The instant application contains a Sequence Listing which has been submitted in .xml format and is hereby incorporated by reference in its entirety. Said .xml copy was created on Aug. 12, 2022, is named “05863600523.xml.” and is 33,930 bytes in size.
Cancer is the second leading cause of death globally, and prevention offers the greatest opportunity to reduce morbidity and mortality. Gene therapies for cancer have typically focused on therapy after the cancer has developed, such as chimeric antigen receptor T cells (CAR-T cells). By contrast, genetic therapies that “correct” oncogenic variants have not been actively pursued. The Clustered Regularly Interspaced Short Palindromic Repeat/Cas9 (CRISPR/Cas9) system is an invaluable research tool that is currently undergoing therapeutic trials related to several diseases (e.g., sickle cell, liver and eye diseases) due to its efficiency in targeted and site-specific correction of genetic mutations. If CRISPR/Cas9-mediated gene editing can successfully correct oncogenic mutations, it could potentially prevent the initiation, growth and spread of cancer. Advancements in reprogramming technologies have led to the development of human induced pluripotent stem cells (iPSCs) as a new tool to model disease and discover drugs. iPSCs can undergo efficient gene editing and reprogramming, making them excellent models of genetic diseases. This strategy has revolutionized our understanding of genetic risk factors that predispose individuals to certain cancers and could help develop novel therapeutic strategies to permanently prevent oncogenesis.
Breast cancer is one of the most diagnosed cancers among US women and is the second leading cause of death among women, globally. Genetic mutations in the two major breast cancer susceptibility genes, BRCA1 and BRCA2, are the major cause of hereditary breast cancer and account for ˜3% of all breast cancers (2). BRCA gene mutations are also associated with an increased risk of breast and prostate cancer in men, and pancreatic cancer and melanoma in both sexes. BRCA1 and BRCA2 are tumor-suppressor genes (TSGs) vital for homology directed repair (HDR) of DNA double-stranded breaks (DSBs). They are crucial for maintaining genomic stability. Women carrying pathogenic germline mutations in either BRCA1 or BRCA2 are much more susceptible to developing breast and ovarian cancers by age 70; their risk is increased by 10-20-fold. Ashkenazi Jews commonly harbor BRCA1 or BRCA2 mutations, with approximately 1:40 individuals harboring one of three oncogenic founder mutations: BRCA1-185-delAG, BRCA1-5382-InsC, and BRCA2-6174-delT. Many women with these mutations elect to undergo bilateral prophylactic (preventative) mastectomy, as well as removal of their ovaries. However, there is an unmet need for safer and less invasive prevention strategies. The present disclosure is pertinent to this need.
The present disclosure provides compositions and methods that are used for precise template-free correction of BRCA1 mutation in human cells via genome editing. In an embodiment, the disclosure provides a method for modifying DNA comprising a BRCA1-5382-InsC mutation. This approach comprises introducing into cells comprising the BRCA1-5382-InsC a Cas enzyme and a guide RNA. The method is performed in a DNA repair template free manner. Thus, the method can be performed without introducing a single stranded DNA or a double stranded DNA that is introduced into a chromosome to correct the BRCA1-5382-InsC mutation. In embodiments, the guide RNA is functional with an AGG protospacer adjacent motif (PAM) that is proximal to the BRCA1-5382-InsC mutation. By “functional” it is meant that in the presence of the particular guide RNA and a Cas enzyme the BRCA1-5382-InsC mutation is eliminated. In embodiments, the functional guide RNA comprises the sequence AAGCGAGCAAGAGAAUCCCC (SEQ ID NO: 1).
The method can be performed in any cells, in vitro or in vivo, that harbor the BRCA1-5382-InsC mutation. In non-limiting embodiments, such cells are breast cancer cells, ovarian cancer cells, prostate cancer cells, or melanoma cells. In embodiments, the method is performed by introducing a described system into cells of an individual who is suspected of having, has been diagnosed with, or is at risk for developing, any of the aforementioned cancer types. In embodiments, use of the compositions and methods inhibitors recurrence or metastasis of cancer.
