Patent Application
20230097513
The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Feb. 2, 2021, is named 8200WO00_SequenceListing.txt and is 652 kilobytes in size.
Poxviruses are large double-stranded, enveloped DNA viruses that replicate entirely in the cytoplasm of infected cells by encoding their own enzymes for DNA transcription and replication20,27. One of the greatest achievements in medical history was the eradication of the causative agent of smallpox (Variola virus) by mass vaccination with replication-competent, attenuated Vaccinia virus vaccine strains. Vaccinia virus is used as the prototype member to study poxvirus replication and has been further developed to generate recombinant vaccines and oncolytic agents.
Modified Vaccinia Ankara (MVA) is a highly attenuated orthopoxvirus that was derived from its parental strain Chorioallantois Vaccinia Ankara (CVA) by 570 passages on chicken embryo fibroblasts (CEF)1. As a result of the attenuation process MVA has acquired six major genome deletions (Del1-6) as well as multiple shorter deletions, insertions, and point mutations, leading to gene fragmentation, truncation, short internal deletions, and amino acid substitutions2. While all of these mutations are likely to contribute to the highly-attenuated phenotype of MVA, the precise genetic determinants that are associated with the MVA assembly deficiency remain obscure2,3. MVA has severely restricted host cell tropism, allowing productive assembly only in avian cells, e.g. CEF and baby hamster kidney (BHK) cells, whereas in human and most other mammalian cells, MVA assembly is abortive due to a late block in virus assembly4,5. Although non-pathogenic and highly attenuated, MVA maintains excellent immunogenicity as demonstrated in various animal models and humans6,7. In the late phase of the smallpox eradication campaign, MVA was used as a priming vector for the replication competent vaccinia-based vaccine in over 120,000 individuals in Germany and no adverse events were reported8. In the past decades, MVA has been developed as a stand-alone smallpox vaccine and is currently pursued by the United States (US) government as a safer alternative to substitute the existing vaccinia-based vaccine stocks as a preventative countermeasure in case of a smallpox outbreak9-11. The FDA approved MVA, under the trade name Jynneos (Bavarian Nordic) on Sep. 24, 2019 to prevent both smallpox and monkey pox. Previously, the identical MVA vaccine using the trade name Imvamune was approved in Europe as a smallpox vaccine.
All currently used MVA vectors or derivatives thereof are licensed or owned by academic, commercial, or governmental entities, which greatly restricts their use to develop MVA-based vaccine vectors. Therefore, there is a need to develop alternative MVA vectors for various research, prophylactic, and therapeutic uses. In addition, novel technologies are urgently needed to accelerate the development of recombinant poxvirus vectors for pathogen preparedness and disease prevention.
In one aspect, this disclosure relates to a method of producing a poxvirus vector or a recombinant poxvirus vector. The method entails the steps of transfecting one or more DNA fragments into a host cell, wherein the one or more DNA fragments comprise the entire genomic DNA sequence of a desired poxvirus, such that the poxvirus is reconstituted in the host cell. In certain embodiments, two or more DNA fragments are co-transfected into the host cell, each DNA fragment comprises a partial sequence of the poxvirus genome such that the two or more DNA fragments are assembled sequentially by homologous recombination and comprise the full-length sequence of the poxvirus genome when reconstituted in the host cell. In certain embodiments, the method further entails infecting the host cell with a helper virus before, during, or after the transfection of the one or more DNA fragments to initiate the transcription of the one or more DNA fragments. In certain embodiments, the helper virus is Fowl pox virus (FPV), sheep fibroma virus, vaccinia virus, or cowpox virus. In certain embodiments, the one or more DNA fragments are circularized before transfection or transfected in circular forms into the host cell. In certain embodiments, the one or more DNA fragments are cloned into a plasmid or a bacterial artificial chromosome (BAC) vector. In certain embodiments, the one or more DNA fragments are linearized before co-transfection or transfected in linearized forms into the host cell. In certain embodiments, the one or more DNA fragments are naturally derived, chemically synthesized, or a combination of naturally derived and chemically synthesized DNA fragments. In certain embodiments, the poxvirus genomic sequence comprises the sequence of Modified Vaccinia Ankara (MVA) Accession No. #U94848 or #AY603355. In certain embodiments, the poxvirus genomic sequence comprises the sequence of Vaccinia virus genome. In certain embodiments, two adjacent DNA fragments have an overlapping sequence to facilitate homologous recombination. In certain embodiments, the overlapping sequence is between about 100 bp and about 5000 bp in length. In certain embodiments, the one or more DNA fragments further comprise an inverted terminal repeat (ITR) region. In certain embodiments, the one or more DNA fragments further comprise a poxvirus terminal hairpin loop (HL) sequence, a poxvirus genome resolution (CR) sequence, or both, wherein the HL or the CR sequence is added to one or both ends of the DNA fragment as single stranded or double stranded DNA sequences in sense or antisense orientation. In certain embodiments, the one or more DNA fragments further comprise one or more HL sequences and one or more CR sequences. In certain embodiments, each HL sequence is flanked by two CR sequences at both ends of the HL sequence. In certain embodiments, wherein only a subset of the one or more DNA fragments comprise the HL or CR sequence. In certain embodiments, the one or more DNA fragments further comprise one or more DNA sequences encoding one or more antigens, subunits, or fragments thereof or other heterologous DNA sequences. In certain embodiments, two or more DNA fragments comprise the DNA sequence of the same antigen, a subunit or fragment thereof or the same heterologous DNA sequence. In certain embodiments, two or more DNA fragments comprise the DNA sequences of different antigens, subunits, or fragments thereof or other heterologous DNA sequences. In certain embodiments, the DNA sequences of the antigens, subunits, or fragments thereof or other heterologous DNA sequences are codon optimized for expression in the host cell. In certain embodiments, the one or more DNA fragments further comprise a virus promoter upstream of the DNA sequences of the antigens, subunits, or fragments thereof or other heterologous DNA sequences, a transcription termination signal downstream the DNA sequences of the antigens, subunits, or fragments thereof or other heterologous DNA sequences, or both. In certain embodiments, the DNA sequences encoding the antigens, subunits, or fragments thereof or other heterologous DNA sequences are inserted in one or more poxvirus insertion sites such as intergenic regions, non-essential genes and regions, and deletion sites.
