TTC GGC AAC ATG GGG AAC AC - #T TCT GGC ACC GGC GTG1010Gln Cys Met Val Phe Gly Asn Met Gly Asn Th - #r Ser Gly Thr Gly Val# 325- CTC TTC ACC AGG AAC CCC AAC ACC GGA GAG AA - #G AAG CTG TAT GGC GAG1058Leu Phe Thr Arg Asn Pro Asn Thr Gly Glu Ly - #s Lys Leu Tyr Gly Glu330 3 - #35 3 - #40 3 -#45- TTC CTG GTG AAC GCT CAG GGT GAG GAT GTG GT - #T GCC GGA ATA AGA ACC1106Phe Leu Val Asn Ala Gln Gly Glu Asp Val Va - #l Ala Gly Ile Arg Thr# 360- CCA GAG GAC CTT GAC GCC ATG AAG AAC CTC AT - #G CCA CAG GCC TAC GAC1154Pro Glu Asp Leu Asp Ala Met Lys Asn Leu Me - #t Pro Gln Ala Tyr Asp# 375- GAG CTT GTT GAG AAC TGC AAC ATC CTG GAG AG - #C CAC TAC AAG GAA ATG1202Glu Leu Val Glu Asn Cys Asn Ile Leu Glu Se - #r His Tyr Lys Glu Met# 390- CAG GAT ATC GAG TTC ACT GTC CAG GAA AAC AG - #G CTG TGG ATG TTG CAG1250Gln Asp Ile Glu Phe Thr Val Gln Glu Asn Ar - #g Leu Trp Met Leu Gln# 405- TGC AGG ACA GGG AAA CGT ACG GGC AAA AGT GC - #C GTG AAG ATC GCC GTG1298Cys Arg Thr Gly Lys Arg Thr Gly Lys Ser Al - #a Val Lys Ile Ala Val410 4 - #15 4 - #20 4 -#25- GAC ATG GTT AAC GAG GGC CTT GTT GAG CCC CG - #C TCA GCG ATC AAG ATG1346Asp Met Val Asn Glu Gly Leu Val Glu Pro Ar - #g Ser Ala Ile Lys Met# 440- GTA GAG CCA GGC CAC CTG GAC CAG CTT CTT CA - #T CCT CAG TTT GAG AAC1394Val Glu Pro Gly His Leu Asp Gln Leu Leu Hi - #s Pro Gln Phe Glu Asn# 455- CCG TCG GCG TAC AAG GAT CAA GTC ATT GCC AC - #T GGT CTG CCA GCC TCA1442Pro Ser Ala Tyr Lys Asp Gln Val Ile Ala Th - #r Gly Leu Pro Ala Ser# 470- CCT GGG GCT GCT GTG GGC CAG GTT GTG TTC AC - #T GCT GAA GAT GCT GAA1490Pro Gly Ala Ala Val Gly Gln Val Val Phe Th - #r Ala Glu Asp Ala Glu# 485- GCA TGG CAT TCC CAA GGG AAA GCT GCT ATT CT - #G GTA AGG GCG GAG ACC1538Ala Trp His Ser Gln Gly Lys Ala Ala Ile Le - #u Val Arg Ala Glu Thr490 4 - #95 5 - #00 5 -#05- AGC CCT GAG GAC GTT GGT GGC ATG CAC GCT GC - #T GTG GGG ATT CTT ACA1586Ser Pro Glu Asp Val Gly Gly Met His Ala Al - #a Val Gly Ile Leu Thr# 520- GAG AGG GGT GGC ATG ACT TCC CAC GCT GCT GT - #G GTC GCA CGT TGG TGG1634Glu Arg Gly Gly Met Thr Ser His Ala Ala Va - #l Val Ala Arg Trp Trp# 535- GGG AAA TGC TGC GTC TCG GGA TGC TCA GGC AT - #T CGC GTA AAC GAT GCG1682Gly Lys Cys Cys Val Ser Gly Cys Ser Gly Il - #e Arg Val Asn Asp Ala# 550- GAG AAG CTC GTG ACG ATC GGA AGC CAT GTG CT - #G CGC GAA GGT GAG TGG1730Glu Lys Leu Val Thr Ile Gly Ser His Val Le - #u Arg Glu Gly Glu Trp# 565- CTG TCG CTG AAT GGG TCG ACT GGT GAG GTG AT - #C CTT GGG AAG CAG CCG1778Leu Ser Leu Asn Gly Ser Thr Gly Glu Val Il - #e Leu Gly Lys Gln Pro570 5 - #75 5 - #80 5 -#85- CTT TCC CCA CCA GCC CTT AGT GGT GAT CTG GG - #A ACT TTC ATG GCC TGG1826Leu Ser Pro Pro Ala Leu Ser Gly Asp Leu Gl - #y Thr Phe Met Ala Trp# 600- GTG GAT GAT GTT AGA AAG CTC AAG GTC CTG GC - #T AAC GCC GAT ACC CCT1874Val Asp Asp Val Arg Lys Leu Lys Val Leu Al - #a Asn Ala Asp Thr Pro# 615- GAT GAT GCA TTG ACT GCG CGA AAC AAT GGG GC - #A CAA GGA ATT GGA TTA1922Asp Asp Ala Leu Thr Ala Arg Asn Asn Gly Al - #a Gln Gly Ile Gly Leu# 630- TGC CGG ACA GAG CAC ATG TTC TTT GCT TCA GA - #C GAG AGG ATT AAG GCT1970Cys Arg Thr Glu His Met Phe Phe Ala Ser As - #p Glu Arg Ile Lys Ala# 645- GTC AGG CAG ATG ATT ATG GCT CCC ACG CTT GA - #G CTG AGG CAG CAG GCG2018Val Arg Gln Met Ile Met Ala Pro Thr Leu Gl - #u Leu Arg Gln Gln Ala650 6 - #55 6 - #60 6 -#65- CTC GAC CGT CTC TTG ACG TAT CAG AGG TCT GA - #C TTC GAA GGC ATT TTC2066Leu Asp Arg Leu Leu Thr Tyr Gln Arg Ser As - #p Phe Glu Gly Ile Phe# 680- CGT GCT ATG GAT GGA CTC CCG GTG ACC ATC CG - #A CTC CTG GAC CAT CCT2114Arg Ala Met Asp Gly Leu Pro Val Thr Ile Ar - #g Leu Leu Asp His Pro# 695- TCT TAC GAG TTC CTT CCA GAA GGG AAC ATC GA - #G GAC ATT GTA AGT GAA2162Ser Tyr Glu Phe Leu Pro Glu Gly Asn Ile Gl - #u Asp Ile Val Ser Glu# 710- TTA TGT GCT GAG ACG GGA GCC AAC CAG GAG GA - #T GCC CTC GCG CGA ATT2210Leu Cys Ala Glu Thr Gly Ala Asn Gln Glu As - #p Ala Leu Ala Arg Ile# 725- GAA AAG CTT TCA GAA GTA AAC CCG ATG CTT GG - #C TTC CGT GGG TGC AGG2258Glu Lys Leu Ser Glu Val Asn Pro Met Leu Gl - #y Phe Arg Gly Cys Arg730 7 - #35 7 - #40 7 -#45- CTT GGT ATA TCG TAC CCT GAA TTG ACA GAG AT - #G CAA GCC CGG GCC ATT2306Leu Gly Ile Ser Tyr Pro Glu Leu Thr Glu Me - #t Gln Ala Arg Ala Ile# 760- TTT GAA GCT GCT ATA GCA ATG ACC AAC CAG GG - #T GTT CAA GTG TTC CCA2354Phe Glu Ala Ala Ile Ala Met Thr Asn Gln Gl - #y Val Gln Val Phe Pro# 775- GAG ATA ATG GTT CCT CTT GTT GGA ACA CCA CA - #G GAA CTG GGG CAT CAA2402Glu Ile Met Val Pro Leu Val Gly Thr Pro Gl - #n Glu Leu Gly His Gln# 790- GTG ACT CTT ATC CGC CAA GTT GCT GAG AAA GT - #G TTC GCC AAT GTG GGC2450Val Thr Leu Ile Arg Gln Val Ala Glu Lys Va - #l Phe Ala Asn Val Gly# 805- AAG ACT ATC GGG TAC AAA GTT GGA ACA ATG AT - #T GAG ATC CCC AGG GCA2498Lys Thr Ile Gly Tyr Lys Val Gly Thr Met Il - #e Glu Ile Pro Arg Ala810 8 - #15 8 - #20 8 -#25- GCT CTG GTG GCT GAT GAG ATA GCG GAG CAG GC - #T GAA TTC TTC TCC TTC2546Ala Leu Val Ala Asp Glu Ile Ala Glu Gln Al - #a Glu Phe Phe Ser Phe# 840- GGA ACG AAC GAC CTG ACG CAG ATG ACC TTT GG - #G TAC AGC AGG GAT GAT2594Gly Thr Asn Asp Leu Thr Gln Met Thr Phe Gl - #y Tyr Ser Arg Asp Asp# 855- GTG GGA AAG TTC ATT CCC GTT CAT CTT GCT CA - #G GGC ATC CTC CAA CAT2642Val Gly Lys Phe Ile Pro Val His Leu Ala Gl - #n Gly Ile Leu Gln His# 870- GAC CCC TTC GAG GTC CTG GAC CAG AGG GGA GT - #G GGC GAG CTG GTG AAG2690Asp Pro Phe Glu Val Leu Asp Gln Arg Gly Va - #l Gly Glu Leu Val Lys# 885- TTT GCT ACA GAG AGG GGC CGC AAA GCT AGG CC - #T AAC TTG AAG GTG GGC2738Phe Ala Thr Glu Arg Gly Arg Lys Ala Arg Pr - #o Asn Leu Lys Val Gly890 8 - #95 9 - #00 9 -#05- ATT TGT GGA GAA CAC GGT GGA GAG CCT TCG TC - #T GTG GCC TTC TTC GCG2786Ile Cys Gly Glu His Gly Gly Glu Pro Ser Se - #r Val Ala Phe Phe Ala# 920- AAG GCT GGG CTG GAT TTC GTT TCT TGC TCC CC - #T TTC AGG GTT CCG ATT2834Lys Ala Gly Leu Asp Phe Val Ser Cys Ser Pr - #o Phe Arg Val Pro Ile# 935- GCT AGG CTA GCT GCA GCT CAG GTG CTT GTC TG - #AGGCTGCC TCCTCG2880Ala Arg Leu Ala Ala Ala Gln Val Leu Val# 945- (2) INFORMATION FOR SEQ ID NO:4:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 947 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:- Met Ala Ala Ser Val Ser Arg Ala Ile Cys Va - #l Gln Lys Pro Gly Ser# 15- Lys Cys Thr Arg Asp Arg Glu Ala Thr Ser Ph - #e Ala Arg Arg Ser Val# 30- Ala Ala Pro Arg Pro Pro His Ala Lys Ala Ar - #g Arg Arg His Pro Leu# 45- Arg Leu Arg Arg Gly Thr Gly Pro His Cys Se - #r Pro Leu Arg Ala Val# 60- Val Asp Ala Ala Pro Ile Gln Thr Thr Lys Ly - #s Arg Val Phe His Phe# 80- Gly Lys Gly Lys Ser Glu Gly Asn Lys Thr Me - #t Lys Glu Leu Leu Gly# 95- Gly Lys Gly Ala Asn Leu Ala Glu Met Ala Se - #r Ile Gly Leu Ser Val# 110- Pro Pro Gly Phe Thr Val Ser Thr Glu Ala Cy - #s Gln Gln Tyr Gln Asp# 125- Ala Gly Cys Ala Leu Pro Ala Gly Leu Trp Al - #a Glu Ile Val Asp Gly# 140- Leu Gln Trp Val Glu Glu Tyr Met Gly Ala Th - #r Leu Gly Asp Pro Gln145 1 - #50 1 - #55 1 -#60- Arg Pro Leu Leu Leu Ser Val Arg Ser Gly Al - #a Ala Val Ser Met Pro# 175- Gly Met