In embodiments, some or all of the components of the described system can be introduced into an individual by using a single, or more than one, expression vector that encodes and expresses some or all of the components. In embodiments, a complex comprising the Cas enzyme and the guide RNA is introduced into cells.
In embodiments, the BRCA1-5382-InsC mutation is eliminated by Canonical Non-homologous end joining (c-NHEJ). In embodiments, elimination of the BRCA1-5382-InsC mutation reverses a loss of heterozygosity for the BRCA1 allele.
The disclosure also provides modified cells, such as any type of stem cells, into which a BRCA1-5382-InsC mutation has been introduced. In embodiments, the stem cells induced pluripotent stem cells (iPSCs). In embodiments, the introduced the BRCA1-5382-InsC mutation is a heterozygous mutation. Such modified cells may be present in an in vitro in vitro cell culture, and may be used to produce non-human animal models for use in evaluating properties of cells that contain the the BRCA1-5382-InsC, and for evaluating therapeutic approaches that target the mutation or cells that contain the mutation.
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
Sequences in Figures: The portion of the sequence in bold and capital on
Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.
Unless specified to the contrary, it is intended that every maximum numerical limitation given throughout this description includes every lower numerical limitation, as if such lower numerical limitations were expressly written herein. Every minimum numerical limitation given throughout this specification will include every higher numerical limitation, as if such higher numerical limitations were expressly written herein. Every numerical range given throughout this specification will include every narrower numerical range that falls within such broader numerical range, as if such narrower numerical ranges were all expressly written herein.
The disclosure includes all polynucleotide and amino acid sequences described herein. Each RNA sequence includes its DNA equivalent, and each DNA sequence includes its RNA equivalent. Complementary and anti-parallel polynucleotide sequences are included. Every DNA and RNA sequence encoding polypeptides disclosed herein is encompassed by this disclosure. Amino acids of all protein sequences and all polynucleotide sequences encoding them are also included, including but not limited to sequences included by way of sequence alignments. Sequences of from 80.00%-99.99% identical to any sequence (amino acids and nucleotide sequences) of this disclosure are included.
As used in the specification and the appended claims, the singular forms “a” “and” and “the” include plural referents unless the context clearly dictates otherwise. Ranges may be expressed herein as from “about” one particular value, and/or to “about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by the use of the antecedent “about” it will be understood that the particular value forms another embodiment. The term “about” in relation to a numerical value is optional and means for example +/−10%.
The disclosure includes all polynucleotide and all amino acid sequences that are identified herein by way of a database entry. Such sequences are incorporated herein by reference as they exist in the database on the filing date of this application or patent.
In embodiments, the disclosure provides compositions, methods, one or more guide RNAs, and CRISPR systems for correcting BRCA mutations. In one aspect the disclosure provides for CRISPR-based, template-free correction of the BRCA1-5382-InsC mutation. The chromosomal location of the BRCA1-5382-InsC mutation is known in the art. This mutation contains a single nucleotide insertion in exon 19 (termed “Ex19”) that disrupts the open reading frame, leading to a premature stop codon in exon 21 (termed “Ex21”) and a truncated protein product. One functional allele is generally sufficient to maintain BRCA1's regulatory function. However, loss of heterozygosity (LOH), which TSG's are particularly susceptible to, results in a loss-of-function variant. In this regard, when expressed, truncated BRCA1 ceases to regulate HDR, causing additional mutations to accumulate throughout the genome. This accumulation characterizes genomic instability, a hallmark cancer risk (7). Conventional gene editing systems generally repair mutations following disease onset, however, the present disclosure provides for correcting BRCA1-5382-InsC prior to LOH, which thereby would prevent genomic instability and decrease the likelihood of oncogenesis. Thus, in embodiments, the disclosure provides for preventing LOH, or correction of LOH, i.e., restoring one functional BRCA1 allele.
By designing the described system with an enhanced probability of generating preferred mutations, the disclosure includes generation of isogenic patient cells with greater efficiency as compared to traditional HDR methods. Thus, the present disclosure provides compositions and methods for producing precise correction of the described mutations.