In another aspect, disclosed herein is an expression system comprising: (i) a single DNA fragment comprising the entire genome of a desired poxvirus, or two or more DNA fragments each comprising a partial sequence of the genome of the desired poxvirus such that the two or more DNA fragments, when transferred into the host cell upon co-transfection, are assembled sequentially and comprise the full-length sequence of the poxvirus genome and enable reconstitution of the poxvirus, and (ii) one or more DNA sequences encoding one or more antigens, subunits, or fragments thereof or other heterologous DNA sequences inserted in one or more insertion sites of the poxvirus, wherein the antigens or subunits thereof or other heterologous DNA sequences are expressed in the host cell upon transfection of the one or more poxvirus DNA fragments and reconstitution of the poxvirus. In certain embodiments, the one or more DNA fragments are circularized before transfection or transfected in circular forms into the host cell. In certain embodiments, the one or more DNA fragments are cloned into a plasmid or a BAC vector. In certain embodiments, the one or more DNA fragments are linearized before transfection or transfected in linearized forms into the host cell. In certain embodiments, the one or more DNA fragments are naturally derived, chemically synthesized, or a combination of naturally derived and chemically synthesized DNA fragments. In certain embodiments, the genomic sequence of the poxvirus comprises the sequence of MVA Accession No. #U94848 or #AY603355. In certain embodiments, the two adjacent DNA fragments have an overlapping sequence to facilitate homologous recombination. In certain embodiments, the overlapping sequence is between about 100 bp and about 5000 bp in length. In certain embodiments, the one or more DNA fragments further comprise an inverted terminal repeat (ITR) region. In certain embodiments, the one or more DNA fragments further comprise a poxvirus terminal hairpin loop (HL) sequence, a poxvirus genome resolution (CR) sequence, or both, wherein the HL or the CR sequence is added to one or both ends of the DNA fragment as single stranded or double stranded DNA sequences in sense or antisense orientation. In certain embodiments, the one or more DNA fragments further comprise one or more HL sequences and one or more CR sequences. In certain embodiments, each HL sequence is flanked by two CR sequences at both ends of the HL sequence. In certain embodiments, only a subset of the one or more DNA fragments comprises the HL or CR sequence. In certain embodiments, the one or more DNA fragments further comprise a virus promoter upstream of the DNA sequences encoding the antigens, subunits or fragments thereof or other heterologous DNA sequences, a transcription termination signal downstream of the DNA sequences encoding the antigens, subunits or fragments thereof or other heterologous DNA sequences, or both. In certain embodiments, the DNA sequences encoding one or more antigens, subunits or fragments thereof or other heterologous DNA sequences are inserted in one or more poxvirus insertion sites.
In another aspect, disclosed herein is a vaccine composition for preventing or treating cancer or an infectious disease comprising: (i) a single DNA fragment comprising the entire genome of a desired poxvirus, or two or more DNA fragments each comprising a partial sequence of the genome of the desired poxvirus such that the two or more DNA fragments, when transferred into the host cell upon co-transfection, are assembled sequentially and comprise the full-length sequence of the poxvirus genome and enable reconstitution of the poxvirus, and (ii) one or more DNA sequences encoding one or more antigens, subunits, or fragments thereof or other heterologous DNA sequences inserted in one or more insertion sites of the poxvirus, wherein the antigens, subunits or fragments thereof or other heterologous DNA sequences are expressed in the host cell upon transfection of the one or more DNA fragments and reconstitution of the poxvirus. In certain embodiments, the antigens, subunits or fragments thereof or other heterologous DNA sequences are inserted in one or more poxvirus insertion sites. In certain embodiments, the vaccine composition further comprises a pharmaceutically acceptable carrier, adjuvant, additive or combination thereof.
In yet another aspect, disclosed herein is a method of preventing or treating cancer or a viral infection in a subject comprising administering a prophylactically or therapeutically effective amount of a vaccine composition to the subject, wherein the vaccine comprises: (i) a single DNA fragment comprising the entire genome of a desired poxvirus, or two or more DNA fragments each comprising a partial sequence of the genome of the desired poxvirus such that the two or more DNA fragments, when transferred into the host cell upon co-transfection, are assembled sequentially and comprise the full-length sequence of the poxvirus genome and enable reconstitution of the poxvirus, and (ii) one or more DNA sequences encoding one or more antigens, subunits or fragments thereof or other heterologous DNA sequences inserted in one or more insertion sites of the poxvirus, wherein the antigens, subunits, or fragments thereof or other heterologous DNA sequences are expressed in the host cell upon transfection of the one or more DNA fragments and reconstitution of the poxvirus. In certain embodiments, the antigens, subunits, or fragments thereof or other heterologous DNA sequences are inserted in one or more poxvirus insertion sites.
This application contains at least one drawing executed in color. Copies of this application with color drawing(s) will be provided by the Office upon request and payment of the necessary fees.
Disclosed herein are methods of producing poxvirus-based vectors and recombinant poxvirus vectors from circularized or linearized, naturally derived or chemically synthesized DNA. Specific examples are provided herein to produce a fully synthetic version of MVA (sMVA) from circularized synthetic DNA fragments as well as recombinant sMVA (rsMVA) expressing one or more heterologous gene sequences, including fluorescence markers or infectious disease and cancer antigens.
Because of its excellent safety profile in addition to its versatile expression system and large capacity to accommodate foreign DNA sequences (up 30 kbp)1, MVA is widely used to develop recombinant vaccine vectors against infections disease and cancer7,12,13. MVA has been pursued to develop different vaccine strategies for cancer treatment14,15 as well as various vaccine approaches to prevent human cytomegalovirus (HCMV) infection16-18, a common cause of permanent birth defects in newborns and complications in transplant recipients19. Some of these vaccines have completed clinical phase I or II evaluation14,17. As a member of the poxvirus family, MVA replicates entirely in the cytoplasm of infected cells, providing its own enzymes for transcription and DNA replication1,20. Although MVA virus production is abortive because of a late block in assembly in mammalian cells, MVA can efficiently infect most mammalian cells, including human cells, and initiate robust gene expression and DNA replication, making MVA an ideal vehicle to efficiently deliver and express foreign antigens in vitro and in vivo1,5. The most commonly used method to generate MVA recombinants is based on the so-called transfection/infection method using a transfer plasmid, which is co-delivered together with MVA into permissive cells (CEF or BHK), thereby inserting a desired antigen together with an upstream promoter sequence and downstream transcription termination signal into the MVA genome by spontaneous homologous recombination1,5,21.
Although this method is widely used, it can be laborious and is hampered by several rounds of selection during antigen insertion and additionally during subsequent marker removal to obtain homogenous populations of recombinant MVA21. These drawbacks in the conventional transfection/infection method can be particular problematic for the generation of multiantigenic MVA vectors with antigens inserted into two or more insertion sites, which can reduce MVA vaccine stability18,22. As an alternative to the conventional transfection/infection method and to facilitate the generation of multiantigenic MVA vectors, methods have been developed to generate MVA recombinants using bacterial artificial chromosome (BAC) technology23-25. These methods allow repeated manipulation to insert antigens into the MVA genome by highly efficient and versatile mutagenesis techniques and to reconstitute homogenous virus populations of recombinant MVA in BHK cells with Fowl poxvirus (FPV) as a helper virus, which is required to “jump-start” the transcription of the non-infectious MVA genome23.
