Patent Application
20240264109
The instant application contains a Sequence Listing which has been submitted in XML format via EFS-Web and is hereby incorporated by reference in its entirety. Said XML copy is named GBNJIP108ST26_Sequence_Listing-20230403.xml, created on 04/03/2023, and is 3,014 bytes in size.
The present disclosure belongs to the field of biochar materials and use thereof, and in particular relates to a BiOX/N-doped biochar nanocomposite, and a preparation method and use thereof.
China is a major power for breeding and eating crayfish and crabs, and tens of thousands of tons of crayfish and crab shells are produced annually in China. These crayfish and crab shells are often treated as litters, which not only causes a great waste, but also brings great harm to the ecological environment. In fact, crayfish and crab shells include a large number of useful chemical substances, such as chitin, proteins, calcium carbonate, and a small number of lipids, but most of the crayfish and crab shells are only used for the extraction of chitin at present. It is necessary to seek for a new recycling way to reduce the waste of crayfish and crab shells.
As a by-product of tofu processing, tofu residue includes rich nutrients, has a crude protein content as high as 25% to 30%, and is one of the cheap feeds for pigs. However, the current scientific use of tofu residue is very limited. China is a large soybean planter, with an annual tofu residue output of about more than 3 million tons. If the tofu residue can be fully utilized, the transformation from waste into treasure can be achieved and the environmental burden can be reduced.
Biochar has a large specific surface area (SSA), well-developed pore structures, and abundant surface functional groups, and exhibits a prominent adsorption capacity for metal ions in water. In addition, biochar can be prepared with easily-available raw materials through a simple process. Therefore, biochar is expected to be used as a cheap adsorbent in actual wastewater treatment. Most of the current studies in this field inside and outside China focus on the preparation and adsorption of biochar, but the application of biochar in other fields is rarely reported.
In recent years, it has been proved that bismuth oxyiodide (BiOI) or bismuth oxybromide (BiOBr) has excellent optical properties due to its prominent energy band structure and unique layered tetragonal structure. However, so far, the research on BiOI or BiOBr has generally focused on the photocatalytic performance, and has rarely involved other application fields.
An objective of the present disclosure is to provide a preparation method of a BiOX/N-doped biochar nanocomposite, where a discarded crayfish shell, crab shell, or tofu residue is used as a raw material to prepare the BiOX/N-doped biochar nanocomposite, to realize the transformation of a renewable biological resource from waste into treasure. A use of a BiOX/N-doped biochar nanocomposite prepared by the method in the detection of adenosine triphosphate (ATP) or Escherichia coli (E. coli) by a photoelectrochemical technology is investigated. The BiOX/N-doped biochar nanocomposite prepared by the microwave method can be used as a photoelectric active material to construct a photoelectrochemical sensor, and the photoelectrochemical sensor can be used in the fields of plant nutrient detection and food safety, which broadens the application fields of biochar and BiOX.
The present disclosure is implemented by the following technical solutions.
A preparation method of a BiOX/N-doped biochar nanocomposite is provided, including the following steps:
In the step 1, the strong alkali is NaOH or KOH; the inert atmosphere is Ar; the calcination is conducted as follows: raising a temperature at 5° C./min from room temperature to 700° C., and holding the temperature for 2 h; and the drying is conducted at 80° C. for 24 h.
In the step 2, in the mixed solution of HCl and HNO3, a volume ratio of the HCl to the HNO3 is 3:1; and the ultrasonic treatment is conducted for 6 h.
In the step 3, in the suspension A, the acidified N-doped biochar, the Bi(NO3)3·5H2O, and the acetic acid are used in a ratio of (1-20) mg:(0.01-0.05) mol: 40 mL; and the continuous stirring is conducted for 30 min.
In the step 3, a concentration of KX in the KX aqueous solution is 0.5 mol/L; and a volume ratio of the suspension A to the KX aqueous solution is 2:1.
In the step 3, the reaction is conducted at the constant temperature of 150° C. to 180° C. and the microwave power of 200 W for 1 h; and the calcination in the tube furnace is conducted at 300° ° C. for 2 h.