In embodiments, a Cas enzyme is used in combination with a single guide RNA that targets the BRCA1-5382-InsC in an AGG protospacer adjacent motif (PAM) dependent manner. The PAM is generally located within 2-6 nucleotides downstream of the DNA sequence targeted by the guide RNA and the Cas cuts 3-4 nucleotides upstream of the PAM.
In an embodiment, the guide RNA comprises the sequence5′-AAGCGAGCAAGAGAAUCCCC-3′ (SEQ ID NO: 1). The C in bold corresponds to the C that is deleted in the BRCA1-5382-InsC mutation. This guide RNA is referred to herein as gRNA-“InsC” and “InsC-1.” As demonstrated in the Examples below, this gRNA is effective to correct the BRCA1-5382-InsC mutation, whereas use of CRISPR systems with other guide RNAs that target the same mutation are not, or are not as efficient as a CRISPR system that includes the InsC-1 gRNA. Thus, in embodiments, the disclosure provides for increased frequency of correction of BRCA1-5382-InsC, such as within a population of cells, relative to a control. The control can be any suitable control, such as a reference value. In embodiments, the reference value comprises a standardized curve(s), a cutoff or threshold value, and the like. In embodiments, increased correction efficiency comprises use of a system of this disclosure to correct the described BRCA1 mutation in a population of cells using the InsC-1 guide RNA relative to the same approach using a control guide RNA, representative and non-limiting embodiments of which are shown in the Examples and include guide RNAs comprising the sequence shown for gRNA-InsC-2 and gRNA InsC-3.
In embodiments, a guide RNA comprising the InsC-1 sequence (and/or a control guide RNA) is present in a single RNA polynucleotide that further comprises a scaffold sequence, a non-limiting embodiment of which comprises the sequence5′-guuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc-3′ (SEQ ID NO: 2).The described sequence may be at the 3′ end of the InsC-1 guide RNA sequence which is5′-AAGCGAGCAAGAGAAUCCCC (SEQ ID NO: 1).
In embodiments, the disclosure comprises introducing into cells comprising the BRCA1-5382-InsC a CRISPR system comprising a Cas nuclease and a guide RNA comprising the InsC-1 sequence to thereby correct the mutation. In embodiments, correction of the mutation comprises a single nucleotide deletion that restores a single nucleotide deletion in exon 19 of the human BRCA1 gene, which in turn eliminates a stop codon in the open reading frame of exon 21 of the human BRCA1 gene. In embodiments, a C is deleted in the mutation that is corrected by the disclosed approaches. In embodiments, correction (e.g., deletion of the inserted C in exon 19) results in production of a non-truncated protein encoded by the human BRCA1 gene.
The method is performed in a DNA template-free manner, meaning no exogenous single-stranded or double stranded DNA template is introduced into the cells for the purpose of insertion of the exogenous DNA into a chromosome. Thus, the method is DNA repair template-free.
In embodiments, the individual in which the BRCA1-5382-InsC mutation present is at risk for developing cancer, is suspected of having, or has been diagnosed with cancer. In embodiments, the cancer is breast cancer, ovarian cancer, prostate cancer, or melanoma. In embodiments, the disclosure comprises identification of an individual as having cells comprising the BRCA1-5382-InsC mutation, and introducing the described CRISPR system into the cells to correct the mutation. In embodiments, the described correction comprises Canonical Non-homologous end joining (c-NHEJ) whereby a single nucleotide is deleted and an open reading frame is restored. In embodiments, the disclosure further comprises confirming the deletion of the insertion by sequencing a segment of a chromosome comprising the deletion site.
In an embodiment, a Cas protein used in this disclosure comprises one or more nuclear localization signals (NLSs). In an embodiment, the one or more NLSs comprise the sequence: GPKKKRKVAAA (SEQ ID NO: 3).
In specific and non-limiting embodiments, the Cas comprises a Cas9, such as Streptococcus pyogenes (SpCas9). Derivatives of Cas9 are known in the art and may also be used with the described DNA polymerase. Such derivatives may be, for example, smaller enzymes that Cas9, and/or have different proto adjacent motif (PAM) requirements. In a non-limiting embodiment, the Cas enzyme may be Cas12a, also known as Cpf1, or SpCas9-HF1, or HypaCas9, or xCas9, or Cas9-NG.