Disclosed herein are methods of producing poxvirus-based vectors or recombinant poxvirus vectors from naturally derived or chemically synthesized DNA. In certain embodiments, a single DNA fragment is derived from viral DNA or chemically synthesized and comprises the entire genome sequence of a poxvirus. This single DNA fragment can be used to transfect a host cell such that the poxvirus is reconstituted. In other embodiments, two or more naturally derived or chemically synthesized DNA fragments, or a combination thereof, are used to co-transfect a host cell, wherein each DNA fragment comprises a partial sequence of the poxvirus genomic DNA with overlapping sequences at the ends of two adjacent DNA fragments, such that when the two or more DNA fragments are co-transfected into the host cell, they assemble with each other by homologous recombination to form a poxvirus comprising a full-length sequence of the desired poxvirus genome. In certain embodiments, the overlapping sequence is between about 100 bp and about 5000 bp in length.
In certain embodiments, a shortened genomic sequence rather than the entire genomic sequence or an altered genomic sequence with deletion(s) or modification(s) in non-essential genes or regions of the genomic sequence of a poxvirus, or a hybrid derivative comprising the genomic sequences from two or multiple different poxviruses can be used to produce vectors disclosed herein.
In certain embodiments, one or more naturally derived or chemically synthesized DNA fragment(s) comprising the poxvirus genome or subgenomic DNA may be further modified to form artificial hybrid fragments composed of natural and synthetic poxvirus genomic DNA sequences. In other embodiments, the naturally derived or chemically synthesized one or more DNA fragment(s) maybe composed of sequences derived from two different poxviruses to form poxvirus hybrid sequences. One or more DNA fragment(s) can be composed of poxvirus sequences or sequences composed of different poxvirus sequences derived from MVA (NCBI accession #U94848, #AY603355), Vaccinia virus (#NC_006998, #LT966077), Camelpox virus (#NC_003391), Cowpox virus (#NC_003663) Ectromelia virus (#NC_004105), Monkeypox virus (#NC_003310), Racoonpox virus (#NC_027213), Skunkpox virus (#NC_031038), Taterapox virus (#NC_008291), Variola virus (#NC_001611, #L22579), Velopox virus (#NC_031033), Canarypox virus (#NC_005309), Swinepox virus (#NC_003389), FPV (#NC_002188, #MH734528), Myxoma virus (#GQ409969), Sheeppox virus (NC_004002), Goatpox virus (#NC_004003), (Orf virus #NC_005336), Rabbit fibroma virus (#NC_001266), any strain variations of these poxviruses, or any other poxvirus or strain variations thereof.
In certain embodiments, the host cell is infected with a helper virus such as FPV before, during, or after the transfection of one or more DNA fragments comprising the sequence of the poxvirus genome or subgenomic DNA. A helper virus can be any suitable virus that infects the host cell and allows initiation of the transcription and replication of the poxvirus. Used herein as an example is FPV in the host cell without undergoing homologous recombination with the poxvirus DNA. The helper virus is unable to replicate in the host cell. Furthermore, the helper virus itself is not a component of the reconstituted poxvirus, e.g., FPV for the purposes of this application. In certain embodiments, cowpox virus, Shope fibroma virus, or other suitable poxviruses can be used as a helper virus. In certain embodiments, one or more DNA fragments for transfection can be linearized, circularized, or a combination of linearized and circularized DNA fragments. In certain embodiments, one or more DNA fragments for transfection are cloned into a vector such as a plasmid or a BAC and/or maintained in a host cell such as a bacterial cell, e.g., E. coli.
In certain embodiments, one or more DNA fragment(s) further comprise one or both of the inverted terminal repeat (ITR) regions of the poxvirus. In certain embodiments, the sequence of the ITR may contain one or more alterations or variations, which do not affect the design scheme of the reconstituted poxvirus. In one embodiment, the one or more DNA fragments that reconstitute the poxvirus may contain only parts of the ITR sequences. For example, the sMVA fragments F1 and F3 as well as the reconstituted sMVA vectors or recombinant sMVA vectors (
In certain embodiments, the HL or CR sequences used herein are disclosed as follows:
Sequence of terminal CR-HL-CR sequences containing a duplex copy of the MVA terminal hairpin loop (HL) flanked by MVA concatemeric resolution sequences (215 bp in length, 5′→3′) (SEQ ID NO: 1), wherein the CR sequences are underlined and the HL sequence is italicized and double underlined:
tttttttctaaacactaaataaata
tatttatttagtgtctagaaaaaaa
Sequence of terminal CR-HL-CR sequences containing a duplex copy of the complementary form of the MVA terminal hairpin loop (HL) flanked by concatemeric resolution sequences (215 bp in length, 5′->3′) (SEQ ID NO: 2), wherein the CR sequences are underlined and the HL sequence is italicized and double underlined:
tttttttctagacactaaataaata
tatttatttagtgtctagaaaaaaa
Sequence of the MVA terminal hairpin loop (HL, 165 nt in length, 5′→3′) (SEQ ID NO: 3):
Sequence of the complementary form of the MVA terminal hairpin loop (HL, 165 nt in length, 5′->3′) (SEQ ID NO: 4):
Sequence of terminal CR-HL-CR sequences containing a duplex copy of the Vaccinia terminal hairpin loop (HL; S-Form) flanked by concatemeric resolution sequences (154 bp in length, 5′->3′) (SEQ ID NO: 5), wherein the CR sequences are underlined and the HL sequence is italicized and double underlined:
tttttttctagacactaaataaaa
attttatttagtgtctagaaaaaaa
Sequence of terminal CR-HL-CR sequences containing a duplex copy of the Vaccinia terminal hairpin loop (HL; F-Form) flanked by concatemeric resolution sequences (154 bp in length, 5′->3′) (SEQ ID NO: 6), wherein the CR sequences are underlined and the HL sequence is italicized and double underlined:
tttttttctagacactaaataaaat
attttatttagtgtctagaaaaaaa
Sequence 1 of the Vaccinia virus terminal hairpin loop (HL, S-form, 104 nt in length, 5′→3′) (SEQ ID NO: 7):
Sequence 2 of the Vaccinia virus terminal hairpin loop (HL, F-form, 104 nt in length, 5′→3′) (SEQ ID NO: 8):
Sequence 1 of the MVA concatemer resolution sequences (CR, 20 bp in length, 5′→3′) (SEQ ID NO: 9, sense orientation), included at the left end of the hairpin duplex copy in the working example:
Sequence 2 of the MVA concatemer resolution sequences (CR, 20 bp in length, 5′→3′) (SEQ ID NO: 10, antisense orientation), included at the right end of the hairpin duplex copy in the working example:
As demonstrated in the working examples, sMVA and rsMVA recombinants disclosed herein are generated based on chemical synthesis of three ˜60 kbp long DNA fragments that encompass the entire ˜178 kbp of the MVA genome published by Antoine and colleagues (Accession #U94848)26. This includes the internal unique region (UR) and the flanking ˜9.6 kbp long inverted terminal repeat (ITR) regions as illustrated in
In certain embodiments, a duplex copy of the HL with flanking CR sequences at both ends of each of the three MVA fragments is included—as opposed to only at the ends at the ITR of F1 and F3 where they occur naturally in concatemeric replication intermediates. This design is based on the intrinsic functions that these sequence elements have during poxvirus DNA replication. The terminal HL in packaged poxvirus genomes connects the two DNA strands at the genomic termini to a continuous polynucleotide chain, where they exist at both ends in inverted and complementary forms that are incompletely base-paired and AT-rich26-29. Poxvirus HL sequences are important for the replication of the double-stranded DNA genomes into multimeric head-to-tail or head-to-head concatemeric replication intermediates, in which the HL sequences are present at the concatemeric junctions as precise duplex copies30-32. The CR elements are comprised of a highly conserved poxvirus resolution sequence and can be found in packaged genomes at both ends of the large ITRs directly adjacent to the terminal H L26,27,33,34. Poxvirus CR elements in concatemeric replication intermediates are present on either site of the HL duplex copies at the genomic junctions, and these CR/HL/CR sequence arrangements are essential for the resolution of unit-length genomes and subsequent genome packaging33-36. When circular plasmids containing poxvirus concatemeric junctions, which are composed of an HL duplex copy flanked by CR elements, are transfected into poxvirus infected cells they are spontaneously resolved into linear minichromosomes with terminal HL36,37. In certain embodiments, the circularized sMVA fragments, when transfected into the host cell, can immediately replicate in the host cell in an origin independent manner. It was reported that any circular DNA molecule transfected into poxvirus infected cells is replicated in an origin independent manner, and this non-specific sequence replication is not enhanced by insertion of any viral DNA fragments38. In other embodiments, the circularized sMVA fragments, when transfected into the host cell, can be replicated by a eukaryotic or viral origin of replication inserted into the vector or MVA sequences.