A use of the BiOX/N-doped biochar nanocomposite prepared by the preparation method of the present disclosure in preparation of a photoelectrochemical sensor for detecting ATP or E. coli is provided.
In the step (A1), a concentration of the BiOX/N-doped biochar nanocomposite in the suspension is 5 mg/mL.
In the step (A2), an ATP aptamer has a sequence of 5′-ACCTGGGGGAGTATTGCGGAGGAAGGT-3′ (SEQ ID NO: 1).
In the step (A3), the ATP solution has a concentration of 1×10−12 mol/L to 1×10−5 mol/L; and the xenon light source has an intensity of 25% to 100%.
A Use of the BiOX/N-Doped Biochar Nanocomposite in the Preparation of a Photoelectrochemical Sensor for Detecting E. coli is Provided, Including the Following Steps:
In the step (B1), a concentration of the BiOX/NBC nanocomposite in the dispersion is 5 mg/mL.
In the step (B3), the E. coli 0157: H7 aptamer has a sequence of ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGA-AGGAAGTTATGTGG TGTTGGCTCCCGTAT-3′ (SEQ ID NO: 2); and the BSA has a concentration of 1 mmol/L.
In the step (B4), the E. coli 0157: H7 dispersion has a concentration of 0.5 to 5×106 CFU/mL; the xenon light source has an intensity of 25% to 100%; and the incubation is conducted for 0.5 h.
The present disclosure has the following beneficial effects.
The technical content and embodiments of the present disclosure are further specifically described in conjunction with the embodiments and accompanying drawings.
A preparation method of a BiOI/N-doped biochar nanocomposite was provided, including the following steps.
A cleaned crayfish shell (derived from crayfish on the fish market) was placed in an aluminum oxide crucible, a sufficient amount of NaOH was added, and calcination was conducted in a tube furnace with an Ar atmosphere as follows: raising a temperature at 5° C./min from room temperature to 700° C., and holding the temperature for 2 h; and a resulting system was cooled and then washed with distilled water until neutral, and a resulting solid was collected and dried at 80° ° C. for 24 h to obtain the N-doped biochar.
The N-doped biochar obtained in the step 1 was dispersed in a mixed solution of HCl and HNO3 (a volume ratio of HCl to HNO; was 3:1) to obtain a mixed solution A; the mixed solution A was subjected to an ultrasonic treatment for 6 h in an ultrasonic cleaner and then filtered; and a filter residue was washed with a large amount of C2H5OH and deionized water, and then dried in an oven at 80° ° C. to obtain the acidified N-doped biochar, which was denoted as NBC.
Step 3: Preparation of the BiOI/N-doped biochar nanocomposite 1 mg of the acidified N-doped biochar obtained in the step 2 and 0.01 mol of Bi(NO3)3·5H2O were added to 40 mL of acetic acid, and a resulting mixture was subjected to an ultrasonic treatment for 10 min to obtain a suspension A; under vigorous stirring, a KI aqueous solution (0.01 mol of KI+20 mL of H2O) was added dropwise to the suspension A (a precipitate was produced) to obtain a mixed solution, the mixed solution was continuously stirred for 30 min, and 25 mL of the mixed solution was taken and transferred to a CEM microwave reactor; a microwave power (MP) was set to 200 W, a reaction temperature (T) was set to 150° C., and a reaction was conducted for 1 h (t); after the reaction was completed, a resulting solid was collected through centrifugation, washed, dispersed in absolute ethanol, dried, and subjected to calcination at 300° C. for 2 h in a tube furnace with a N2 atmosphere to obtain a BiOI/N-doped biochar nanocomposite, which was denoted as a BiOI/NBC nanocomposite. According to the above process, a monomer BiOI was prepared without the addition of N-doped biochar.
A use of the BiOI/N-doped biochar nanocomposite in the preparation of a photoelectrochemical sensor for detecting ATP was provided, including the following steps.
A preparation method of a BiOI/N-doped biochar nanocomposite was provided, including the following steps.