The reference sequence of S. pyogenes is available under GenBank accession no. NC_002737, with the Cas9 gene at position 854757-858863. The S. pyogenes Cas9 amino acid sequence is available under number NP_269215. These sequences are incorporated herein by reference as they were provided in the database on the priority date of this application or patent.
Any of the described components may be introduced into cells using any suitable route and form. In embodiments, the disclosure provides for use of one or more plasmids or other suitable expression vectors that encode the targeting RNA, and/or the described proteins. In embodiments, a single plasmid encodes a Cas nuclease and a guide RNA. In embodiments, one plasmid encodes the Cas nuclease and a separate plasmid encodes the guide RNA. In embodiments, the disclosure provides RNA-protein complexes, e.g., RNAPs, which can be introduced into cells. RNAPs can be assembled if desired in vitro prior to introduction into cells.
In embodiments, a viral expression vector may be used for introducing one or more of the components of the described system. Viral expression vectors may be used as naked polynucleotides, or may comprise viral particles. In embodiments, the expression vector comprises a modified viral polynucleotide, such as from an adenovirus, a herpesvirus, or a retrovirus, such as a lentiviral vector. In embodiments, one or more components of the described systems may be delivered to cells using, for example, a recombinant adeno-associated virus (rAAV) vector. rAAV vectors are commercially available, such as from TAKARA BIO® and other commercial vendors, and may be adapted for use with the described systems, given the benefit of the present disclosure. In embodiments, for producing rAAV vectors, plasmid vectors may encode all or some of the well-known rep, cap and adeno-helper components. In certain embodiments, the expression vector is a self-complementary adeno-associated virus (scAAV). Suitable ssAAV vectors are commercially available, such as from CELL BIOLABS, INC.® and can be adapted for use in the presently provided embodiments when given the benefit of this disclosure.
In embodiments, non-viral delivery systems may be used for introducing one or more of the components of the described system. Non-viral tools including hydrodynamic injection, electroporation and microinjection. Hydrodynamic injection can systemically deliver the described systems into targeted tissues, including but not necessarily limited to cancer cells. Chemical vectors, such as lipids and nanoparticles, are widely used for delivery. Cationic lipids interact with negatively charged DNA and the cell membrane, protecting the DNA and cellular endocytosis. DNA nanoparticles, are potential delivery strategies. DNA conjugated to gold nanoparticles (CRISPR-gold) complexed with cationic endosomal disruptive polymers can deliver the described systems into human cells.
In embodiments, a described CRISPR system may be introduced systemically, such as by intravenous administration, or may be introduced directly into a tumor.
In embodiments, expression vectors, proteins, ribonucleoproteins (RNPs), polynucleotides, and combinations thereof, can be provided as pharmaceutical formulations. A pharmaceutical formulation can be prepared by mixing the described components with any suitable pharmaceutical additive, buffer, and the like. Examples of pharmaceutically acceptable carriers, excipients, and stabilizers can be found, for example, in Remington: The Science and Practice of Pharmacy (2005) 21st Edition, Philadelphia, Pa. Lippincott Williams & Wilkins, the disclosure of which is incorporated herein by reference. Further, any of a variety of therapeutic delivery agents can be used, and include but are not limited to nanoparticles, lipid nanoparticle (LNP), fusosomes, exosomes, and the like. In embodiments, a biodegradable material can be used. In embodiments, poly(lactide-co-galactide) (PLGA) is a representative biodegradable material, but it is expected that any biodegradable material, including but not necessarily limited to biodegradable polymers. As an alternative to PLGA, the biodegradable material can comprise poly(glycolide) (PGA), poly(L-lactide) (PLA), or poly(beta-amino esters). In embodiments, the biodegradable material may be a hydrogel, an alginate, or a collagen. In an embodiment the biodegradable material can comprise a polyester a polyamide, or polyethylene glycol (PEG). In embodiments, lipid-stabilized micro and nanoparticles can be used.