The disclosed construction technique of the synthetic poxvirus such as sMVA includes the HL and CR sequences such that transfection of circular plasmids or DNA molecules containing the three synthetic MVA fragments with flanking concatemeric genomic junctions (CR-HL-CR) and overlapping genome sequences into FPV-infected BHK or CEF cells will promote (1) the transcription and replication of the three sMVA fragments, (2) the resolution of the three sMVA fragments from the plasmid vector sequences, and (3) the recombination of the three sMVA fragments into full-length genomes, ultimately leading to the packaging of vector-free genomes with terminal HL into preformed virus particles (
Regardless of whether using circular or linearized forms of the three MVA fragments or a combination of circular and linearized forms, the ends of the fragments may or may not contain HL and CR sequences. In certain embodiments, only a subset of the fragments may contain the HL and CR sequences, or they may be added to only one end or two ends of the fragments as single or double stranded DNA sequences in sense or antisense orientation, for example in a way that they are only present at the MVA partial sequences of F1 and F3 where they occur naturally in putative concatemeric replication intermediates. In another example, not all F1 fragments contain the HL and CR sequences; rather, F1 fragments with or without the HL and CR sequences may be mixed in the construction process. Likewise, not all F2 or F3 fragments are required to contain the HL and CR sequences but a subset or a subpopulation of F2 or F3 fragments may contain the HL and CR sequences. In certain embodiments, HL and/or CR sequences may also be chemically ligated as single or double stranded DNA sequences in linearized forms of the three fragments.
In another embodiment, the sMVA virus reconstituted from the sMVA fragments may be modified by introducing insertions, deletions, or point mutations, or by insertion with one or more heterologous DNA sequences encoding one or more antigens, subunits or fragments thereof. These modifications or antigen sequences may be introduced into the sMVA DNA fragment by conventional transfection/infection methods using a transfer plasmid with homology flanks that mediate homologous recombination. In certain embodiments, the one or more nucleotide sequences encoding the one or more antigens, subunits or fragments thereof may be codon optimized for eukaryotic or vaccinia expression. For example, the antigens, subunits or fragments thereof may be optimized for stability in transcription or expression in the host cell. Various codon optimization techniques may be used, including but not limited to the alteration of four of the same nucleotides in a row (e.g. GGGG, CCCC, TTTT, AAAA) by introducing silent point mutations that do not lead to amino acid changes in the encoded protein, or the adaption of the codon usage to a specific host species.
In another embodiment, the sMVA virus reconstituted from the sMVA fragments in a host cell such as BHK or CEF cells may be used to generate an sMVA bacterial artificial chromosome (BAC) containing a full length sMVA genome. The BAC vector sequences may be inserted into the sMVA genome by a transfer construct containing the BAC sequences with flanking homology sequences that mediate homologous recombination. Circular replication intermediates with inserted BAC sequences may be isolated from host cells such as BHK or CEF cells and transferred by electroporation or chemical transformation into E. coli cells that allow stable propagation of large DNA constructs, such as DH10B or EPI300. In another embodiment, the sMVA BAC may be transferred into GS1783 E. coli cells and manipulated by Red-recombination techniques such as En passant mutagenesis.
In another embodiment, the sMVA fragments may be used to reconstitute a complete or full-length sMVA genome by in vitro ligation methods or by other in vitro DNA assembly methods such as Gibson or Golden Gate assembly.
The technology disclosed herein has the flexibility of inserting various antigens, subunits or fragments thereof, or other heterologous DNA sequences into the one or more naturally derived or chemically synthesized DNA fragment(s) before transfection such that upon reconstitution, a synthetic poxvirus expressing the antigens, subunits or fragments thereof is obtained. These antigens, subunits or fragments thereof maybe derived from or based on viruses such as cytomegalovirus (CMV), Epstein-Barr virus (EBV), Kaposi-Sarcoma-associated herpesviruses (KSHV), other herpesviruses, Zika virus, Lassa virus, Hepatitis C virus (HCV), Hepatitis (HBV), Coronaviruses (such as 2019-nCoV, SARS, MERS), Influenza, or any other viral, bacterial, or other forms of infectious pathogen. The antigen sequences may also be derived from or based on cancer-associated proteins (e.g., p53, Retinoblastioma, neoantigens). Likewise, other heterologous gene sequences may be inserted into the naturally derived or chemically synthesized poxvirus DNA fragment(s). Such heterologous gene sequences include but are not limited to fluorescence markers, cDNA copies of RNAs such as RNAi, shRNA, LNCRNA, miRNA, etc., interferons, cytokines, antibodies or fragments thereof, or other proteins expressed in prokaryotic or eukaryotic cells. In certain embodiments, the antigen sequences or heterologous gene sequences maybe inserted into the sMVA fragments with an upstream natural or synthetic poxvirus promoter (pSyn, P11, H5, mH5, P28, ATI, pHyb, p7.5) and a downstream transcription termination signal (TTTTTAT), such that the antigen sequences or heterologous gene sequences are expressed when the poxvirus fragments are transfected into a host cell.