Met Asp Thr Val Leu Asn Leu Gly Le - #u Asn Asp Glu Val Ala# 190- Ala Gly Leu Ala Ala Lys Ser Gly Glu Arg Ph - #e Ala Tyr Asp Ser Phe# 205- Arg Arg Phe Leu Asp Met Phe Gly Asn Val Va - #l Met Asp Ile Pro Arg# 220- Ser Leu Phe Glu Glu Lys Leu Glu His Met Ly - #s Glu Ser Lys Gly Leu225 2 - #30 2 - #35 2 -#40- Lys Asn Asp Thr Asp Leu Thr Ala Ser Asp Le - #u Lys Glu Leu Val Gly# 255- Gln Tyr Lys Glu Val Tyr Leu Ser Ala Lys Gl - #y Glu Pro Phe Pro Ser# 270- Asp Pro Lys Lys Gln Leu Glu Leu Ala Val Le - #u Ala Val Phe Asn Ser# 285- Trp Glu Ser Pro Arg Ala Lys Lys Tyr Arg Se - #r Ile Asn Gln Ile Thr# 300- Gly Leu Arg Gly Thr Ala Val Asn Val Gln Cy - #s Met Val Phe Gly Asn305 3 - #10 3 - #15 3 -#20- Met Gly Asn Thr Ser Gly Thr Gly Val Leu Ph - #e Thr Arg Asn Pro Asn# 335- Thr Gly Glu Lys Lys Leu Tyr Gly Glu Phe Le - #u Val Asn Ala Gln Gly# 350- Glu Asp Val Val Ala Gly Ile Arg Thr Pro Gl - #u Asp Leu Asp Ala Met# 365- Lys Asn Leu Met Pro Gln Ala Tyr Asp Glu Le - #u Val Glu Asn Cys Asn# 380- Ile Leu Glu Ser His Tyr Lys Glu Met Gln As - #p Ile Glu Phe Thr Val385 3 - #90 3 - #95 4 -#00- Gln Glu Asn Arg Leu Trp Met Leu Gln Cys Ar - #g Thr Gly Lys Arg Thr# 415- Gly Lys Ser Ala Val Lys Ile Ala Val Asp Me - #t Val Asn Glu Gly Leu# 430- Val Glu Pro Arg Ser Ala Ile Lys Met Val Gl - #u Pro Gly His Leu Asp# 445- Gln Leu Leu His Pro Gln Phe Glu Asn Pro Se - #r Ala Tyr Lys Asp Gln# 460- Val Ile Ala Thr Gly Leu Pro Ala Ser Pro Gl - #y Ala Ala Val Gly Gln465 4 - #70 4 - #75 4 -#80- Val Val Phe Thr Ala Glu Asp Ala Glu Ala Tr - #p His Ser Gln Gly Lys# 495- Ala Ala Ile Leu Val Arg Ala Glu Thr Ser Pr - #o Glu Asp Val Gly Gly# 510- Met His Ala Ala Val Gly Ile Leu Thr Glu Ar - #g Gly Gly Met Thr Ser# 525- His Ala Ala Val Val Ala Arg Trp Trp Gly Ly - #s Cys Cys Val Ser Gly# 540- Cys Ser Gly Ile Arg Val Asn Asp Ala Glu Ly - #s Leu Val Thr Ile Gly545 5 - #50 5 - #55 5 -#60- Ser His Val Leu Arg Glu Gly Glu Trp Leu Se - #r Leu Asn Gly Ser Thr# 575- Gly Glu Val Ile Leu Gly Lys Gln Pro Leu Se - #r Pro Pro Ala Leu Ser# 590- Gly Asp Leu Gly Thr Phe Met Ala Trp Val As - #p Asp Val Arg Lys Leu# 605- Lys Val Leu Ala Asn Ala Asp Thr Pro Asp As - #p Ala Leu Thr Ala Arg# 620- Asn Asn Gly Ala Gln Gly Ile Gly Leu Cys Ar - #g Thr Glu His Met Phe625 6 - #30 6 - #35 6 -#40- Phe Ala Ser Asp Glu Arg Ile Lys Ala Val Ar - #g Gln Met Ile Met Ala# 655- Pro Thr Leu Glu Leu Arg Gln Gln Ala Leu As - #p Arg Leu Leu Thr Tyr# 670- Gln Arg Ser Asp Phe Glu Gly Ile Phe Arg Al - #a Met Asp Gly Leu Pro# 685- Val Thr Ile Arg Leu Leu Asp His Pro Ser Ty - #r Glu Phe Leu Pro Glu# 700- Gly Asn Ile Glu Asp Ile Val Ser Glu Leu Cy - #s Ala Glu Thr Gly Ala705 7 - #10 7 - #15 7 -#20- Asn Gln Glu Asp Ala Leu Ala Arg Ile Glu Ly - #s Leu Ser Glu Val Asn# 735- Pro Met Leu Gly Phe Arg Gly Cys Arg Leu Gl - #y Ile Ser Tyr Pro Glu# 750- Leu Thr Glu Met Gln Ala Arg Ala Ile Phe Gl - #u Ala Ala Ile Ala Met# 765- Thr Asn Gln Gly Val Gln Val Phe Pro Glu Il - #e Met Val Pro Leu Val# 780- Gly Thr Pro Gln Glu Leu Gly His Gln Val Th - #r Leu Ile Arg Gln Val785 7 - #90 7 - #95 8 -#00- Ala Glu Lys Val Phe Ala Asn Val Gly Lys Th - #r Ile Gly Tyr Lys Val# 815- Gly Thr Met Ile Glu Ile Pro Arg Ala Ala Le - #u Val Ala Asp Glu Ile# 830- Ala Glu Gln Ala Glu Phe Phe Ser Phe Gly Th - #r Asn Asp Leu Thr Gln# 845- Met Thr Phe Gly Tyr Ser Arg Asp Asp Val Gl - #y Lys Phe Ile Pro Val# 860- His Leu Ala Gln Gly Ile Leu Gln His Asp Pr - #o Phe Glu Val Leu Asp865 8 - #70 8 - #75 8 -#80- Gln Arg Gly Val Gly Glu Leu Val Lys Phe Al - #a Thr Glu Arg Gly Arg# 895- Lys Ala Arg Pro Asn Leu Lys Val Gly Ile Cy - #s Gly Glu His Gly Gly# 910- Glu Pro Ser Ser Val Ala Phe Phe Ala Lys Al - #a Gly Leu Asp Phe Val# 925- Ser Cys Ser Pro Phe Arg Val Pro Ile Ala Ar - #g Leu Ala Ala Ala Gln# 940- Val Leu Val945- (2) INFORMATION FOR SEQ ID NO:5:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 2610 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 70..2589- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:- GAATTCTCAA TCCTTTGCTC ATCGCAGCAT ATCAATGTTA ACACATAAAC TT - #TAGGAGGA 60- AGAAAACTT ATG GCA AAA TGG GTT TAT AAG TTC GAA - # GAA GGC AAT GCA 108#Tyr Lys Phe Glu Glu Gly Asn Ala# 10- TCT ATG AGA AAC CTT CTT GGA GGC AAA GGC TG - #C AAC CTT GCA GAG ATG 156Ser Met Arg Asn Leu Leu Gly Gly Lys Gly Cy - #s Asn Leu Ala Glu Met# 25- ACC ATC TTA GGA ATG CCG ATT CCA CAG GGC TT - #T ACT GTA ACA ACA GAA 204Thr Ile Leu Gly Met Pro Ile Pro Gln Gly Ph - #e Thr Val Thr Thr Glu#45- GCT TGT ACA GAG TAC TAC AAC AGT GGA AAA CA - #G ATC ACA CAG GAA ATT 252Ala Cys Thr Glu Tyr Tyr Asn Ser Gly Lys Gl - #n Ile Thr Gln Glu Ile# 60- CAG GAT CAG ATT TTC GAA GCT ATC ACA TGG TT - #A GAG GAA CTG AAC GGC 300Gln Asp Gln Ile Phe Glu Ala Ile Thr Trp Le - #u Glu Glu Leu Asn Gly# 75- AAG AAG TTC GGC GAC ACT GAA GAT CCG TTA TT - #A GTA TCT GTA CGT TCC 348Lys Lys Phe Gly Asp Thr Glu Asp Pro Leu Le - #u Val Ser Val Arg Ser# 90- GCG GCC CGC GCA TCC ATG CCG GGT ATG ATG GA - #T ACC ATC CTG AAC CTT 396Ala Ala Arg Ala Ser Met Pro Gly Met Met As - #p Thr Ile Leu Asn Leu# 105- GGT TTA AAC GAC GTT GCA GTA GAG GGC TTT GC - #A AAG AAA ACG GGA AAT 444Gly Leu Asn Asp Val Ala Val Glu Gly Phe Al - #a Lys Lys Thr Gly Asn110 1 - #15 1 - #20 1 -#25- CCA AGA TTT GCA TAT GAT TCT TAC AGA AGA TT - #T ATC CAG ATG TAT TCC 492Pro Arg Phe Ala Tyr Asp Ser Tyr Arg Arg Ph - #e Ile Gln Met Tyr Ser# 140- GAC GTA GTT ATG GAA GTT CCG AAG TCC CAT TT - #C GAG AAA ATC ATC GAT 540Asp Val Val Met Glu Val Pro Lys Ser His Ph - #e Glu Lys Ile Ile Asp# 155- GCG ATG AAA GAA GAA AAG GGC GTT CAC TTC GA - #T ACA GAC CTG ACT GCC 588Ala Met Lys Glu Glu Lys Gly Val His Phe As - #p Thr Asp Leu Thr Ala# 170- GAT GAT TTA AAA GAG CTG GCT GAG AAG TTC AA - #A GCT GTT TAC AAA GAG 636Asp Asp Leu Lys Glu Leu Ala Glu Lys Phe Ly - #s Ala Val Tyr Lys Glu# 185- GCT ATG AAC GGC GAA GAG TTC CCA CAG GAG CC - #G AAG GAT CAG TTA ATG 684Ala Met Asn Gly Glu Glu Phe Pro Gln Glu Pr - #o Lys Asp Gln Leu Met190 1 - #95 2 - #00 2 -#05- GGC GCT GTT AAA GCA GTT TTC CGT TCC TGG GA - #C AAC CCT CGT GCA ATC 732Gly Ala Val Lys Ala Val Phe Arg Ser Trp As - #p Asn Pro Arg Ala Ile# 220- GTA TAC CGC CGT ATG AAC GAT ATC CCT GGA GA - #C TGG GGT ACT GCA GTT 780Val Tyr Arg Arg Met Asn Asp Ile Pro Gly As - #p Trp Gly Thr Ala Val# 235- AAC GTT CAG ACC ATG GTA TTT GGT AAC AAG GG - #C GAG ACC AGC GGT ACA 828Asn Val Gln Thr Met Val Phe Gly Asn Lys Gl - #y Glu Thr Ser Gly Thr# 250- GGC GTT GCC TTC ACA CGT AAC CCA TCC ACA GG - #T GAA AAA GGC ATC TAC 876Gly Val Ala Phe Thr Arg Asn Pro Ser Thr Gl - #y Glu Lys Gly Ile Tyr# 265- GGT GAG TAC CTG ATC AAT GCA CAG GGC GAG GA - #C GTA GTT GCA GGT GTC 924Gly Glu Tyr Leu Ile Asn Ala Gln Gly Glu As - #p Val Val Ala Gly Val270 2 - #75 2 - #80 2 -#85- CGC ACA CCA CAG CCT ATC ACC CAG TTA GAG AA - #C GAT ATG CCT GAC TGC 972Arg Thr Pro Gln Pro Ile Thr Gln Leu Glu As - #n Asp Met Pro Asp Cys# 300- TAC AAG CAG TTC ATG GAT CTG GCC ATG AAG CT - #G GAG AAA CAT TTC CGT1020Tyr Lys Gln Phe Met Asp