In embodiments, a combination of proteins, and a combination of one or more proteins and polynucleotides described herein, may be first assembled in vitro and then administered to a cell or an organism.
In an embodiment, the disclosure provides an isogenic model of a BRCA mutation developed in stem cells. In an embodiment, the stem cells comprise induced pluripotent stem cells (iPSCs). In embodiments, the disclosure provides for iPSC isogenic models, in which the wild type and mutant cells are genetically identical, except for the mutation, which allows distinguishing the effects of pathogenic mutations from those due to the cell's genetic background. In embodiments, non-human mammals produced using the stem cells are provided. Thus, in embodiments, the disclosure provides modified stem cells comprising an introduced BRCA1-5382-InsC mutation. “Introduced” as used herein means the stem cells did not have any copies of the BRCA1-5382-InsC mutation before being modified using the described compositions and methods.
The disclosure includes all reporter constructs and cells comprising the reporter constructs, described herein. Substitutions of the type of fluorescent markers used in the reporter constructs will be apparent to those skilled given the benefit of this disclosure, in the art and are encompassed by this disclosure.
The disclosure is illustrated by the following Examples, which are not intended to limit the scope of the disclosure. In particular, the Examples demonstrate precise correction of the BRCA1-5382-InsC mutation in human iPSCs via CRISPR/Cas9-mediated template-free gene editing using a specific guide RNA. This approach can be extended to correction of this mutation in human cells that contain this mutation, as demonstrated in subsequent Examples.
This Example provides a non-limiting proof-of-concept demonstration designed to test the efficacy of an aspect of the described strategy in a reporter system. We cloned mutated Ex19 (termed “Ex19-5382-InsC”) into a Lentivirus (pLenti) backbone to generate a recombinant plasmid (termed “reporter plasmid”). pLenti expresses a CMV promoter, tdTomato fluorescent protein (tdTom) and enhanced Green Fluorescent Protein (eGFP). Ex19-5382-InsC was inserted immediately downstream of the CMV promoter and out-of-frame with tdTom, resulting in a premature stop codon in tdTom and preventing its expression. Upon CRISPR/Cas9-mediated correction of the open reading frame, tdTom expression was rescued. This cloning strategy served as an accurate and quantifiable method to visualize correction efficacy using a reporter system.
Next, a plasmid (referred to herein as a “rescue plasmid”) was designed to correct the mutation within the reporter plasmid. The rescue plasmid was constructed by cloning a gRNA targeting the region of interest in BRCA1-5382-InsC (termed “gRNA-InsC”), into a Cas9 plasmid expressing enhanced Green Fluorescent Protein (eGFP) (
Following reporter system transfection, cells were sorted based on their expression of eGFP (eGFP+) and tdTom (tdTom+) fluorescence (
We repeated the experiment in 3 independent trials (n=3) (
This Example demonstrates generating patient-specific knock-in of BRCA1-5382-InsC in human iPSCs.