The DNA sequences of the antigens, subunits or fragments thereof, or other heterologous gene sequences, can be inserted into one or more poxvirus insertion sites within the one or more DNA fragment(s). Using sMVA as an example, the DNA sequence of one antigen or fragment thereof can be inserted in a single MVA insertion site located on one sMVA DNA fragment, e.g., sMVA F2, before transfection of the host cell (
In certain embodiments, one or more DNA sequences encoding one or more antigens, subunits or fragments thereof, or other heterologous DNA sequences are inserted in frame at the 5′ end, 3′ end, or any internal position of one or more essential or non-essential poxvirus open reading frames (ORFs) such that when the one or more naturally-derived or chemically synthesized poxvirus DNA fragments are transfected into the host cell, one or more fusion proteins composed of a poxvirus protein with one more antigens, subunits or fragments thereof, or other heterologous protein sequences added to the C-terminus, N-terminus, or any internal position of the poxvirus proteins are expressed. In some embodiments, the one or more DNA sequences encoding one or more antigens, subunits or fragments thereof, or other heterologous DNA sequences are linked to the one or more poxvirus ORFs by 2A encoding sequences of picornaviruses (P2A, F2A, T2A etc,) such that the expressed one or more fusion proteins composed of a poxvirus protein with one more antigens, subunits or fragments thereof, or other heterologous protein sequences added to the C-terminus, N-terminus, or any internal position of the poxvirus proteins are processed (“cleaved”) into the individual components at the 2A linker sequences by a ribosomal skipping mechanism. In other embodiments, the one or more DNA sequences encoding one or more antigens, subunits or fragments thereof, or other heterologous DNA sequences are linked to one or more essential or non-essential poxvirus ORFs by internal ribosomal entry site sequences such that when the one or more naturally-derived or chemically synthesized poxvirus DNA fragments are transfected into the host cell, one or more poxvirus proteins and one more antigens, subunits or fragments thereof, or other heterologous protein sequences are simultaneously expressed through chimeric polycistronic expression constructs with multiple translation initiation sites at the 5′ end of each of the ORFs within the expression constructs.
In certain embodiments, the DNA sequences of two or more antigens, subunits or fragments thereof or other heterologous gene sequences may be inserted into two or more MVA insertion sites, which may be located on the same sMVA fragment or on different sMVA fragments. For example, the DNA sequences of two or more antigens, subunits or fragments thereof can be inserted in two different MVA insertion sites, both located on sMVA F1. In another example, the DNA sequences of two or more antigens, subunits or fragments thereof can be inserted into two different MVA insertion sites, one located on sMVA F1 and the other located on sMVA F2 (
As demonstrated in the working examples, previously established methods of generating recombinant MVA vectors using BAC technology16,18,24,25 were adapted to generate rsMVA recombinants using the three sMVA fragments. Because the three sMVA fragments have been cloned into a BAC vector with mini-F replicon they can be stably propagated in bacteria and, consequently, they can be manipulated by highly efficient recombination methods such as En Passant mutagenesis or other E. coli-based manipulation procedures39,40. Using these methods, naturally derived or synthetic heterologous antigen sequences together with an upstream vaccinia virus promoter and downstream transcription termination signal can be inserted into only one, two, or all three of the sMVA fragments in a parallel, successive, or repeated manner into virtually every MVA genome position (
The poxvirus vectors produced by the technology disclosed herein may be used, for example, to generate multi-antigenic vaccine vectors to stimulate polyfunctional humoral and cellular immune response against various conditions such as viral infections and cancer. As an example, the disclosed technology based on the three sMVA fragments F1-F3 may be used to generate multi-antigenic rsMVA vaccine vectors to stimulate polyfunctional humoral and cellular immune response against human cytomegalovirus (HCMV). This may include immunodominant antigen sequences based on the five subunits of the HCMV pentamer complex (PC), glycoprotein B (gB), phosphoprotein 65 (pp65), and the immediate-early 1 and 2 proteins (IE1 and IE2). The antigen sequences may be inserted separately or combined as 2A-linked polycistronic expression constructs into the sMVA fragments at different commonly used MVA insertion sites (Del2, Del3, IGR44/45, IGR69/70, IGR64/65) to generate rsMVA vaccine vectors expressing 5, 6, 7, 8, or 9 HCMV antigens, as illustrated in
According to the embodiments described herein, an MVA expression system is provided herein. In certain embodiments, the expression system may express one or more desired antigens, subunits or fragments thereof or other heterologous protein sequences.
As described above, one or more sMVA fragments may be inserted with the DNA sequences encoding one or more antigens, subunits or fragments thereof such that the reconstituted sMVA simultaneously expresses the antigens, subunits and fragments thereof.
In certain embodiments, the antigen DNA sequences inserted into the sMVA fragments may be based on the natural DNA sequence or from chemical synthesis. In other embodiments, the antigen DNA sequences may be optimized for expression and stability within the expression system.
The sMVA described herein may be part of a vaccine composition that may be used in methods to treat or prevent viral infection or to treat cancer, depending on the antigens expressed by the sMVA. The vaccine composition as described herein may comprise a therapeutically effective amount of the sMVA as described herein, and further comprising a pharmaceutically acceptable carrier according to a standard method. Examples of acceptable carriers include physiologically acceptable solutions, such as sterile saline and sterile buffered saline.
In some embodiments, the vaccine or pharmaceutical composition may be used in combination with a pharmaceutically effective amount of an adjuvant to enhance the prophylactic or therapeutic effects. Any immunologic adjuvant that may stimulate the immune system and increase the response to a vaccine, without having any specific antigenic effect itself may be used as the adjuvant. Many immunologic adjuvants mimic evolutionarily conserved molecules known as pathogen-associated molecular patterns (PAMPs) and are recognized by a set of immune receptors known as Toll-like Receptors (TLRs). Examples of adjuvants that may be used in accordance with the embodiments described herein include Freund's complete adjuvant, Freund's incomplete adjuvant, double stranded RNA (a TLR3 ligand), LPS, LPS analogs such as monophosphoryl lipid A (MPL) (a TLR4 ligand), flagellin (a TLR5 ligand), lipoproteins, lipopeptides, single stranded RNA, single stranded DNA, imidazoquinolin analogs (TLR7 and TLR8 ligands), CpG DNA (a TLR9 ligand), Ribi's adjuvant (monophosphoryl-lipid A/trehalose dicorynoycolate), glycolipids (α-GalCer analogs), unmethylated CpG islands, oil emulsion, liposomes, virosomes, saponins (active fractions of saponin such as QS21), muramyl dipeptide, alum, aluminum hydroxide, squalene, BCG, cytokines such as GM-CSF and IL-12, chemokines such as MIP 1-α and RANTES, activating cell surface ligands such as CD40L, N-acetylmuramine-L-alanyl-D-isoglutamine (MDP), and thymosin α1. The amount of adjuvant used can be suitably selected according to the degree of symptoms, such as softening of the skin, pain, erythema, fever, headache, and muscular pain, which might be expressed as part of the immune response in humans or animals after the administration of this type of vaccine.