Leu Ala Met Lys Le - #u Glu Lys His Phe Arg# 315- GAC ATG CAG GAT ATG GAG TTC ACA ATC GAG GA - #A GGT AAA TTA TAC TTC1068Asp Met Gln Asp Met Glu Phe Thr Ile Glu Gl - #u Gly Lys Leu Tyr Phe# 330- TTA CAG ACA CGT AAC GGC AAG AGA ACA GCT CC - #G GCT GCT CTT CAG ATT1116Leu Gln Thr Arg Asn Gly Lys Arg Thr Ala Pr - #o Ala Ala Leu Gln Ile# 345- GCC TGC GAT TTA GTA GAC GAA GGC ATG ATC AC - #A GAG GAA GAG GCT GTT1164Ala Cys Asp Leu Val Asp Glu Gly Met Ile Th - #r Glu Glu Glu Ala Val350 3 - #55 3 - #60 3 -#65- GTA AGA ATC GAA GCA AAA TCT CTT GAT CAG TT - #A CTT CAC CCG ACC TTC1212Val Arg Ile Glu Ala Lys Ser Leu Asp Gln Le - #u Leu His Pro Thr Phe# 380- AAC CCG GCT GCT TTA AAG GCC GGC GAA GTA AT - #C GGT TCC GCT CTT CCG1260Asn Pro Ala Ala Leu Lys Ala Gly Glu Val Il - #e Gly Ser Ala Leu Pro# 395- GCA TCT CCT GGC GCA GCA GCA GGT AAA GTA TA - #C TTC ACC GCT GAT GAG1308Ala Ser Pro Gly Ala Ala Ala Gly Lys Val Ty - #r Phe Thr Ala Asp Glu# 410- GCT AAG GCT GCC CAC GAG AAG GGT GAG AGA GT - #T ATC CTT GTT CGT CTT1356Ala Lys Ala Ala His Glu Lys Gly Glu Arg Va - #l Ile Leu Val Arg Leu# 425- GAG ACA TCT CCG GAA GAT ATC GAA GGT ATG CA - #T GCA GCC GAA GGT ATC1404Glu Thr Ser Pro Glu Asp Ile Glu Gly Met Hi - #s Ala Ala Glu Gly Ile430 4 - #35 4 - #40 4 -#45- CTG ACA GTG CGC GGC GGT ATG ACA AGC CAT GC - #A GCC GTA GTT GCA CGT1452Leu Thr Val Arg Gly Gly Met Thr Ser His Al - #a Ala Val Val Ala Arg# 460- GGT ATG GGA ACA TGC TGC GTA TCC GGA TGC GG - #T GAG ATC AAG ATC AAC1500Gly Met Gly Thr Cys Cys Val Ser Gly Cys Gl - #y Glu Ile Lys Ile Asn# 475- GAA GAA GCT AAG ACA TTC GAA CTT GGC GGA CA - #C ACA TTT GCA GAG GGA1548Glu Glu Ala Lys Thr Phe Glu Leu Gly Gly Hi - #s Thr Phe Ala Glu Gly# 490- GAT TAC ATC TCC TTA GAT GGT TCC ACA GGT AA - #G ATT TAC AAG GGC GAC1596Asp Tyr Ile Ser Leu Asp Gly Ser Thr Gly Ly - #s Ile Tyr Lys Gly Asp# 505- ATC GAG ACT CAG GAA CGT TCC GTA AGC GGA AG - #C TTC GAG CGT ATC ATG1644Ile Glu Thr Gln Glu Arg Ser Val Ser Gly Se - #r Phe Glu Arg Ile Met510 5 - #15 5 - #20 5 -#25- GTA TGG GCT GAC AAG TTC AGA ACA TTA AAG GT - #T CGT ACA AAT GCC GAC1692Val Trp Ala Asp Lys Phe Arg Thr Leu Lys Va - #l Arg Thr Asn Ala Asp# 540- ACA CCG GAA GAT ACA CTC AAT GCC GTT AAA CT - #G GGT GCA GAG GGC ATC1740Thr Pro Glu Asp Thr Leu Asn Ala Val Lys Le - #u Gly Ala Glu Gly Ile# 555- GGT CTT TGC CGT ACA GAG CAT ATG TTC TTC GA - #G GCT GAC AGA ATC ATG1788Gly Leu Cys Arg Thr Glu His Met Phe Phe Gl - #u Ala Asp Arg Ile Met# 570- AAG ATC AGA AAG ATG ATC CTT TCC GAT TCA GT - #G GAA GCA AGA GAA GAG1836Lys Ile Arg Lys Met Ile Leu Ser Asp Ser Va - #l Glu Ala Arg Glu Glu# 585- GCT CTG AAC GAA TTA ATC CCG TTC CAG AAG GG - #C GAT TTC AAG GCT ATG1884Ala Leu Asn Glu Leu Ile Pro Phe Gln Lys Gl - #y Asp Phe Lys Ala Met590 5 - #95 6 - #00 6 -#05- TAC AAA GCT CTG GAA GGC AGG CCA ATG ACG GT - #T CGC TAC CTG GAT CCG1932Tyr Lys Ala Leu Glu Gly Arg Pro Met Thr Va - #l Arg Tyr Leu Asp Pro# 620- CCG CTG CAT GAG TTC GTT CCT CAT ACA GAA GA - #G GAG CAG GCT GAA CTG1980Pro Leu His Glu Phe Val Pro His Thr Glu Gl - #u Glu Gln Ala Glu Leu# 635- GCT AAG AAC ATG GGC CTT ACT TTA GCA GAA GT - #A AAA GCA AAA GTT GAC2028Ala Lys Asn Met Gly Leu Thr Leu Ala Glu Va - #l Lys Ala Lys Val Asp# 650- GAA TTA CAC GAG TTC AAC CCA ATG ATG GGC CA - #T CGT GGC TGC CGT CTT2076Glu Leu His Glu Phe Asn Pro Met Met Gly Hi - #s Arg Gly Cys Arg Leu# 665- GCA GTT ACC TAT CCG GAA ATT GCA AAG ATG CA - #G ACA AGA GCC GTT ATG2124Ala Val Thr Tyr Pro Glu Ile Ala Lys Met Gl - #n Thr Arg Ala Val Met670 6 - #75 6 - #80 6 -#85- GAA GCT GCT ATC GAA GTG AAG GAA GAG ACA GG - #A ATC GAT ATT GTT CCT2172Glu Ala Ala Ile Glu Val Lys Glu Glu Thr Gl - #y Ile Asp Ile Val Pro# 700- GAG ATC ATG ATT CCG TTA GTT GGC GAG AAG AA - #A GAG CTT AAG TTC GTT2220Glu Ile Met Ile Pro Leu Val Gly Glu Lys Ly - #s Glu Leu Lys Phe Val# 715- AAG GAC GTA GTT GTG GAA GTA GCT GAG CAG GT - #T AAG AAA GAG AAA GGT2268Lys Asp Val Val Val Glu Val Ala Glu Gln Va - #l Lys Lys Glu Lys Gly# 730- TCC GAT ATG CAG TAC CAC ATC GGT ACC ATG AT - #C GAA ATT CCT CGT GCA2316Ser Asp Met Gln Tyr His Ile Gly Thr Met Il - #e Glu Ile Pro Arg Ala# 745- GCT CTC ACA GCA GAT GCC ATC GCT GAG GAA GC - #A GAG TTC TTC TCC TTC2364Ala Leu Thr Ala Asp Ala Ile Ala Glu Glu Al - #a Glu Phe Phe Ser Phe750 7 - #55 7 - #60 7 -#65- GGT ACA AAC GAC TTA ACA CAG ATG ACA TTC GG - #C TTC TCC CGT GAC GAC2412Gly Thr Asn Asp Leu Thr Gln Met Thr Phe Gl - #y Phe Ser Arg Asp Asp# 780- GCC GGC AAG TTC CTG GAT TCC TAC TAT AAA GC - #A AAA ATT TAT GAG TCC2460Ala Gly Lys Phe Leu Asp Ser Tyr Tyr Lys Al - #a Lys Ile Tyr Glu Ser# 795- GAT CCA TTC GCA AGA CTT GAC CAG ACA GGC GT - #T GGC CAG TTA GTA GAG2508Asp Pro Phe Ala Arg Leu Asp Gln Thr Gly Va - #l Gly Gln Leu Val Glu# 810- ATG GCA GTT AAG AAA GGC CGT CAG ACA CGT CC - #G GGC CTT AAG TGC GGC2556Met Ala Val Lys Lys Gly Arg Gln Thr Arg Pr - #o Gly Leu Lys Cys Gly# 825- ATC TGC GGC GAG CAC GGC GAG ATC CTT CTT CC - #G TAGAGTTCTG CCACAAAGTA2609Ile Cys Gly Glu His Gly Glu Ile Leu Leu Pr - #o830 8 - #35 8 - #40# 2610- (2) INFORMATION FOR SEQ ID NO:6:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 840 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:- Met Ala Lys Trp Val Tyr Lys Phe Glu Glu Gl - #y Asn Ala Ser Met Arg# 15- Asn Leu Leu Gly Gly Lys Gly Cys Asn Leu Al - #a Glu Met Thr Ile Leu# 30- Gly Met Pro Ile Pro Gln Gly Phe Thr Val Th - #r Thr Glu Ala Cys Thr# 45- Glu Tyr Tyr Asn Ser Gly Lys Gln Ile Thr Gl - #n Glu Ile Gln Asp Gln# 60- Ile Phe Glu Ala Ile Thr Trp Leu Glu Glu Le - #u Asn Gly Lys Lys Phe# 80- Gly Asp Thr Glu Asp Pro Leu Leu Val Ser Va - #l Arg Ser Ala Ala Arg# 95- Ala Ser Met Pro Gly Met Met Asp Thr Ile Le - #u Asn Leu Gly Leu Asn# 110- Asp Val Ala Val Glu Gly Phe Ala Lys Lys Th - #r Gly Asn Pro Arg Phe# 125- Ala Tyr Asp Ser Tyr Arg Arg Phe Ile Gln Me - #t Tyr Ser Asp Val Val# 140- Met Glu Val Pro Lys Ser His Phe Glu Lys Il - #e Ile Asp Ala Met Lys145 1 - #50 1 - #55 1 -#60- Glu Glu Lys Gly Val His Phe Asp Thr Asp Le - #u Thr Ala Asp Asp Leu# 175- Lys Glu Leu Ala Glu Lys Phe Lys Ala Val Ty - #r Lys Glu Ala Met Asn# 190- Gly Glu Glu Phe Pro Gln Glu Pro Lys Asp Gl - #n Leu Met Gly Ala Val# 205- Lys Ala Val Phe Arg Ser Trp Asp Asn Pro Ar - #g Ala Ile Val Tyr Arg# 220- Arg Met Asn Asp Ile Pro Gly Asp Trp Gly Th - #r Ala Val Asn Val Gln225 2 - #30 2 - #35 2 -#40- Thr Met Val Phe Gly Asn Lys Gly Glu Thr Se - #r Gly Thr Gly Val Ala# 255- Phe Thr Arg Asn Pro Ser Thr Gly Glu Lys Gl - #y Ile Tyr Gly Glu Tyr# 270- Leu Ile Asn Ala Gln Gly Glu Asp Val Val Al - #a Gly Val Arg Thr Pro# 285- Gln Pro Ile Thr Gln Leu Glu Asn Asp Met Pr - #o Asp Cys Tyr Lys Gln# 300- Phe Met Asp Leu Ala Met Lys Leu Glu Lys Hi - #s Phe Arg Asp Met Gln305 3 - #10 3 - #15 3 -#20- Asp Met Glu Phe Thr Ile Glu Glu Gly Lys Le - #u Tyr Phe Leu Gln Thr# 335- Arg Asn Gly Lys Arg Thr Ala Pro Ala Ala Le - #u Gln Ile Ala Cys Asp# 350- Leu Val Asp Glu Gly Met Ile Thr Glu Glu Gl - #u Ala Val Val Arg Ile# 365- Glu Ala Lys Ser Leu Asp Gln Leu Leu