A cleaned crab shell (derived from a crab on the fish market) was placed in an aluminum oxide crucible, a sufficient amount of KOH was added, and calcination was conducted in a tube furnace with an Ar atmosphere as follows: raising a temperature at 5° C./min from room temperature to 700° C., and holding the temperature for 2 h; and a resulting system was cooled and then washed with distilled water until neutral, and a resulting solid was collected and dried at 80ºC for 24 h to obtain the N-doped biochar.
The N-doped biochar obtained in the step 1 was dispersed in a mixed solution of HCl and HNO3 (a volume ratio of HCl to HNO; was 3:1) to obtain a mixed solution A; the mixed solution A was subjected to an ultrasonic treatment for 6 h in an ultrasonic cleaner and then filtered; and a filter residue was washed with a large amount of C2H5OH and deionized water, and then dried in an oven at 80° ° C. to obtain the acidified N-doped biochar, which was denoted as NBC.
20 mg of the acidified N-doped biochar obtained in the step 2 and 0.05 mol of Bi(NO3)3·5H2O were added to 40 mL of acetic acid, and a resulting mixture was subjected to an ultrasonic treatment for 10 min to obtain a suspension A; under vigorous stirring, a KI aqueous solution (0.01 mol of KI+20 mL of H2O) was added dropwise to the suspension A (a precipitate was produced) to obtain a mixed solution, the mixed solution was continuously stirred for 30 min, and 25 mL of the mixed solution was taken and transferred to a CEM microwave reactor; a microwave power (MP) was set to 200 W, a reaction temperature (T) was set to 160° ° C., and a reaction was conducted for 1 h (t); after the reaction was completed, a resulting solid was collected through centrifugation, washed, dispersed in absolute ethanol, dried, and subjected to calcination at 300° C. for 2 h in a tube furnace with a N2 atmosphere to obtain a BiOI/N-doped biochar nanocomposite, which was denoted as a BiOI/NBC nanocomposite. According to the above process, a monomer BiOI was prepared without the addition of N-doped biochar.
A use of the BiOI/N-doped biochar nanocomposite in the preparation of a photoelectrochemical sensor for detecting ATP was provided, including the following steps.
A preparation method of a BiOI/N-doped biochar nanocomposite was provided, including the following steps.
A cleaned crayfish shell (derived from crayfish on the fish market) was placed in an aluminum oxide crucible, a sufficient amount of NaOH was added, and calcination was conducted in a tube furnace with an Ar atmosphere as follows: raising a temperature at 5° C./min from room temperature to 700° C., and holding the temperature for 2 h; and a resulting system was cooled and then washed with distilled water until neutral, and a resulting solid was collected and dried at 80° ° C. for 24 h to obtain the N-doped biochar.
The N-doped biochar obtained in the step 1 was dispersed in a mixed solution of HCl and HNO3 (a volume ratio of HCl to HNO; was 3:1) to obtain a mixed solution A; the mixed solution A was subjected to an ultrasonic treatment for 6 h in an ultrasonic cleaner and then filtered; and a filter residue was washed with a large amount of C2H5OH and deionized water, and then dried in an oven at 80° ° C. to obtain the acidified N-doped biochar, which was denoted as NBC.
10 mg of the acidified N-doped biochar obtained in the step 2 and 0.02 mol of Bi(NO3)3·5H2O were added to 40 mL of acetic acid, and a resulting mixture was subjected to an ultrasonic treatment for 10 min to obtain a suspension A; under vigorous stirring, a KI aqueous solution (0.01 mol of KI+20 mL of H2O) was added dropwise to the suspension A (a precipitate was produced) to obtain a mixed solution, the mixed solution was continuously stirred for 30 min, and 25 mL of the mixed solution was taken and transferred to a CEM microwave reactor; a microwave power (MP) was set to 200 W, a reaction temperature (T) was set to 180° C., and a reaction was conducted for 1 h (t); after the reaction was completed, a resulting solid was collected through centrifugation, washed, dispersed in absolute ethanol, dried, and subjected to calcination at 300° C. for 2 h in a tube furnace with a N2 atmosphere to obtain a BiOI/N-doped biochar nanocomposite, which was denoted as a BiOI/NBC nanocomposite. According to the above process, a monomer BiOI was prepared without the addition of N-doped biochar.