In further embodiments, use of various other adjuvants, drugs or additives with the vaccine of the invention, as discussed above, may enhance the therapeutic effect achieved by the administration of the vaccine or pharmaceutical composition. The pharmaceutically acceptable carrier may contain a trace amount of additives, such as substances that enhance the isotonicity and chemical stability. Such additives should be non-toxic to a human or other mammalian subject in the dosage and concentration used, and examples thereof include buffers such as phosphoric acid, citric acid, succinic acid, acetic acid, and other organic acids, and salts thereof; antioxidants such as ascorbic acid; low molecular weight (e.g., less than about 10 residues) polypeptides (e.g., polyarginine and tripeptide) proteins (e.g., serum albumin, gelatin, and immunoglobulin); amino acids (e.g., glycine, glutamic acid, aspartic acid, and arginine); monosaccharides, disaccharides, and other carbohydrates (e.g., cellulose and derivatives thereof, glucose, mannose, and dextrin), chelating agents (e.g., EDTA); sugar alcohols (e.g., mannitol and sorbitol); counterions (e.g., sodium); nonionic surfactants (e.g., polysorbate and poloxamer); antibiotics; and PEG.
The vaccine or pharmaceutical composition containing the sMVA described herein may be stored as an aqueous solution or a lyophilized product in a unit or multiple dose container such as a sealed ampoule or a vial.
The poxvirus reconstituted from the one or more naturally derived or chemically synthesized DNA fragment(s), with or without the inserted antigens, subunits or fragments thereof, or other heterologous sequences may be used as a vaccine composition for preventing or treating various viral infections or cancer. One of ordinary skill in the art would know how to select a particular viral or cancer antigen for the conditions or diseases to be prevented or treated. This may include but is not limited to any infectious disease or cancer antigen that is capable of eliciting an immune response, such as viral envelope glycoproteins or glycoprotein complexes, immunodominant T cell antigens, or mutated cancer neoantigens. These antigen sequences or portions thereof maybe derived from or based on viruses such as CMV, EBV, KSHV, other herpesviruses, Zika virus, Lassa virus, HCV, HBV, Coronaviruses, Influenza, or any other viral, bacterial, or other forms of infectious pathogen.
The following examples are intended to illustrate various embodiments of the invention. As such, the specific embodiments discussed are not to be constructed as limitations on the scope of the invention. It will be apparent to one skilled in the art that various equivalents, changes, and modifications may be made without departing from the scope of invention, and it is understood that such equivalent embodiments are to be included herein. Further, all references cited in the disclosure are hereby incorporated by reference in their entirety, as if fully set forth herein.
As an initial test to validate the sMVA platform, a procedure as illustrated in
This analysis indicated that the reconstituted sMVA had similar capacity compared to MVA NIH clone 1 to form characteristic MVA viral foci and to spread in BHK cell monolayers (
To characterize the genome of the reconstituted sMVA, viral DNA prepared from sMVA-infected BHK cells was evaluated by PCR using primers specific for different genome positions within the three synthetic MVA fragments. DNA prepared from mock-infected (uninfected) BHK cells as well as BHK cells infected with the NIH MVA clone 1 were used as controls. This PCR analysis revealed the presence of DNA derived from all three sMVA fragments within the genomic DNA of the reconstituted sMVA (
Sanger sequencing analysis of all PCR products derived from sMVA-infected BHK cells revealed sequences at these genome positions that were identical to the published sequence of MVA strain Antoine26, including the recombination sites of F1/F2 and F2/F3. The only exception to this was the PCR product derived from the Del2 site of sMVA showing a single T to A nucleotide alteration located in the IGR at three base pairs downstream of open reading frame (ORF) 021L26. BLAST analysis showed that this sequence alteration within sMVA DNA is not present in any published MVA or vaccinia virus genome sequence. Sanger sequences analysis of sMVA F1 purified from E. coli indicated that this specific nucleotide alteration at the Del2 site was already present before the sMVA reconstitution in BHK cells, suggesting that it has its origin in the chemical synthesis of F1 or is a result of the cloning or propagation of sMVA F1 in E. coli. Additional sequencing analysis of PCR products (
The following DNA sequences are given as the nucleotide sequences (5′ to 3′) of the sense strands of the DNA molecules. Sequence of sMVA fragment 1 (F1, 60021 bp in length) (SEQ ID NO: 11):
Any of the sequences of the sMVA fragments F1, F2, and F3 may contain one or more alterations or variations. For example, the sequence of sMVA fragment F1 (deposited at NCBI under Accession No. MW023923, www.ncbi.nlm.nih.gov/nuccore/MW023923.1/) contains 1 nucleotide alteration in a non-coding determining region downstream of open reading frame 021 (SEQ ID NO: 12):
Sequence of sMVA fragment 2 (F2, 63035 bp in length) (deposited with NCBI under Accession No. MW023924, www.ncbi.nlm.nih.gov/nuccore/MW023924.1/) (SEQ ID NO: 13):
Sequence of sMVA fragment 3 (F3, 62068 bp in length) (SEQ ID NO: 14):
Alternatively, the sequence of sMVA F3 may contain 1 nucleotide alteration in a non-coding determining region at 88 bp close to the end of the ITR sequence (deposited with NCBI under Accession No. MW030459, www.ncbi.nlm.nih.gov/nuccore/MW030459.1/) (SEQ ID NO: 15):
Also disclosed are examples of synthetic Vaccinia virus (sVAC) fragments to reconstitute the complete Vaccinia virus genome. An example sequence of sVAC fragment 1 (F1, 66679 bp in length) (SEQ ID NO: 16):
An example of sVAC fragment 2 (F2, 66679 bp in length) (SEQ ID NO: 17):
An example sequence of sVAC fragment 3 (F3, 66679 bp in length) (SEQ ID NO: 18):
To evaluate the removal of the bacterial vector sequences following sMVA reconstitution, DNA of sMVA-infected BHK cells upon serial virus passage of sMVA in BHK cells was evaluated by PCR using primers specific for the sopA and cat chloramphenicol resistance gene of the bacterial vector. This PCR analysis showed that residual vector sequences can be detected in sMVA DNA at 7 or 8 dpt/i, although they were undetectable in sMVA DNA following two additional virus passages of sMVA. These results in sum provide evidence that co-transfection of the three synthetic MVA fragments as circular plasmid molecules into FPV-infected BHK cells leads to the formation of sMVA with full-length, vector-free genomes that appear to have similar sequence composition as the published genome sequence of MVA strain Antoine26.