His Pr - #o Thr Phe Asn Pro Ala# 380- Ala Leu Lys Ala Gly Glu Val Ile Gly Ser Al - #a Leu Pro Ala Ser Pro385 3 - #90 3 - #95 4 -#00- Gly Ala Ala Ala Gly Lys Val Tyr Phe Thr Al - #a Asp Glu Ala Lys Ala# 415- Ala His Glu Lys Gly Glu Arg Val Ile Leu Va - #l Arg Leu Glu Thr Ser# 430- Pro Glu Asp Ile Glu Gly Met His Ala Ala Gl - #u Gly Ile Leu Thr Val# 445- Arg Gly Gly Met Thr Ser His Ala Ala Val Va - #l Ala Arg Gly Met Gly# 460- Thr Cys Cys Val Ser Gly Cys Gly Glu Ile Ly - #s Ile Asn Glu Glu Ala465 4 - #70 4 - #75 4 -#80- Lys Thr Phe Glu Leu Gly Gly His Thr Phe Al - #a Glu Gly Asp Tyr Ile# 495- Ser Leu Asp Gly Ser Thr Gly Lys Ile Tyr Ly - #s Gly Asp Ile Glu Thr# 510- Gln Glu Arg Ser Val Ser Gly Ser Phe Glu Ar - #g Ile Met Val Trp Ala# 525- Asp Lys Phe Arg Thr Leu Lys Val Arg Thr As - #n Ala Asp Thr Pro Glu# 540- Asp Thr Leu Asn Ala Val Lys Leu Gly Ala Gl - #u Gly Ile Gly Leu Cys545 5 - #50 5 - #55 5 -#60- Arg Thr Glu His Met Phe Phe Glu Ala Asp Ar - #g Ile Met Lys Ile Arg# 575- Lys Met Ile Leu Ser Asp Ser Val Glu Ala Ar - #g Glu Glu Ala Leu Asn# 590- Glu Leu Ile Pro Phe Gln Lys Gly Asp Phe Ly - #s Ala Met Tyr Lys Ala# 605- Leu Glu Gly Arg Pro Met Thr Val Arg Tyr Le - #u Asp Pro Pro Leu His# 620- Glu Phe Val Pro His Thr Glu Glu Glu Gln Al - #a Glu Leu Ala Lys Asn625 6 - #30 6 - #35 6 -#40- Met Gly Leu Thr Leu Ala Glu Val Lys Ala Ly - #s Val Asp Glu Leu His# 655- Glu Phe Asn Pro Met Met Gly His Arg Gly Cy - #s Arg Leu Ala Val Thr# 670- Tyr Pro Glu Ile Ala Lys Met Gln Thr Arg Al - #a Val Met Glu Ala Ala# 685- Ile Glu Val Lys Glu Glu Thr Gly Ile Asp Il - #e Val Pro Glu Ile Met# 700- Ile Pro Leu Val Gly Glu Lys Lys Glu Leu Ly - #s Phe Val Lys Asp Val705 7 - #10 7 - #15 7 -#20- Val Val Glu Val Ala Glu Gln Val Lys Lys Gl - #u Lys Gly Ser Asp Met# 735- Gln Tyr His Ile Gly Thr Met Ile Glu Ile Pr - #o Arg Ala Ala Leu Thr# 750- Ala Asp Ala Ile Ala Glu Glu Ala Glu Phe Ph - #e Ser Phe Gly Thr Asn# 765- Asp Leu Thr Gln Met Thr Phe Gly Phe Ser Ar - #g Asp Asp Ala Gly Lys# 780- Phe Leu Asp Ser Tyr Tyr Lys Ala Lys Ile Ty - #r Glu Ser Asp Pro Phe785 7 - #90 7 - #95 8 -#00- Ala Arg Leu Asp Gln Thr Gly Val Gly Gln Le - #u Val Glu Met Ala Val# 815- Lys Lys Gly Arg Gln Thr Arg Pro Gly Leu Ly - #s Cys Gly Ile Cys Gly# 830- Glu His Gly Glu Ile Leu Leu Pro# 840- (2) INFORMATION FOR SEQ ID NO:7:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 2722 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 48..2702- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:#CAA AGA 56ATTTGT AAGAATTTAG AGTTCATTCA GATAATA ATG#Gln Arg Met# 1- GTA TAT GCT TTC GAA GAT GGT GAT GGA ACC AA - #C AAG AAA CTC CTT GGA 104Val Tyr Ala Phe Glu Asp Gly Asp Gly Thr As - #n Lys Lys Leu Leu Gly# 15- GGA AAG GGA GCT GGA CTT TGC ACA ATG ACA AA - #A ATT GGA CTT CCA GTT 152Gly Lys Gly Ala Gly Leu Cys Thr Met Thr Ly - #s Ile Gly Leu Pro Val#35- CCA CAA GGA TTT GTT ATT ACA ACT GAA ATG TG - #T AAA CAA TTC ATT GCT 200Pro Gln Gly Phe Val Ile Thr Thr Glu Met Cy - #s Lys Gln Phe Ile Ala# 50- AAT GGA AAC AAA ATG CCA GAA GGA TTA ATG GA - #A GAA GTT AAA AAA GAA 248Asn Gly Asn Lys Met Pro Glu Gly Leu Met Gl - #u Glu Val Lys Lys Glu# 65- TAT CAA TTA GTT GAA AAG AAA TCA GGA AAA GT - #C TTT GGA GGA GAA GAA 296Tyr Gln Leu Val Glu Lys Lys Ser Gly Lys Va - #l Phe Gly Gly Glu Glu# 80- AAT CCA CTT CTT GTT TCA GTC AGA TCA GGA GC - #T GCT ATG TCT ATG CCA 344Asn Pro Leu Leu Val Ser Val Arg Ser Gly Al - #a Ala Met Ser Met Pro# 95- GGT ATG ATG GAT ACT ATT CTT AAT CTT GGA CT - #T AAT GAT AAA ACT GTT 392Gly Met Met Asp Thr Ile Leu Asn Leu Gly Le - #u Asn Asp Lys Thr Val100 1 - #05 1 - #10 1 -#15- GTT GCT CTT GCT AAA TTA ACC AAC AAT GAA AG - #A TTT GCA TAT GAT TCA 440Val Ala Leu Ala Lys Leu Thr Asn Asn Glu Ar - #g Phe Ala Tyr Asp Ser# 130- TAC AGA AGA TTT GTT TCC CTC TTC GGA AAG AT - #T GCT CTT AAT GCT TGT 488Tyr Arg Arg Phe Val Ser Leu Phe Gly Lys Il - #e Ala Leu Asn Ala Cys# 145- GAT GAA GTT TAT GAT AAG ACT CTT GAA AAC AA - #A AAA GTT GAA AAG GGA 536Asp Glu Val Tyr Asp Lys Thr Leu Glu Asn Ly - #s Lys Val Glu Lys Gly# 160- GTT AAA TTA GAT ACT GAA TTA GAT GCT AAT GA - #T ATG AAA GAA CTT GCA 584Val Lys Leu Asp Thr Glu Leu Asp Ala Asn As - #p Met Lys Glu Leu Ala# 175- CAA GTC TTC ATT AAA AAG ACT GAA GAA TTC AC - #T AAA CAA CCA TTC CCA 632Gln Val Phe Ile Lys Lys Thr Glu Glu Phe Th - #r Lys Gln Pro Phe Pro180 1 - #85 1 - #90 1 -#95- GTT GAT CCA TAT GCT CAA TTA GAA TTT GCC AT - #T TGT GCT GTA TTC AGA 680Val Asp Pro Tyr Ala Gln Leu Glu Phe Ala Il - #e Cys Ala Val Phe Arg# 210- TCA TGG ATG GGA AAG AGA GCT GTT GAT TAC AG - #A AGA GAA TTC AAG ATT 728Ser Trp Met Gly Lys Arg Ala Val Asp Tyr Ar - #g Arg Glu Phe Lys Ile# 225- ACT CCA GAA CAA GCT GAT GGA ACT GCT GTT TC - #A GTT GTT TCT ATG GTT 776Thr Pro Glu Gln Ala Asp Gly Thr Ala Val Se - #r Val Val Ser Met Val# 240- TAT GGT AAT ATG GGT AAT GAT TCA GCT ACT GG - #T GTT TGT TTC ACT AGA 824Tyr Gly Asn Met Gly Asn Asp Ser Ala Thr Gl - #y Val Cys Phe Thr Arg# 255- GAT CCA GGA ACA GGA GAA AAT ATG TTC TTC GG - #A GAA TAT CTT AAG AAT 872Asp Pro Gly Thr Gly Glu Asn Met Phe Phe Gl - #y Glu Tyr Leu Lys Asn260 2 - #65 2 - #70 2 -#75- GCA CAA GGA GAA GAT GTT GTT GCT GGT ATT AG - #A ACA CCA CAA ATT ATT 920Ala Gln Gly Glu Asp Val Val Ala Gly Ile Ar - #g Thr Pro Gln Ile Ile# 290- TCA AAG ATG GCA GAA GAT CGA GAT CTT CCA GG - #T TGC TAT GAA CAA CTT 968Ser Lys Met Ala Glu Asp Arg Asp Leu Pro Gl - #y Cys Tyr Glu Gln Leu# 305- CTT GAT ATT AGA AAG AAA TTA GAA GGA TAT TT - #C CAT GAA GTA CAA GAC1016Leu Asp Ile Arg Lys Lys Leu Glu Gly Tyr Ph - #e His Glu Val Gln Asp# 320- TTT GAA TTC ACT ATT GAA AGA AAG AAA CTT TA - #C ATG CTC CAA ACT AGA1064Phe Glu Phe Thr Ile Glu Arg Lys Lys Leu Ty - #r Met Leu Gln Thr Arg# 335- AAT GGA AAG ATG AAT GCA ACT GCT ACT GTC AG - #A ACA GGA GTT GAT ATG1112Asn Gly Lys Met Asn Ala Thr Ala Thr Val Ar - #g Thr Gly Val Asp Met340 3 - #45 3 - #50 3 -#55- GTT GAA GAA GGA CTT ATT ACA AAA GAA CAA GC - #C ATT ATG AGA ATT GCA1160Val Glu Glu Gly Leu Ile Thr Lys Glu Gln Al - #a Ile Met Arg Ile Ala# 370- CCA CAA TCA GTT GAT CAA TTA CTT CAT AAG AA - #T ATG CCA GCT AAT TAT1208Pro Gln Ser Val Asp Gln Leu Leu His Lys As - #n Met Pro Ala Asn Tyr# 385- GCA GAA GCT CCA TTA GTT AAA GGA CTT CCA GC - #A TCA CCA GGA GCT GCT1256Ala Glu Ala Pro Leu Val Lys Gly Leu Pro Al - #a Ser Pro Gly Ala Ala# 400- ACA GGA GCT GTT GTT TTT GAT GCC GAT GAT GC - #A GTT GAA CAA GCT AAA1304Thr Gly Ala Val Val Phe Asp Ala Asp Asp Al - #a Val Glu Gln Ala Lys# 415- GGA AAG AAA GTT CTT CTT CTT AGA GAA GAA AC - #T AAA CCA GAA GAT ATT1352Gly Lys Lys Val Leu Leu Leu Arg Glu Glu Th - #r Lys Pro Glu Asp Ile420 4 - #25 4 - #30 4 -#35- CAT GGA TTC TTT GTT GCT GAA GGT ATT TTA AC - #C TGC AGA GGA GGA AAA1400His Gly Phe Phe Val Ala Glu Gly Ile Leu Th - #r Cys Arg Gly Gly Lys# 450- ACA TCA CAC GCA GCT GTC GTT GCT AGA GGT AT - #G GGT AAA CCA TGT GTT1448Thr Ser His Ala Ala Val Val Ala Arg Gly Me - #t Gly Lys Pro Cys Val# 465- TCA GGA GCT GAA GGA ATT AAA GTT GAT GTT GC - #T