A use of the BiOI/N-doped biochar nanocomposite in the preparation of a photoelectrochemical sensor for detecting ATP was provided, including the following steps.
A preparation method of a BiOI/N-doped biochar nanocomposite was provided, including the following steps.
A cleaned crab shell (derived from a crab on the fish market) was placed in an aluminum oxide crucible, a sufficient amount of KOH was added, and calcination was conducted in a tube furnace with an Ar atmosphere as follows: raising a temperature at 5° C./min from room temperature to 700° C., and holding the temperature for 2 h; and a resulting system was cooled and then washed with distilled water until neutral, and a resulting solid was collected and dried at 80° C. for 24 h to obtain the N-doped biochar.
The N-doped biochar obtained in the step 1 was dispersed in a mixed solution of HCl and HNO3 (a volume ratio of HCl to HNO3 was 3:1) to obtain a mixed solution A; the mixed solution A was subjected to an ultrasonic treatment for 6 h in an ultrasonic cleaner and then filtered; and a filter residue was washed with a large amount of C2H5OH and deionized water, and then dried in an oven at 80° ° C. to obtain the acidified N-doped biochar, which was denoted as NBC.
5 mg of the acidified N-doped biochar obtained in the step 2 and 0.03 mol of Bi(NO3)3·5H2O were added to 40 mL of acetic acid, and a resulting mixture was subjected to an ultrasonic treatment for 10 min to obtain a suspension A; under vigorous stirring, a KI aqueous solution (0.01 mol of KI+20 mL of H2O) was added dropwise to the suspension A (a precipitate was produced) to obtain a mixed solution, the mixed solution was continuously stirred for 30 min, and 25 mL of the mixed solution was taken and transferred to a CEM microwave reactor; a microwave power (MP) was set to 200 W, a reaction temperature (T) was set to 170° C., and a reaction was conducted for 1 h (t); after the reaction was completed, a resulting solid was collected through centrifugation, washed, dispersed in absolute ethanol, dried, and subjected to calcination at 300° C. for 2 h in a tube furnace with a N2 atmosphere to obtain a BiOI/N-doped biochar nanocomposite, which was denoted as a BiOI/NBC nanocomposite. According to the above process, a monomer BiOI was prepared without the addition of N-doped biochar.
A use of the BiOI/N-doped biochar nanocomposite in the preparation of a photoelectrochemical sensor for detecting ATP was provided, including the following steps.
A preparation method of a BiOBr/N-doped biochar nanocomposite was provided, including the following steps.
A tofu residue (purchased from the bean product market) was placed in an aluminum oxide crucible, then NaOH (keeping NaOH sufficient) was added, and calcination was conducted in a tube furnace with an Ar atmosphere (raising a temperature at 5° C. min-1 from room temperature to 700° C., and holding the temperature for 2 h); and a resulting system was cooled and then washed with distilled water until neutral, and a resulting solid was collected and dried at 80° C. for 24 h to obtain the N-doped biochar.
The N-doped biochar obtained in the step 1 was added to a mixed solution of HCl and HNO3 (a volume ratio of HCl to HNO3 was 3:1) to obtain a mixed solution A; the mixed solution A was subjected to an ultrasonic treatment for 6 h in an ultrasonic cleaner and then filtered; and a filter residue was washed with a large amount of C2H5OH and deionized water, and then dried in an oven at 80° ° C. to obtain the acidified N-doped biochar, which was denoted as NBC.