To evaluate the use of the three sMVA fragments to generate rsMVA, the three fragments were transferred into GS1783 E. coli cells40, which are used to manipulate large BAC-cloned DNA molecules by En Passant mutagenesis39,40. This highly-efficient method allows the introduction of point mutations or large or small sequence insertions or deletions into BAC cloned DNA molecules by a two-step mutagenesis procedure based on Red recombination without leaving behind any bacterial marker sequences39,40. As an initial test of the sMVA platform to generate rsMVA expressing heterologous gene sequences, the generation of rsMVA expressing a single fluorescence marker was evaluated. As previously described for the insertion of antigen sequences into MVABAC-TK18,24, En passant mutagenesis was used to insert an expression cassette composed of a red fluorescent protein (RFP) marker with upstream mH5 promoter and downstream TTTTTAT vaccinia virus transcription termination signal into the IGR69/70 (also known as G1L/I8R) insertion site within sMVA fragment F2 (
To evaluate the sMVA platform for the generation of rsMVA with multiple heterologous gene sequences inserted into different genome positions, the construction of rsMVA expressing two fluorescence markers was evaluated. Using En passant mutagenesis of GS1783 cells, gene expression cassettes composed of a P11 promoter, an RFP marker or blue fluorescent protein (BFP) marker, and TTTTTAT transcription termination signal were separately inserted into the IGR69/70 of sMVA F2 and the Del3 site of sMVA F3. The modified sMVA F2 with inserted RFP marker (F2-RFP) and the modified sMVA F3 with inserted BFP marker (F3-BFP) were isolated from GS1783 E. coli cells and co-transfected together with unmodified sMVA F1 into BHK cells to evaluate the reconstitution of rsMVA with RFP and BFP marker in the presence of a helper virus using the procedure shown in
To further evaluate the sMVA platform for the generation of rsMVA with multiple inserted heterologous gene sequences, the generation of rsMVA expressing three fluorescence markers was investigated. Using En passant mutagenesis in E. coli, a green fluorescent protein (GFP) marker together with upstream P11 promoter and downstream transcription termination signal was inserted into the IGR44/45 of MVA F1. The resulting modified sMVA fragment F1 with inserted GFP marker (F1-GFP) was then tested in different combinations with the fluorescence tagged forms of F2 and F3 (F2-RFP and F3-BFP) as well as unmodified sMVA fragments of F1, F2, and F3 to evaluate the single, double, or triple fluorescent sMVA expression vectors using the procedure shown in
To demonstrate utility of the sMVA platform to generate a multi-antigenic vaccine vector for infectious disease, the construction of rsMVA expressing the five-member HCMV envelope pentamer complex (PC) composed of gH, gL, UL128, UL130, and UL131A is evaluated. Antigen expression cassettes composed of 2A-linked gH/gL and UL128/UL130/UL131A subunits are separately inserted into the IGR69/70 located in sMVA F2 and the Del3 site located sMVA F3 using En Passant mutagenesis in E. coli. The modified sMVA fragments of F2 and F3 are transfected together with the unmodified sMVA fragment of F1 into FPV-infected BHK cells to reconstitute sMVA expressing all five PC subunits (rsMVA-PC). As a control, rsMVA expressing only the gH/gL or UL128/130/131A subunits is generated as well as sMVA without any inserted antigen sequences. Expression of the antigen sequences is confirmed by Western Blot, and the formation of multi-protein complexes by the PC subunits expressed from rsMVA-PC is verified by flow cytometry (FC) using neutralizing antibodies (NAb) that target conformational epitopes formed by two or more subunits of the PC. To investigate the immunogenicity of the rsMVA-PC vector to stimulate NAb, Balb/c mice are immunized three times with rsMVA-PC or the control vectors by intraperitoneal route in four-week intervals. At various time points post immunization, HCMV-specific NAb responses are measured on MRC-5 fibroblasts (FB) and ARPE-19 epithelial cells (EC). This analysis can reveal potent stimulation of FB and EC-specific NAb responses in mice immunized with rsMVA-PC, while no or only minimal responses are measured in mice immunized with the control vectors. These results can demonstrate that the sMVA vaccine platform can be used to generate a multi-antigenic MVA vaccine vector that expresses all five PC subunits which assemble with each other to form NAb epitopes and stimulate potent NAb responses in mice.
An example for the utility of the sMVA platform to generate vaccines for the Coronavirus strain 2019-nCoV (Wuhan), which has recently emerged as a new, highly contagious and pathogenic Coronavirus is illustrated. Because the S (Spike) protein of Coronaviruses is involved in receptor recognition, as well as virus attachment and entry, and a dominant target of protective humoral and cellular immunity it represents a potential target for the development of Coronavirus (CoV) vaccines and therapeutics. cDNAs encoding the full-length S protein (1273 amino acids), the immunogenic S1 domain of the S protein of the 2019-nCoV strain, or the receptor binding domain (RBD) of the S1 domain are separately inserted into the MVA Del3 site of sMVA fragment F3. The resulting modified fragment of sMVA F3 is then co-transfected with the unmodified versions of sMVA fragment F1 and F2 into BHK cells to initiate the reconstitution of sMVA expressing the new coronavirus S protein (sMVA-2019-nCoV-S), the S1 domain (sMVA-2019-nCoV-S1), or the RBD domain (sMVA-2019-nCoV-RBD) using the procedure as illustrated in
To test the immunogenicity and protective efficacy of the sMVA constructs two animal models can be used: (1) Given the more severe symptoms observed in elderly individuals, 12 months old Balb/c mice are immunized two times by subcutaneous and intramuscular routes in four-week intervals with 1×107-1×108 of sMVA plaque forming units (Pfu); and (2) Considering the potential involvement of human angiotensin-converting enzyme-2 (hACE-2) in nCoV entry into lung cells, transgenic mice expressing the human hACE2 receptor are used to test vaccine efficacy.
To test the immunogenicity and protective efficacy of the sMVA constructs, Balb/c mice transgenic for angiotensin converting enzyme 2 (ACE2) are immunized two times by subcutaneous and intramuscular routes in four-week intervals with 1×107-1×108 of sMVA plaque forming units (Pfu). Neutralizing antibody responses and T cell responses specific for the 2019-nCoV-S protein and derivatives are measured as previously described at 1 week after each immunization. At 45 days post booster immunization, the mice are infected with 7×104 50% tissue culture infective doses (TICD50) of 2019-nCoV that is homologous to the vaccine antigens, and heterologous strains (SARS-CoV and MERS-CoV) and 4 days post challenge, the animals are sacrificed, and their lungs are harvested for measurement of viral loads and for histopathological analysis. Large virus loads, on average, >11,000 to >20,000 2019-nCoV genome equivalents/ng of total RNA, are found in both mock-immunized and nonrecombinant MVA-immunized control groups and in animals challenged with heterologous CoV strains. In sharp contrast, the lung tissue of protein (sMVA-nCoV-S) or the S1 domain (sMVA-nCoV-S1) subjects contains significantly lower levels of 2019-nCoV RNA (viral load), indicating efficient inhibition of 2019-nCoV replication by the vaccine-induced immune responses. All placebo control animals (MVA-GFP) succumbed 4 to 8 days postinfection, while MVA-S, MVA-N and MVA-N/S show no or minimal signs of disease, including minimal weight loss. MVA-N/S immunized mice are completely protected.