AAG AAA ATT GCT AAG1496Ser Gly Ala Glu Gly Ile Lys Val Asp Val Al - #a Lys Lys Ile Ala Lys# 480- ATT GGA AGC CTT GAA GTT CAT GAA GGA GAT AT - #T TTA ACT ATT GAT GGA1544Ile Gly Ser Leu Glu Val His Glu Gly Asp Il - #e Leu Thr Ile Asp Gly# 495- TCA ACT GGA TGT GTC TAT AAG GGA GAA GTT CC - #A TTA GAA GAA CCA CAA1592Ser Thr Gly Cys Val Tyr Lys Gly Glu Val Pr - #o Leu Glu Glu Pro Gln500 5 - #05 5 - #10 5 -#15- GTT GGA TCA GGA TAT TTC GGA ACC ATC TTA AA - #A TGG GCC AAT GAA ATT1640Val Gly Ser Gly Tyr Phe Gly Thr Ile Leu Ly - #s Trp Ala Asn Glu Ile# 530- AAA AAG ATT GGA GTT TTT GCT GCT GGA GAT CT - #T CCA TCA GCT GCT AAG1688Lys Lys Ile Gly Val Phe Ala Ala Gly Asp Le - #u Pro Ser Ala Ala Lys# 545- AAA GCC CTT GAA TTT GGA GCT GAA GGT ATT GG - #A CTT TGC AGA ACT GAA1736Lys Ala Leu Glu Phe Gly Ala Glu Gly Ile Gl - #y Leu Cys Arg Thr Glu# 560- CGT ATG TTC AAT GCA GTT GAA AGA CTT CCA AT - #T GTT GTC AAG ATG ATT1784Arg Met Phe Asn Ala Val Glu Arg Leu Pro Il - #e Val Val Lys Met Ile# 575- CTT TCA AAT ACC CTT GAA GAA AGA AAG AAA TA - #T CTT AAT GAA CTT ATG1832Leu Ser Asn Thr Leu Glu Glu Arg Lys Lys Ty - #r Leu Asn Glu Leu Met580 5 - #85 5 - #90 5 -#95- CCA CTT CAA AAA CAA GAT TTC ATT GGA TTA TT - #G AAG ACT ATG AAT GGA1880Pro Leu Gln Lys Gln Asp Phe Ile Gly Leu Le - #u Lys Thr Met Asn Gly# 610- CTT CCA GTC ACT GTC AGA CTT CTT GAT CCA CC - #A TTA CAT GAA TTC CTC1928Leu Pro Val Thr Val Arg Leu Leu Asp Pro Pr - #o Leu His Glu Phe Leu# 625- CCA ACT CTT GAA GAG TTA ATG AGA GAA ATC TT - #T GAA ATG AAA CTT TCA1976Pro Thr Leu Glu Glu Leu Met Arg Glu Ile Ph - #e Glu Met Lys Leu Ser# 640- GGT AAG ACT GAA GGA CTT GCA GAA AAA GAA GT - #T GTT CTT AAG AAA GTT2024Gly Lys Thr Glu Gly Leu Ala Glu Lys Glu Va - #l Val Leu Lys Lys Val# 655- AAA GAA CTT ATG GAA GTT AAT CCA ATG ATT GG - #A CAC AGA GGA ATT AGA2072Lys Glu Leu Met Glu Val Asn Pro Met Ile Gl - #y His Arg Gly Ile Arg660 6 - #65 6 - #70 6 -#75- CTT GGA ACT ACT AAT CCA GAA ATT TAT GAA AT - #G CAA ATT AGA GCA TTC2120Leu Gly Thr Thr Asn Pro Glu Ile Tyr Glu Me - #t Gln Ile Arg Ala Phe# 690- TTA GAA GCT ACT CGT GAA GTT ATT AAG GAA GG - #A ATT AAC GAT CAT CGA2168Leu Glu Ala Thr Arg Glu Val Ile Lys Glu Gl - #y Ile Asn Asp His Arg# 705- GAA ATT ATG ATT CCA AAT GTT ACA GAA GTT AA - #T GAA CTT ATT AAC TTA2216Glu Ile Met Ile Pro Asn Val Thr Glu Val As - #n Glu Leu Ile Asn Leu# 720- AGA AAG AAT GTT CTT GAA CCA GTT CAT GAA GA - #A GTT GAA AAG AAA TAT2264Arg Lys Asn Val Leu Glu Pro Val His Glu Gl - #u Val Glu Lys Lys Tyr# 735- GGT ATT AAA GTA CCA TTC TCG TAT GGT ACT AT - #G GTT GAA TGT GTT AGA2312Gly Ile Lys Val Pro Phe Ser Tyr Gly Thr Me - #t Val Glu Cys Val Arg740 7 - #45 7 - #50 7 -#55- GCA GCA TTA ACA GCT GAT AAG ATT GCT ACA GA - #A GCT TCA TTC TTC TCA2360Ala Ala Leu Thr Ala Asp Lys Ile Ala Thr Gl - #u Ala Ser Phe Phe Ser# 770- TTC GGA ACT AAT GAT CTT ACA CAA GGA ACA TT - #C TCA TAC TCA CGT GAA2408Phe Gly Thr Asn Asp Leu Thr Gln Gly Thr Ph - #e Ser Tyr Ser Arg Glu# 785- GAT TCA GAA AAC AAA TTC ATT CCA AAA TAT GT - #T GAA CTT AAG ATT CTT2456Asp Ser Glu Asn Lys Phe Ile Pro Lys Tyr Va - #l Glu Leu Lys Ile Leu# 800- CCA GCT AAT CCA TTT GAA ATT CTT GAT AGA CC - #A GGT GTT GGA GAA GTT2504Pro Ala Asn Pro Phe Glu Ile Leu Asp Arg Pr - #o Gly Val Gly Glu Val# 815- ATG AGA ATT GCT GTT ACT AAA GGA AGA CAA AC - #A AGA CCA GAA TTA CTT2552Met Arg Ile Ala Val Thr Lys Gly Arg Gln Th - #r Arg Pro Glu Leu Leu820 8 - #25 8 - #30 8 -#35- GTT GGT ATT TGT GGA GAA CAC GGA GGA GAA CC - #A TCA TCA ATT GAA TGG2600Val Gly Ile Cys Gly Glu His Gly Gly Glu Pr - #o Ser Ser Ile Glu Trp# 850- TGC CAC ATG ATT GGA TTG AAC TAT GTT TCA TG - #T TCT TCA TAC AGA ATT2648Cys His Met Ile Gly Leu Asn Tyr Val Ser Cy - #s Ser Ser Tyr Arg Ile# 865- CCA GTT GCT AGA ATT GCT GCT GCT CAA GCC CA - #A ATT AGA CAT CCA AGA2696Pro Val Ala Arg Ile Ala Ala Ala Gln Ala Gl - #n Ile Arg His Pro Arg# 880# 2722 T TTTTTGGTTTGlu Asn 885- (2) INFORMATION FOR SEQ ID NO:8:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 885 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:- Met Gln Arg Val Tyr Ala Phe Glu Asp Gly As - #p Gly Thr Asn Lys Lys# 15- Leu Leu Gly Gly Lys Gly Ala Gly Leu Cys Th - #r Met Thr Lys Ile Gly# 30- Leu Pro Val Pro Gln Gly Phe Val Ile Thr Th - #r Glu Met Cys Lys Gln# 45- Phe Ile Ala Asn Gly Asn Lys Met Pro Glu Gl - #y Leu Met Glu Glu Val# 60- Lys Lys Glu Tyr Gln Leu Val Glu Lys Lys Se - #r Gly Lys Val Phe Gly# 80- Gly Glu Glu Asn Pro Leu Leu Val Ser Val Ar - #g Ser Gly Ala Ala Met# 95- Ser Met Pro Gly Met Met Asp Thr Ile Leu As - #n Leu Gly Leu Asn Asp# 110- Lys Thr Val Val Ala Leu Ala Lys Leu Thr As - #n Asn Glu Arg Phe Ala# 125- Tyr Asp Ser Tyr Arg Arg Phe Val Ser Leu Ph - #e Gly Lys Ile Ala Leu# 140- Asn Ala Cys Asp Glu Val Tyr Asp Lys Thr Le - #u Glu Asn Lys Lys Val145 1 - #50 1 - #55 1 -#60- Glu Lys Gly Val Lys Leu Asp Thr Glu Leu As - #p Ala Asn Asp Met Lys# 175- Glu Leu Ala Gln Val Phe Ile Lys Lys Thr Gl - #u Glu Phe Thr Lys Gln# 190- Pro Phe Pro Val Asp Pro Tyr Ala Gln Leu Gl - #u Phe Ala Ile Cys Ala# 205- Val Phe Arg Ser Trp Met Gly Lys Arg Ala Va - #l Asp Tyr Arg Arg Glu# 220- Phe Lys Ile Thr Pro Glu Gln Ala Asp Gly Th - #r Ala Val Ser Val Val225 2 - #30 2 - #35 2 -#40- Ser Met Val Tyr Gly Asn Met Gly Asn Asp Se - #r Ala Thr Gly Val Cys# 255- Phe Thr Arg Asp Pro Gly Thr Gly Glu Asn Me - #t Phe Phe Gly Glu Tyr# 270- Leu Lys Asn Ala Gln Gly Glu Asp Val Val Al - #a Gly Ile Arg Thr Pro# 285- Gln Ile Ile Ser Lys Met Ala Glu Asp Arg As - #p Leu Pro Gly Cys Tyr# 300- Glu Gln Leu Leu Asp Ile Arg Lys Lys Leu Gl - #u Gly Tyr Phe His Glu305 3 - #10 3 - #15 3 -#20- Val Gln Asp Phe Glu Phe Thr Ile Glu Arg Ly - #s Lys Leu Tyr Met Leu# 335- Gln Thr Arg Asn Gly Lys Met Asn Ala Thr Al - #a Thr Val Arg Thr Gly# 350- Val Asp Met Val Glu Glu Gly Leu Ile Thr Ly - #s Glu Gln Ala Ile Met# 365- Arg Ile Ala Pro Gln Ser Val Asp Gln Leu Le - #u His Lys Asn Met Pro# 380- Ala Asn Tyr Ala Glu Ala Pro Leu Val Lys Gl - #y Leu Pro Ala Ser Pro385 3 - #90 3 - #95 4 -#00- Gly Ala Ala Thr Gly Ala Val Val Phe Asp Al - #a Asp Asp Ala Val Glu# 415- Gln Ala Lys Gly Lys Lys Val Leu Leu Leu Ar - #g Glu Glu Thr Lys Pro# 430- Glu Asp Ile His Gly Phe Phe Val Ala Glu Gl - #y Ile Leu Thr Cys Arg# 445- Gly Gly Lys Thr Ser His Ala Ala Val Val Al - #a Arg Gly Met Gly Lys# 460- Pro Cys Val Ser Gly Ala Glu Gly Ile Lys Va - #l Asp Val Ala Lys Lys465 4 - #70 4 - #75 4 -#80- Ile Ala Lys Ile Gly Ser Leu Glu Val His Gl - #u Gly Asp Ile Leu Thr# 495- Ile Asp Gly Ser Thr Gly Cys Val Tyr Lys Gl - #y Glu Val Pro Leu Glu# 510- Glu Pro Gln Val Gly Ser Gly Tyr Phe Gly Th - #r Ile Leu Lys Trp Ala# 525- Asn Glu Ile Lys Lys Ile Gly Val Phe Ala Al - #a Gly Asp Leu Pro Ser# 540- Ala Ala Lys Lys Ala Leu Glu Phe Gly Ala Gl - #u Gly Ile Gly Leu Cys545 5 - #50 5 - #55 5 -#60- Arg Thr Glu Arg Met Phe Asn Ala Val Glu Ar - #g Leu Pro Ile Val Val# 575- Lys Met Ile Leu Ser Asn Thr Leu Glu Glu Ar - #g Lys Lys Tyr Leu Asn# 590- Glu Leu Met Pro Leu Gln Lys Gln Asp Phe Il - #e Gly Leu Leu Lys Thr# 605- Met Asn Gly Leu Pro Val Thr Val Arg Leu Le - #u Asp Pro Pro Leu His# 620- Glu Phe Leu Pro Thr Leu Glu Glu Leu Met Ar - #g Glu Ile Phe Glu Met625 6 - #30 6 - #35 6 -#40- Lys Leu Ser Gly Lys Thr Glu Gly Leu Ala Gl - #u Lys Glu Val Val Leu# 655- Lys Lys Val Lys Glu Leu Met Glu Val Asn Pr - #o Met Ile Gly His Arg# 670- Gly Ile Arg Leu Gly Thr Thr Asn Pro Glu Il - #e Tyr Glu Met Gln Ile# 685- Arg Ala Phe Leu Glu Ala Thr Arg Glu Val Il - #e Lys Glu Gly Ile Asn# 700- Asp His Arg Glu Ile Met Ile Pro Asn Val Th - #r Glu Val Asn Glu Leu705 7 - #10 7 - #15 7 -#20- Ile Asn Leu Arg Lys Asn Val Leu Glu Pro Va - #l His Glu Glu Val Glu# 735- Lys Lys Tyr Gly Ile Lys Val Pro Phe Ser Ty - #r Gly Thr Met Val Glu# 750- Cys Val Arg Ala Ala Leu Thr Ala Asp Lys Il - #e Ala Thr Glu Ala Ser# 765- Phe Phe Ser Phe Gly Thr Asn Asp Leu Thr Gl - #n Gly Thr Phe Ser Tyr# 780- Ser Arg Glu Asp Ser Glu Asn Lys Phe Ile Pr - #o Lys Tyr Val Glu Leu785 7 - #90 7 - #95 8 -#00- Lys Ile Leu Pro Ala Asn Pro Phe Glu Ile Le - #u Asp Arg Pro Gly Val# 815- Gly Glu Val Met Arg Ile Ala Val Thr Lys Gl - #y Arg Gln Thr Arg Pro# 830- Glu Leu Leu Val Gly Ile Cys Gly Glu His Gl - #y Gly Glu Pro Ser Ser# 845- Ile Glu Trp Cys His Met Ile Gly Leu Asn Ty - #r Val Ser Cys Ser Ser# 860- Tyr Arg Ile Pro Val Ala Arg Ile Ala Ala Al - #a Gln Ala Gln Ile Arg865 8 - #70 8 - #75 8 -#80- His Pro Arg Glu Asn 885- (2) INFORMATION FOR SEQ ID NO:9:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 3180 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 142..3006- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:- CTGAAATTCC CGTAATCTAT CATCATTTAC ACCACAAATC GATTCACATC CT - #CACCGAAT 60- AGAAATCAAA TATCATTTAC TCCATCTCAC GATCTCCTTT TGCTATTGCT GA - #TACCTCAA 120#GAA GGT ATG CCT 171 ATG AGT TCG TTG TTT GTT#Gly Met Proer Ser Leu Phe Val Glu# 10- CTG AAG TCA GCC AAT GAG TCG TGC TTA CCG GC - #G AGC GTG AAG CAA CGG 219Leu Lys Ser Ala Asn Glu Ser Cys Leu Pro Al - #a Ser Val Lys Gln Arg# 25- CGA ACC GGT GAT CTC AGG CGA TTG AAC CAC CA - #C CGT CAA CCG GCG TTT 267Arg Thr Gly Asp Leu Arg Arg Leu Asn His Hi - #s Arg Gln Pro Ala Phe# 40- GTC CGG GGG ATT TGC CGT CGG AAG TTG AGT GG - #A GTT AGC AGA ATA GAG 315Val Arg Gly Ile Cys Arg Arg Lys Leu Ser Gl - #y Val Ser Arg Ile Glu# 55- TTG CGC ACC GGT GGT TTA ACT CTG CCA CGA GC - #G GTG CTT AAT CCG GTG 363Leu Arg Thr Gly Gly Leu Thr Leu Pro Arg Al - #a Val Leu Asn Pro Val# 70- TCT CCT CCG GTA ACG ACG ACT AAA AAG AGG GT - #T TTC ACT TTT GGT AAA 411Ser Pro Pro Val Thr Thr Thr Lys Lys Arg Va - #l Phe Thr Phe Gly Lys#90- GGA AAC AGT GAA GGC AAC AAG GAC ATG AAA TC - #C TTG TTG GGA GGA AAA 459Gly Asn Ser Glu Gly Asn Lys Asp Met Lys Se - #r Leu Leu Gly Gly Lys# 105- GGT GCA AAT CTT GCA GAG ATG GCA AGC ATT GG - #C CTA TCA GTT CCT CCT 507Gly Ala Asn Leu Ala Glu Met Ala Ser Ile Gl - #y Leu Ser Val Pro Pro# 120- GGG CTC ACT ATT TCA ACT GAA GCA TGT GAG GA - #A TAT CAA CAA AAT GGA 555Gly Leu Thr Ile Ser Thr Glu Ala Cys Glu Gl - #u Tyr Gln Gln Asn Gly# 135- AAA AAA CTG CCT CCA GGT TTA TGG GAT GAG AT - #T CTG GAA GGC TTA CAG 603Lys Lys Leu Pro Pro Gly Leu Trp Asp Glu Il - #e Leu Glu Gly Leu Gln# 150- TAT GTC CAG AAA GAG ATG TCT GCA TCT CTC GG - #T GAC CCG TCT AAA GCT 651Tyr Val Gln Lys Glu Met Ser Ala Ser Leu Gl - #y Asp Pro Ser Lys Ala155 1 - #60 1 - #65 1 -#70- CTC CTC CTT TCC GTC CGT TCG GGT GCT GCC AT - #A TCG ATG CCT GGT ATG 699Leu Leu Leu Ser Val Arg Ser Gly Ala Ala Il - #e Ser Met Pro Gly Met# 185- ATG GAC ACT GTA TTG AAT CTC GGG CTT AAT GA - #T GAG GTC GTA GAT GGT 747Met Asp Thr Val Leu Asn Leu Gly Leu Asn As - #p Glu Val Val Asp Gly# 200- CTA GCT GCC AAA AGT GGA GCT CGC TTT GCC TA - #T GAC TCG TAT AGG AGG 795Leu Ala Ala Lys Ser Gly Ala Arg Phe Ala Ty - #r Asp Ser Tyr Arg Arg# 215- TTT CTA GAT ATG TTT GGC AAC GTT GTA ATG GG - #T ATC CCA CAT TCG TTA 843Phe Leu Asp Met Phe Gly Asn Val Val Met Gl - #y Ile Pro His Ser Leu# 230- TTT GAT GAA AAG TTA GAG CAG ATG AAA GCT GA - #A AAA GGG ATT CAT CTC 891Phe Asp Glu Lys Leu Glu Gln Met Lys Ala Gl - #u Lys Gly Ile His Leu235 2 - #40 2 - #45 2 -#50- GAC ACT GAT CTC ACT GCT GCT GAT CTT AAA GA - #T CTT GCT GAG CAA TAC 939Asp Thr Asp Leu Thr Ala Ala Asp Leu Lys As - #p Leu Ala Glu Gln Tyr# 265- AAG AAC GTG TAT GTG GAA GCA AAG GGC GAA AA - #G TTT CCC ACA GAT CCA 987Lys Asn Val Tyr Val Glu Ala Lys Gly Glu Ly - #s Phe Pro Thr Asp Pro# 280- AAG AAA CAG CTA GAG TTA GCA GTG AAT GCG GT - #T TTT GAT TCT TGG GAC1035Lys Lys Gln Leu Glu Leu Ala Val Asn Ala Va - #l Phe Asp Ser Trp Asp# 295- AGC CCA AGG GCC AAT AAG TAC AGG AGT ATT AA - #C CAG ATA ACT GGG TTA1083Ser Pro Arg Ala Asn Lys Tyr Arg Ser Ile As - #n Gln Ile Thr Gly Leu# 310- AAG GGG ACC GCG GTT AAC ATT CAA TGC ATG GT - #G TTT GGC AAC ATG GGG1131Lys Gly Thr Ala Val Asn Ile Gln Cys Met Va - #l Phe Gly Asn Met Gly315 3 - #20 3 - #25 3 -#30- AAC ACT TCA GGA ACC GGT GTT CTT TTC ACT AG - #G AAC CCA AGC ACT GGT1179Asn Thr Ser Gly Thr Gly Val Leu Phe Thr Ar - #g Asn Pro Ser Thr Gly# 345- GAG AAG AAG CTG TAT GGG GAG TTT TTA GTC AA - #T GCT CAG GGA GAG GAT1227Glu Lys Lys Leu Tyr Gly Glu Phe Leu Val As - #n Ala Gln Gly Glu Asp# 360- GTT GTT GCT GGG ATC AGA ACA CCA GAA GAT TT - #G GTG ACC ATG GAG ACT1275Val Val Ala Gly Ile Arg Thr Pro Glu Asp Le - #u Val Thr Met Glu Thr# 375- TGC ATG CCT GAA GCA TAC AGA GAG CTT GTG GA - #G AAC TGT GTG ATT TTA1323Cys Met Pro Glu Ala Tyr Arg Glu Leu Val Gl - #u Asn Cys Val Ile Leu# 390- GAG AGA CAC TAC AAA GAT ATG ATG GAT ATT GA - #A TTC ACA GTT CAA GAA1371Glu Arg His Tyr Lys Asp Met Met Asp Ile Gl - #u Phe Thr Val Gln Glu395 4 - #00 4 - #05 4 -#10- AAC AGA CTT TGG ATG CTG CAA TGC CGA ACA GG - #G AAA CGT ACT GGG AAA1419Asn Arg Leu Trp Met Leu Gln Cys Arg Thr Gl - #y Lys Arg Thr Gly Lys# 425- GGT GCG GTG AGA ATT GCA GTA GAT ATG GTG AA - #C GAA GGG CTA ATT GAT1467Gly Ala Val Arg Ile Ala Val Asp Met Val As - #n Glu Gly Leu Ile Asp# 440- ACT AGA ACA GCA ATT AAG AGG GTT GAG ACT CA - #A CAT CTA GAT CAG CTT1515Thr Arg Thr Ala Ile Lys Arg Val Glu Thr Gl - #n His Leu Asp Gln Leu# 455- CTT CAT CCA CAG TTT GAG AAT CCG TCT GCT TA - #C AAA AGC CAT GTG GTA1563Leu His Pro Gln Phe Glu Asn Pro Ser Ala Ty - #r Lys Ser His Val Val# 470- GCA ACC GGT TTG CCA GCA TCC CCT GGG GCA GC - #C GTG GGG CAG GTT GTG1611Ala Thr Gly Leu Pro Ala Ser Pro Gly Ala Al - #a Val Gly Gln Val Val475 4 - #80 4 - #85 4 -#90- TTC AGC GCA GAG GAT GCT GAA ACA TGG CAT GC - #A CAA GGA AAG AGT GCT1659Phe Ser Ala Glu Asp Ala Glu Thr Trp His Al - #a Gln Gly Lys Ser Ala# 505- ATC TTG GTA AGG ACT GAA ACA AGC CCA GAA GA - #T GTT GGT GGT ATG CAT1707Ile Leu Val Arg Thr Glu Thr Ser Pro Glu As - #p Val Gly Gly Met His# 520- GCA GCA GCT GGA ATC TTA ACC GCT AGA GGA GG - #A ATG ACA TCA CAT GCA1755Ala Ala Ala Gly Ile Leu Thr Ala Arg Gly Gl - #y Met Thr Ser His Ala# 535- GCA GTG GTG GCT CGC GGA TGG GGC AAA TGT TG - #T GTT TCT GGT TGT GCT1803Ala Val Val Ala Arg Gly Trp Gly Lys Cys Cy - #s Val Ser Gly Cys Ala# 550- GAT ATT CGT GTG AAC GAT GAT ATG