10 mg of the acidified N-doped biochar obtained in the step 2 and 0.03 mol of Bi(NO3)3·5H2O were added to 40 mL of acetic acid, and a resulting mixture was subjected to an ultrasonic treatment for 10 min to obtain a suspension A; under vigorous stirring, a KBr aqueous solution (0.01 mol of KBr+20 mL of H2O) was added dropwise to the suspension A (a precipitate was produced) to obtain a mixed solution, the mixed solution was continuously stirred for 30 min, and 25 mL of the mixed solution was taken and transferred to a CEM microwave reactor; a microwave power (MP) was set to 200 W, a reaction temperature (T) was set to 180° C., and a reaction was conducted for 1 h (t); after the reaction was completed, a resulting solid was collected through centrifugation, washed, dispersed in absolute ethanol, dried, and subjected to calcination at 300° C. for 2 h in a tube furnace with a N2 atmosphere to obtain a BiOBr/NBC nanocomposite. According to the above process, a monomer BiOBr was prepared without the addition of N-doped biochar, and a BiOBr nanosheet was actually obtained.
A use of the BiOBr/NBC nanocomposite in the preparation of a photoelectrochemical sensor for detecting E. coli was provided, including the following steps.
The prepared BiOBr/NBC nanocomposite was dispersed in DMF to obtain the dispersion with a concentration of 5 mg/mL.
A 1×0.5 cm2 ITO electrode was first boiled in a 1 mol/L sodium hydroxide solution for 15 min to 20 min, then subjected to ultrasonic cleaning with acetone, double-distilled water, and ethanol successively, and blow-dried with nitrogen for later use.
20 μL of the BiOBr/NBC nanocomposite dispersion prepared in the step (1) was taken with a microsyringe and drip-coated on a surface of the ITO electrode obtained in the step (2), and the ITO electrode was oven-dried with an IR lamp to obtain an electrode denoted as BiOBr/NBC/ITO; 8 μL of GA was drip-coated on a surface of the BiOBr/NBC/ITO, and 8 μL of a 4 μmol/L E. coli 0157: H7 (E. coli 0157: H7) aptamer solution was added to the surface of the electrode for modification to obtain an E. coli 0157: H7 aptamer/BiOBr/NBC/ITO electrode;
the electrode was stored overnight in a 4ºC refrigerator, then rinsed with PBS (pH=7.0, concentration: 0.1 mol/L) multiple times to remove the physical adsorption, and dried in a N2 atmosphere; and 8 μL of BSA (1 mmol/L) was drip-coated on a surface of the electrode, and the electrode was allowed to stand at room temperature for 1 h to block non-specific adsorption sites on the modified electrode and finally rinsed with UPW to remove the unbound aptamer. An E. coli 0157 H7 had a aptamer sequence of
(4) Correspondence Between an E. coli 0157: H7 Concentration and a PEC Signal
An electrochemical workstation three-electrode system was assembled with the E. coli O157: H7 aptamer/BiOBr/NBC/ITO electrode obtained in the step (3) placed in 5 mL of PBS (pH=7 to 8, concentration: 0.1 mol/L) as a working electrode at a bias voltage of 0.0 V, a platinum wire electrode as a counter electrode, and an SCE as a reference electrode, and under the irradiation of a xenon light source (with a light intensity of 75%), a photoelectrochemical signal (PEC) was acquired by an i-t curve method; and the E. coli 0157: H7 aptamer/BiOBr/NBC/ITO electrode was immersed in an E. coli 0157: H7 dispersion at different concentrations and then incubated for 0.5 h, and then detection was conducted.
Through XPS characterization, the chemical composition and electronic structure of the BiOBr/NBC nanocomposite were further investigated.
E. coli 0157: H7 concentrations to be tested are 0 CFU/mL, 0.5 CFU/mL, 5 CFU/mL, 50 CFU/mL, 500 CFU/mL, 1,000 CFU/mL, 2,000 CFU/mL, 5×105 CFU/mL, and 5×106 CFU/mL. As shown in A of
| Number | Date | Country | Kind |
|---|---|---|---|
| 202210709707.4 | Jun 2022 | CN | national |
This application is the national stage entry of International Application No. PCT/CN2022/104800, filed on Jul. 11, 2022 which is based upon and claims priority to Chinese Patent Application No. 202210709707.4 filed on Jun. 22, 2022, the entire contents of which are incorporated herein by reference.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/CN2022/104800 | 7/11/2022 | WO |