Histopathology is focused on lung damage that is substantially reduced in the 2019-nCoV subunit antigen immunized animals. The potential for antibody-enhancement of disease is also evaluated and found to be absent in these subunit vaccine models. NAb responses to S protein antigens and their S1 and RBD derivatives are assessed using a pseudotyping strategy for nCoV that is robust for recognition by antigen-specific NAb, but the use of pathogenic strains of CoV is avoided. The serum from animals immunized with S proteins and derivatives develops high titer and neutralizing antibodies against homologous 2019-nCoV strains and not heterologous CoV strains such as the etiologic agents for MERS and SARS. IC90 neutralizing titers are calculated for each mouse serum sample. Based on the success of the vaccine studies in transgenic ACE2 Balb/c mouse strains, progressively larger animal species are investigated, i.e. rabbits, ferrets, and rhesus macaques which have susceptibility to 2019-nCoV challenge and are known to respond to MVA-based vaccines.
This example demonstrates insertion of a mouse p53 gene that has been previously used in studies with MVA backbones obtained from the ATCC or the NIAID46. The mouse p53 cDNA is inserted into the deletion (DEL3) locus using en passant such that no additional nucleotide additions or subtractions are made in the exact insertion site of the locus. The insertion is verified by sequence analysis to be accurately made and all pertinent regions are intact and 100% sequence verifiable. Subsequent to the modification of plasmid F3, all three plasmids are combined into a single aliquot and using the identical method as described in Example 2, a modified version of sMVA is generated, and live virus is obtained two days after the transfection/infection with FPV. The live virus is concentrated and expanded on BHK cells and stocks are made, and are sequence verified using the Sanger method to establish that the virus has the correct sequence of the p53 gene insertion in the DEL3 locus. Furthermore, virus stocks are made and are frozen and put into long-term storage, while at the same time, working stocks are prepared using the published methods to expand modified sMVA stocks to titers in ≥1×109 pfu/mL. The verification of the expanded stock is conducted using a combination of qPCR, Sanger sequencing, infectious titer, and Western blot analysis. All four of these procedures are performed and the appropriate result is obtained to confirm that a nucleotide sequence has the appropriate size, the infectious titer is within the range of ≥1×109 pfu/mL, and Western blot analysis confirms a protein band at approximately 53 Kd. One skilled in the art can apply this approach using human versions of the p53 gene as a vaccine to protect humans from cancer progression.
Murine (mu) p53-sMVA
Female 6-8-week old BALB/C mice are obtained from the Jackson Laboratory (Bar Harbor, Me.) and maintained in a specific pathogen-free environment. All studies are approved by the Research Animal Care Committee of City of Hope National Medical Center and performed under the American Association for the Accreditation of Laboratory Animal Care guidelines. Meth A sarcoma cells (Meth A) are a kind gift of Dr. LJ Old, Memorial Sloan-Kettering Cancer Center (New York, N.Y.). Meth A is passaged as an ascitic tumor. Anti-CTLA-4 (9H10) is a gift of Dr. James Allison, MD Anderson Cancer Center (Houston, Tex.). Antibodies are produced using the CELLine device (BD Biosciences, Mountain View, Calif.). IgG antibodies are purified by absorption over protein G-sepharose (Amersham Biosciences, Uppsala, Sweden) followed by elution with 0.1 M glycine-HCL (pH 2.7). The product is dialyzed against phosphate-buffered normal saline and concentrated using a Sentry Plus centrifugal filter device (Millipore, Bedford, Mass.). Control Syrian hamster IgG is obtained from Jackson ImmunoResearch (West Grove, Pa.). The rsMVA titer is determined by immunostaining infected cultures using the VECTASTAIN Elite ABC Kit (Vector Laboratories, Burlingame, Calif.). Antigen-specific detection of the mouse p53 protein expressed from sMVA uses the anti-p53 antibody, pab122, followed by incubation with a peroxidase-labeled goat anti-mouse secondary antibody provided in the kit. A control sMVA expressing CMV-pp65 is also constructed using the same technique as is used in constructing murine sMVAp53.
Six-week-old female BALB/C mice are injected by subcutaneous route in the left flank with 5×105 METH A cells. On day three, the mice are treated with 5×107 pfu of sMVAp53 by intraperitoneal injection. Negative control mice are injected with 5×107 pfu of sMVApp65 or phosphate buffered saline. An additional positive control utilizes the identical murine MVAp53 described in the original report. The subcutaneous tumors are evaluated by IVIS imaging methods weekly using a luciferase technique or by calipers if no luciferase gene is inserted into the METH A sarcoma cells. An additional approach is to inject BALB/C mice of the same age as the sMVA infections in the left flank with 1×106 METH A cells. This tumor is shown to produce a rapidly lethal tumor in the majority of mice despite CTLA-4 (9H10) antibody treatment. On day seven post tumor inoculation, mice are injected intraperitoneally with 5×107 pfu of sMVAp53. Controls are the same as described above. Anti-CTLA-4 (9H10) antibody or control hamster antibody are injected intraperitoneally on day six, nine, and twelve post tumor injection at doses of 100, 50, and 50 micrograms, respectively.
The three sMVA fragments designed as shown in
Using a previously employed procedure to rescue MVA from a BAC16,24,25, sMVA virus was reconstituted with Fowl pox (FPV) as a helper virus upon co-transfection of the three DNA plasmids into BHK cells (
To characterize the viral DNA of sMVA, DNA extracts from sMVA and wtMVA-infected CEF were compared for several MVA genome positions by PCR. Similar PCR results were obtained with sMVA and wtMVA for all evaluated genome positions (
To characterize the replication properties of sMVA, growth kinetics of sMVA and wtMVA were compared on BHK and CEF cells, two cell types known to support productive MVA replication4. This analysis revealed similar growth kinetics of sMVA and wtMVA on both BHK and CEF cells (
To characterize sMVA in vivo, the immunogenicity of sMVA and wtMVA was compared in C57BL/6 mice following two immunizations at high or low dose. MVA-specific binding antibodies stimulated by sMVA and wtMVA after the first and second immunization were comparable (
The references, patents and published patent applications listed below, and all references cited in the specification above are hereby incorporated by reference in their entirety, as if fully set forth herein.
This application claims priority to U.S. Provisional Patent Application No. 62/969,628, filed Feb. 3, 2020, and U.S. Provisional Patent Application No. 63/113,803, filed Nov. 13, 2020, the contents of which are hereby incorporated by reference in their entirety.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2021/016247 | 2/2/2021 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63112803 | Nov 2020 | US | |
| 62969628 | Feb 2020 | US |