AAG GTT TT - #T ACG ATA GGT GAC CGT1851Asp Ile Arg Val Asn Asp Asp Met Lys Val Ph - #e Thr Ile Gly Asp Arg555 5 - #60 5 - #65 5 -#70- GTG ATT AAA GAA GGT GAC TGG CTT TCA CTT AA - #T GGT TCA ACT GGC GAA1899Val Ile Lys Glu Gly Asp Trp Leu Ser Leu As - #n Gly Ser Thr Gly Glu# 585- GTC ATA TTG GGT AAA CAG CTA CTG GCT CCA CC - #T GCA ATG AGC AAT GAT1947Val Ile Leu Gly Lys Gln Leu Leu Ala Pro Pr - #o Ala Met Ser Asn Asp# 600- TTA GAA ACA TTC ATG TCA TGG GCT GAT CAA GC - #A AGG CGT CTC AAG GTT1995Leu Glu Thr Phe Met Ser Trp Ala Asp Gln Al - #a Arg Arg Leu Lys Val# 615- ATG GCA AAT GCA GAC ACA CCT AAT GAT GCA TT - #A ACA GCC AGA AAC AAT2043Met Ala Asn Ala Asp Thr Pro Asn Asp Ala Le - #u Thr Ala Arg Asn Asn# 630- GGT GCA CAA GGG ATC GGA CTC TGT AGA ACT GA - #A CAT ATG TTT TTC GCT2091Gly Ala Gln Gly Ile Gly Leu Cys Arg Thr Gl - #u His Met Phe Phe Ala635 6 - #40 6 - #45 6 -#50- TCT GAC GAG AGG ATC AAA GCT GTA AGA AAG AT - #G ATC ATG GCG GTC ACT2139Ser Asp Glu Arg Ile Lys Ala Val Arg Lys Me - #t Ile Met Ala Val Thr# 665- CCA GAA CAA AGA AAA GCG GCT CTA GAC CTC TT - #A CTC CCA TAC CAA AGA2187Pro Glu Gln Arg Lys Ala Ala Leu Asp Leu Le - #u Leu Pro Tyr Gln Arg# 680- TCC GAT TTT GAG GGC ATT TTC CGA GCA ATG GA - #T GGA CTT CCT GTA ACA2235Ser Asp Phe Glu Gly Ile Phe Arg Ala Met As - #p Gly Leu Pro Val Thr# 695- ATC CGC CTT CTA GAC CCT CCA CTT CAT GAG TT - #T CTA CCC GAA GGT GAT2283Ile Arg Leu Leu Asp Pro Pro Leu His Glu Ph - #e Leu Pro Glu Gly Asp# 710- CTA GAA CAC ATA GTG AAT GAA CTT ACA GCG GA - #T ACA GGC ATG AGC AAA2331Leu Glu His Ile Val Asn Glu Leu Thr Ala As - #p Thr Gly Met Ser Lys715 7 - #20 7 - #25 7 -#30- GAT GAA ATC TAT TCA AGA ATC GAA AAA TTA TC - #C GAA GTG AAC CCT ATG2379Asp Glu Ile Tyr Ser Arg Ile Glu Lys Leu Se - #r Glu Val Asn Pro Met# 745- CTT GGT TTC CGT GGT TGC CGA TTA GGG ATT TC - #A TAC CCC GAG CTA ACA2427Leu Gly Phe Arg Gly Cys Arg Leu Gly Ile Se - #r Tyr Pro Glu Leu Thr# 760- GAA ATG CAA GTT CGT GCG ATC TTT CAA GCT GC - #A GTG TCT ATG AAC AAT2475Glu Met Gln Val Arg Ala Ile Phe Gln Ala Al - #a Val Ser Met Asn Asn# 775- CAG GGG GTG ACT GTA ATA CCA GAG ATC ATG GT - #T CCG TTA GTC GGA ACA2523Gln Gly Val Thr Val Ile Pro Glu Ile Met Va - #l Pro Leu Val Gly Thr# 790- CCT CAG GAA TTA CGG CAT CAA ATC GGC GTA AT - #T CGT GGT GTA GCT GCA2571Pro Gln Glu Leu Arg His Gln Ile Gly Val Il - #e Arg Gly Val Ala Ala795 8 - #00 8 - #05 8 -#10- AAT GTT TTT GCT GAA ATG GGG CTG ACG TTG GA - #G TAT AAA GTG GGA ACG2619Asn Val Phe Ala Glu Met Gly Leu Thr Leu Gl - #u Tyr Lys Val Gly Thr# 825- ATG ATT GAG ATT CCT CGA GCT GCT TTG ATT GC - #T GAT GAG ATT GCA AAA2667Met Ile Glu Ile Pro Arg Ala Ala Leu Ile Al - #a Asp Glu Ile Ala Lys# 840- GAA GCC GAG TTC TTT TCG TTT GGA ACC AAT GA - #T TTG ACC CAG ATG ACA2715Glu Ala Glu Phe Phe Ser Phe Gly Thr Asn As - #p Leu Thr Gln Met Thr# 855- TTT GGG TAC AGC AGA GAT GAT GTT GGC AAG TT - #T TTG CCG ATT TAT CTT2763Phe Gly Tyr Ser Arg Asp Asp Val Gly Lys Ph - #e Leu Pro Ile Tyr Leu# 870- TCT CAA GGC ATT CTG CAG CAT GAT CCA TTT GA - #G GTT CTT GAC CAG AAA2811Ser Gln Gly Ile Leu Gln His Asp Pro Phe Gl - #u Val Leu Asp Gln Lys875 8 - #80 8 - #85 8 -#90- GGG GTG GGT CAA TTG ATC AAG ATG GCC ACG GA - #G AAA GGT CGT GCA GCC2859Gly Val Gly Gln Leu Ile Lys Met Ala Thr Gl - #u Lys Gly Arg Ala Ala# 905- AAT CCT AAC TTA AAG GTT GGG ATA TGT GGG GA - #G CAT GGT GGA GAA CCT2907Asn Pro Asn Leu Lys Val Gly Ile Cys Gly Gl - #u His Gly Gly Glu Pro# 920- TCT TCT GTT GCA TTT TTT GAC GGA GTT GGA CT - #A GAT TAT GTG TCG TGC2955Ser Ser Val Ala Phe Phe Asp Gly Val Gly Le - #u Asp Tyr Val Ser Cys# 935- TCT CCA TTC AGG GTT CCT ATC GCA AGG TTG GC - #C GCT GCA CAA GTC GTT3003Ser Pro Phe Arg Val Pro Ile Ala Arg Leu Al - #a Ala Ala Gln Val Val# 950- GTT TAAGCTTTGA AAGGAGGATG GCTTATTTGC TTCATGTTTT CCGCCATTG - #T3056Val955- ATATTATTTT GGTTTCATCC TTATTGTAAT GGTGAAAATG AACGATGTTT AA - #ACAAAACA3116- ACCCATTATA TTTTGGTTTG GTATGCAATA ATCTACTTTT CAAACAAAAA AA - #AAAAAAAA3176# 3180- (2) INFORMATION FOR SEQ ID NO:10:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 955 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:- Met Ser Ser Leu Phe Val Glu Gly Met Pro Le - #u Lys Ser Ala Asn Glu# 15- Ser Cys Leu Pro Ala Ser Val Lys Gln Arg Ar - #g Thr Gly Asp Leu Arg# 30- Arg Leu Asn His His Arg Gln Pro Ala Phe Va - #l Arg Gly Ile Cys Arg# 45- Arg Lys Leu Ser Gly Val Ser Arg Ile Glu Le - #u Arg Thr Gly Gly Leu# 60- Thr Leu Pro Arg Ala Val Leu Asn Pro Val Se - #r Pro Pro Val Thr Thr# 80- Thr Lys Lys Arg Val Phe Thr Phe Gly Lys Gl - #y Asn Ser Glu Gly Asn# 95- Lys Asp Met Lys Ser Leu Leu Gly Gly Lys Gl - #y Ala Asn Leu Ala Glu# 110- Met Ala Ser Ile Gly Leu Ser Val Pro Pro Gl - #y Leu Thr Ile Ser Thr# 125- Glu Ala Cys Glu Glu Tyr Gln Gln Asn Gly Ly - #s Lys Leu Pro Pro Gly# 140- Leu Trp Asp Glu Ile Leu Glu Gly Leu Gln Ty - #r Val Gln Lys Glu Met145 1 - #50 1 - #55 1 -#60- Ser Ala Ser Leu Gly Asp Pro Ser Lys Ala Le - #u Leu Leu Ser Val Arg# 175- Ser Gly Ala Ala Ile Ser Met Pro Gly Met Me - #t Asp Thr Val Leu Asn# 190- Leu Gly Leu Asn Asp Glu Val Val Asp Gly Le - #u Ala Ala Lys Ser Gly# 205- Ala Arg Phe Ala Tyr Asp Ser Tyr Arg Arg Ph - #e Leu Asp Met Phe Gly# 220- Asn Val Val Met Gly Ile Pro His Ser Leu Ph - #e Asp Glu Lys Leu Glu225 2 - #30 2 - #35 2 -#40- Gln Met Lys Ala Glu Lys Gly Ile His Leu As - #p Thr Asp Leu Thr Ala# 255- Ala Asp Leu Lys Asp Leu Ala Glu Gln Tyr Ly - #s Asn Val Tyr Val Glu# 270- Ala Lys Gly Glu Lys Phe Pro Thr Asp Pro Ly - #s Lys Gln Leu Glu Leu# 285- Ala Val Asn Ala Val Phe Asp Ser Trp Asp Se - #r Pro Arg Ala Asn Lys# 300- Tyr Arg Ser Ile Asn Gln Ile Thr Gly Leu Ly - #s Gly Thr Ala Val Asn305 3 - #10 3 - #15 3 -#20- Ile Gln Cys Met Val Phe Gly Asn Met Gly As - #n Thr Ser Gly Thr Gly# 335- Val Leu Phe Thr Arg Asn Pro Ser Thr Gly Gl - #u Lys Lys Leu Tyr Gly# 350- Glu Phe Leu Val Asn Ala Gln Gly Glu Asp Va - #l Val Ala Gly Ile Arg# 365- Thr Pro Glu Asp Leu Val Thr Met Glu Thr Cy - #s Met Pro Glu Ala Tyr# 380- Arg Glu Leu Val Glu Asn Cys Val Ile Leu Gl - #u Arg His Tyr Lys Asp385 3 - #90 3 - #95 4 -#00- Met Met Asp Ile Glu Phe Thr Val Gln Glu As - #n Arg Leu Trp Met Leu# 415- Gln Cys Arg Thr Gly Lys Arg Thr Gly Lys Gl - #y Ala Val Arg Ile Ala# 430- Val Asp Met Val Asn Glu Gly Leu Ile Asp Th - #r Arg Thr Ala Ile Lys# 445- Arg Val Glu Thr Gln His Leu Asp Gln Leu Le - #u His Pro Gln Phe Glu# 460- Asn Pro Ser Ala Tyr Lys Ser His Val Val Al - #a Thr Gly Leu Pro Ala465 4 - #70 4 - #75 4 -#80- Ser Pro Gly Ala Ala Val Gly Gln Val Val Ph - #e Ser Ala Glu Asp Ala# 495- Glu Thr Trp His Ala Gln Gly Lys Ser Ala Il - #e Leu Val Arg Thr Glu# 510- Thr Ser Pro Glu Asp Val Gly Gly Met His Al - #a Ala Ala Gly Ile Leu# 525- Thr Ala Arg Gly Gly Met Thr Ser His Ala Al - #a Val Val Ala Arg Gly# 540- Trp Gly Lys Cys Cys Val Ser Gly Cys Ala As - #p Ile Arg Val Asn Asp545 5 - #50 5 - #55 5 -#60- Asp Met Lys Val Phe Thr Ile Gly Asp Arg Va - #l Ile Lys Glu Gly Asp# 575- Trp Leu Ser Leu Asn Gly Ser Thr Gly Glu Va - #l Ile Leu Gly Lys Gln# 590- Leu Leu Ala Pro Pro Ala Met Ser Asn Asp Le - #u Glu Thr Phe Met Ser# 605- Trp Ala Asp Gln Ala Arg Arg Leu Lys Val Me - #t Ala Asn Ala Asp Thr# 620- Pro Asn Asp Ala Leu Thr Ala Arg Asn Asn Gl - #y Ala Gln Gly Ile Gly625 6 - #30 6 - #35 6 -#40- Leu Cys Arg Thr Glu His Met Phe Phe Ala Se - #r Asp Glu Arg Ile Lys# 655- Ala Val Arg Lys Met Ile Met Ala Val Thr Pr - #o Glu Gln Arg Lys Ala# 670- Ala Leu Asp Leu Leu Leu Pro Tyr Gln Arg Se - #r Asp Phe Glu Gly Ile# 685- Phe Arg Ala Met Asp Gly Leu Pro Val Thr Il - #e Arg Leu Leu Asp Pro# 700- Pro Leu His Glu Phe Leu Pro Glu Gly Asp Le - #u Glu His Ile Val Asn705 7 - #10 7 - #15 7 -#20- Glu Leu Thr Ala Asp Thr Gly Met Ser Lys As - #p Glu Ile Tyr Ser Arg# 735- Ile Glu Lys Leu Ser Glu Val Asn Pro Met Le - #u Gly Phe Arg Gly Cys# 750- Arg Leu Gly Ile Ser Tyr Pro Glu Leu Thr Gl - #u Met Gln Val Arg Ala# 765- Ile Phe Gln Ala Ala Val Ser Met Asn Asn Gl - #n Gly Val Thr Val Ile# 780- Pro Glu Ile Met Val Pro Leu Val Gly Thr Pr - #o Gln Glu Leu Arg His785 7 - #90 7 - #95 8 -#00- Gln Ile Gly Val Ile Arg Gly Val Ala Ala As - #n Val Phe Ala Glu Met# 815- Gly Leu Thr Leu Glu Tyr Lys Val Gly Thr Me - #t Ile Glu Ile Pro Arg# 830- Ala Ala Leu Ile Ala Asp Glu Ile Ala Lys Gl - #u Ala Glu Phe Phe Ser# 845- Phe Gly Thr Asn Asp Leu Thr Gln Met Thr Ph - #e Gly Tyr Ser Arg Asp# 860- Asp Val Gly Lys Phe Leu Pro Ile Tyr Leu Se - #r Gln Gly Ile Leu Gln865 8 - #70 8 - #75 8 -#80- His Asp Pro Phe Glu Val Leu Asp Gln Lys Gl - #y Val Gly Gln Leu Ile# 895- Lys Met Ala Thr Glu Lys Gly Arg Ala Ala As - #n Pro Asn Leu Lys Val# 910- Gly Ile Cys Gly Glu His Gly Gly Glu Pro Se - #r Ser Val Ala Phe Phe# 925- Asp Gly Val Gly Leu Asp Tyr Val Ser Cys Se - #r Pro Phe Arg Val Pro# 940- Ile Ala Arg Leu Ala Ala Ala Gln Val Val Va - #l945 9 - #50 9 - #55- (2) INFORMATION FOR SEQ ID NO:11:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:# 18 GT- (2) INFORMATION FOR SEQ ID NO:12:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:# 20 ATAC- (2) INFORMATION FOR SEQ ID NO:13:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:# 17 C- (2) INFORMATION FOR SEQ ID NO:14:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:# 17 C- (2) INFORMATION FOR SEQ ID NO:15:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 23 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:# 23CTCC TCC- (2) INFORMATION FOR SEQ ID NO:16:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 34 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:# 34 TATC ACGGCTAAAA AGAG- (2) INFORMATION FOR SEQ ID NO:17:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:# 27 CTCC TCCGGTA- (2) INFORMATION FOR SEQ ID NO:18:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:# 20 CAAG- (2) INFORMATION FOR SEQ ID NO:19:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:# 20 CTGC- (2) INFORMATION FOR SEQ ID NO:20:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 23 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:# 23CATA ATC- (2) INFORMATION FOR SEQ ID NO:21:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 21 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:#21 CATT G- (2) INFORMATION FOR SEQ ID NO:22:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:# 18 TC- (2) INFORMATION FOR SEQ ID NO:23:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:# 20 CATC- (2) INFORMATION FOR SEQ ID NO:24:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:# 18 TC- (2) INFORMATION FOR SEQ ID NO:25:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:# 24AAAA CTTG- (2) INFORMATION FOR SEQ ID NO:26:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 19 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:# 19 ATC- (2) INFORMATION FOR SEQ ID NO:27:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 21 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:#21 CAAT G- (2) INFORMATION FOR SEQ ID NO:28:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:# 20 GTGC- (2) INFORMATION FOR SEQ ID NO:29:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 22 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:# 22TAA AG- (2) INFORMATION FOR SEQ ID NO:30:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:# 20 CTTC- (2) INFORMATION FOR SEQ ID NO:31:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:# 18 TC- (2) INFORMATION FOR SEQ ID NO:32:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 23 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:# 23AAAC TTG- (2) INFORMATION FOR SEQ ID NO:33:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 23 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:# 23ATAA ATC- (2) INFORMATION FOR SEQ ID NO:34:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:# 24CTCA AATG- (2) INFORMATION FOR SEQ ID NO:35:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:# 20 GTGC- (2) INFORMATION FOR SEQ ID NO:36:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:# 20 AAGC- (2) INFORMATION FOR SEQ ID NO:37:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 23 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: other nucleic acid- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:# 23CATA ATC__________________________________________________________________________

Number	Date	Country	Kind
52275/93	Dec 1993	AUX
6-197780	Jul 1994	JPX

Number	Date	Country
WO9509234	Apr 1995	WOX
9515385	Jun 1995	WOX
9604369	Feb 1996	WOX

Polypeptide having cold-stable pyruvate, orthophoshate dikinase activity, DNA encoding the same and recombinant vector and transformed plants containing the DNA

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

Priority Claims (2)

PCT Information

Foreign Referenced Citations (3)

Non-Patent Literature Citations (10)

Entry
Shimamoto et al, Nature, vol. 338, pp. 274-276 (Mar. 16, 1989).
Tanaka et al, Nucleic Acids Research, vol. 18, No. 23, pp. 6767-6770 (1990).
Baba et al, Plant Cell Physiol., 27(3), pp. 463-471 (1986).
Ueki et al, Plant Cell Physiol., 36(5), pp. 903-914 (1995).
Burnell, Plant Cell Physiol., 31(2), pp. 295-297 (1990).
Matsuoka et al. (1988) Primary Structure of Maize Pyruvate, Orthophosphate Dikinase as Deduced from cDNA Sequence, J. Biol. Chem. 263 (23): 11080-11083, Aug. 15, 1988.
Rosche et al. (1990) Primary structure of pyruvate, orthophosphate dikinase in the dicotyledonous C4 plant Flaveria trinervia, FEBS Letters 273 (1,2): 116-121, Oct. 1990.
Pocalyko et al. (1990) Analysis of Sequence Homologies in Plant and Bacterial Pyruvate Phosphate Dikinase, Enzyme I of the Bacterial . . . , Biochem. 29: 10757-10765, Nov. 1990.
Rosche et al. (1994) Primary structure of the photosynthetic pyruvate orthophosphate dikinase of the C3 plant Flaveria pringlei and . . . , Plant Molecular Biology 26: 763-769, Oct. 1994.
Rudinger, J. (1976) Characteristics of the amino acids as components of a peptide hormone sequence, In Peptide Hormones, Ed. J. A. Parsons, University Park Press, pp. 1-7, Jun. 1976.