We generated a patient-specific knock-in model of BRCA1-5382-InsC, in which to perform the correction (
The genomic polymerase chain reaction (PCR) products from BRCA1 exon 19 were cloned and sequenced to validate the generation of a heterozygous knock-in. Our PCR product from Heterozygous Knock-in InsC-SC4 was transformed in TOP10 bacteria, which were then incubated in the presence of X-gal. Transformed bacteria containing recombinant vectors give rise to white clones, whereas those transformed with TOPO lacking the insert, produce blue clones. Seven white clones, each representing a single allele, were selected, purified, and sent for Sanger Sequencing. Sequencing results for individual alleles indicate that 3/7 clones contain the WT sequence and 4/7 clones contain the knock-in sequence (
We corrected Heterozygous Knock-in InsC-SC4 in a template-free manner via the c-NHEJ pathway. gRNA-InsC was generated as described for
After ˜2 weeks of culturing the transfected cells, DNA was extracted, PCR-amplified, and sent for Sanger sequencing. Sequencing results revealed the efficacy of correcting BRCA1-5382-InsC in iPSCs using our rescue plasmid. Within the control cell mixture, approximately 50% of the alleles were WT and 50% were mutated. These allelic ratios are consistent with those of Heterozygous Knock-in InsC-SC4, indicating that no editing occurred in the control sample. In contrast, the mixture of cells transfected with the rescue plasmid contained approximately 93% WT alleles and 6% mutant alleles. The increased ratio of WT:mutant alleles generated by rescue plasmid transfection, in comparison to those in the control, indicates successful, template-free correction of BRCA1-5382-InsC. Similarly, a single clone transfected with the rescue plasmid contained 100% WT alleles, further substantiating correction of the mutant allele (
To further validate these results, we performed the correction in 3 independent trials(n=3). In all 3 trials, the ratio of WT:mutant alleles in the cell mixture transfected with the rescue plasmid, exceeded the ˜50:50 ratio present in Heterozygous Knock-in InsC-SC4. In trials 1 and 2, sequencing results corresponding to single clones transfected with the rescue plasmid, revealed corrected clones (
This Example relates to
In
In
Table A provides the gRNA sequences and PAMs used for the pool of gRNAs targeting the InsC mutation.
All gRNAs use the following scaffold (SEQ ID NO: 6): 5′-gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc-3′ (where T is replaced by U (SEQ ID NO: 7)).
GTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTC
ACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTT
GGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCA
TTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAG
AGCTGGTTTAGTGAACCGTCAGATCCGCTAGCCACCAATG
ACCGGTCgtgageaagggcgaggag
Gtcatcaaagagttcatgcgcttcaaggtgcgcatggagggctccatgaa
Cggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagg
Gcacccagaccgccaagctgaaggtgaccaagggcggccccctgcccttc
Gcctgggacatcctgtccccccagttcatgtacggctccaaggcgtacgt
Gaagcaccccgccgacatccccgattacaagaagctgtccttccccgagg
Gcttcaagtgggagcgcgtgatgaacttcgaggacggcggtctggtgacc
Gtgacccaggactcctccctgcaggacggcacgctgatctacaaggtgaa
gatgcgcggcaccaacttcccccccgacggcc
ccgtaatgcagaagaagaccatgggctgggaggcctccaccgagcgcctg
tacccccgcgacggcgtgctgaagggcgagatccaccaggccctgaagctg
aaggacggcggccactacctggtggagttcaagaccatctacatggccaag
aagcccgtgcaactgcccggctactactacgtggacaccaagctggacat
cacctcccacaacgaggactacaccatcgtggaacagtacgagcgctccg
agggccgccaccacctgttcctggggcatggcaccggcagcaccggcagc
ggcagctccggcaccgcctcctccgaggacaacaacatggccgtcatcaaa
gagttcatgcgcttcaaggtgcgcatggagggctccatgaacggccacga
gttcgagatcgagggcgagggcgagggccgcccctacgagggcacccaga
ccgccaagctgaaggtgaccaagggcggccccctgcccttcgcctgggac
atcctgtccccccagttcatgtacggctccaaggcgtacgtgaagcaccc
cgccgacatccccgattacaagaagctgtccttccccgagggcttcaagt
gggagcgcgtgatgaacttcgaggacggcggtctggtgaccgtgacccag
gactcctccctgcaggacggcacgctgatctacaaggtgaagatgcgcgg
caccaacttcccccccgacggccccgtaatgcagaagaagaccatgggct
gggaggcctccaccgagcgcctgtacccccgcgacggcgtgctgaagggc
gagatccaccaggccctgaagctgaaggacggcggccactacctggtgga
gttcaagaccatctacatggccaagaagcccgtgcaactgcccggctact
actacgtggacaccaagctggacatcacctcccacaacgaggactacacc
atcgtggaacagtacgagcgctccgagggccgccaccacctgttcctgta
cggcatggacgagctgtacaaagcggccgca
This application claims priority to U.S. provisional patent application No. 63/232,598, filed Aug. 12, 2021, the entire disclosure of which is incorporated herein by reference.
Number | Date | Country | |
---|---|---|---|
63232598 | Aug 2021 | US |